#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 23, 2019; 18:46 GMT TreeBASE (cc) 1994-2008 Study reference: Jin L.S., Cadotte M.W., & Fortin M. 2015. Phylogenetic turnover patterns consistent with niche conservatism in montane plant species. Journal of Ecology, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17093] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=784; TAXLABELS Acer_campestre Acer_glabrum Acer_pseudoplatanus Achillea_millefolium Achnatherum_lettermanii Achnatherum_nelsonii Achnatherum_pinetorum Achnatherum_robustum Aconitum_columbianum Aconitum_napellus Aconitum_racemulosum Actaea_rubra Agalinis_pulchella Agalinis_tenuifolia Agoseris_elata Agoseris_glauca Agoseris_grandiflora Agoseris_retrorsa Agrostis Agrostis_exarata Agrostis_gigantea Agrostis_humilis Agrostis_idahoensis Agrostis_scabra Agrostis_stolonifera Allium Allium_cernuum Allium_geyeri Allium_triquetrum Alnus_incana Alopecurus_aequalis Alopecurus_alpinus Alopecurus_geniculatus Alopecurus_pratensis Alyssum_alyssoides Alyssum_desertorum Amborella_trichopoda Amelanchier_alnifolia Amelanchier_utahensis Anaphalis_margaritacea Androsace_chamaejasme Androsace_filiformis Androsace_septentrionalis Anemone Anemone_cylindrica Anemone_narcissiflora Angelica Angelica_ampla Angelica_archangelica Angelica_grayi Angelica_lignescens Angelica_pinnata Antennaria Antennaria_anaphaloides Antennaria_corymbosa Antennaria_dioica Antennaria_media Antennaria_microphylla Antennaria_parvifolia Antennaria_rosea Antennaria_umbrinella Apocynum Apocynum_androsaemifolium Apocynum_cannabinum Aquilegia Aquilegia_canadensis Aquilegia_coerulea Aquilegia_ecalcarata Aquilegia_elegantula Aquilegia_vulgaris Arabis Arabis_drummondii Arabis_fendleri Arabis_glabra Arabis_hirsuta Aralia_nudicaulis 'Arctostaphylos uva-ursi' Arenaria_fendleri Arenaria_hookeri Arenaria_serpyllifolia Arenaria_tetraquetra Arnica Arnica_chamissonis Arnica_cordifolia Arnica_latifolia Arnica_mollis Arnica_parryi Arnica_rydbergii Artemisia Artemisia_arbuscula Artemisia_arctica Artemisia_campestris Artemisia_cana Artemisia_frigida Artemisia_ludoviciana Artemisia_scopulorum Artemisia_tridentata Astragalus Astragalus_borealimongolicus Astragalus_mongholicus Astragalus_parryi Avenula_hookeri Barbarea_vulgaris Betula_nana Betula_occidentalis Blepharoneuron_tricholepis Bouteloua_gracilis Brassica Brassica_juncea Brassica_napus Brickellia_grandiflora Bromus Bromus_arvensis Bromus_carinatus Bromus_ciliatus Bromus_hordeaceus Bromus_inermis Bromus_lanatipes Bromus_porteri Bromus_tectorum Calamagrostis Calamagrostis_canadensis Calamagrostis_purpurascens Calamagrostis_stricta Callitriche_deflexa Callitriche_palustris Callitriche_stagnalis Caltha_appendiculata Caltha_leptosepala Calypso_bulbosa Camelina_microcarpa Campanula Campanula_parryi Campanula_rotundifolia Campanula_uniflora Cardamine_cordifolia Cardamine_pensylvanica Carex Carex_albonigra Carex_aquatilis Carex_arapahoensis Carex_athrostachya Carex_atrosquama Carex_bella Carex_brunnescens Carex_canescens Carex_capillaris Carex_deweyana Carex_disperma Carex_duriuscula Carex_ebenea Carex_echinata Carex_elynoides Carex_engelmannii Carex_filifolia Carex_geophila Carex_geyeri Carex_hallii Carex_haydeniana Carex_heteroneura Carex_illota Carex_inops Carex_jonesii Carex_lachenalii Carex_limosa Carex_magellanica Carex_microptera Carex_nardina Carex_nelsonii Carex_nigricans Carex_norvegica Carex_nova Carex_occidentalis Carex_phaeocephala Carex_praeceptorum Carex_praegracilis Carex_praticola Carex_pyrenaica Carex_rossii Carex_rupestris Carex_saxatilis Carex_scopulorum Carex_siccata Carex_utriculata Carex_vesicaria Castilleja Castilleja_flava Castilleja_linariifolia Castilleja_miniata Castilleja_occidentalis Castilleja_puberula Castilleja_rhexiifolia Castilleja_sulphurea Ceanothus_cordulatus Ceanothus_fendleri Ceanothus_sanguineus Ceanothus_velutinus Cerastium Cerastium_arvense Cerastium_beeringianum Cerastium_brachypodum Cerastium_fontanum Cercocarpus_montanus Chamerion_angustifolium Chenopodium Chenopodium_atrovirens Chenopodium_berlandieri Chenopodium_capitatum Chenopodium_foliosum Chenopodium_fremontii Chenopodium_leptophyllum Chimaphila_umbellata Chionophila_jamesii Chrysothamnus Chrysothamnus_linifolius Chrysothamnus_molestus Chrysothamnus_viscidiflorus Cicuta_douglasii Cinna_latifolia Cirsium Cirsium_arvense Cirsium_eatonii Cirsium_japonicum Cirsium_palustre Cirsium_scariosum Cirsium_scopulorum Cirsium_undulatum Cirsium_vulgare Clematis_ligusticifolia Clematis_occidentalis Clematis_patens Collinsia_parviflora Collomia_linearis Conioselinum_scopulorum Conium_maculatum Conringia_orientalis Corallorhiza Corallorhiza_maculata Corallorhiza_trifida Cornus_sericea Corylus_cornuta Cryptantha Cryptantha_bakeri Cryptantha_flavoculata Cryptantha_virgata Dactylorhiza_viridis Danthonia_intermedia Danthonia_parryi Danthonia_spicata Dasiphora_fruticosa Delphinium Delphinium_barbeyi Delphinium_pseudohamatum Delphinium_ramosum Deschampsia_cespitosa Descurainia_incana Dodecatheon_pulchellum Draba Draba_albertina Draba_aurea Draba_crassa Draba_fladnizensis Draba_streptocarpa Dryas_octopetala Eleocharis_acicularis Eleocharis_quinqueflora Elymus Elymus_albicans Elymus_elymoides Elymus_glaucus Elymus_lanceolatus Elymus_scribneri Elymus_trachycaulus Epilobium Epilobium_anagallidifolium Epilobium_ciliatum Epilobium_cylindricum Epilobium_hornemannii Epilobium_lactiflorum Epilobium_obscurum Epilobium_saximontanum Erigeron Erigeron_acris Erigeron_compositus Erigeron_coulteri Erigeron_divergens Erigeron_elatior Erigeron_eximius Erigeron_flagellaris Erigeron_formosissimus Erigeron_leiomerus Erigeron_melanocephalus Erigeron_peregrinus Erigeron_pinnatisectus Erigeron_pumilus Erigeron_simplex Erigeron_speciosus Erigeron_subtrinervis Erigeron_ursinus Erigeron_vetensis Eriogonum Eriogonum_alatum Eriogonum_flavum Eriogonum_umbellatum Eriophorum_angustifolium Eritrichium_nanum Erysimum Erysimum_capitatum Erysimum_cheiranthoides Eucephalus_engelmannii Eucephalus_glabratus Euphorbia_brachycera Euphorbia_tirucalli Euphorbia_usambarica Eurybia_glauca Festuca Festuca_brachyphylla Festuca_dasyclada Festuca_idahoensis Festuca_minutiflora Festuca_saximontana Festuca_thurberi Fragaria Fragaria_vesca Fragaria_virginiana Frasera_speciosa Gaillardia_aristata Galium Galium_aparine Galium_boreale Galium_trifidum Galium_triflorum Gaultheria_humifusa Gayophytum_diffusum Gayophytum_heterozygum Gentiana Gentiana_affinis Gentiana_algida Gentiana_macrophylla Gentiana_parryi Gentiana_prostrata Gentianella_amarella Gentianopsis_barbellata Gentianopsis_ciliata Gentianopsis_crinita Gentianopsis_thermalis Geranium Geranium_caespitosum Geranium_nepalense Geranium_richardsonii Geum Geum_aleppicum Geum_canadense Geum_macrophyllum Geum_rivale Geum_rossii Geum_triflorum Geum_urbanum Glyceria_grandis Glyceria_striata Goodyera_oblongifolia Grindelia_lanceolata Grindelia_mendocina Grindelia_squarrosa Grindelia_subalpina Gypsophila_paniculata Harbouria_trachypleura Helianthus_petiolaris Helianthus_pumilus Helictotrichon_mortonianum Heracleum Heracleum_maximum Heracleum_sphondylium Hesperostipa_comata Heterotheca_fulcrata Heterotheca_pumila Heterotheca_villosa Heuchera_bracteata Heuchera_micrantha Heuchera_parvifolia Heuchera_rubescens Hieracium Hieracium_albiflorum Hieracium_caespitosum Hieracium_gracile Hippuris_vulgaris Hordeum Hordeum_brachyantherum Hordeum_jubatum Hydrophyllum_canadense Hydrophyllum_fendleri Hydrophyllum_virginianum Ipomopsis_aggregata Iris_ensata Iris_missouriensis Jamesia_americana Juncus Juncus_arcticus Juncus_castaneus Juncus_drummondii Juncus_effusus Juncus_longistylis Juncus_mertensianus Juncus_parryi Juncus_saximontanus Kalmia_angustifolia Kalmia_buxifolia Kalmia_microphylla Kobresia_myosuroides Koeleria_macrantha Lactuca Lactuca_serriola Lactuca_watsoniana Lappula_barbata Lappula_deflexa Lappula_occidentalis Lappula_sessiliflora Leersia_oryzoides Leucanthemum_vulgare Leucopoa_kingii Lewisia_pygmaea Leymus_triticoides Liatris_punctata Ligusticum_acuminatum Ligusticum_jeholense Ligusticum_porteri Ligusticum_sinense Ligusticum_tenuifolium Ligusticum_tenuissimum Linaria_vulgaris Linnaea_borealis Linum_lewisii Listera_cordata Listera_ovata Listera_smallii Lithophragma_glabrum Lloydia_serotina Lonicera_involucrata Lonicera_nervosa Lupinus Lupinus_argenteus Lupinus_bakeri Lupinus_luteus Luzula Luzula_comosa Luzula_parviflora Luzula_spicata Luzula_subcapitata Machaeranthera_bigelovii Magnolia_grandiflora Mahonia_repens Maianthemum Maianthemum_racemosum Maianthemum_stellatum Mentha_arvensis Mentha_spicata Menyanthes_trifoliata Mertensia_ciliata Mertensia_lanceolata Mertensia_virginica Minuartia_obtusiloba Minuartia_rubella Mitella_pentandra Mitella_stauropetala Moehringia_lateriflora Monarda_fistulosa Moneses_uniflora Montia_chamissoi Muhlenbergia_filiculmis Muhlenbergia_montana Muhlenbergia_richardsonis Nassella_viridula Noccaea_montana Nuphar_lutea Opuntia Opuntia_engelmannii 'Opuntia ficus-indica' Opuntia_polyacantha Oreochrysum Oreochrysum_parryi Oreoxis_alpina Orthilia_secunda Oryzopsis_asperifolia Osmorhiza Osmorhiza_berteroi Osmorhiza_depauperata Oxypolis_fendleri Oxyria_digyna Oxytropis_lambertii Oxytropis_multiceps Packera Packera_cana Packera_crocata Packera_dimorphophylla Packera_fendleri Packera_werneriifolia Paronychia_echinulata Paronychia_kapela Paronychia_pulvinata Pedicularis Pedicularis_bracteosa Pedicularis_groenlandica Pedicularis_parryi Pedicularis_procera Pedicularis_racemosa Pedicularis_sudetica Pediocactus_simpsonii Penstemon Penstemon_glaber Penstemon_laricifolius Penstemon_procerus Penstemon_rydbergii Penstemon_unilateralis Penstemon_virens Penstemon_whippleanus Phacelia_hastata Phacelia_heterophylla Phacelia_sericea Phalaris_arundinacea Phleum_alpinum Phleum_phleoides Phleum_pratense Phlox_divaricata Phlox_longifolia Phlox_multiflora Phlox_pulvinata Physocarpus_malvaceus Physocarpus_monogynus Piptatherum_micranthum Plantago_major Platanthera Platanthera_chlorantha Platanthera_dilatata Platanthera_edgeworthii Platanthera_hyperborea Platanthera_obtusata Platanthera_stricta Poa Poa_alpina Poa_arctica Poa_arida Poa_compressa Poa_cusickii Poa_glauca Poa_leptocoma Poa_nemoralis Poa_nervosa Poa_palustris Poa_pratensis Poa_reflexa Poa_secunda Poa_tracyi Poa_trivialis Polemonium Polemonium_brandegeei Polemonium_foliosissimum Polemonium_occidentale Polemonium_pulcherrimum Polemonium_viscosum Polygonum Polygonum_amphibium Polygonum_aviculare Polygonum_bistortoides Polygonum_douglasii Polygonum_filiforme Polygonum_maritimum Polygonum_viviparum Populus_angustifolia Populus_balsamifera Populus_tremuloides Potentilla Potentilla_diversifolia Potentilla_effusa Potentilla_fissa Potentilla_gracilis Potentilla_hippiana Potentilla_nivea Potentilla_norvegica Potentilla_pensylvanica Potentilla_pulcherrima Potentilla_subjuga Potentilla_uniflora Primula_parryi Prosartes_trachycarpa Prunus Prunus_americana Prunus_virginiana Pseudocymopterus_montanus Pseudoroegneria_spicata Pterospora_andromedea Pulsatilla Pulsatilla_patens Purshia_tridentata Pyrola Pyrola_asarifolia Pyrola_chlorantha Pyrola_minor Pyrola_picta Ranunculus Ranunculus_abortivus Ranunculus_adoneus Ranunculus_alismifolius Ranunculus_eschscholtzii Ranunculus_flammula Ranunculus_inamoenus Ranunculus_macounii Ranunculus_pygmaeus Ranunculus_ranunculinus Rhodiola_bupleuroides Rhodiola_fastigiata Rhodiola_integrifolia Rhodiola_kirilowii Rhodiola_rhodantha Rhus_aromatica Rhus_trilobata Ribes Ribes_cereum Ribes_inerme Ribes_lacustre Ribes_laxiflorum Ribes_montigenum Rorippa Rorippa_amphibia Rorippa_islandica Rosa_woodsii Rubus Rubus_deliciosus Rubus_idaeus Rubus_parviflorus Rudbeckia_hirta Rudbeckia_laciniata Rumex Rumex_acetosella Rumex_crispus Salix Salix_bebbiana Salix_boothii Salix_brachycarpa Salix_drummondiana Salix_exigua Salix_geyeriana Salix_ligulifolia Salix_lucida Salix_monticola Salix_nivalis Salix_petrophila Salix_planifolia Salix_scouleriana Salix_wolfii Sambucus_racemosa Saxifraga Saxifraga_bronchialis Saxifraga_caespitosa Saxifraga_cernua Saxifraga_chrysantha Saxifraga_flagellaris Saxifraga_mertensiana Saxifraga_odontoloma Saxifraga_oppositifolia Saxifraga_rhomboidea Saxifraga_stellaris Schedonorus_phoenix Schizachyrium_scoparium Scirpus Scirpus_microcarpus Scirpus_pallidus Scutellaria_baicalensis Scutellaria_brittonii Scutellaria_galericulata Sedum_alfredii Sedum_lanceolatum Sedum_rupestre Senecio Senecio_amplectens Senecio_bigelovii Senecio_crassulus Senecio_eremophilus Senecio_fremontii Senecio_integerrimus Senecio_pudicus Senecio_serra Senecio_spartioides Senecio_triangularis Senecio_wootonii Shepherdia_canadensis Sibbaldia_procumbens Silene Silene_acaulis Silene_drummondii Silene_scouleri Sisyrinchium_montanum Smelowskia_calycina Solidago Solidago_canadensis Solidago_multiradiata Solidago_simplex Solidago_speciosa Sorbus_scopulina Sorghastrum_nutans Sparganium Sparganium_angustifolium Sparganium_stoloniferum Spiranthes_romanzoffiana Stellaria Stellaria_calycantha Stellaria_crassifolia Stellaria_longifolia Stellaria_longipes Stellaria_media Stellaria_umbellata Streptopus_amplexifolius Swertia_perennis Symphoricarpos Symphoricarpos_occidentalis Symphoricarpos_orbiculatus Symphoricarpos_oreophilus Symphoricarpos_rotundifolius Symphyotrichum_campestre Symphyotrichum_cordifolium Symphyotrichum_falcatum Symphyotrichum_foliaceum Symphyotrichum_lanceolatum Symphyotrichum_porteri Symphyotrichum_spathulatum Taraxacum_officinale Tetraneuris_acaulis Tetraneuris_grandiflora Thalictrum Thalictrum_alpinum Thalictrum_dioicum Thalictrum_fendleri Thalictrum_minus Thalictrum_pubescens Thalictrum_sparsiflorum Thermopsis Thermopsis_divaricarpa Thermopsis_montana Thinopyrum_intermedium Thlaspi_arvense Tonestus_lyallii Tonestus_pygmaeus Townsendia_florifer Townsendia_grandiflora Tragopogon Tragopogon_dubius Tragopogon_lamottei Tragopogon_pratensis Trifolium Trifolium_dasyphyllum Trifolium_hybridum Trifolium_nanum Trifolium_parryi Trifolium_pratense Trifolium_repens Trisetum_flavescens Trisetum_spicatum Trisetum_wolfii Trollius_laxus Urtica_dioica Vaccinium Vaccinium_cespitosum Vaccinium_myrtillus Vaccinium_scoparium Valeriana_edulis Valeriana_occidentalis Verbascum_thapsus Veronica_americana Veronica_officinalis Veronica_peregrina Veronica_serpyllifolia Veronica_wormskjoldii Viburnum_acerifolium Viburnum_edule Vicia Vicia_sativa Vicia_tetrasperma Viola Viola_adunca Viola_affinis Viola_biflora Viola_canadensis Viola_labradorica Viola_macloskeyi Zigadenus_elegans ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M30155] TITLE _Rocky_Mountain_angiosperm_communities_FcC_s_matrix; LINK TAXA = Taxa1; DIMENSIONS NCHAR=4898; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910 4920 4930 4940 4950 4960 4970 4980 4990 5000 5010 5020 5030 5040 5050 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acer_campestre ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGAAAGAATATCAA------ATCCATTTAGAACTAGATAGATCTCAGCAACACAACTTCCTATACCCACTTCTTTTTCGAGAGTATATTTATGCACTTGCTCATGATCACGGTTTA------AATAGATCGACGATTCCGT------TGGAAAATGGGGGTTATGACAATAAATCTA------GTTCACTCAGTGTGAAACGTTTAATTA------------GTCGGACGTATCAACGGATTCAT------TTGAGTATTTATGCTAAGGATTCTAATCCAAATCAGTTTATTG---------------GACACAACAA------TAAATTTTATTCGCA------AATGATATCGGAGGGATTTTCAGTCATTGTGGAAATTCCATTTTCCCTACGATTAGTAGCTTTCTTAG--------------AAGGGAAA------GAAATGGCGAAATCTCAAAATTTCCAATCAATTCATTCAATATTTCCTTTTTTCGAGAACAATTTCTCACATTTACACTATGTCTTAGATGTACTAATACCCTACCCCATTCGCCCGGAAATCTTGGTTCGAACCTTTCGCTATTGGGTAAAAGATGCCTCTTCTTT--ACATTTATT------GCGATTCTTTCTTCATG-------AGTATTTTAAT------TGGAA---TAGTCTTATTACTCCAA------AGAAATCAAATT------------------CCATTTTTTCA------ACAAGGAATCCAAG------ATTTTTCTTGTTCCTATATAATTCTCATGTATATGAATATGAATCAATCTTCTTTTTTCTCCGTAACCAATCCTCTCATTTACGATCAACATCTTCAGGACCCCTTTTTGAGCGAATTTCTTTTTATGG---------------AAAAGTA------GAAGATCTTG------------TCCAAGT------CTTTGTTAATGATTTTCAGGAC---AACTTA------TGGTTGTTCAAGCATCCTATCATGCATTATGTTAGATATCAAGGAAAATCCGTTCTGGCTTCAAAAGATATGCCTCTTCTGATGAATAAATGGAAATATT-ACCTTGTCAAT---TTATGGCAATGGCATTTTCACGTGTGGTCTCAACCCGGAAGGATTCATATAAA------CCACTTATACAAAGATTATATCGACTTTCTGGGCTATCTTTCCAGGG------GGCGACTAAATACTTTGGTGGTGCGGAGTCAAATGCTAGAAAATGCATTTCTAATCGATAA------TGCTATGAAGCAGTTCGAGACAACCGTTCCAATTATTCCTCTGATTGGATCATTGACTACGGCGCGTTTTTGTAACTCATTAGGGCATCCCATTAGTAAGCCGACCTGGGCCGATTCCTCAGATTCTTATATTATCGACCGGTTTATGCGTATATGCAGAAATCTTTCTCATTATCACAGCGGATCTTCAAAAAAAAAGAGTTTGTATAGAATAAAATATATACTTCGGGTTTCTTGTGTTAAAAGTTTGG-TTCGTAAACACAAAAGTACTGTGCGCGTTTTTTTGAAAAG---ATTAGGCTCGGAA---TTCTTGGAAGAATTCTTTACGGAGGAGGAGCACGT------TCTTTCTTTAATCTTTCCAAGAGCTTTGTTTACTTCGCGGAGGTTATATAGGGGGAGGGT---TTGGTATTTGGATATTATTTGTATTAACGATTTGGTTAATCATGATAAATTAGAAATTGTTCCTAACTGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGGGTTCCGCCCGAGGAAGCCGGGGCCGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTATAAAGGACGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCGAAAACTTTCCAAGGCCCCCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGGCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGATTATCCGCTAAGAACTACGGTAGAGCTGTTTATGAATGTCTACGTG--------GTGGACTTGACTTTACCAAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCAGAAGCTATTTTTAAATCGCAGGCAGAAACCGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGTACATGGGAAGAGATGCTAAAAAGGGCGGTATTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCATCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATACACTTTCGTGTACTAGCTAAAGCTTTGCGTATGTCAGGTGGAGATCATATTCACGCAGGTACAGTAGTAGGTAAACTTGAAGGAGAAAGAGACATAACTTTGGGCTTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGCCGCGGCATTTATTTCACTCAAGATTGGGTCTCTTTACCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGGGACGATTCCGTACTGCAATTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCGCCAGGCGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGCG--AGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTGCTGAATTGGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTTGAAGCAATGGATACTTTGTAA--------------------------------------------- Acer_glabrum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTTA-GGCCGAGGGCACACCTGCCT---GGGT-GTCACGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTGTCGAAACCTGCCTAGCAGAACGA-----CCCGCGAACTCGTTT--TATCATCAGGGGGAGC---ACGGGTGCG-------------CGAGCCTAGTGG----------T-CCCCCTCCGCAGTCGGATCGGTG---GCT--------------CCTGCCCTCGCTCCCTCG----TCACAACAA--CG------AACCCCGGCGCG-GACCGCGCC-AAGGAAA-CTTAACAAGAGA----GCG---TGC--CCTTGA-----CGCCCCGGAAACGGT---GTGTGTGCCTGTGGCATTGCCTTCTTTCACTATTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------------------------------------GTTGGATTCAAAGCCGGT-GTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGGGTTCCGCCCGAGGAAGCCGGGGCCGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTATAAAGGACGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCGAAAACTTTCCAAGGCCCCCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGGCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGATTATCCGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTACGTG--------GTGGACTTGACTTTACCAAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCAGAAGCTATTTATAAATCGCAGGCAGAAACTGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGTACATGCGAAGATATGATAAAAAGGGCGGTATTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCATCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATACACTTTCGTGTACTAGCTAAAGCTTTGCGTATGTCTGGTGGAGATCATATTCACTCAGGTACAGTAGTAGGTAAACTTGAAGGAGAAAGAGACATAACTTTGGGCTTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGCCGCGGTATTTATTTCACTCAAGATTGGGTCTCTTTACCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGGGACGATTCCGTACTGCAATTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCGCCGGGCGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGCG--AGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTGCTGAATTGGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTTGAAGCAATGGATACTTTGTAA--------------------------------------------- Acer_pseudoplatanus ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTTTCAAATGAAAGAATATCAA------ATCCATTTAGAACTAGATAGATCTCAGCAACACAACTTCCTATACCCACTTCTTTTTCGAGAGTATATTTATGCACTTGCTCATGATCACGGTTTA------AATAGATCGACGATTCCGT------TGGAAAATGGGGGTTATGACAATAAATCTA------GTTCACTAAGTGTGAAACGTTTAATTA------------GTCGGACGTATCAACGGATTCAT------TTAAGTATTTATGCTAAGGATTCTAATCCAAATCAATTTATTG---------------GACACAACAA------TCAATTTTATTCGCA------AATGATATCGGAGGGATTTTCAGTCATTGTGGAAATTCCATTTTCCCTACGATTAGTAGCTTTCTTAG--------------AAGGGAAAGAAAAAGAAATGGCGAAATCTCATAATTTCCAATCAATTCATTCAATATTTCCTTTTTTCGAGAACAATTTCTCACATTTACACTATGTCTTAGATGTACTAATACCCTACCCCATTCGCCCGGAAATCTTGGTTCGAACCTTTCGCTATTGGGTAAAAGATGCCTCTTCTTT--ACATTTATT------GCGATTCTTTCTTCATG-------AGTATTTTAAT------TGGAA---TAGTCTTATTACTCCAA------AGAAATCAAATT------------------CCATTTTTTCA------ACAAGTAAGCCAAG------ATTTTTCTTGTTCCTATATAATTCTCATGTATATGAATATGAATCAATCTTCTTTTTTCTCCGTAACCAATCTTCTCATTTACGATCAACATCTTCAGGACTCCTTTTTGAGCGAATTTCTTTTTATGG---------------AAAAGTA------GAAGATCTTG------------TCCAAGT------CTTTGTTAATGATTTTCAGGAC---AACTTA------TGGTTGTTCAAGCATCCTATCATGCATTATGTTAGATATCAAGGAAAATCTGTTCTGGCTTCAAAAGATATGCCTCTTCTGATGAATAAATGGAAATATT-ACCTTGTCAAT---TTATGGCAATGGCATTTTCACGTGTGGTCTCAACCCGGAAGGATTCATATAAA------CCACTTATACAAAGATTATATCTACTTTCTGGGCTATCTTTCCAGGG------GGCGACTAAATACTTTGGTGGTGCGGAGTCAAATGCTAGAAAATGCATTTCTAATCGATAA------TGCTATGAAGCAGTTCGAGACAACCGTTCCAATTATTCCTCTGATTGGATCATTGACTACGGCGCGTTTTTGTAACTCATTAGGGCATCCCATTAGTAAGCCGACCTGGGCCGATTCCTCAGATTCTTATATTATCGACCGGTTTATGCGTATATGCAGAAATCTTTCTCATTATCACAGCGGGTCTTCAAAAAAAAAGAGTTTGTATAGAATAAAATATATACTTCGGGTTTCTTGTGTTAAAAGCTTGG-TTCGTAAACACAAAAGTACTGTGCGCGTTTTTTTGAAAAG---ATTAGGCTCGGAA---TTCTTGGAAGAATTCTTTACGGAGGAAGAGCACGT------TCTTTCTTTAATCTTTCCAAGAGCTGTGTTTCCTTCGCGGAGGTTATATAGGGGGCGGGT---TTGGTATTTTGATATTATTTGTATTAACGATTTGGTTAATCATGATAAATTCGAAATTTTTCCTAACTGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTGGATTCAAAGCCGGT-GTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGGGTTCCGCCCGAGGAAGCCGGGGCCGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTATAAAGGACGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCCGCGTATTCGAAAACTTTCCAAGGCCCCCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGGCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGATTATCCGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTACGTG--------GTGGACTTGACTTTACCAAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCAGAAGCTATTTATAAATCGCAGGCAGAAACTGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGTACATGGGAAGAAATGATAAAAAGGGCGGTATTTGCCAGAGAGTTGGGAGTTCCTATAGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCATCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATACACTTTCGTGTACTAGCTAAAGCTTTGCGTATGTCTGGTGGAGATCATATTCACGCAGGTACAGTAGTAGGTAAACTTGAAGGAGAAAGAGACATAACTTTGGGCTTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGCCGCGGTATTTATTTCACTCAAGATTGGGTCTCTTTACCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGGGACGATTCCGTACTGCAATTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCGCCAGGCGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGCG--AGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTGCTGAATTGGCTGCTGCTTGTGAAGTATGGAAGG?GATCAAATTTGAATTTGAAGCAATGGATAC---------------------------------------------------- Achillea_millefolium ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTT-GGC{CT}GAGGGCACGTCTGCCT---GGGC-GTCACG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAA---AGCAGAA-CGACCCG-TGAACACGT-AAAAACAACTGAG-CGTCGAGTGGATTAAG--------------CATTTGTTT-----GATCCTCTCGAT--GCTTTGTCGATGT-GCATTTACTTGTGTTCT------TTTT--TGGACCTGGT{AG}AATGTGTCATTGACGC--AATAACAA-CCCCCGGCACA-ATGTGTGCC-AAGGAAAACTA-AACTTGAGAAGGCTT---GTTT-CATGTTGC-CCCGTTCGCGG--TG-C--GCTCATGGAATGT-GGCTTCTTTTTAATTACAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAATACGGGAAGGCTTTCTCCCAGGAATTTATTCTTGATTTTTAATGAATCCTAAATATTATCATTCTCCATTTCATAATGGAAACGTATGTGTATAAGAAACAGTATATTGATAAAAAATTTCCAAAATCAAAAGAGCGATTAGGTTGAAAAAAGTAAAGGATTTCTAATCATCTTGTTATCCTATAATGAAAACGAACATAAATACTTCAATTTAAATGGAAAAAGAGAGGATAGAGAATCCGTTGATAAGTTTATGTGGATCCGAGGTATCTATTTGGTTTGTACTATAATACCTTGTTTTGACTGTATCGCACTATGTATCATTTATAACCCCAAAAATCCTCTACCTTTCATTTAAATAGAATTTCAAATGGAGAAATTCCAAAGCTATTTAGGGCTAGATAGATCTCAACAACACTCTTTCTTATATCCACTTATCTTTCAGGAGTATATTTATGTACTTGCTCATGATCATGGTTTAAATAGATCGATTT---TGTTG------------GAAAATGCAGGTTATGACAATAAATCCA------GCTTACTAATTGTGAAACGTTTAATCATTCG------------AATGTATCAACAGAATCAT------TTTATTCTTTCTGTTAATGATTCTAAACAA------------------------------TTGGGGCACAACAATATTTTTTATTCGCA------AGTAATGTCAGAGGTTTCTTCAATCATTCTGGAAATTCCACTGTCTCTGCGATTAATATCTTCCCTAGAAAAG--------------AAA------GGGGTAGTTAAATTCGATAATTTACGATCAATTCATTCAATATTTTCTTTTTTAGAGGACAATTTTTCACATTTAAATTATGTATTAGATATACTAATACCTTACCCAGCCCATCTGGAAATCTTGGTTCAGGCTCTTCGCTATTGGATAAAAGATGCTTCCTCTTT--GCATTTATT------AAGATTCTTTCTCCATG-------AGTGTCA------TAATTGGGA---TAGTCTTATTACTTCAAATTCAAAGAAAGTTAGTTCTT---------------CTTTTTCAAAA---------AGAAAAAACAG------ATTATTCTTCTTCCTATATACTTTTCATATAGGTGAATATGAATCTGGCTTCCTCTTTCTCCGTAACCAGTCTTCTCACTTACGATCAACATCTTCTGGAGCCCTTATTGAACGAATCAATTTCTATGG---------------AAAAATA------GAGCATCTTG------------CAGAAGTCTTTGT------CAGGTCTTTT-CAAGCA--AATTTA------TGGTTGTTCAAAGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTTGCTTCAAAAGGGACGTTTCTTTTGATGAATAAATGGAAATATT-ACTTTGTAAAT---TTCTGGAAATATTATTTTTACCTGTGGCCTCAACCAGGAAGGATTTATATAAAC------AAATTATCCAATCATTCCCTTGACTTTCTGGGTTATCGTTCAAGT------GTCGCGGTAAATCCTTCAATGGTACGCAGTCAAATGCTAGAAAATGCATTTCTAATCGATAA------TGCTATTAAGAAGTTTGATACTCTTGTTCCAATTATGCCTCTGATTGGATCACTGGCTAAATCGAAATTTTGTAACCCATTGGGGCATCCTATTGGCAAGGCGATTTGGACCGATTTATCAGATTCTGATATTATTGAGCGCTTTGGGCGTATATACAGAAATCTTTCTCATTATCATAGTGGATCTTCAAAAAAAAAGAGTTTGTATCGAGTAAAGTATATACTTAGACTTTCTTGTGCTAGAACTTTAG-CTCGTAAGCATAAAAGTACTGTACGTGCTTTTTTGAAAA------GATTTGGTTCGGAATTATTGGAAGAATTCTTTATGGAAGAAGAACAAGT------TTTTTCCTTGACCTTTCCAAGAGTTTCTTCTATTTCGCGAAGGTTATCTAGAAGGCGGAT---TTGGTATTTGGATATT---ATTTGTATCAATGATTTGGCCAATCATGAATGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGT-GTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACGAGCCTTGATCGTTACAAAGGGCGCTGCTATGGAATTGAGCCTGTTCTTGGAGAAGAGAATCAATATATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATGGTAGGTAACGTATTTGGTTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATTTGCGAATTCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGTG--------GTGGCCTTGATTTTACTAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTTTAAATCACAAGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCGGGTACATGCGAAGAAATGATGAAAAGGGCTATATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACCTAACAGGTGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAACCATGGTATACACTTCCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATCCATGCCGGTACCGTAGTAGGTAAACTTGAAGGGGAAAGAGAAATCACTTTGGGCTTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGATAGAAGTCGCGGTATTTATTTCACCCAGGATTGGGTGTCTCTACCAGGTGTTCTGCCGGTAGCTTCGGGCGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGTGGAACTTTAGGCCACCCTTGGGGAAATGCACCTGGTGCCGTAGCTAACCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGGGACGCGATCTTGCTACCG--AGGGTAATGAAATTATCCGCGAAGCTACCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAA---------------------------------------------------------------------------- Achnatherum_lettermanii -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Achnatherum_nelsonii ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCC-GGCTGAGGGCACGCCTGCCT---GGGC-GTCA--------------------------------------------------------------------------------------------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAAAATTCGAAGGGTATTCAGAAAAACTTAAATCTCGTCAACAATACTTCGTCTACCCACTTCTCTTTCAGGAGTATATTTATGCATTTGCCCATGATTATGGATTAAATGGTTCCGAACCTGTGGAAATTGTT------------------AGTTGTAATAACAAGAAATTTAGTTCACTACTTGTGAAACGTTTAATTA------------TTCGAATGTATCAGCAGAATTTT------TGGATTAACTCGGTTAATCATCCTAACCAAGATCGATTG---------------TTGGATTACAAAAATTATTTTTATTCTGAGTTTTATTCTCAGATTCTATCTGAGGGGTTTGCGATCGTTGTAGAAATCCCATTCTCGCTACGAGAATTATCTCGTCCGA--------------------AAGAAAAAGAAATACCAAAGTTTCAGAATTTACGCTCTATTCATTCAATATTTCCCTTTTTAGAAGACAAATTTTTGCATTTGGATTATCTATCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAACTCCTTCAATACCATATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Achnatherum_pinetorum -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Achnatherum_robustum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATAC{CT}TGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCC-GGCTAAGGGCACGCCTGCCT---GGGC-GTCACGC-----------------------------------------------------------------------------------------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAAAATTCGAAGGGTATTCAGAAAAACTTAAATCTCGTCAACAATACTTCGTCTACCCACTTCTCTTTCAGGAGTATATTTATGCATTTGCCCATGATTATGGATTAAATGGTTCCGAACCTGTGGAAATTGTT------------------AGTTGTAATAACAAGAAATTTAGTTCACTACTTGTGAAACGTTTAATTA------------TTCGAATGTATCAGCAGAATTTT------TGGATTAACTCGGTTAATCATCCTAACCAAGATCGATTG---------------TTGGATTACAAAAATTATTTTTATTCTGAGTTTTATTCTCAGATTCTATCTGAGGGGTTTGCGATCGTTGTAGAAATCCCATTCTCGCTACGAGAATTATCTCGTCCGA--------------------AAGAAAAAGAAATACCAAAGTTTCAGAATTTACGCTCTATTCATTCAATATTTCCCTTTTTAGAAGACAAATTTTTGCATTTGGATTATCTATCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAACTCCTTCAATACCATATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Aconitum_columbianum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------{CT}AAAC{CG}A{AC}T{CT}T{CT}GGCAACGGATAT{CT}T{CT}GG---CT{CT}TTG{CG}AT{CT}G-AT{CT}AA{AG}AACGTA{AG}CGAAATGCGATACTTGGTGTGA-ATTG{CG}-A{AG}AATCCCGTGAACCAT{CT}GAGT{CT}TTTGAACGCAAGTTGCGCCCGAGGCCATTA-GG{CT}CGAGGGCAC{CG}T{CT}TG{CG}CT---GGGC-GT{CT}ACAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACCTGCCCA----GCAGAG-CGACCCG-CGAACAAGTGAAA{AC}CAA-ACCCGGACGTACCGAAGAGGGGCGCATG------CCCCCGATCG--CTCGCCCGTCGGACCACGACCTCTTCTACGACCGCACTGAT{CT}TGCG------------GGCGGAGGGG{GT}GGG{GT}{CT}{CG}TTG-{GT}GT{CT}C{CG}{AC}AC--AAAACC{AC}AAAACC{CG}G-{CG}{CG}CGA-{AC}{AC}GG{CG}{CG}{CG}C-{AC}A{AG}GAAAT{CT}TTA-----{AG}CGGAAAA-AGA{AG}GGTTGCCCC{GT}T---CC{CT}-----{CT}GG{GT}-----GGCA{AG}CCT-TTAAAAT{CT}C{CG}ATACT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Aconitum_napellus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGACTCTCGGCAACGGATATCTCGG---CTCTTGCATCG-ATGAAGAACGTA{GT}CGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCC-ATTAGGTCGAGGGCACGTCTGCCT---GGGC-GTCACAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACCTGCCCA----GCAGAG-CGACCCG-CGAACAAGTGAAAACAA-ACCCGGACGGACCGAAGAGGGGCGCATG------CCCCCGATCG--CTCGCCCGTCGGACCACGACCTCTTCTGCGACTGCATTGATATGCG------------GGCGGAGGGGTGGGTCGTTG-TGTCCACAC--AAAACCAAAAACCGG-CGAGA-CATTCGCC-AAGGAAATCTTA-----GCGGAAAA-AGAGGGTTGTCCCGT---CCG-----CGGT-----GGCAGCCT-TCAGAATCCGATACT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACCCCATCCTATCCATCTGGAACTATTGGTTCAAATCCTTCGTTGTTGGATACAAGATGTCCCCTTTTT--GCACTTATT------GAGACTCTTTCTCTACG-------AGTATCATCAT------TGGAA---TATTCTTATTA------CTCAAAA---AAATCAAATGAATT------------TCTTTTTTTCA------AAAGAGAATCAAAG------ATTTTTTCTGTTCCTATATAATTTTCATGTATATGAGTCGGAATCCATATTCGTTTTTCTGCGTAAACAATCTTCTCATTTACGATCAACATCCTCTAGAACTTTTCTTGATCGAACACATTTTTTTGG---------------AAAAATA------GAACATTTTT------------TAGTGGTT------TTTCGTAATGATTTTCATACC---ATCCTT------TGGTTGTTCAAGGATATTTTCATCCATTATTTCAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGGAACTCCTCTTCTGATGAAGAAATGGAAATATT-ACCTTGTAAAT---TTATGGGAATGTCATTTTTTTTTTTGGTCTCAACCGAATAGGATTCATATAAAC------CAATTATCCAATCATTTTATAGATTTTCTGGGCTATTTTTCAACTG------TACGACCAAATCCTTCAGTGGTAAGGAGTCAAATGTTAGAAAATTCATTTATTATAGATAT------TGCTATTAATAAGTTTGATACTATAGTCCCAATTATTCCTTTGATTGAATCACTGGCTAAATCGAAATTTTGTAACTTATCAGGGCATCCCATCAGTAAGCCGACTTGGGCCGATTCATCCGATTCTGATATTATCGATAGATTTGGTCGAATATGCAGAAATCTTTCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACCACAAACAGAGACTAAAGCAAGTGTTGGCTTCAAAGCAGGT-GTTAAAGATTACAAATTGAATTATTATACTCCGGAATATACACCCAAAGATACTGATACCTTGGCGGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAAGAAGCAGGGGCTGCTGTAGCTGCCGAATCTTCTACAGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATTTGTTATGTAGCATATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCGCTACGCGCTCTACGTCTGGAGGATCTGCGAATTCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCACTATTGGGATGTACTATTAAACCAAAATTGGGATTATCTGCTAAGAACTACGGTAGAGCGGTTTATGAATGCCTGCGTG--------GTGGGCTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAACCCTTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCTGAAGCACTTTATAAAGCACAAGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCGGGTACATGCGAAGAAATGATAAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTACCCATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATACATTTCCGTGTACTAGCTAAAGCGTTACGCATGTCTGGTGGAGATCATATTCACTCTGGTACCGTAGTAGGTAAACTGGAAGGGGAAAGAGAGATCACCTTGGGTTTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTACTTCACTCAAGATTGGGTCTCTCTACCGGGTGTTCTGCCCGTTGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCGCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCGGGTGCTGTAGCTAATCGAGTAGCCCTAGAAGCCTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTG--AAGGTAATGAAATTATCCGTGAGGCTTGCAAATGGAGCCTTGAACTAGCCGCTGCTTGTGAGGTATGGAAGGAAATCAAATTCGAATTTGAAGCAATGGATACTTTGTAA--------------------------------------------- Aconitum_racemulosum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCATACGACTCTCGGCAACGGATATCTCGG---CTCTTGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCC-ATTAGGTCGAGGGCACGTCTGCCT---GGGC-GTCACA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACCTGCCCA----GCAGAG-CGACCCG-CGAACAAGTGAAAACAA-ACCCGGACGGATCGAAGAGGGGCGCACG------CCCCCGATCG--CCCGCCCGTCGGACCACGACCTCTTCTGCGACCGCACTGACCTGCG------------GCTGGAGGGGTGGGTCGTTG-TGTCCGCAC--AAAACCAAAAACCGG-CGCGA-CAGGCGCC-AAGGAAATCTTA-----GCGGAAAA-AGAGGGCCGCCTCAT---CCG-----CGGA-----GGCAGCCT-TCAGAATCCGATAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTGCTCATGATCATGGGTTAAATAAATCGATTCCTTATGAGCCTA------TGGAAAATTTAGGTTATGCCAAT------AAATATAGTTTACTAATTGTTAAACGTTTAATTA------------CTCAAATGTATCAACAGAAGCAT------TTGATTTTTTTGGCTAATGATTCGAATCAAAATCAATTA---------------------GTTGGGTATAATAAAATTTTTTATTCTCA------AATGATATCAGAGGGGTTTGCAGTCATTGTGGAAATTCCATTCTCACTGCGATTAGTATCTTCCCTAG-----------------AAGGTAAAAAAGAAATAGTCAAATCTATTAATTTACGATCAATTCATTCCATATTTCCTTTTTTAGAGGATAAATTATCACATTTAAATCATGTATTAGATATCCTAATACCCCATCCTATCCATCTGGAACTATTGGTTCAAATCCTTCGTTGTTGGATACAAGATGTCCCCTTTTT--GCACTTATT------GAGATTCTTTCTCTACG-------AATATCATCAT------TGGAA---TATTCTTATTA------CTCAAAA---AAATCAAATGAATT------------TCTTTTTTTCA------AAAGAGAATCAAAG------ATTTTTTCTGTTCCTATATAATTTTCATGTATATGAATCGGAATCCATATTCGTTTTTCTCCGTAAACAATCTTCTCATTTACGATCAACATCCTCTAGAGCTTTTCTTGATCGAACACATTTTTTTGG---------------AAAAATA------GAACATTTTT------------TAGTGGTT------TTTCGTAATGATTTTCATACC---ATCCTT------TGGTTGTTCAAGGATACTTTCATGCATTATTTCAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGGAACTCCTCTTCTGATGAATAAATGGAAATATT-ACCTTGTAAAT---TTATGGGAATGTCAATTTTTTTTTTGGTCTCAACCGAATAGGATTCATATAAAC------CAATTATCCAATCATTTTATCGATTTTCTGGGCTATTTTTCAACTG------TACGACCAAATCCTTCAGTGGTAAGGAGTCAAATGTTAGAAAATTTATTTATTATAGATAT------TGCTATTAATAAGTTTGATACTATAGTCCCAATTATTCCTTTGATTGGATCACTGGCTAAATCGAAATTTTGTAACTTATCAGGGCATCCCATCAGTAAGCCGACTTGGGCCGATTCATCCGATTCTGATATTATCGATAGATTTGGTCGGATATGCAGAAATGTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAGTATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAAGCAGGT-GTTAAAGATTACAAATTGAATTATTATACTCCGGAATATGCACCCAAAGATACTGATACCTTGGCGGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAAGAAGCAGGGGCTGCTGTAGCTGCCGAATCTTCTACAGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATTTGTTATGTAGCATATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCGCTACGCGCTCTACGTCTGGAGGATCTGCGAATTCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCACTATTGGGATGTACTATTAAACCAAAATTGGGATTATCTGCTAAGAACTATGGTAGAGCGGTTTATGAATGCCTGCGTG--------GTGGGCTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAACCCTTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCTGAAGCACTTTATAAAGCACAAGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCGGGTACATGCGAAGAAATGATAAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTACCCATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATACATTTCCGTGTACTAGCTAAAGCATTACGCATGTCTGGTGGAGATCATATTCACTCCGGTACCGTAGTAGGTAAACTGGAAGGGGAAAGAGAGATCACCTTGGGTTTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTACTTCACTCAAGATTGGGTCTCTCTACCGGGTGTTCTGCCCGTTGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCGCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTGGCCCTAGAAGCCTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTG--AAGGTAATGAAATTATCCGTGAGGCTTGCAAATGGAGCCTTGAACTAGCCGCTGCTTGTGAGGTATGGAAGGAAATCAAATTCGAATTTGAAGCAATGGATACTTTGTAA--------------------------------------------- Actaea_rubra ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGACTCTCGGCAACGGATATCTCGG---CTCTTGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTTAGGTTGAGGGCACGTCTGCCT---GGGC-GTCACACACA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAA-CGACC-G-TGAACACGTTAAAA-AACATT-ATGTGGATTGATGAGGAGTGTGA-------GCTCTTAATCATCCA--TTGTCGGGTCATGGGATTGACCA-------------------------------------TGGTTGATCTTATGCTCTTGTAC--AAACACAAAACTCGG-CGCAA-TTAGCGTC-AAGGAAATCTTA-----GCGGAAACAGA-GTGTTATCCATT---TA------TAGTTG---GGCGATGC-TTCGAATCCGATACTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCTTTTTT--GCACTTATT------GAGATTCTTTCTCTACG-------AGTATCATAAT------TGGAATAATAGTCTTATTA------CGCAAAA---AACAAAAAATAATT------------TATTTTTTTCA------AAAGATAATCAAAG------ATTATTCCTGTTCCTGTATAATTTTCATGTATATGAATCGGAATCCATATTCGTTTTTCTCCGTAAAAAATATTCTCATTTACGATTAACCTCTTCTAGAGCTTTTCTTGATCGAACACATTTTTATGA---------------AAAAATA------GAAAATTTTA------------TAGTGGTC------TTTCGTAATGATTTTCATACC---ATTCTA------TGGTTGTTCAAGGATCTTTTCATGCATTATTTCAGATATCAAGGAAAATCAATTCTGTCTTCAAAAGGACCCCCTCTTCTGATGAAGAAATGGAAACATT-ACCTTGTAAAT---TTATGGGAATATCATTTTTACTTTTGGTCTCAACCGGATAGGATTCATATAAAC------CAATTATCCAATCATTTTCTTGATTTTCTGGGCTATCTTTCAAGTG------TACGATCAAATCCTTCGGTGGTAAGGAGTCAAATGTTAGAAAATTCATTTATTATAGACAT------TGCTATTAATAAGTTTGATACTATAGTCCCAATTATTCCTTTGATTGGATTATTGGCTAAAGCGAAATTTTGTAACTTATCGGGGCATCCCATTAGTAAGCCGGCTTGGGCCGATTCATCAGATTCTGATATTATCGATAGATTTGGTCGGATATGCAGAAATGTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAAGCAGGT-GTTAAAGATTACAAATTGACTTATTATACTCCTGAATATGCACCCAAAGATACTGATACCTTGGCGGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCTGTAGCTGCCGAATCTTCTACAGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATTGAGCCTGTTGCTGGAGAAGAAAATCAATATATTTGTTATGTAGCCTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCGCTACGCGCTCTACGTCTGGAGGATCTGCGAATCCCTGTTGCTTATGTTAAAACTTTCCAAGGACCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCTAAGAACTACGGCAGAGCGGTTTATGAATGTCTCCGCG--------GTGGGCTTGATTTTACCAAGGATGATGAGAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agalinis_pulchella --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTC-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACGCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAAA--AGCAGA-----CC-GCG-AACACGTTAAACCA---CATCGGGATCTTGGGTC----GGGGG----CAACCCCAACCCT-CGCTCCCCCTCCGCATCGCGTGCGTCT-----------------------------------CG-GCG-TGCACGGTGC-GG-CTAACG--AACCC-C------CGGCGCG-GCATGCGCC-AAGGAAAACTCATAGA----AGCACCC---G-CCTCCCGTCGCCCC-GTTCGCGG--TGCGCGGTGGGAGGAGTGGGTGTCTCTCCAATGT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGGAAATCCAAAGAGATTTACAGCTAGAGAGATCTCAACAACACGACTTCCTATATCCACTTATTTTTCAGGAGTATATTTATACATTTGCTCATGATCGTGGTTTCGGTAGATCGATTT---TGTCG------------GAAAATCCAGGTTATGACAAGAAATCCA------GTTTACGGATTGTGAAACGGTTAATTACTCG------------AATGTATCAACAGAATCAT------TTGATGATTTCTCCTAATGATTTTAACCAAAATCCATTT---------------------TTGGCGCGCAACCAAAATTTGTATTCTCA------AATTATATCAGAGGGGTTTGCTTTTATTGTGGAAATTCCATTTTCTCTAAGATTAATATCTTGTCTAGAAGGG--------------AAAAAGAAAAAGATAGTCAAATCTCAGAATTTACGATCAATTTTTTCAATATTTCCCTTTTTAGAGGACAATTTTGCACATTTAAATTTTGTATTAGATATACTAATACCCCGCCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGCGTCAAAGATGCCTCTTCTTT--ACATTTATT------ACGATTCTTTCTGACCA-------AGTATTG------GAATTGGAC---TAGTCTTATTAC------TCCAAAGAAAGCCAGTTCCT---------------CTTTTTCAAAAAG---------AAATCCAAG------GTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCGTCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGGTTTTCTTGAACGAATCTATTTCTATGG---------------AAAAATA------GAACGTCTTG------------GGAATGTCTTTGTAAAGGTTAAGGATTTT-CAGGCG--AACCTG------TGGTTGGTCAAGGAACCTTGCATCCATTATAGTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTT-ACCTTATCACT---TTTTGGCAATGGCATTTTTCGCTGTGGTTTGATCCAAGAAGGATTTATATAAAC------CAATTAGCCAATCATTCCTTTGAATTTTTGGGCTATCATTCAAGC------TTGCGAATGAACCCTTCAGTGGTCCGGAGTCTCATTTTCGAAAATGCATTTCTAATCAATAA------TGCTATTAAGAAAGTCGATACCTTTATTCCAATTCTTCCTCTGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTACTATTATTGACCGATTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCTTCCCAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCTTGTGCTAGAACTTTGG-CTCGGAAACACAAAAGTACTGTGCGTACTTTTTTGAAAA------GATTAGGCTCGGAGTTGTTGGAAGAATTTCTTCTGTCGGAAGAAGACGT------TCTTTTTTTGACGTTCCCAAAAGCTTCTTCCAGTTTGCAGGGAGTATATAGAAATCGAAT---TTGGTATTTGGATATTCTTTCTATTAATGATTTGGCCGATCACAAATCCAAATTCTGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTTGGATTCAAAGCGGGT-GTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCGGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCG--------GTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTGAATGCTACTGCGGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGAGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAGAAGAACCATGGTATACACTTCCGTGTACTAGCTAAAGCGTTACGTATGTCTGGGGGAGATCATATTCACTCTGGGACCGTAGTAGGTAAACTTGAAGGAGAAAGAGACATCACTTTGGGCTTTGTTGATTTACTGCGTGATGATTTTATTGAAAAAGATCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTATTCCCGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTTTAACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGTAATGCGCCAGGTGCCGTAGCTAACCGAGTCGCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTGTTG--AGGGTAATGCAATTATCCGTGAGGCTAGCAAAT-------------------------------------------------------------------------------------------------------------------------- Agalinis_tenuifolia --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTC-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACGCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAAA--AGCAGA-----CC-GCG-AACACGTTAAACCA---CATCGGGATCTTGGGTC----GGGGG----CAACCCCAACCCT-CGTTCTCGTCCCGCAGCGCGCGCGTCT-----------------------------------CG-GCG-TGCGCGGTGC-GG-CTAACG--AACCC-C------CGGCGCG-GCATGCGCC-AAGGAAAACTCATAGA----AGCACTC---G-CCTCCTATCGCCCC-GTTCGCGG--TGTGCGGTGGGGGGAGCGGGTGTATCTCCAATGT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGGAAATCCAAAGATATTTACAGCTAGAGAGATCTCAACAACACGACTTCCTATATCCACTTATTTTTCAGGAGTATATTTATACATTTGCTCATGATCGTGGTTTCGGTAGATCGATTT---TGTCG------------GAAAATCCAGGTTATGATAATAAATCCA------GTTTACTGATTGTGAAACGGTTAATTACTCG------------AATGTATCAACAGAATCAT------TTGATTATTTCTCCTAATGATTTTAACCAAAATCCATTT---------------------TGGGCGCGCAACAAAAATTTGTATTCTCA------AATCATATCAGAGGGGTTTGCTTTTATTGTGGAAATTCCATTTTCTCTAAGATTAATATCTTGTCTAGAAGGG--------------AAAAAGAAAAAGATAGTAAAATCTCAGAATTTACGATCAATTCTTTCAATATTTCCCTTTTTAGAGGACAATTTTTCACATTTAAATTTTGTATTAGATATACTAATACCCTACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTT--ACATTTTTT------ACGATTCTTTCTGAACA-------AGTATTG------GAATTGGAA---TAGTCTTATTAC------TCCAAAGAAAGCCAGTTCCT---------------CTTTTTCAAAAAG---------AAATCAAAG------GTTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCCGTTTTCGTCTTTCTACGAAACCAATCTTCTCATTTACGATCAACAGCTTTTGGAGTTTTTCTTGAACGAATCTATTTCTATGG---------------AAAAATA------GAACGTCTTG------------TGAATGTCTTTGTAAAGGTTAAGGATTTT-CAGGCG--AACCTG------TGGTTGGTCAAGGAACCTTGCATCCATTATATTAGGTATCAAAGAAAAGCCATTCTAGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTT-ACCTTATCACT---TTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATAAAC------CAATTATCCAATCATTCCTTTGAATTTTTGGGCTATCATTCAAGC------TTGCGAATGAACCCTTCAGTGGTACGGAGTCTTATTTTAGAAAATTCATTTCTAATCAATAA------TGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCAATGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGATTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCTTCCCAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCTTGTGCTAGAACTTTGG-CTCGGAAACACAAAAGTACTGTGCGTACTTTTTTGAAAA------GATTAGGCTCGGAGTTGTTGGAAGAATTTCTTCTGTCGGAAGAAGACGT------TCTTTTTTTGACGTTCCCAAAAGCTTCTTCCAGTTTGCAGGGAGTATATAGAAATCGAAT---TTGGTATTTGGATATTATTTCTATTAATGATTTGGCCGATCACAAATCCAAATTCTAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGTGTTGGATTCAAAGCGGGT-GTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATCTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTACTGCTTATATTAAAACTTTCCAAGGTCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCG--------GTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agoseris_elata ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGAAATTCCAA------AGCTATTTAGGGCTAGATAGATCTCAACAACACTACTTCTTATATCCACTTATCTTTCAGGAGTATATTTATGTATTTGCTCATGATCATGGTTTA------AATAGATCGATTTTGT---------TGGAAAATGCAGGTTATGACAATAAATCCA------GCTTACTAATTGTGAAACGTTTAATCA------------ATCGAATGTATCAACAGAATCAT------TTGATTCTTTCGGTTAATAATTCTAAACAGACTCCATCTTTGG---------------GGCACAACAA------GAATTCTTATTCACG------GGTAATGTCAGAGGTATCTTCAATCATTATGGAAATTCCATTGTCTCTGCGATTAATATCTTACCTAG--------------AAAGGAAAGGGGTAGTCA------AATCCGATAATTTACGATCAATTCATTCAATATTTTCTTTTTTAGAGGATAACCTTTCACATTTAAATTATGTATTAGATATACTAATACCTTACCCAGCCCATCTGGAAATCTTGGTTCAGGCTCTTCGCTATTGGATAAAAGATGCTTCCTCTTT--GCAT{AT}TATT------AAGATGCTTTCTCCATG-------AGTGTCATAAT------TGGGA---TAGTCTTATTACTTCAAATTCAAAGAAAGCCAGTT------------------CTTCTTTTTCA------AAAAGAAATCACAG------ACTATTCTTCTTCCTATATACTTCTCATGTATGTCAATATGAATCTGGCTTCCTCTTTCTCCGTAACCAATCTTCTCACTTACGATCAACATCTTCTGGAGCCCTTATTGAACGAATATATTTCTATGG---------------AAAAATA------GAGCATCTTG------------CAGAAGT------CTTTGCCAGGGCTTTTCAAGCG---AATTTA------TGGTTGTTCAAAGATCCTTTCATGCATTATGTTAGGTATCCAAGAAAATCTATTCTTGCTTCAAAAGGGACGTTTCTTTTGATGAATAAATGGAAATATT-ACTTTGTGAAT---TTCTGGAAATCTTATTTTGACCTGTGGTCTCAACCAGGCACGATTTATATAAA------CCAAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Agoseris_glauca -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agoseris_grandiflora ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCC-GGCTGAGGGCACGCCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAAC--AGCAGAA-CGACCCG-CGAACAAGT-ACCCACAATCGGGAGTCAGTGGATGTTGGC-------------TCCGGTCTAT------ATCCACGAC----GCCCTGCCGGCGT-GTGTTTGTG-ATGCCCC------ATCC--GGGGTTTCATGGATCTCACGTTGGCAC--ATTAACAAA-CCCCGGCACG-ACATGTGCC-AAGGAAAATATTAA-ATGAGAAGGACG---CGTCC-ATTATCACCCCGTTCGCGG--TG-T--GTGTCTT-GGCGTTTGCCTCCTTGAAATTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Agoseris_retrorsa ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCC-GGCCAAGGGCACGCCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAAC--AGCAGAA-CGACCCG-CGAACAAGT-ACCCACAATCGGGAGTCGGTGGATGTTGGC-------------TTCGGTCTCT------ATCCACGAC----ACTCTGCCGGCGT-ATGTTTGTG-ATGCCCC------ATTT--GGGGTTTCATGGATCTCACGTTGGCAC--ATTAACAAA-CCCCGGCACG-ACATGTGCC-AAGGAAAATATTAA-ATGAGAAGGACA---CGTCC-ATTATCACCCCGTTCGCGG--TG-T--GTGTCTT-GGCGTTTGCCTCCTTGAAATTAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGAAATTCCAA------AGCTATTTAGGGCTAGATAGATCTCAACAACACTACTTCTTATATCCACTTATCTTTCAGGAGTATATTTATGTACTTGCTCATGATCATGGTTTA------AATAGATCTATTTTGT---------TGGAAAATGCAGGTTATGACAATAAATCCA------GCTTACTAATTGTGAAACGTTTAATCA------------CTCGAATGTATCAACAGAATCAT------TTGATTCTTTCGGTTAATAATTCTAAACAGACTCCATTTTTTG---------------GGGACAACAA------AAATTTTTATTCGCA------AGTAATGTCAGAGGTATCTTCAATCATTATGGAAATTCCATTGTCTCTGCGATTAATATCTTCCCTAG--------------AAAGGAAAGGGGTAGTCA------AATCTGATAATTTACGATCAATTCATTCAATATTTTCTTTTTTAGAGGACAACTTTTCACATTTAAATTATGTATTAGATATACTAATACCTTACCCAGCCCATCTGGAAATCTTGGTTCAGGCTCTTCGCTATTGGATAAAAGATGCTTCCTCTTT--GCATTTATT------AAGATTCTTTCTACATG-------AGTGTCATAAT------TGGGA---TAGTCTTATTACTTCAAATTCAAAGAAAGCCAGTT------------------CTTCTTTTTCA------AAAAGAAATCACAG------ACTATTCTTCTTCCTATATACTTCTCATGTATGTGAATATGAATCTGGCTTCCTCTTTCTCCGTAACCAATCTTCTCACTTACGATCAACATCTTCTGGAGCCCTTATTGAACGAATATATTTCTATGG---------------AAAAATA------GAGC------------------------T------CTTTGCCAGGGCTTTTCAAGCG---AATTTA------TGGTTGTTCAAAGATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATCAATTCTTGCTTCAAAAGGGACGTTTCTTTTGATGAATAAATGGAAATATT-ACTTTGTCAAT---TTCTGGAAATCCTATTTTTACCTGTGGTCTCAACCAGGAAGGATTTATATAAA------CCAAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Agrostis -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Agrostis_exarata ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTC-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACG------------------------------------------------------------------------------------------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAAAATTTCAAGGGTATTCAGAAAAACATAAATCTCGTCAACAATACTTTGTCTACCCACTTCTCTTTCAGGAGTATATTTATGCATTTGCCCATGATTATGGATTAAATGATTCAGAACCTGTGGAAATTGTT------------------AGTTGTAATAACAAGAAATTTAGTTCACTACTTGTGAAACGTTTAATTA------------CTCGAATGTATCAGCAGAATTTT------TGGATTAACTCGGTTAATCATCCTAACCAAGATCGATTG---------------TTGGATTACAAAATTGGTTTTTATTCTGAGTTTTATTCTCAGATTCTACCTGAGGGGTTTGCGATCGTTGTAGAAATCCCATTCTCGCTACGAGAATTATTTTGTCCGA--------------------AAGAAAAAGAAATACCAAAGTTTCAGAATTTACGCTCTATTCATTCAATATTTCCCTTTTTAGAAGACAAATTTTTGCATTTGGATTATCTTTCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTGCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCAAATTGGA------ATAGT---TTTATTAC------TTCAATGAAATCTATTT------------------TTCTTTTTAAA------AAAGAAAATAAAAG------ACTTTTTCGATTCTTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTCCTTACCATTATTATCTTCTGGAACTTTTCTGGAACGAATCATCTTTTCTAG---------------GAAGATG------GAACATTTT---------------------GGGATAATGTACCCGGGTTTTTTTCGGAAAACCATA------TGGTTCTTTATGGATCCTCTGATGCATTATGTTCGCTATCAAGGAAAGGCAATTCTTGGATCAAAAGGAACTCATTTTTTGAACAAGAAATGGAAATGGT-ACCTTATCAAT---TTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAAC------CAATTAGCAAACTCTTGCTTCGATTTTCTGGGGTACCTTTCAAGTG------TACAAAAAAGTACTTTGTTAGTAAGGAATCAAATGCTGGAGAATTTATTTCTAATAAATAC------TCGAATGAAAAAATTCGATACCATAGTTCCCGCTACTGCCCTCATAGGGTACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGCATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACAGACTTTGTATCGCCTAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTAG-CTCGTAAACATAAAAGCACGGTACGAACTTTTATGCAAC------GGTTGGGTTCGGCATTTTTAGAAGAATTTTTTACCGAAGAAGAGTTAGT------TTTTTCTTTGATGTTCACCAAAACAAGCCTTTTTTCTTTCCGTGGATCGCACAGTGAGCGTATTTGGTATTTTGATATTATACGTATCAACGACCTGGTAAAGCCTCTTAATTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Agrostis_gigantea ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTC-GGCTGAGGGCACGCCTGCCT---GGGC-GTCACGC-----------------------------------------------------------------------------------------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAAAATTTCAAGGGTATTCAGAAAAACATAAATCTCGTCAACAATACTTTGTCTACCCACTTCTCTTTCAGGAGTATATTTATGCATTTGCCCATGATTATGGATTAAATGATTCAGAACCTGTGGAAATTGTT------------------AGTTGTAATAACAAGAAATTTAGTTCACTACTTGTGAAACGTTTAATTA------------CTCGAATGTATCAGCAGAATTTT------TGGATTAACTCGGTTAATCATCCTAACCAAGATCGATTG---------------TTGGATTACAAAATTGGTTTTTATTCTGAGTTTTATTCTCAGATTCTACCTGAGGGGTTTGCGATCGTTGTAGAAATCCCATTCTCGCTACGAGAATTATCTTGTCCGA--------------------AAGAAAAAGAAATACCAAAGTTTCAGAATTTACGCTCTATTCATTCAATATTTCCCTTTTTAGAAGACAAATTTGTGCATTTGGATTATCTTTCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTGCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCAAATTGGA------ATAGT---TTTATTAC------TTCAATGAAATCTATTT------------------TTCTTTTTAAA------AAAGAAAATAAAAG------ACTTTTTCGATTCTTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTGCTTACCATTATCATCTTCTGGAACTTTTCTGGAACGAATCATCTTTTCTAG---------------GAAGATG------GAACATTTT---------------------GGGATAATGTACCCGGTTTTTTTTCGGAAAACCATA------TGGTTCTTTATGGATCCTATGATGCATTATGTTCGCTATCAAGGAAAGGCAATTCTTGGATCAAAAGGAACTCATTTTTTGAACAAGAAATGGAAATGGT-ACCTTATCAAT---TTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAAC------CAATTAGCAAACTCTTGCTTCGATTTTCTGGGGTACCTTTCAAGTG------TACCAAAAAGTACTTTGTTAGTAAGGAATCAAATGCTGGAGAATTTATTTCTAATAGATAC------TCGAATGAAAAAATTCGATACCATAGTTCCCGCTACTGCCCTCATAGGGCACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGCATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACAGACTTTGTATCGCCTAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTAG-CTCGTAAACATAAAAGCACGGTACGAACTTTTATGCAAC------GGTTGGGTTCGGCATTTTTAGAAGAATTTTTTACCGAAGAAGAGTTAGT------TTTTTCTTTGATGTTCACCAAAACAACCCTTTTTTCTTTCCGTGGATCGCACAATGAGCGTATTTGGTATTTTGATATTATACGTATCAACGACCTGGTAAAGCCTCTTAATTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Agrostis_humilis ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAAAATTTCAAGGGTATTCAGAAAAACATAAATCTCGTCAACAATACTTTGTCTACCCACTTCTCTTTCAGGAGTATATTTATGCATTTGCCCATGATTATGGATTAAATGATTCAGAACCTGTGGAAATGGTT------------------AGTTGTAATAACAAGAAATTTAGTTCACTACTTGTGAAACGTTTAATTA------------CTCGAATGTATCAGCAGAATTTT------TGGATTAACTCGGTTAATCATCCTAACCAAGATCGATTG---------------TTGGATTACAAAATTGGTTTTTATTCTGAGTTTTATTCTCAGATTCTACCTGAGGGGTTTGCGATCGTTGTAGAAATCCCATTCTCGCTACGAGAATTATCTTGTCCGA--------------------AAGAAAAAGAAATACCAAAGTTTCAGAATTTACGCTCTATTCATTCCATATTTCCCTTTTTAGAAGACAAATTTTTGCATTTGGATTATCTTTCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTGCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCAAATTGGA------ATAGT---TTTATTAC------TTCAATGAAATCTATTT------------------TTCTTTTTAAA------AAAGAAAATAAAAG------ACTTTTTCGATTCTTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTGCTTACCATTATCATCTTCTGGAACTTTTCTGGAACGAATCATCTTTTCTAG---------------GAAGATG------GAACATTTT---------------------GGGATAATGTACCCGGTTTTTTTTCGGAAAACCATA------TGGTTCTTTATGGATCCTCTGATGCATTATGTTCGATATCAAGGAAAGGCAATTCTTGCATCAAAAGGAACTCATTTTTTGAACAAGAAATGGAAATGGT-ACCTTATCAAT---TTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAAC------CAATTAGCAAACTCTTGCTTCGATTTTCTGGGGTACCTTTCAAGTG------TACCAAAAAGTACTTTGTTAGTAAGGAATCAAATGCTGGAGAATTTATTTCTAATAGATAC------TCGAATGAAAAAATTCGATACCATAGTTCCCGCTACTGCCCTCATAGGGTACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGCATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACAGACTTTGTATCGACTAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTAG-CTCGTAAACATAAAAGCACGGTACGAACTTTTATGCAAC------GGTTGGGTTCGGCATTTTTAGAAGAATTTTTTACCGAAGAAGAGTTAGT------TTTTTCTTTGATGTTCACCAAAACAACCCTTTTTTCTTTCCGTGGATCGCACAGTGAGCGTATTTGGTATTTTGATATTATACGTATCAACGACCTGGTAAAGCCTCTTAATTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Agrostis_idahoensis ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTC-GGTTGAGGGCACGCCTGCCT---GGGC-GTCACG------------------------------------------------------------------------------------------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAAAATTTCAAGGGTATTCAGAAAAACATAAATCTCGTCAACAATACTTTGTCTACCCACTTCTCTTTCAGGAGTATATTTATGCATTTGCCCATGATTATGGATTAAATGATTCAGAACCTGTGGAAATTGTT------------------AGTTGTAATAACAAGAAATTTAGTTCACTACTTGTGAAACGTTTAATTA------------CTCGAATGTATCAGCAGAATTTT------TGGATTAACTCGGTTAATCATCCTAACCAAGATCGATTG---------------TTGGATTACAAAATTGGTTTTTATTCTGAGTTTTATTCTCAGATTCTACCTGAGGGGTTTGCGATCGTTGTAGAAATCCCATTCTCGCTACGAGAATTATTTTGTCCGA--------------------AAGAAAAAGAAATACCAAAGTTTCAGAATTTACGCTCTATTCATTCAATATTTCCCTTTTTAGAAGACAAATTTTTGCATTTGGATTATCTTTCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTGCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCAAATTGGA------ATAGT---TTTATTAC------TTCAATGAAATCTATTT------------------TTCTTTTTAAA------AAAGAAAATAAAAG------ACTTTTTCGATTCTTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTCCTTACCATTATTATCTTCTGGAACTTTTCTGGAACGAATCATCTTTTCTAG---------------GAAGATG------GAACATTTT---------------------GGGATAATGTACCCGGGTTTTTTTCGGAAAACCATA------TGGTTCTTTATGGATCCTCTGATGCATTATGTTCGCTATCAAGGAAAGGCAATTCTTGGATCAAAAGGAACTCATTTTTTGAACAAGAAATGGAAATGGT-ACCTTATCAAT---TTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAAC------CAATTAGCAAACTCTTGCTTCGATTTTCTGGGGTACCTTTCAAGTG------TACCAAAAAGTACTTTGTTAGTAAGGAATCAAATGCTGGAGAATTTATTTCTAATAAATAC------TCGAATGAAAAAATTCGATACCATAGTTCCCGCTACTGCCCTCATAGGGTACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGCATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACAGACTTTGTATCGCCTAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTAG-CTCGTAAACATAAAAGCACGGTACGAACTTTTATGCAAC------GGTTGGGTTCGGCATTTTTAGAAGAATTTTTTACCGAAGAAGAGTTAGT------TTTTTCTTTGATGTTCACCAAAACAAGCCTTTTTTCTTTCCGTGGATCGCACAGTGAGCGTATTTGGTATTTTGATATTATACGTATCAACGACCTGGTAAAGCCTCTTAATTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Agrostis_scabra ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTC-GGCTGAGGGCACGCCTGCCT---GGGC-GTCACG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGACCCTGA-----CCAAAA-TAGACCG-TGCACGCGT--------CATCC-AGCCTGCCGG-CGGCGG------------------CTCCG--TCCGTCGCTCGGCCAA-GTCCTCG-------ACAACCTCCT-CTC------------CTCGAAGTGGG---GGC-T-----CGGGGT--AAAAGAACCCAC-GA-CGCCT-AAGGCGTC-AAGGAACACTG-----TGCCTAGCCCGGGG-ACGCGGACGG---CTTGCTGGCCGCC------CCCTGTGCTGCAATGC--TAT-TTAATCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAAAATTTCAAGGGTATTCAGAAAAACATAAATCTCGTCAACAATACTTTGTCTACCCACTTCTCTTTCAGGAGTATATTTATGCATTTGCCCATGATTATGGATTAAATGATTCAGAACCTGTGGAAATTGTT------------------AGTTGTAATAACAAGAAATTTAGTTCACTACTTGTGAAACGTTTAATTA------------CTCGAATGTATCAGCAGAATTTT------TGGATTAACTCGGTTAATCATCCTAACCAAGATCGATTG---------------TTGGATTACAAAATTGGTTTTTATTCTGAGTTTTATTCTCAGATTCTACCTGAGGGGTTTGCAATCGTTGTAGAAATCCCATTCTCGCTACGAGAATTATTTTGTCCGA--------------------AAGAAAAAGAAATACCAAAGTTTCAGAATTTACGCTCTATTCATTCAATATTTCCCTTTTTAGAAGACAAATTTTTGCATTTGGATTATCTTTCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTGCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCAAATTGGA------ATAGT---TTTATTAC------TTCAATGAAATCTATTT------------------TTCTTTTTAAA------AAAGAAAATAAAAG------ACTTTTTCGATTCTTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTCCTTACCATTATTATCTTCTGGAACTTTTCTGGAACGAATCATCTTTTCTAG---------------GAAGATG------GAACATTTT---------------------GGGATAATGTACCCGGGTTTTTTTCGGAAAACCATA------TGGTTCTTTATGGATCCTCTGATGCATTATATTCGCTATCAAGGAAAGGCAATTCTTGGATCAAAAGGAACTCATTTTTTGAACAAGAAATGGAAATGGT-ACCTTATCAAT---TTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAAT------CAATTAGCAAACTCTTGCTTCGATTTTCTGGGGTACCTTTCAAGTG------TACCAAAAAGTACTTTGTTAGTAAGGAATCAAATGCTGGAGAATTTATTTCTAATAAATAC------TCGAATGAAAAAATTCGATACCATAGTTCCCGCTACTGCCCTCATAGGGTACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGCATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACAGACTTTGTATCGCCTAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTAG-CTCGTAAACATAAAAGCACGGTACGAACTTTTATGCAAC------GGTTGGGTTCGGCATTTTTAGAAGAATTTTTTACCGAAGAAGAGTTAGT------TTTTTCTTTGATGTTCACCAAAACAAGCCTTTTTTCTTTCCGTGGATCGCACAGTGAGCGTATTTGGTATTTTGATATTATACGTATCAACGACCTGGTAAAGCCTCTTAATTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Agrostis_stolonifera ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTC-GGCTGAGGGCACGCCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTGACCCTGA-----CCAAAA-TAGACCG-TGCACGCGT--------CATCC-AGCCTGCCGG-CGGCGG------------------CACCG--TCCGTCGCTCGGCCAA-GTCCTCG-------ACAACCTCAT-CTC------------CTCGGAGTGGG---G-C-T-----CGGGGT--AAAAGAACCCAC-GA-CGCCT-AAGGCGTC-AAGGAACACTG-----TGCCTAGCCCGGGG-ACGCGGACGG---CTTGCTGGCCGCC------CCCCGTGCTGCAATGC--TAT-TTAATCCACACGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAAAATTTCAAGGGTATTCAGAAAAACATAAATCTCGTCAACAATACTTTGTCTACCCACTTCTCTTTCAGGAGTATATTTATGCATTTGCCCATGATTATGGATTAAATGATTCAGAACCTGTGGAAATTGTT------------------AGTTGTAATAACAAGAAATTTAGTTCACTACTTGTGAAACGTTTAATTA------------CTCGAATGTATCAGCAGAATTTT------TGGATTAACTCGGTTAATCATCCTAACCAAGATCAATTG---------------TTGGATTACAAAATTGGTTTTTATTCTGAGTTTTATTCTCAGATTCTACCTGAGGGGTTTGCGATCGTTGTAGAAATCCCATTCTCGCTACGAGAATTATTTTGTCCGA--------------------AAGAAAAAGAAATACCAAAGTTTCAGAATTTACGCTCTATTCATTCAATATTTCCCTTTTTAGAAGACAAATTTTTGCATTTGGATTATCTTTCACATATAGAAATACCCTATCCTATCCATTTTGAAATCTTGGTGCAACTCCTTCAATACCGTATCAAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCAAATTGGA------ATAGT---TTTATTAC------TTCAATGAAATCCATTT------------------TTCTTTTTAAA------AAAGAAAATAAAAG------ACTTTTTCGATTCTTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTCCTTACCATTATTATCTTCTGGAACTTTTCTGGAACGAATCATCTTTTCTAG---------------GAAGATG------GAACATTTT---------------------GGGATAATGTACCCGGGTTTTTTTCGGAAAACCATA------TGGTTCTTTATGGATCCTCTGATGCATTATGTTCGCTATCAAGGAAAGGCAATTCTTGGATCAAAAGGAACTCATTTTTTGAACAAGAAATGGAAATGGT-ACCTTATCAAT---TTTTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAAC------CAATTAGCAAACTCTTGCTTCGATTTTCTGGGGTACCTTTCAAGTG------TACCAAAAAGTACTTTGTTAGTAAGGAATCAAATGCTGGAGAATTTATTTCTAATAAATAC------TCGAATGAAAAAATTCGATACCATAGTTCCCGCTACTGCCCTCATAGGGTACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGCATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACAGACTTTGTATCGCCTAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTAG-CTCGTAAACATAAAAGCACGGTACGAACTTTTATGCAAC------GGTTGGGTTCGGCATTTTTAGAAGAATTTTTTACCGAAGAAGAGTTAGT------TTTTTCTTTGATGTTCACCAAAACAAGCCTTTTTTCTTTCCGTGGATCGCACAGTGAGCGTATTTGGTATTTTGATATTATACGTATCAACGACCTGGTAAAGCCTCTTAATTAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAGCAAGTGTTGGATTCCAAGCTGGT-GTTAAAGATTATAAATTGACTTACTACACCCCGGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAGCCTGGGGTTCCGCCGGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCTGTTGCTGGGGAAGACAACCAATGGATCTGTTATGTAGCTTATCCGTTAGACTTATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTCGGTAACGTATTTGGTTTCAAAGCCCTACGTGCTCTACGTCTGGAGGATCTACGAATTCCCCCTGCTTATGCAAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTATCTGCAAAAAATTACGGTAGAGCGTGTTATGAGTGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGCTGGAGAGACCGTTTTGTCTTTTGTGCCGAAGCT{AC}TTTATAAAGCACAAGCCGAAACCGGTGAAATTAAGGGGCATTACTTGAATGC{AG}ACTGCAGGTACATGTGAAGAAATGATTAAGAGAGCTGTATTTGCGAGAGAATTAGGGGTTCCTATTGTAATGCATGACTACATAACTGGGGGATTCACCGCAAATACTAGTTTGGCTCATTATTGCCGCGACAATGGCCTACTTCTTCACATTCACCGTGCAATGCACGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTATTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATCCACTCCGGTACAGTAGTAGGTAAGTTAGAAGGGGAACGCGAAATGACTTTAGGTTTTGTTGATTTATTGCGCGATGATTTTATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAGGACTGGGCATCCATGCCTGGTGTTATACCGGTAGCTTCGGGTGGTATTCATGTTTGGCATATGCCAGCTCTGACCGAAATCTTTGGGGATGATTCCGTATTACAATTTGGTGGAGGAACTTTAGGGCATCCTTGGGGGAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGTG--AAGGTAAGGAAATTATCC----------------------------------------------------------------------------------------------------------------------------------------- Allium -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Allium_cernuum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCATGACTCTTGGCAACGGATATCTAGG---CTCTCGCGTCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCA-GGTCGAGGGCACGTCTGCTT---GGGC-GTCACGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAGTCC-TCTTTATGAGAT----TGGAAA-CATGTGT-AGCTTTAC-----CCCATCGAGAAGAGAAGAGGCTAGTTTT----G------CAAGTGCACTT--CTACTTTCTAGATGGACGCCC--CTT-GCCGCCTC--TGGCTTGC------------TTCATTCGAGGCAAGA-AA-----GAGAGC--GGGAATAAGACCCCGGCGCGG-TTTGCGCC-AAGG-ACATTT------TTTGTTGGAGTGC--------------ATCGCCTTCGATT-------T--GTTGCGCGGTGCA-TCTTC--------TTACTAG-TGCGAGATTA--------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Allium_geyeri ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCATGACTCTTGGCAACGGATATCTAGG---CTCTCGCGTCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGCCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCC??A??CCATCA-GGTC?AGGGCACGTCTGCTT---GGGC-GTCAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAGTCCCTCTTTATGAGAT----TGAGAA-C--GTGT-AGCATTAC-----CC-ATCGAGAAC?A-----GCTAGTTTT----G------CAATTGCACTT--CTGCTTTCTAGATGGCTGTCT--TTTTGCCGCCTT--TGGCTTGC------------TTTACTCGAGGCAACA-AG-----GAAAGC--GGGAATAAGACCCCGGCGCGG-TTTGCGCC-AAGG-ACGGTT------GTTGTTGGAGTGC--------------ATCGCCTTCTTTT-------TTTGTTGCGCGGTGTG-TTCTC--------CTACTAG-TGTGAGAATA--------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Allium_triquetrum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCATGACTCTTGGCAACGGATATCTAGG---CTCTCGCGTCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAATCATCGAGTCTTTGAATGCAAGTTGCGCCTTAGACCATCA-GGTCAAGGGCACGTCTGCTT---GGGC-GTCACGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCAAGTCCCTCTTCAAGAGAT----TGAGAA-C--TTGT-AGCATTACA----CCCGTCGAGGAGGA-----GTTAGTTTT----G------CAACTGCAATT--CTGCTCTATAGATGGATGTCC--TTTTGCCGCATT--CTTCTTGC------------GATACTCGAGGCAAAGCAG-----GAGAAC--GGGAATAAGACCCCGGCGTTG-TCTGCGCC-AAGG-ATGGTT------GGTGTCGGAGTGC--------------ACCG---TTGCTT-------TATCTGGTACGGTGTAATCCTC--------TTACTAGGTTTGAGAATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTCAGATATACTAATACCTCATCCCATCCATATGGAAATCTCGGTTCAAATCCTTCAGTGCTGGATCCAAGATGTTCCCTTTTT--ACACTTATT------GCAATTCTTTCTTCACG-------AATACCATAATTGGA------GTAATCTCCCCATTAC------TCAGAAGAAATCTATTT------------------ATGTTTTTTCG------AAAGAAAATAAAAG------ATTCTTTTGGTTCCTATACAATTCTTATGTATTTGAATGCGAAATTTTATTAGTGATTATTCGTAAACAATCTTCTTATTTACGATTAACTTCTTTTAGAACTTTTATTGAGCGAATACATTTCTATGG---------------AAAAATA------GAACATCTTCAAATCGAACAT------TTTTTCGTAGTAGGTCATAACTATTTTCATAGAACTCTG------TGGTTCTTCAAAGACCCTTTCGTGCATTATGCTCGATATCAAGGAAAAGCAATTCTTGCTTCAAAGGGGACTCATTTTCTGATGAAGAAATGGAAATATC-ATTTTGTCAAT---TTTTGGCAATATTATTTTAACTTTTGGTCTCAACCATATAGGATCCATATAAAT------AAATTATCAAACTATTCTTTCTATTTTTGGGGTTATCTTGCAAGTT------TACTAAAAAATTCTTTGGCTATAAGGAATAAAATGTTAAAGAATTCGTATCTAATAGATAC------CATTACTAAGAAATTTGATACCATAATCCCAGTTATTCTTCTTATTGGATCCTTATCTAAAGCTAAAATTTGTACCATATCGGGCCATCCTATTAGTAAGCCAATCTGGGCTCATTTATCAGATTCTGATATTCTCGATAGATTTGGTCGAATATGTAGAAATCTTTCTCATTATTACT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Alnus_incana ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACCT-GGCCGAGGGCACGTCTGCCT---GGGT-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACC--TGCCC-AGCAGAA-CGACCC-GCGAACCTGTCACAACAACTGGGGGCGG---GGGGCGATC---------------TCGCGCCCCGCCCTCGAAC-GGCAGGA-AGACA--------------------------------------CTCGTGCCTTCC----------TGCCG--AACAACGTA-CCCCGGCGCGGT-CTGCGCC-AAGGAAC-ATGAACGA------AAGAG---TGCCTCCG-GTCGCCTCGGAAACGCTGCGCG-CA-CCGGAGGCGAATCTTGTCTAGAACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCTTCGCTATCGGGTGAAAGATGCCTCCTCTTT--CCATTTATT------GCGGTTCTTTCTTCATG-------AGTATTCTAATG------GTAA---TATTCTTATTATTCTAA------ATAAATCTATTT------------------CTATTTTTTCA------AAAAGTAATTCAAG------ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCGTTTTCCTTTTTATCCGTAACCAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAACGAATCTATTTACATAG---------------AAAAATG------GACGATCTTG------------TCGAAGT------CTTTGTTAATGATTTTCGGGGC---ATCTTA------TGTTTCCTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGATACGCCTCTTCTGATGAATAAATGGAAATATT-ACCTTGTCAGT---TTATGGCAATGTCATTTTTATGTATGGTCTCACCCAGGAAGGATCTATATAAA------CCAATTATCCAAGCATTCCCTCGACTTTTGGGGTTATTTTTCAAGTG------TGCCACTAAATCCTTCAATGGTGCAGAGTCAAATGCTAGAAAATTCATTTATAATAAATAA------TGCTCCCAAGAAGCTCGATACAATAGTTCCAATTATTCCTCTGATTGGATCATTGGCTAAAGCGAAATTTTGTAACGCATTAGGGCACCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGACATTATCAATCGATTTGTGCGTATATGCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGGT-GTTAAAGATTATAAATTGACTTATCATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTGCCGCCTGAGGAAGCAGGGGCAGCAGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCAGTTGCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGATTCAAGGCCCTGCGTGCTCTACGTCTGGAGGATTTGCGAATCCCTCCTGCTTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTAAACAAGTATGGCCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGATTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTCCGCG--------GTGGGCTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCAATTTATAAAGCGCAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCATCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATACACTTTCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACGCGGGTACCGTAGTAGGTAAACTTGAAGGGGAAAGAGAGATCACTTTAGGCTTTGTTGATTTACTACGTGATGATTATATTGAAAAAGATCGAAGCCGCGGTATTTATTTCACTCAAGATTGGGTCTCTCTACCTGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAAATCTTTGGAGATGATTCCGTACTACAATTCGGTGGAGGAACTTTAGGGCACCCTTGGGGAAATGCACCTGGTGCTGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTG--AGGGTAATGAAATTATTCGTGAGGCTGCTAAATGGAGTCCTGAGCTAGCTGCCGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATT------------------------------------------------------------------- Alopecurus_aequalis ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCT-GGCTGAGGGCACGCCTGCCT---GGGC-GTCACGCCAAATA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTGACCCTGA-----CCAAAA-CAGACCG-CGCACGCGT--------TATCT-AACTTGCCGG-TGGCGG------------------CACTG--TCCGTCGCTTGGCCAAAGTCCTCG-------ATAACCTTCT-CTT------------CTCGGAGAGGG---GGCCT-----CGGGGT--AAAAGAACCCAC-GG-CGCCG-AAGGCGTC-AAGGAACACTG-----TGCCTAACTCAGGG-ATGCGGCTGG---CTTGCTAGCCGCC------CCTCGTGTTGCAATGC--TAT-TTAATCCACATGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Alopecurus_alpinus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCT-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACGC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTCGTGACCCTGA-----CCAAAA-CAGACCG-CGCACGCGT--------TATCT-ACCTTGCCGG-CGGCGG------------------CACTG--TCCGTCGCTTGGCCAAAGTCCCCG-------ATAACCTCCT-CTC------------CTCGGAGCGGG---GGC-T-----CGGGGT--AAAAGAACCCAC-GG-CGCCG-AAGGCGTC-AAGGAACACTG-----TGCCTAACTCGGGG-ACGCGGCTGG---CTTGCTAGCCGCC------CCCCGTGTTGCAATGC--TAT-TTAATC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Alopecurus_geniculatus ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCT-GGTTGAGGGCACGCCTGCCT---GGGC-GTCACGCCAAATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCCTGA-----CCAAAA-CAGACCG-CGCACGCGT--------TATCT-AACTTGCCGG-TGGCGG------------------CACTG--TCCGTCGCTTGGCCAAAGTCCTCG-------ATAACCTTCT-CTT------------CTCGGAGAGGG---GGCCT-----CGGGGT--AAAAGAACCCAC-GG-CGCCG-AAGGCGTC-AAGGAACACTG-----TGCCTAACTCGGGG-ATGCGGCTGG---CTTGCTAGCCGCC------CCTCGTGTTGCAATGC--TAT-TTAATCCACATGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCAAATTGGA------ATAGT---TTTATTAC------TTCAATGAAATCCATTT------------------TTTTTTTTAAA------AAAGAAAATAAAAG------ACTATTTCGATTCCTATATAACTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTGGTAAACAATCTTCTTGCTTACCATTAGCATCTTCTGGAACTTTTTTGGAACGAATCCACTTTTCGAG---------------GAAGATG------GAACATTTT---------------------GGGATAATGTACCCTGGTTTTGTTAGGAAAACCATA------TGGTTTTTTATGGATCCTCTTATGCATTATGTTCGATATCAAGGAAAGGCTATTTTTGCATCAAAAGGAACTCTTTTTTTGAACAAAAAATGGAAATGGT-ACCTTATCCAT---TTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAAC------CAATTAGCAAACTCTTGCTTCGATTTTATGGGGTACCTTTCAAGTG------TACCAAAAAGTCCTTTGTTAGTAAGGAATCAAATGCTGGAGAATTGGTTTCTAATAGATAC------TCGAATGCAAAAATTAGATACCATAGTTCCCGTTACTACCCTCATAGGATACTTATCAAAAGCTCAATTTTGTACTGGATTGGGCCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGGATATGTAGAAATCTTTTTCATTATCATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGGT-GTTAAAGATTATAAATTGACTTACTACACCCCGGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAGCCTGGGGTTCCCCCGGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCTGTTGCTGGGGAAGACAACCAATGGATCTGTTATGTAGCTTATCCATTAGACCTATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTGGGTAACGTATTTGGTTTCAAAGCCCTACGTGCTCTACGTCTGGAGGATCTACGAATTCCCGTTGCTTATGCAAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAATTACGGTAGAGCGTGTTATGAGTGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTCTTTTGTGCCGAAGCTATTTATAAAGCACAGGCTGAAACAGGTGAAATTAAGGGGCATTACTTGAATGCGACTGCAGGTACATGTGAAGAAATGATTAAGAGAGCTGTATTTGCGAGAGAATTAGGGGTTCCTATTGTAATGCATGACTACATAACTGGGGGATTCACCGCAAATACTAGTTTGGCTCATTATTGCCGCGACAATGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTATTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATCCACGCCGGTACAGTAGTAGGTAAGCTAGAAGGGGAACGCGAAATGACTTTAGGTTTTGTTGATTTATTGCGCGATGATTTTATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAGGACTGGGTATCCATGCCAGGTGTTATACCGGTAGCTTCAGGTGGTATTCATGTTTGGCATATGCCAGCTCTGACTGAAATCTTTGGGGATGATTCCGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGTG--AAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTA------------------------------------------------------------------------------------------------------------ Alopecurus_pratensis ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAAAATTCGAAGGGTATTCAGAAAAACACAAATCTCGTCAACAATATTTTGTCTACCCACTACTCTTTCAGGAGTATATTTATGCATTTGCCCATGATTATGGATTAAATGATTCCGAACCTGTGGAAATTGTT------------------AGTTGTAATAACAAGAAATTTAGTTCACTACTTGTGAAACGTTTAATTA------------TTCGAATGTATCAGCAGAATTTT------GGGATTAACTCGGTTAATCATCCTAACCAAGATCGATTG---------------TTGGATTACAAAATTAGTTTTTATTCTGAGTTTTATTCTCAGATTCTATCTGAGGGATTTGCAATCGTTGTAGAAATCCCATTCTCGCTACGAGAATTACCTTGTTCGA--------------------AAGAAAAAGAAATACCCAAGTTTCAGAATTTACGCTCTATTCATTCAATATTTCCCTTTTTAGAAGACAAATTTTTGCATTTGGATTATTTATCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCAAATTGGA------ATAGT---TTTATTAC------TTCAATGAAATCTATTT------------------TTCTTTTTAAA------AAAGAAAATAAAAG------ACTATTTCGATTCCTATATAACTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAGACAATCTTCTTGCTTACCATTAGCATCTTCTGGAACTTTTTTGGAACGAATCCACTTTTCGAG---------------GAAGATG------GAACATTTT---------------------GGGATAATGTACCCTGGTTTTTTTAGGAAAACCATA------TGGTTTTTTATGGATCCTCTTATGCATTATGTTCGATATCAAGGAAAGGCTATTTTTGCATCAAAAGGAACTCTTTTTTTGAACAAAAAATGGAAATGGT-ATCTTATCCAT---TTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAAC------CAATTAGCAAACTCTTGCTTCGATTTTATGGGGTACCTTTCAAGTG------TACCAAAAAGTCCTTTGTTAGTAAGGAATCAAATGCTGGAGAATTCGTTTCTAATAGATAC------TCGAATGCAAAAATTAGATACCATAGTTCCCGTTACTACCCTCATAGGATACTTATCAAAAGCTCAATTTTGTACTGGATTGGGCCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGGATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACGGACTTTGTATCGACTAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTAG-CTCGTAAACATAAAAGCACGGTACGAACTTTTATGCAAC------GATTAGGTTCGGCATTTTTAGAAGAATTTTTTACCGAAGAAGAGATAGT------TTTTTCTTTGATGTTCACCAAAACAACCCTTTTTTCTTTCCGTGGATCGCACAGTGAGCGTATTTGGTATTTTGATATTATATGTATCAACGACCTGGTGAAGCCTCTTAATTAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAGCAAGTGTTGGATTTAAAGCTGGT-GTTAAAGATTATAAATTGACTTACTACACCCCGGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAGCCTGGGGTTCCCCCGGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTATAAAGGACGATGCTATCACATCGAGCCTGTTGCTGGGGAAGACAACCAATGGATCTGTTATGTAGCTTATCCATTAGACCTATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTGGGTAACGTATTTGGTTTCAAAGCCCTACGTGCTCTACGTCTGGAGGATCTACGAATTCCCGTTGCTTATGCAAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAATTACGGTAGAGCGTGTTATGAGTGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTCTTTTGTGCCGAAGCTATTTATAAAGCACAGGCCGAAACCGGTGAAATTAAGGGGCATTACTTGAATGCGACTGCAGGTACATGTGAAGAAATGATTAAGAGAGCTGTATTTGCAAGAGAATTAGGGGTTCCTATTGTAATGCATGACTACATAACTGGGGGATTCACCGCAAATACTAGTTTGGCTCATTATTGCCGCGACAATGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTATTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATCCACTCCGGTACAGTAGTAGGTAAGTTAGAAGGGGAACGCGAAATTACTTTAGGTTTTGTTGATTTATTGCGCGATGATTTTATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAGGACTGGGTATCCATGCCAGGTGTTATACCGGTAGCTTCAGGTGGTATTCATGTTTGGCATATGCCAGCTCTGACCGAAATCTTTGGGGATGATTCCGTATTACAATTTGGTGGTGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCGAATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGTG--AAGGTAATGAAATTATCCGAGAAGCTTGCAAATGGAGTCCTGAACTAGCCGCGGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGAGCCGGTAGATACTATTTAATAACTAGATAAAACTAAATATAAAGAAGGTC-------------- Alyssum_alyssoides ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCTTCT-GGCCGAGGGCACGTCTGCCT---GGGT-GTCAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAAACAGAA-CGACCCGTG-AACGAACGATCATCACTCCCGGCGGGCCGGTCTCCTAACAGAT--------TCCGTTGCCC--GCTGG-TTCCGTGGT-TTCGCGAACTGTTCCAGATTCGGACTCACGT--------CCGGATCCGGTCTTTGCGCGTTGCTTCCGGAC--TT-AACCAAACCACGGCACG-AAAAGTGTC-AAGGAACATGC-AACTGAA---CGGCT---C-GGCATTCGCGGCCCCGGAGACGG--TG-C--GTCCGCGGAT-----GCTCTGCTGGAAAATATAAAGTCTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Alyssum_desertorum ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCTTCT-GGCCGAGGGCACGTCTGCCT---GGGT-GTCAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAAACAGAA-CGACCCGCG-AACGAACGATCATCACTCCCGGCGGGCCGGTCTCCTAACAGAT--------TCCGTTGCCC--GCTGG-TTCCGTGGT-TTCGCGAACTGTCCCCGATTCGGGCTAACGT--------CCGGATCTGGTCTTTGCGCGTTGCTTCCGGAC--TT-AACCAAACCACGGCACG-AAAAGTGTC-AAGGAACATGC-AATTGAA---CGGCT---A-GGCATTCGCGGCCCCGGAGACGG--TG-T--GTCCG{CT}GGAT-----GCTATGCTGAAAAATCTAAAGTCTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Amborella_trichopoda ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGGAATTACGAGGATATTTAGAAATAGATAGACCCCATCAACAACGCTTCCTATATCCGCTTCTATTCCAGGAGTCTATCTATGCACTTGCTCATAATCATGGTTTAAATGGATCAATTCTTTACGAACCCA------TGGAAGATTTAGGTCATGACAAG------AAATCCAGTTCACTAAATGTAAAACGTTTAATTA------------TTCAAATGTATCAACAGAATCAT------TTCATCATTTCATTTAATGATTCTAACCAAAATAGATTT---------------------CTTGGGCATAGCAGGAATTCTTATTTTCA------AATGGTATCAGAGGGTTTTGCAGTAATTGTGGAAATTCCATTCTCGATGCGATTAGTATCTTCCCTAG-----------------AAAAAG---------GATCTGAATCTCATAATTTCCAATCTATCCATTCAATATTTCCGTTTCTAGAGGACAAACTTTCATATTTAAATTATGTGTTAGATATACTAATACCCCACCCAA?CCATCTGGAAATCTTGGTTCAAAGCCTTCGCCAATGGATACGAGACCTTTCTTCTTT--GCATTTATT------GCGGTTTTTTCTCCACG-------AACATCAGAAT------TGGAA---TAGTTTCATTA------CTACAAATACAAAGAAATGCAGTT------------CTTTTTTTTCA------AGAGAGAATCAAAG------ATTGTTTTTGTTCCTGTACAATTTTCATGTATATCAATTTGAATCCCTTTTCGTTTTCCTACGTAAACAATTTTTTCATTTACGGTCGATATCTTTTGGATCTTTTCTTGAACGAACACATTTCTATGG---------------AAAAATA------GAAAATTTTG------------TAGTATCC------ATGCGTAATCATTCTCAGAAT---ATTTTA------TGGTTGTTCAAGGACCTTTTCATGCATTATGTTAGATATAAAGGAAAATCAATTATGGCTTCAAGGGGTACTTATCTCCTTATGAATAAATGGAAATCTC-ACCTTGTCAAT---TTCTGGCAATTCCGTTTTTACTTCTGGTCTCAACCGGGCAGAATCCATATAAAT------GAATTATCCAATCATTCCTTCTATTTCCCGGGCTATCTTTCAGGTC------TACGATTAAATCCCTCGATGGTAAGGAGTGAAATGCTAGAGAATTCATTTATGATAGATGC------TG{GT}TATCAAGAGATTCGATACAGTAGTCCCAACTATTTTTCTTATTGGATCCTTGGCTAAAGTAAAATTATGTAACGTATCAGGGCATCCTATTAGTAAGTCGGTCTGGGCCGATTCGTCAGATTCTGATATTCTCGATCAATTTGGGCGGATATGCAGAAATCTCTCTCATTATCACAGTGGGTCCTACAAAAAACACAGTTTGTGTCGAATAAAATATATACTTCGACTTTCGTGTGCTAGAACTTTGG-CTCGTAAACATAAAAGCACGGTACGCGCAATTTTGAAAA------GATTAGGTTCGGAATTCTTGGACGAATTCCTTACGGAGGAACAAGAGAT------TCTTTCCTTGATTTTTCCAAAAACCCCTTT---------------CCATAGTGGACGAAT---TTGGTATTTGGATATTATCCGTATTCATAGTCTGGCCAATCAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGCTGGATTCAAAGCCGGT-GTTAAAGATTACAGATTGACTTATTATACTCCTGACTATGAAACCCTAGCTACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAGGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGTCGATGCTACCACATCGAACCCGTTGCTGGGGAACAAAATCAATATATTGCTTATGTAGCTTATCCTTTGGACCTTTTTGAGGAAGGTTCTGTTACTAACATGTTTACTTCCATCGTAGGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTCTAGAGGATCTGCGAATTCCTCCTGCTTATTCCAAAAGTTTCCAAGGCCCACCTCATGGCATCCAAGTCGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTAGGATGTACTATTAAACCAAAATTGGGGTTATCTGCCAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGTG--------GTGGGCTTGATTTTACCAAGGATGATGAGAATGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCCGAAGCTCTTTATAAAGCACAGGCAGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGGGCCGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGAGGATTCACTGCAAATACTAGTTTGGCCCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCATCGCGCAATGCATGCAGTTATTGATAGACAAAGGAATCATGGTATACACTTTCGTGTACTAGCTAAAGCATTGCGTATGTCTGGTGGGGATCATATTCACGCTGGTACCGTAGTAGGTAAACTGGAAGGGGAACGGGATGTCACTTTGGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCCGTGGCTTCAGGTGGTATTCACGTTTGGCATATGCCTGCCCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTCGGCGGAGGAACTCTGGGACACCCTTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTG--AAGGTAATGAAGTTATCCGTGAAGCTAGCAGGTGGAGCCCAGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATTCGAATTCGAAGCAATGGATGTCTTGTAA--------------------------------------------- Amelanchier_alnifolia --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTA-GGCCGAGGGCACGCCTGCCT---GGGC-GTCAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAA-CC--TGCAA-AGC{AG}GAG-CGACCC-GAGAACCAGTTTCAACGCCGGGGGT---CGG{CG}GG-CCTTCGG-----------GCTC--GGCGTCCCCCTGTCCCGGGAGT------------------------------------------------C{AC}G-------CTCC----CGGGCG--CACAAACGAACACCGGCGCGTG-CTGCGCC-AAGGAAC-{AC}CGAACGAA--AGAGCGC----GCTCCCGCCG---CCCCGGAAACGGTGCGCG-AGCGGG-C{AG}-C{AG}TCGTCTTCTTCAA-TATGTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------------------------------------GTTGGATTCAAAGCTGGT-GTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATTTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCACCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGACGGTCTTACCAGTCTTGATCGTTACAAAGGTCGATGCTACCACATCGAGCCTGTTGCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTGTTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTACTGCTTATGTTAAAACTTTCCAGGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGCCCTCTATTGGGATGTACTATAAAACCAAAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTACGCG--------GTGGACTTGATTTTACCAAAGATGATGAGAATGTTAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTAAACGCTACTGCAGGTACATGCGAAGAGATGATGAAAAGAGCTATATTTGCCAGAGAATTGGGGGTTCCAATCGTAATGCATGATTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATCGATAGACAGAAGAATCATGGTATACACTTTCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATACACTCTGGTACCGTAGTAGGTAAACTTGAGGGGGAAAGAGAGATTACTTTAGGCTTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGATCGAAGCCGCGGTATTTATTTCACTCAAGATTGGGTCTCTCTGCCAGGTGTTTTGCCTGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTTGGTGGCGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTG--AGGGTAATGAAATTATTCGTGAGGCTAGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATTCGAATTCGAAGCAATGGATACTTTGTAA--------------------------------------------- Amelanchier_utahensis --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCGAGTCTTTGAACGCA{AC}ATTGCGCCCGAAGCCGTTA-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAA-CC--TGCAA-AGCAGAA-CGACCC-GAGAACCAGTTTCAACGCCGGGGGT---CGGCGGGCCTTCGG-----------GCTC--GGCGTCCCCCTGTCCCGGGAGT------------------------------------------------CCG-------CTCC----CGGGCG--CACAAACGAACACCGGCGCGTG-CTGCGCC-AAGGAAC-CCGAACGAA--AGAGCGC----GCTCCCGCCG---CCCCGGAAACGGTGCGCG-AGCGGG-CG-CGTCGTCTTCTTCAA-TATGTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Anaphalis_margaritacea ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTT-GGTTGAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAG---AGCAGAA-CGACCCG-TGAACATGT-AACTACAACTGG--CAAATTAGGGATTGAG--------------CTTCTGTTC-----GATCCTTAGCTG--CC-TTGTCGATGT-GCGTTCGAGATTCCTT-------------ACGGATGATAGGATGTCACATTGACAT--ACTAACCAA-CCCCGGCACG-GAATGTGCC-AAGGAAATTTAAATTTTAGGAATGTA----AGTTTCATGATGTCCCGTTTTGCGG--TG----CACTATTGAAACTTTACTTCTTTGTAATGACAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGAAATTCCAAAGCTATTTAGGGCTAGATAGATCTCAACAACACTATTTCTTATATCCACTTATCTTTCAGGAGTATATTTATGTACTTGCTCATGATTATGGTTTAAATAGATCAATTT---TTTTG------------GAAAATTCAGGTTATGACAATAAATCCA------GCTTACTAATTGTGAAACGTTTAATCATTCG------------AATGTATCAACAGAATAAT------TTGATTCTTTCTGGTAATGATTCTAAACAGACTCCTCTT---------------------TTCGGGAACAACAAGAATTTTTATTCGCA------AGTAATGTCAGAGGTTTCTTCAATTATTATGGAAATTCCATTGTCTCTGCGATTAATATCTTCCCTAGAAAGG--------------AAA------GGGGTAGTTAAATCAGATAATTTACGATCAATTCATTCAATATTTTCTTTTTTAGAGGACAACTTTTCACATTTAATTTATGTATTAGATATATTAATACCTTACCCAGCTCATCTGGAAATCTTGGTTCAGGCTCTTCGCTATTGGATAAAAGATGCTTCCTCTTT--ACATTTTTT------AAGATTCTTTCTCCACG-------AATGTCA------TAATTGGGA---TAGTCTTATTACTTCAAATTCAAAGAAAGCCAGTTCTT---------------CTTTTTCAAAA---------AGAAATCACAG------ATTATTCTTTTTCCTATATACTTTTCATGTACGTGAATATGAATCTGGCTTCTTCTTTCTCCGTAACCAATCTTCTCACTTACGAGCAACATCTTCTGGAGCCCTTATTGAACGAATCCATTTCTATGG---------------AAAAATA------GAGCATCTTG------------CAGAAGTCTTTGC------CAGGGCTTTT-CAAGCG--AATTTT------TGGTTGTTCAAAGATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATCAATTATTGCTTCAAAAGGGACGTTTCTTTTGATGAATAAATGGAAATATT-ACTTTGTCAAT---TTCTGGAAATCCTATTTTTACCTGTGGTCTCAACCAGGAAGGATTTATATAAAC------GAATTATACAATCATTCCATTGACTTTCTGGGTTATCGTTCAAGT------GTGCGGCTAGAGCCTTCAATGATACGCAGTCAAATGCTAGAAAATTCATTTCTAATCGATAA------TGCTATTAAAAAGTTTGATACTCTTGTTCCAATTATACCTCTGATTAGATCATTGGCTAAATCAAAATTTTGTAACGCGTTGGGGCATCCTATTGGTAAGGCGATTTGGGCCGATTTTTCAGATTCTGATATTATTGAGCGCTTTGGGCGTATATACAGAAATCTTTCTCATTATCATAGTGGATCTTCAAAAAAAAAGAGTTTGTATCGAGTAAAGTATATACTTCGACTTTCTTGTGCTAGAACTTTAG-CTCGGAAGCATAAAAGTACTGTACGTGCTTTTTTGAAAA------GATTTGGTTCGGAATTATTAGAAGAATTCTTTACGGAAGAAGAACAGGT------TTTTTCCTTGACCTTTCCAAGAGTTTCTTCTATTTCGCGAAGGTTATCTAGAAGGCGGAT---TTGGTATTTGGATATT---ATTTGTATCAATGATTTGGCCAATCATGAATGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGTGTTGGATTCAAAGCAGGT-GTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACGAGCCTTGATCGTTACAAAGGACGATGCTATGGAATCGAGCCTGTTCCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTACGTTTGGAAGATTTGCGAATCCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGTG--------GTGGCCTTGATTTTACTAAGGATGATGAGAACGTGAACTCCCAACCATTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Androsace_chamaejasme ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGACTCTCGGCAACGGATATCTAGG---CTCTCGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTA-GGCCGAGGGCACGCCTGCCT---GGGC-GTCTCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACCTGCAT---AGCAGAA-CGACCCGTG-AACATGTTTTCAATTTGGAAAGGGGTCCGGAT{GT}GCCTCGGCCA----CCCGGGTGCCTTTC{CT}GGCAAAGGGGCGTGCCTGTCGTACCT-----------------------------------CACGGTCGCAGGCTCGCATTCCTGGCT--AAACAACGAACCCCGGCGCG-GACCGCGCC-AAGGAAATCTAACAAA--GAGATCCCG---TGCCT-----TGCCCCCGTTCGCGG---GCGG-CGAGGAGCGGTGGAAATCTTCAATATAACG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGGAATTCAAAAGATATTTAAAACTAGATAGATCTCAGCAGCACGACTTCCTATATCCGCTTATATTTCAGGAGTATATTTATGCACTTGCTCATGATCATAGTTTAACTAGATCCATTTCATTGGAAT---------TGGAAAAGGTAGGTTATAACAATAACTTCA------GCTTACTAATTGTGAAACGTTTAATTACTTATTTAATTACTCAAACGGATCGACAGAATCAT------TTGAG---------TACTGATTCTAACCAAAATCCATTT---------------------TTGGGGTACAACACAACTTTCTATTCTCA------AATTATATTAGACGGATTTGTAGTCGTTGTAGAAATTCCATTTTCTCTCCGAGTAATACCTTCCCTAAAAGGG--------------------AAAGAAATAGTCAAATCTCATAATTTACGATCAATTCATTCAATATTTCCTTTTTTAGAGGACAAATTTTCACATTTAAATTATGTGTTAGATCTAGTAATACCCCACTCTATCCATCTGGAAATATTGGTTCGAACTCTTCGCTACTGGGTAAAAGATGCTTCTTCTTT--GCATTTATT------ACGGGCTTTTCTTTACA-------AGTATCA------TAATTGGAC---GAGTCTTATTAC------TTCAAAGAAATCTAGTTTTT---------------CTTTTTCAAAA---------AGAAATAAACG------ATTATTATTTTTCTTATATAATTTTCATGTACATGAATATGAATCGATTTTCGCCTTTCTCCGCAATCAATCCGCTCATTTACAATCAAAATATTATAAACCTTTTCTTGACCGAATCCATTTCTATGA---------------AAAACGA------GACCA------------TTTTGTAGAAATATTTAG------TAAATATTTT-CAGGCC--ATTTTA------TGGTCGTTTAAGGATCCTGTCATGCATTATGTTAGGTATCAAGGAAAAGTCCTTTTGGCTTCAAAAGGGGCGTTTCTTTTGATGAATAAATGGAATTATT-ATCTTGTAAAT---TTCTGGCAATGTTATTTTTACATGTGGTCTAAACCAGAAAGGATCCATATAAAT------AAATTATCTAATCATTCCCTCGACCTTTTGGGATATCTTTCAAGT------GTGGGACTAAATTCTTCAATGGTCCGGAATCAAATGCTAGAAACTACATTTCTAATAGCTAA------TGCTAGTAAGAACTTAGATATGATCGTTCCAATTATTCCTCTTATTGGATCGTTGTCTAAAGCTAAATTTTGTAACCTATTAGGGCATCCCCTTAGTAAGCCAGTCTGGGCTGATTTATCCGATTCAGATATTATTGACCGATTTGGGCGTATATATAGAAATATTTCTCATTATTATAGTGGATCCTCAAAAAAAATGGGTTTGTATCGAATAAAGTATATACTTCGCCTTTCTTGTGCTAGAACTTTGG-CTCGTAAACACAAAAGTACGACACGCCTTCTTTTGAAAA------AAGTAGGCTCAGAAATTTTTGACGAATTCTTTATGGAAGAAGAGCTCAT------TTTTTCTTTGAACTTCCCAAAAGTTGCGTCTACTTCGAGAGGTTTATATAAAAGACATAT---TTGGTATTTGGATATTTTTTGTATCAATGATCTGGCCAATCATTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Androsace_filiformis ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGACTCTCGGCAACGGATATCTAGG---CTCTCGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTA-GGCCGAGGGCACGTCTGCCT---GGGC-GTCTCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACCTGCAC---AGCAGAA-CGACCCGCG-AACTTGTTCCAAACACG-AAAGGCGTCCGGTAGGCCTTGGCC-----TTCAGACGTCTTTCCGGCCAAGGGGCGAGCATGTTGTTCCT-----------------------------------CACGGACGCGGACCTGCATTCCTGGCC--AAACAACGAACCCCGGCGCG-GACCGCGCC-AAGGAAATATAACAAA--GAGATCACG---CGCCT-----TGCTACCGTTCGCGG---ATCGGCGAGGTACGGA---AGTCTTGCATATAACA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Androsace_septentrionalis ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAACGACTCTCGGCAACGGATATCTAGG---CTCTCGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTT-A-GGCCGAGGGCACGTCTGCCT---GGGC-GTCTCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGT-C---GGAAAAA-CGACCCGCG-AACACGTCTC-----TA-AAGGGC----GGAGGGCC---ACC-----CCCGGGTGTCCCGCCG-TCGCTGGGGGGGCGGG-----CCT-----------------------------------CACCG-------CCCGCCTTCCCGGCC--TAACA--CAACCCCGGCGCG-GACCGCGCC-AAGGAAATCAAACAGA--GACTTCACG---TGCCG-----TGCCCCCGTCCGCGG---GCCG-CACGGCGCGGAG--AATCTTGCGTATAACA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Anemone -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Anemone_cylindrica --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTCTCGGCAACGGATATCTCGG---CTCTTGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTTTGGCCGAGGGCACGCCTGCCT---GGGC-GTCACAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTGCTCAG------CAGAA-CGACCCG-TGAACACGTGAA---AAAAACCTACCATGCCCGGGGAGCGGG-----------------------------CTCCCGCCAGCGACCCGGTGCTGCAACAAAA-TTCGGCG------------CAACTGGCGTCAAGGAAAACTCACCGGAAG--CAAGGCGTCGGCTCGTT-------CGGCGC-CGTGTGTCCGA----ATACTCAAAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Anemone_narcissiflora --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACTCTCGGCAACGGATATCTCGG---CTCTTGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCCTA--GGCTTAGGGCACGTCTGCCT---GGGC-GTCACACACAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGATACCTGCTAAG------CAGAA-CGACCCG-CGAACAAGTGAA---AACAGCCAA--ACGCA-GGGGAACGGG------------------------------CTTGCCCCGCGACCCAGCAACAAATCAAAA-TCCGGCG------------CAGCTG-CGTCAAGGAAAACTTATAGGAAA--TAAGGGATC----CGT--------C----C-CAGAAATCCTA----ATACTCAAAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATGAGTTGTAAGGAGGGACTTATGTCACCACAAACAGAGACTAAAGCGAGTGTTGGCTTCAAAGCAGGT-GTTAAAGAGTACAAATTGAATTATTATACTCCTGAATATACACCAAAAGATACTGATACCTTGGCGGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGAGCTACTG-AGCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Angelica -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Angelica_ampla ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAAT--AGCAGAA-TGACCCGCT-AACACGTTAACAATTTGGGCGAGCGTCGGGGGGCCTC-------------GGTCTCCTGTCTGTGAATCCCTGGTAGGTGG--CCACT-----------------------------------CCCGGGTGGCCACTGGCC-TGCAAAAT--CATTC-G-------GGCGCG-GAATGCGCC-AAGGACC-TTAAAACT---GAATTGTG---CGTCC----GTATCCCGTT-AGCGGGCAACGG----CGTCATTCCAAAACAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Angelica_archangelica ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAAT--AGCAGAA-TGACCCGCT-AACACGTTAACAATTTGGGCGAGCGTCGGGGGGCCTC-------------GGTCTCCTGTCTGCGAATCCCTGGTAGGTGG--CCACT-----------------------------------CCCGGGTGGCCACTGGCC-TGCAAAAT--CATTC-G-------GGCGCG-GAATGCGCC-AAGGACC-TTAAAACT---GAATTGTG---CGTCC----GTATCCCGTT-AGCGGGCAACGG----CGTCATTCCAAAACAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGACGCTTCTTCTTT--ACATTTATT------AAGATTCTTTCTCCACG-------AGTATCG------TATTTGGAA---TA---------------CTCCAAATAAAGCCAGTTCTT---------------GTTTTTCAAAA---------ATAAATCAAAG------GTTTTTCTTCGTCCTATATAATTCTCATCTATGTGAATACGAATCCATCTTCGTCTTTCTTCGTAACAAATCTTCTCATTTATGCTCAACGTCTTCTGGAACCCTTCTTGAACGAATCTTTTTATATGG---------------AAAACTA------AAACATCTTGG------ACTTGTAGAAGCTTTTGC------TAAGGCCTTT-CAGGAC--AATCTA------TGGTTGTTTAAGGACCCTTTCATGCATTATATTAGTTATCAAGGAAAATCCATTCTCGCTTCAAAAGGGACGCCCCTTTTGATGAAAAAATGGATATATT-ATTTTGTCAAT---TTATGGAAATGTCATTTTTACCTATGGTCTCAGCCGGGACGGATCTGTATAAAC------CAATTATATAATCATTCCCTAGCTCTTCTGGGCTATCTATCAAGT------GCGCGACTAAACCCTTCAATGGTACGCAGTCAAATGCTAGAAAATGCATTTATAATTGATAA------TCCTATTAATAAGTTCGATACTCTTGTTCCAATTGTTCCTCTAATTGGATCATTGGCTAAAGCGAGATTTTGTAACGTATTGGGGCACCCTATTAGTAAGGCGGTTTGGACTGATTTATCAGATTCTGATATTGTTGTCCGATTTGGGCGTATCTGCAGAAATATTTCTCA?TATTATAGTGGATCCTCACAAAAAAAGAGTTTGTATCGAATAAAGTATATACT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGCTGCTACGGAATCGAGCCCGTTGCTGGAGAAGAAAATCAATTTATCGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCCGTTGCTTATGTTAAAACTTTCCAAGGACCGCCTCATGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Angelica_grayi ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAAT--AGCAGAA-TGACCCGCT-AACACGTTAACAATTTGGGCGAGCGTCCGGGGGCCTC-------------GGTCACCTGTCTGCGAATCCTTGGTAGGTGG--CCACT-----------------------------------CCCAAGTGGCCACCGGCC-TGCAAAAT--CATTC-G-------GGCGCG-GAATGCGCC-AAGGACC-TTAAAATT---GAATTGTA---CGTCT----GTATCCCGTTTAGCGGGCACCAG----CGGCATTCCAAAACAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Angelica_lignescens -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACGACTCTCGACAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTA-GGTTGAGGGCACGCCTGCCT---GGGT-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAAT--AGCAGAA-TGACCCGCT-AACACGTTAACAATTTGGGCGAGCGTCGGGGGGCCTC-------------GGTCTCCTGTCTGCGAATCCCTGGTAGGTGG--CCACT-----------------------------------CCCGGGTGGCCACTGGCC-TGCAAAAT--CATTC-G-------GGCGCG-GAATGCGCC-AAGGACC-TTAAAACT---GAATTGTA---TGTCC----GTATCCCGTT-AGCGGGCATCGG----CGTCATTCCAAAACAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCATGGTTTAA-TATAAATAGATCCGTTTTG------------TTGGAAAATGCAGGTTCTAATAAGTTCA------GCTTACTAATTGTGAAACGTGCAATTGAGCGAATG------TATCAGTATGAACAGAATCAT------TTGATTCTTTTTGCTAATGATTTTACCCAAAATACCTTT---------------------TTTGGGCGCAACAAAAATTTTAATTTTCA------AATGATATCAGAAGGATTTGCAGTCATTGTAGAAATTCCGTTTTATCTCCGATTATTATCTTCGCTAGAAAGG--------------------AAAGGAATAGTTAAATCTCATAATTTACGATCAATTCATTCAATATTCCCTTTTTTAGAGGACAAATTTTCACATTTAATTTATGTGTTAGAGATACTAATACCCTACCCAGTCCATCTGGAAATATTAGTTCAAACTCTTCGCTACTGGGTAAAAGACGCTTCTTCTTT--ACATTTATT------AAGATTCTTTCTCCACG-------AGTATCG------TATTTGGAA---TA---------------CTCCAAATAAAGCCAGTTCTT---------------GTTTTTCAAAA---------AGAAATCAAAG------GTTTTTCTTCGTCCTATATAATTCTCATCTATGTGAATACGAATCCATCTTCGTCTTTCTTCGTAACAAATCTTCTCATTTATGCTCAACGTCTTCTGGAACCCTTCTTGAACGAATCTTTTTATATGG---------------AAAACTA------AAACATCTTGG------ACTTGTAGAAGCTTTTGC------TAAGGCCTTT-CAGGAC--AATCTA------TGGTTGTTTAAGGACCCTTTCATGCATTATATTAGTTATCAAGGAAAATCCATTCTCGCTTCAAAAGGGACGCCCCTTTTGATGAAAAAATGGACATATT-ATTTTGTCAAT---TTATGGAAATGTCATTTTTACCTATGGTCTCAGCCGGGACGGATCTGTATAAAC------CAATTATATAATCATTCCCTAGCCCTTCTGGGCTATCTATCAAGT------GCGCGACTAAACCCTTCAATGGTACGCAGTCAAATGCTAGAAAATGCATTTATAATTGATAA------TCCTATTAATAAGTTCGATACTCTTGTTCCAATTGTTCCTCTAATTGGATCATTGGCTAAGGCGAGATTTTGTAACGTATTGGGGCACCCTATTAGTAAGGCGGTTTGGACTGATTTATCAGATTCTGATATTGTTGTCCGATTTGGGCGTATCTGCAGAAATATTTCTCATTATTATAGTGGATCCTCACAAAAAAAGAGT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGGG-GTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGCTGCTACGGAATCGAGCCCGTTGCTGGAGAAGAAAATCAATTTATCGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCCGTTGCTTATGTTAAAACTTTCCAAGGACCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCG--------GTGGACTTGATTTTACCAAAGACGATGAGAATGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCGGGTACATGTGAAGAAATGATGAAAAGGGCTATATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGATTACTTAACAGGGGGATTCACTGCAAATACTAGCTTAGCCCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACGCCGGTACCGTAGTAGGTAAACTTGAAGGGGAAAGAGACATCACTCTGGGCTTTGTCGATTTACTGCGTGATGATTTCATTGAAAAAGATCGAAGTCGCGGTATTTATTTCACCCAAGATTGGGTCTCTCTACCAGGTGTTCTACCCGTTGCTTCGGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGGGGCGTGATCTTGCTCGTG--AGGGGAATGAAATTATCCGTGAGGCTGCTAAATGGAGCCCCGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATT------------------------------------------------------------------- Angelica_pinnata ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------------------------------------------------------------------------------------------------------------------------TCGAA?CCTGCAAT--AGCAGAA-TGACCCGCT-AACACGTTAACAATTTGGGCGAGCGTCGGGGGGCCTC-------------GGTCCCCAGTCTGCGAATCCCTGGTAGGTGA--CCACT-----------------------------------CCCGGGTGGCCACCGGCC-TGCAAAAT--CATTC-G-------GGCGCG-GAATGCGCC-AAGTACC-TTAAAATT---GAATTGTA---CGTCT----GTATCCCGTT-AGCGGGCACCGG----CGTCATTCCAAAACAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Antennaria -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antennaria_anaphaloides -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antennaria_corymbosa -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antennaria_dioica ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAACCATTT-GGTTGAGGGCACGTCTGCCT---GGGC-GTCACAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAA---AGCAGAA-CGACCCG-TGAACATGT-AACTACAACCGGT-CAACTTAGGGATTGAG--------------CTTTTGTTT-----GATCCTTAGTTG--CCTTTGTCGATGT-GCGTTCGAAAGTCCTT-------------AGGGATGAGTGGACGTCACATCGGCAT--ACTAACCAA-CCCCGGCACG-GAATGTGCC-AAGGAAATATTAACTTAAAGAATGGAT---GGTTTCATGATGTCCCGTTTTGCGG--TG----ACCTAATGAAACTTTACTTCTTTATAATCACAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGAAATTCCAAAGCTATTTAGGGCTAGATAGATCTCAACAACACTACTTCTTATATCCACTTATCTTTCAGGAGTATATTTATGTACTTGCTCATGATTATGGTTTAAATAGATCCATTT---TGTTG------------GAAAATTCAGGTTATGACAATAAATCCA------GCTTACTAATTGTGAAACGTTTAATCATTCG------------AATGTATCAACAGAATAAT------TTGATTCTTTCTGTTAATGATTCTAAACAGACTCCTTTT---------------------TTCGGGAACAACAAGAATTTTTATTCGCA------AGTAATGTCAGAGGTTTCTTCAATTATTATGGAAATTCCATTGTCTCTGCGATTAATATCTTCCCTAGAAAGG--------------AAA------GGGCTAGTTAAATCCGATAATTTACGATCAATTCATTCAATATTTTCTTTTTTAGAGGACAACTTTTCACATTTAAATTATGTATTAGATATATTAATACCTTACCCAGCTCATCTGGAAATCTTGGTTCAGGCTCTTCGCTATTGGATAAAAGATGCTTCCTCTTT--GCATTTTTT------AAGATTCTTTCTCCACG-------AATGTCA------TAATTGGGA---TAGTCTTATTACTTCAAATTCAAAGAAAGCCAGTTCTT---------------CTTTTTCAAAA---------AGAAATCACAG------ATTATTCTTTTTCCTATATACTTTTCATGTACGTGAATATGAATCTGGCTTCTTCTTTCTCCGTAACCAATCTTCTCACTTACGATCAACATCTTCTGGAGCCCTTATTGAACGAATCCATTTCTATGG---------------AAAAATA------GAGCATCTTG------------CAGAAGTCTTTGG------CAGGGCTTTT-CAAGCG--AATTTT------TGGTTGTTCAAAGATCCTCTCATGCATTATGTTAGGTATCAAGGAAAATCAATTCTTGCTTCAAAAGGGACGTTTCTTTT????????????????????-??????????T---TTCTGGAAATCCTATTTTTACCTGTGGTCTCAACCAGGAAGGATTTATATAAAC------GAATTATACAATCATTCCATTGACTTTATGGGTTATCGTTCAAGT------GTGCGGCTAAAGCCTTCAATGATACGCAGTCAAATGCTAGAAAATGCATTTCTAATCGATAA------TGCTATTAAAAAGTTTGATACTCTTGTTCCAATTATACCTCTGATTAGATCATTGGCTAAATCAAAATTTTGTAACGCATTGGGGCATCCTATTGGTAAGGCGATTTGGGCCGATCTTTCAGATTCTGATATTATTGAGCGCTTTGGGCGTATATACAGAAATCTTTCTCATTATCATAGTGGATCTTCAAAAAAAAAGAGTTTGTATCGAGTAAAGTATATACTTCGACTTTCTTGTGCTAGAACTTTAG-CTCGGAAGCATAAAAGTACTGTACGTGCTTTTTTGAAAA------GATTCGGTTCGGAATTATTAGAAGAATTCTTTACGGAAGAAGAACAGGT------TTTTTCCTTGACCTTTCCAAGAGTTTCTTCTATTTCGCGAAGGTTATCTAGAAGGCGGAT---TTGGTATTTGGATATT---ATTTGGATCAATGATTTGGCCAATCATGAATGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTCAAAGCAGGT-GTTAAAGATTATAAATTGACTTATTATACTCCTGATTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACGAGCCTTGATCGTTACAAAGGACGATGCTATGGAATCGAGCCTGTTCCTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTACGTTTGGAAGATTTGCGAATCCCTACTGCGTATGTTAAAACTTTCCAAGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGCG--------GTGGACTTGATTTTAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Antennaria_media -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antennaria_microphylla ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAACCATTT-GGTTGAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAA---AACAGAA-CGACCCG-TGAACATGT-AACTACAACCGGT-CAACTTAGGGATTGAG--------------CTTTTGTTT-----GATCCTTAGTTG--CCCTTGTCGATGT-GCGTTTGAAAGTCCTT-------------AGGGATGATTGGACGTCACATCGGCAT--GCTAACCAA-CCCCGGCACG-GAACGTGCC-AAGGAAATATCAACTTAAAGAATGGAC---GGTTTCATGATGTCCCGTTTTGCGG--TG----ACCTAATGAAACTATACTTCTTTTTAATCACAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Antennaria_parvifolia -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antennaria_rosea -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antennaria_umbrinella -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Apocynum -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Apocynum_androsaemifolium ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCACATTTTAATTTGATGTTAGATATACAAATACCCCACCCCGTTCATCTGGAAATCTTGGTTCAAACCCTTCGCTATTGGGTAAAGGATGCCCCTTCTTT--GCACTTATT------ACGATTCTTTCTACGCG-------AGTATTG------TAATTGTAA---TAAAATTATTTC------TACAAAGAAACCCGGTTTTC---------------TTTTTTTAACAAA------AAAAAATCAAAG------ATTATTCTTCTTGTTATATAATTTTTATGTATGTGAATACGAATCTATTTTCGTCTTTCTCCATACCCAATCTTCTCATTTACGACCAACATCCTTTGGGGTCTTTCGTGAACGAATTTATTTCTATGG---------------AAAAATA------GAACATTTTG------------CCGAAGTCTTCGC------TAAGGATTTT-CCGACC--AACTTA------TGCTTGTTCAAATATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATCCATTCTGCTTTCAAGGGGGACGGCTCTTTTGATGAATAAATGGAAATCTT-ACCTTGTTAAT---TTTTGGCAATGTAATTTTGACTTGTGGGTTCACTCGCGAAGGGCCTATATAAAG------CAAGTGTACAATTATTCCCTTGACTTTATGGGTTATCTTTCAATT------GTTCGACAAACCCCCTTAACGGTACGGAGTCAAATGCTGAAAAATGCATTTCTAATTAAAAA------TCCTATTAATAAATTAGATACCCTTGTTCCAATTATTCCTCTGATCGGATCATTCGCTAAAGCGAAATTTTGTAATCTATTAGGACATCCCATTAGTAAGCCGGTTCGGACTGATTTATCAGATTCTGATATTATGGACAGATTTGGGCGTATATGCAGAAACCTTTCTCATTATTATAGTGGATCCTCCAAAAAAAAGAGTTTGTATCGAATAAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGTGT?GGATTCAAAGCCGGT-GTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACTAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTCCTGGCGAAGAAGATCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGCTTACTTCCATTGTAGGTAATGTGTTTGGGTTCAAAGCCCTACGCGCTCTACGTCTGGAAGATTTGCGAATCCCTCCGGCTTATGTTAAAACCTTCCAAGGCCCGCCTCATGGCATCCAGGTTGAGAGAGATAAATTGAACAAATATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCAGCTAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTGAACTCCCAACCGTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Apocynum_cannabinum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAACGACTCTCGGCAACGGATATCTAGG---CTCTCGCATCG-ATGAAGAACGTAGCAAACTGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTA-GGCCGAGGGCACGTCTGCCT---GGGC-GTCACG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCATTGTCGAATCCTGCAA---AGCAGA--CGACCCGCG-AACTCGTTC-TCT----TTCGGGCGTCGGGGTCCTTCC----C----CGCGCCCATCTCA---TCTCGGCCGGCCGGTG--CCCTCGG-----------------------------------GTTCCC---TGTCGTGC-CGAGAAACT--AAAAA-A-----TCGGCGCGGAAA-GCGCC-AAGGAATACGCAAAC---GGAATGCCC-----CCTCGTGGCTCGCCCGTTCGCGG--CGCGGGTCTCGGGG--AAAAGGCTCCATCGGAATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCAAAGATATTTCAGCTTGATAGATCTCACAACCCTGCTTTCTATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGCTCATGACCATAATTTAAACCGAGCTATTT---TGTTG------------GAAAATCCAGGTTATGACAATAAATCGA------GTTTCCTTATTGTGAAACGGTTAATTACTCG------------AATGTATCAACAGAATCAT------TTTCTTACTTCTGCTAATGATTCTAGCCAAAATCTATTT---------------------ATTGGGCGCAACAAAAATTTGTATTCTAA------AATGATATCAGAGGGATTTTCATTTATTGTGGAAATTCTGTTTTCTATGCGATTAATATCTTCTGAAGAACGG--------------AAAGG------GATATCCCAATCTCATAATTTACGATCAATTCATTCAATATTTCCTTTCTTAGAGGACAATTTTTCACATTTTAATTTTATGTTAGATATACAAATACCCCACCCCGTTCATCTGGAAATCTTGGTTCAAACCCTTCGCTATTGGGTAAAAGATGCCCCTTCTTT--GCACTTATT------ACGATTCTTTCTACGCG-------AGTATTG------TAATTGTAA---TAAAATTCTTTC------TTCAAAGAAACCCGGTTTTC---------------TTTTTGTTAAAAA------AAGAAATCAAAG------ATTATTCTTCTTGTTATATAATTTTTATGTATGTGAATACGAATCCATTTTCGTCTTTCTCCATAACCAATCTTCTCATTTACGACCAACATCCTTTGGGGTCCTTCGTGAACGAATCTATTTCTATGG---------------AAAAATA------GAACATTTTT------------CCGAAGTCTTCGC------TAAGGATTTT-CCGACC--AACTTA------TGCTTGTTCAAATATTCTTTCATGCATTATGTTAGGTATCAAGGAAAATCCATTCTGCTTTCAAGGGGGACGGCTCTTTTGATGAATAAATGGAAATCTT-ACCTTGTTAAT---TTTTGGCAATGTAATTTTGACCTGTGGGTTCACTCGCGAAGGGCCTATATAAAG------CAAGTGTACAATTATTCCCTTGACTTTATGGGTTATCTTTCAATT------GTGCGACTAACCCCCTTAACGGTACGGAGTCAAATGCTGAAAAATGCATTTCTAATTAAAAA------TCCTATTAAGAAATTAGATACCCTTGTTCCAATTATTCCTCTGATCAGATCATTCGCTAAAGCGAGATTTTGTAATCTATTAGGACATCCCATTAGTAAGCCGGTTCGGACTGATTTATCAGATTCTGAGATTATGGACAGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTATAGTGGATCTTCCAAAAAAAAGAGTTTATATCGAATAAAGTATATACTTCGACTCTCTTGTGCTAAAACTTTAG-CTCGAAAACACAAAAGTACTGTACGGGCTTTTTTGAAAA------GATTAGGTTCGGCATTTTTGGAAGAATTCTTCATGTCGGAAGAAGAAGT------ATTTTCTTTGACCTTTCCAAGAGTTTATTCTCTTTTTTTGGGGGTCTATAGAAGTCGGAT---TTGGTATTTGGATATTACTTGTATCAACGATCTGGCGAATCAGCAATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATTCAAAGCCGGT-GTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACTAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTCCTGGCGAAGAAGATCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGCTTACTTCCATTGTAGGTAATGTGTTTGGGTTCAAAGCCCTACGCGCTCTACGTCTGGAAGATTTGCGAATCCCTCCGGCTTATGTTAAAACCTTCCAAGGACCGCCTCATGGCATCCAGGTTGAGAGAGATAAATTGAACAAATATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGTTTATCAGCTAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGTG--------GTGGACTAGATTTTACCAAAGATGATGAAAACGTGAACTCACAACCGTTTATGCGTTGGAGAGATCGTTTCTTGTTTTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACCGGCGAAATCAAAGGGCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Aquilegia -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Aquilegia_canadensis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAACGACTCTCGGCAACGGATATCTCGG---CTCTTGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAGGCCTTCT-GGTCGAGGGCACGTCTGCCT---GGGC-GTCACGC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCAGAA-CGACCCG-CGAACACGTGAAAACAACCCTGCAGGGGTCCGGGGAGGGGCGCGAG------CCCCCGACCGAT-CCCTTCGTCGTTCCGCGGCCCCGACCGCA---------------------------------TGCGGTCGTCCGTGG--TCCGACAC--AAACCAAAAACCCGG-CGCAA-TTGGCGTC-AAGGAAATCTTA-----GCGGAAAC-AAGGCCTAGCCCTGC---TTG-----CGGG------GCGAAGT-CGCGAATCCGATATT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTCCCATTTAAATCATGTATTAGATATACTAATACCCTATCCTATCCACCCGGAACTATTGGTTCAAACCCTTCGCTGTTGGATACAAGATGCCTCCCTTTT--ACACTTATT------GAGATTCTTTCTCTACG-------AGTATCATAATCATAATTGGAA---TAGTCTTATTA------CTCAAAA---AACGAAAATGCATT------------TTTCA------------AAAGAGAATCAAAG------ATTCTTCTTGTTCCTATATAATTTTCATGTATATGAATCGGAATCCATATTTGTGTTTCTCCGTAAACAATCTTATTATTTACGATCAACATCTTCTAGAGCTTTTCTTGATCGAACACATTTTTATGG---------------AAAAATA------GAACATTTTC------------TGGCGGTT------TTTCATAAAGATTTTCCTATT---ACCCTG------TGGTTGTTCAAGGATCCTTTCGTGCATTATTTCAGATATCAAGGAAAATCAATTCTATCTTCAAAAGGAACTCCTCTTCTGATGAAGAAGTGGAAATATT-ACCTTATAAAT---TTATGGGAATCCCATTTTTCCTTTTGGTCTCAATCGGATCGGATTCATATAAAC------CAATTATCCAATAATTGGATCGATTTTTTGGGCTATCTTTCAAGTG------TACGACCAAATCTTTCCGTGGTAAGGAGTCAAATGTTAGAAAATGGATTTCTTATAGATAT------TTCTATTAATAAGTTGGATCCTATAGTTCCAATTATTCCTTTGATTGGATCGTTGGCTAAAGCGAAATTTTGTAACTTATCTGGGCATCCCATTAGTAAGCCGGCTTGGGCCGATTCATCGGATTCTGATATTATCAATCGATTTGGTCGGATATGCAGAAATGTTTCTCATTATTACAGCGGATCCTCGAAAAAAAAGAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAGTTCCACCTGAAGAAGCAGGGGCTGCTGTAGCTGCTGAATCTTCTACAGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACAATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTTGTTATGTAGCCTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCGCTGCGCGCTCTACGCCTGGAGGATCTGCGAATTCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCCAAATTGGGATTATCTGCTAAGAACTACGGTA{AG}AGCGGTTTATGAATGTCTCCGGG--------GTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAGCCCTTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCGGAAGCACTTTATAAAGCACAAGCCGAAACAGGTGAAATCAAAGGACATTATTTGAATGCTACTGCGGGTACGTGCGAAGAAATGATAAAAAGAGCTGTATTTGCCAGAGAATTGGGAGTACCCATCGTAATGCACGACTACCTCACGGGTGGATTCACCGCAAACACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCCGTTATTGATAGACAGAAGAATCATGGTATACATTTCCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCAGGTACCGTAGTAGGTAAACTAGAAGGGGAAAGAGAGATCACCTTGGGCTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTACTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTCTACCCGTTGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTAACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCGCCGGGTGCCGTAGCTAATCGAGTAGCCCTAGAAGCCTGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTG--AAGGTAATGAAATTATCCGTGAGGCTTGCAAATGGAGCCTTGAACTAGCCGCTGCTTGCGAAATATGGAAGGAAATCAAATT------------------------------------------------------------------------- Aquilegia_coerulea ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGAAGGAATTACAATTACAAGGATATTTAAAGATAGATATATCTCGAGAACGAGACTTCCTATATCCACTTCTCTTTCAGGAATACATTTATGCACTTGCTCACGACCCTGGATTA------AATAAACGGATTCCTTATGAACCTATGGAAAGTTTAGGTTATGACAATAAATATA------GTTCACTAATTGTTAAACGTTTAATTA------------CTCGAATGTATCAACAAAAGTAT------TTGATTATTTTGGCTAATGATTGTAATCCAAATAAATTTGTTG---------------GGCATAAGAA------AAATTTGGATTCTCA------AATGATATCCGAGGGGTTTGCAGTCATTGTGGAAATTCCATTCGCACTGCGATTAGTATCTTCTCTAG--------------AAAGTAAAGAAATAGCCA------AATCCATTAATTTACAATCAATTCATTCCATATTTCCTTTTTTAGAGGATAATTTATCCCATTTAAATCATGTATTAGATATACTAATACCCTATCCTATCCACCCGGAACTATTGGTTCAAACCCTTCGCTGTTGGATACAAGATGCCTCCCTTTT--ACACTTATT------GAGATTCTTTCTCTACG-------AGTATCATAATCATAATTGGAA---TAGTCTTATTACTC---------AAAAAACGAAAA------------------TGCATTTTTCA------AAAGAGAATCAAAG------ATTCCTCTTGTTCCTATATAATTTTCATGTATATGAATCGGAATCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Aquilegia_ecalcarata ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAACGACTCTCGGCAACGGATATCTCGG---CTCTTGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAGGCCTTCT-GGTCGAGGGCACGTCTGCCT---GGGC-GTCACGC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCAGAA-CGACCCG-CGAACACGTGAAAACAACCATGTAGGGGTCCGGGGAGGGGCGCGAG------CCCCCGACCGAT-CCCTTCGCCGTTCCGCGGCCCCGACCGCA---------------------------------TGCGGTCGTCCGTGG--TCCGGCAC--AAACCAAAAACCCGA-CGCAA-TTGGCGTC-AAGGAAATCTTA-----GCGGAAAC-AAGGCCTAGCCCTGC---TTG-----CGGG------GCGAAGT-CGCGAATCCGATATT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTGCTCACGACCCTGGATTAAATAAACGGATTCCTTATGAACCTA------TGGAAAGTTTAGGTTATGACAAT------AAATATAGTTCACTAATTGTTAAACGTTTAATTA------------CTCGAATGTATCAACAAAAGTAT------TTGATTATTTTGGCTAATGATTGTAATCCAAATAAATTT---------------------GTTGGGCATAAGAAAAATTTGGATTCTCA------AATGATATCCGAGGGGTTTGCAGTCATTGTGGAAATTCCATTCGCACTGCGATTAGTATCTTCTCTAG-----------------AAAGTAAA---GAAATAGCCAAATCCATTAATTTACAATCAATTCATTCCATATTTCCTTTTTTAGAGGATAATTTATCCCATTTAAATCATGTATTAGATATACTAATACCCTATCCTATCCACCCGGAACTATTGGTTCAAACCCTTCGCTGTTGGATACAAGATGCCTCCCTTTT--ACACTTATT------GAGATTCTTTCTCTACG-------AGTATCATAATCATAATTGGAA---TAGTCTTATTA------CTCAAAA---AACGAAAATGCATT------------TTTCA------------AAAGAGAATCAAAG------ATTCTTCTTGTTCCTATATAATTTTCATGTATATGAATCGGAATCCATATTTGTGTTTCTCCGTAAACAATCTTATTATTTACGATCAACATCTTCTAGAGCTTTTCTTGATCGAACACATTTTTATGG---------------AAAAATA------GAACATTTTC------------TCGCGGTT------TTTCATAAAGATTTTCCTATT---ACCCTG------TGGTTGTTCAAGGATCCTTTCGTGCATTATTTCAGATATCAAGGAAAATCAATTCTATCTTCAAAAGGAACTCCTCTTCTGATGAAGAAGTGGAAATATT-ACCTTATAAAT---TTATGGGAATCCCATTTTTCCTTTTGGTCTCAATCGGATCGGATTCATATAAAC------CAATTATCCAATAATTGGATCGATTTTTTGGGCTATCTTTCAAGTG------TACGACCAAATCTTTCCGTGGTAAGGAGTCAAATGTTAGAAAATGGATTTCTTATAGATAT------TTCTATTAATAAGTTGGATCCTATAGTTCCAATTATTCCTTTGATTGGATCGTTGGCTAAAGCGAAATTTTGTAACTTATCTGGGCATCCCATTAGTAAGCCGGCTTGGGCCGATTCATCGGATTCTGATATTATCAATCGATTTGGTCGGATATGCAGAAATGTTTCTCATTATTACAGCGGATCCTCGAAAAAAAAGAGTTTGTATCGAATAAAGTATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAAGCGGGT-GTTAAAGATTACAAACTGAATTATTATACTCCGGAATATGCACCCAAAGATACTGATACCTTGGCGGCATTCCGAGTAACTCCTCAACCGGGAGTTCCACCTGAAGAAGCAGGGGCTGCTGTAGCTGCTGAATCTTCTACAGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTTGTTATGTAGCCTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCGCTGCGCGCTCTACGCCTGGAGGATCTGCGAATTCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCCAAATTGGGATTATCTGCTAAGAACTACGGTAGAGCGGTTTATGAATGTCTCCGGG--------GTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAGCCCTTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCGGAAGCACTTTATAAAGCACAAGCCGAAACAGGTGAAATCAAAGGACATTATTTGAATGCTACTGCGGGTACGTGCGAAGAAATGATAAAAAGAGCTGTATTTGCCAGAGAATTGGGAGTACCCATCGTAATGCACGACTACCTCACGGGTGGATTCACCGCAAACACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCCGTTATTGATAGACAGAAGAATCATGGTATACATTTCCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCAGGTACCGTAGTAGGTAAACTAGAAGGGGAAAGAGAGATCACCTTGGGCTTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTACTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTCTACCCGTTGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTAACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCGCCGGGTGCCGTAGCTAATCGAGTAGCCCTAGAAGCCTGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTG--AAGGTAATGAAATTATCCGTGAGGCTTGCAAATGGAGCCTTGAACTAGCCGCTGCTTGTGAGGTATGGAAGGAGATCAAATTCGAATTTGAAGCAATGGATACTTTGTAA--------------------------------------------- Aquilegia_elegantula ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAACGACTCTCGGCAACGGATATCTCGG---CTCTTGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAGGCCTTCT-GGTCGAGGGCACGTCTGCCT---GGGC-GTCACGC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCAGAA-CGACCCG-CGAACACGTGAAAACAACCCTGCAGGGGTCCGGGGAGGGGCGCGAG------CCCCCGACCGAT-CCCTTCGTCGTTCCGCGGCCCCGACCGCA---------------------------------TGCGGTCGTCCGTGG--TCCGACAC--AAACCAAAAACCCGG-CGCAA-TTGGCGTC-AAGGAAATCTTA-----GCGGAAAC-AAGGCCTAGCCCTGC---TTG-----CGGG------GCGAAGT-CGCGAATCCGATATT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGAAGGAATTACAATTACAAGGATATTTAAAGATAGATATATCTCGAGAACGAGACTTCCTATATCCACTTCTCTTTCAGGAATACATTTATGCACTTGCTCACGACCCTGGATTA------AATAAACGGATTCCTTATGAACCTATGGAAAGTTTAGGTTATGACAATAAATATA------GTTCACTAATTGTTAAACGTTTAATTA------------CTCGAATGTATCAACAAAAGTAT------TTGATTATTTTGGCTAATGATTGTAATCCAAATAAATTTGTTG---------------GGCATAAGAA------AAATTTGGATTCTCA------AATGATATCCGAGGGGTTTGCAGTCATTGTGGAAATTCCATTCGCACTGCGATTAGTATCTTCTCTAG--------------AAAGTAAAGAAATAGCCA------AATCCATTAATTTACAATCAATTCATTCCATATTTCCTTTTTTAGAGGATAATTTATCCCATTTAAATCATGTATTAGATATACTAATACCCTATCCTATCCACCCGGAACTATTGGTTCAAACCCTTCGCTGTTGGATACAAGATGCCTCCCTTTT--ACACTTATT------GAGATTCTTTCTCTACG-------AGTATCATAATCATAATTGGAA---TAGTCTTATTACTC---------AAAAAACGAAAA------------------TGCATTTTTCA------AAAGAGAATCAAAG------ATTCTTCTTGTTCCTATATAATTTTCATGTATATGAATCGGAATCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Aquilegia_vulgaris ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAACGACTCTCGGCAACGGATATCTCGG---CTCTTGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAGGCCTTCT-GGTCGAGGGCACGTCTGCCT---GGGC-GTCACGC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCAGAA-CGACCCG-CGAACACGTGAAAACAACCCTGCAGGGGTCCGGGGAGGGGCGCGAG------CCCCCGACCGAT-CCCTTCGCCGTTCCGCGGCCCCGACCGCA---------------------------------TGCGGTCGTCCGTGG--TCCGGCAC--AAACCAAAAACCCGA-CGCAA-TTGGCGTC-AAGGAAATCTTA-----GCGGAAAC-AAGGCCTAGCCCTGC---TTG-----CGGG------GCGAAGT-CGCGAATCCGATATT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTAGATATACTAATACCCTATCCTATCCACCCGGTAATCTTGGTTCAAACCCTTCGCTGTTGGATACAAGATGCCTCCCTTTT--ACACTTATT------GAGATTCTTTCTCTACG-------AGTATCATAATCATAATTGGAA---TAGTCTTATTA------CTCAAAA---AACGAAAATGCATT------------TTTCA------------AAAGAGAATCAAAG------ATTCTTCTTGTTCCTATATAATTTTCATGTATATGAATCGGAATCCATATTTGTGTTTCTCCGTAAACAATCTTATTATTTACGATCAACATCTTCTAGAGCTTTTCTTGATCGAACACATTTTTATGG---------------AAAAATA------GAACATTTTC------------TGGCGGTT------TTTCATAAAGATTTTCCTATT---ACCCTG------TGGTTGTTCAAGGATCCTTTCGTGCATTATTTCAGATATCAAGGAAAATCAATTCTATCTTCAAAAGGAACTCCTCTTCTGATGAAGAAGTGGAAATATT-ACCTTATAAAT---TTATGGGAATCCCATTTTTCCTTTTGGTCTCAATCGGATCGGATTCATATAAAC------CAATTATCCAATAATTGGATCGATTTTTTGGGCTATCTTTCAAGTG------TACGACCAAATCTTTCCGTGGTAAGGAGTCAAATGTTAGAAAATGGATTTCTGATAGATAT------TTCTATTAATAAGTTGGATCCTACAGTTCCAATTATTCCTTTGATTGGATCGTTGGCTAAAGCGAAATTTTGTAACTTATCTGGGCATCCCATTAGTAAGCCGGCTTGGGCCGATTCATCGGATTCTGATATTATCAATAGATTTGGCCGGATATGCAGAAATGTTTCTCATTATTACA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGGT-GTTAAAGATTACAAACTGAATTATTATACTCCGGAATATGCACCCAAAGATACTGATACCTTGGCGGCATTCCGAGTAACTCCTCAACCGGGAGTTCCACCTGAAGAAGCAGGGGCTGCTGTAGCTGCTGAATCTTCTACAGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTTGTTATGTAGCCTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCGCTGCGCGCTCTACGCCTGGAGGATCTGCGAATTCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCCAAATTGGGATTATCTGCTAAGAACTACGGTAGAGCGGTTTATGAATGTCTCCGGG--------GTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAGCCCTTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCGGAAGCACTTTATAAAGCACAAGCCGAAACACGTGAAATCAAAGGACATTATTTGAATGCTACTGCGGGTACGTGCGAAGAAATGATAAAAAGAGCTGTATTTGCCAGAGAATTGGGAGTACCCATCGTAATGCACGACTACCTCACGGGTGGATTCACCGCAAACACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCCGTTATTGATAGACAGAAGAATCATGGTATACATTTCCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCAGGTACCGTAGTAGGTAAACTAGAAGGGGAAAGAGAGATCACCTTGGGCTTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTACTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTCTACCCGTTGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTAACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCGCCGGGTGCCGTAGCTAATCGAGTAGCCCTAGAAGCCTGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTG--AAGGTAATGAAATTATCCGTGAGGCTTGCAAATGGAGCCTTGAACTAGCCGCTGCTTGTGAGGTATGGAAGGAGATCAAATTCGAATT------------------------------------------------------------------- Arabis -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Arabis_drummondii -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCT-GGCCGAGGGCACGTCTGCCT---GGGT-GTCACAAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACCTGTCA-AAAACAGAA-CGACCCGCG-AACAAACGATCACCACTCGCGGTGGGCTGGTTTCTTAGCCGAT--------CCCTT-GCCC--GCCGGTATCCGTGGT-TTCGCGTACCGTCCCG-ATCGGGAGCTTAAT--------CTCTGTCTGG-TCGTGCGCGTTGCTTCCGGAT--AT-CACCAAACCCCGGCACA-AAAAGTGTC-AAGGAACATGC-AACCGAA---CGGCC-----GGTATTCGCCTCCCCGGAGACGG--TG-T--GTGCGCGGAT-----GCTGAGCTGCGA--TCTAAAGTCTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGAAATTTCAA------GGATATTTAGAGTTCGATGGGGCTCGGCAACAGAGTTTTCTATATCCACTTTTTTTTCGGGAGTATATTTATGTACTTGCTTATGATCATGGTTTAAATAGATTAAATAGAAATCGCTCTATTTTCTTGGAAAATCCGGATTATGACAAAAAATATA------GTTCACTAATTGTGAAACGCTTAATTT------------TGCGAATGTATGAACAGAATCGT------TTGATTATTCCCACTAAGGATTTGAACCAAAAT---------------------CCCTTTTTGGGGCATACCAGTCTTTTCTATTATCA------AATGATATCTGTTTTATTTGCAGTGATTGTAGAAATTCCATTTTCCCTAAGATTAGGATCCTCTTTCC--------------AAGGAAAACAATTAAAAA------AATCTTATAATTTACAATCAATTCATTCAATATTTCCCTTTTTAGAAGACAAATTAGCATATTTTAATTATGTGTTAGATGTACTAATACCTTACCCCATCCATCTAGAAATCTTGGTTCAAACCCTACGTTACCGGGTAAAAGATGCCTCTTCTTT--GCATTTTTT------TCGGTTCTGTTTATACG-------AGTATTGTAAT------TGGAA---GAATTTTAATATTCAAA------AAAAAT------------------------CAATTTT---------------GAATCCAAG------ATTTTTCTTGTTCTTATATAATTCTCATGTATGTGAATACGAATCCATCTTTTTTTTTCTACGCAAGCAGTCTTCGCATTTACGATCGACATCTTATGAAGTCCTTTTTGAGCGAATTTTATTCTATGG---------------AAAAATA------CAACATTTTT------------TGAAAG------TTTTTGTTAATAATTTTCCGGCG---ATCCTA------GGGTTGCTCAAGGATCCTTTCATACATTATGTTAGATATCACGGAAGATGCATTCTAGCAACAAAAGATACTCCGCTTCTGATGAATAAATGGAAATATT-ATTTTGTTAAT---TTATGGCAATGTTATTTTTCTGTATGGTTTCAATCGCAAAAGGTCAATATAAA------TCAATTATCAAAAGATAATTTAGAGTTTCTGGGTTATCTGTCAAGTT------TGCGATTAAACCCTTTAGTGGTACGTAGTCAAATGCTAGAAAACTCATTTCTAATAGATAA------TGTTAGAATCGAATTGGATAGCAAAATTCCAATTTCTTCTATTATTGGATCATTGGCTAAAGATAAATTTTGTAATGTATTAGGGTATCCCATTAGTAAAGCGACCTGGACGGATTCATCAGATTCTGATATTCTCAACCGATTTGTGCGTATATGCAGAAATATTTCTCATTATTACAGCGGATCTTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGTCTTTGTTGTGTTAAAACTTTGG-CTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAG---GTTGGGCTCGGGT---TTATTGGAAGAATTCCTTACGGGGGAAGACCAAGT------TCTTTCTTTAATCTTCCCAAGAAGTTATTATGCTTCTAAAAGATTATATCGAGTGCGAAT---TTGGTATTTGGATATTCTTTATCTTAATGATTTGGTCAATCATGAATAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Arabis_fendleri ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCG-GGCCGAGGGCACGTCTGCCT---GGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACCTGTCA-AAAACAGAA-CGACCCGCG-AACAAACGATCACCACTCGCGGTGGGCTGGTTTCTTAGCCGAT--------CCCTT-GCCC--GCCGG-ATCCGTGGT-TTCGCGTACCGTCCCG-ATCGGGAGCTTTAT--------CTCGGTCTGG-TCGTGCGCGTTGCTTCCGGAT--AT-CACCAAACCCCGGCACG-AAAAGTGTC-AAGGAACATGC-AACCGAA---CGGCC-----GGTATTCGCCTCCCCGGAGACGG--TG-T--GTGCGCGGAT-----GCTGAGCTGCGA--TCTAAAGTCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGAAATTTCAA------GGATATTTAGAGTTCGATGGGGCTCGGCAACAGAGTTTTCTATATCCACTTTTTTTTCGGGAGTATATTTATGTACTTGCTTATGATCATGGTTTAAATAGATTAAATAGAAATCGCTCCATTTTCTTGGAAAATCCGGATTATGACAAAAAATATA------GTTCACTAATTGTGAAACGCTTAATTT------------TGCGAATGTATGAACAGAATCGT------TTGATTATTCCCACTAAGGATTTGAACCAAAAT---------------------CCCTTTTTGGGGCATACCAGTCTTTTCTATTATCA------AATGATATCTGTTTTATTTGCAGTGATTGTAGAAATTCCATTTTCCCTAAGATTAGGATCCTCTTTCC--------------AAGGAAAAAAATTAAAAA------AATCTTATAATTTACAATCAATTCATTCAATATTTCCCTTTCTAGAAGACAAATTAGCATATTTTAATTATGTGTTAGATGTACTAATACCTTACCCCATCCATCTAGAAATCTTGGTTCAAACCCTACGTTACCGGGTAAAAGATGCCT?TTCTTT--GCATTTTTT------TCGGTTCTGTTTATACG-------AGTATTGTAAT------TGGAA---GAATTTTAATATTCAAA------AAAAAT------------------------CAATTTT---------------GAATCCAAG------ATTTTTCTTGTTCTTATATAATTCTCATGTATGTGAATACGAATCCATCTTTTTTTTTCTACGCAAGCAGTCTTCGCATTTACGATCGACATCTTATGAAGTCCTTTTTGAGCGAATTTTATTCTATGG---------------AAAAATA------CAACATTTTT------------TGAAAG------TTTTTGTTAATAATTTTCCGGCG---ATCCTA------GGGTTGCTCAAGGATCCTTTCATACATTATGTTAGATATCACGGAAGATGCATTCTAGCAACAAAAGATACTCCGCTTCTGATGAATAAATGGAAATATT-ATTTTGTTAAT---TTATGGCAATGTTATTTTTCTGTATGGTTTCAATCGCAAAAGGTCAATATAAA------TCAATTATCAAAAGATAATTTAGAGTTTCTGGGTTATCTGTCAAGTT------TGCGATTAAATCCTTTAGTGGTACGTAGTCAAATGCTAGAAAACTCATTTCTAATAGATAA------TGTTAGAATCGAATTGGATAGCAAAATTCCAATTTCTTCTATTATTGGATCATTGGCTAAAGATAAATTTTGTAATGTATTAGGGTATCCCATTAGTAAAGCGACCTGGACGGATTCATCAGATTCTGATATTCTCAACCGATTTGTGCGTATATGCAGAAATATTTCTCATTATTACAGCGGATCTTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGTCTTTGTTGTGTTAAAACTTT?G-CTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAG---GTTGGGCTCGGGT---TTATTGGAAGAATTCCTTACGGGGGAAGACCAAGT------TCTTTCTTTAATCTTCCCAAGAAGTTATTATGCTTCTAAAAGATTATATCGAGTGCGAAT---TTGGTATTTGGATATTCTTTATCTTAATGATTTGGTCAATCATGAATAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Arabis_glabra ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTAT-GGCCGAGGGCACGTCTGCCT---GGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGATACCTGTCC-GAAACAGAA-CGACCCGCG-AACCAACGATCACCACTCGCGGTGGGCCGGTTTCCTTGCCGAT--------CCCGT-GCCC--GCCGG-ATCCGTGGTATTCGCGTACGGTCCCG-GTCGAGAGCTCTTT--------CTCGGTCTGG-TCGTGCGCGTTGCTTCCGGAT--AT-CACAAAACCACGGCACG-AAAAGTGTC-AAGGAACATGC-AACAGAA---CGGCC-----AGCATTCGCCTCCCCGGAGACGG--TG-T--GTGCGCGGAT-----GCTGAGCTGCGA--TCTAAAGTCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGATAAATTTCAA------GGATATTTAGAGTTCGATGGGGTTCGGCAACAGAGTTTTCTATATCCACTTTTTTTTCGGGAGTATATTTATGTACTTGCTTATGATCATGGTTTAAATAGATTAAATAGAAATCGCTCTATTTTCTTGGAAAATACGGATTATGACAAAAAATATA------GTTCACTAATTGTGAAACGCTTAATTT------------TGCGAATGTATGAACAGAATCGT------TTGATTATTCCCACTAAGGATTTGAATCAAAAT---------------------TCCTTTTTGGGGCATACCAGTCTTTTCTATTATCA------AATGATATCTGTTTTATTTGCAGTGATTGTAGAAATTCCATTTTCCCTAAGATTAGGATCCTCTTTTC--------------AAGGAAAACAATTAAAAA------AATCTTATAATTTACAATCAATTCATTCAATATTTCCCTTTTTAGAAGACAAATTAGCACATTTTAATTATGTGTTAGATGTACTAATACCTTACCCCATCCATCTCGAAATCTTGGTTCAAACCCTACGTTACCGGGTAAAAGATGCCTCTTCTTT--GCATT?TTT------TCGGTTCTGTTTATACG-------AGTATTGCAAT------TGGAA---GAATTTTTATAAAAAAA------AAAAAC------------------------CAATTTT---------------GAATCCAAG------ATTTTTCTTGTTCTTATATAATTCTCATGTATGTGAATACGAATCCATCTTTTTTTTTCTACGCAAGCGGTCTTCGCATTTACGATCGACATCTTATGAAGTTCTTTTTGAGCGAATTTTATTCTATGG---------------AAAAATA------CAACATTTTT------------TAAAAG------TTTTTGTTAATAATTTTCCGGCG---ATCCTA------GGGTTGCTCAAGGATCCTTTCATACATTATGTTAGATATCACGGAAGATGCATTCTGGCAACAAAGGATACGCCGCTTCTGATGAATAAATGGAAATATT-ATTTTGTTAAT---TTATGGCAATGTTATTTTTCCGTATGGTTTCAATCGCACAAGGTCAATATAAA------TAAATTATCTAAAGATAATTTAGAGTTTCTGGGTTATCTGTCAAGTT------TGCGATTAAACCCTTTAGTGGTACGTAGTCAAATGCTAGAAAACTCATTTCTAATAGATAA------TGTTAGAATAAAATTGGATAGCAAAATTCCAATTTCTTCTATTATTGGATCGTTGGCTAAAGATAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAAGCGACCTGGACGGATTCATCAGATTCTGATATTCTCAACCGATTTGTGCGTATATGCAGAAATATTTCTCATTATTACAGCGGATCTTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGTCTTTGTTGTGTTAAAACTTTGG-CTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAG---GTTGGGCTCGGGT---TTATTGGAAGAATTCCTTACGGGGGAAGACCAAGT------TCTTTCTTTAATCTTCCCAAGAAGTTATTATGCTTCTAAAAGATTATATCGAGTGCGAAT---TTGGTATTTGGATATTCTTTATCTTAATGATTTGGTCAATCATGAATAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCTAGGAGAAGAAACTCAATTTATTGCGTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCGGTTACTAACATGTTTACCTCGATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGGCTGCTCTACGTCTAGAGGATCTGCGAATTCCTCCTGCTTATACTAAAACTTTCCAAGGACCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGACGTCCCCTATTAGGATGTACTATTAAACCAAAATTGGGGTTATCCGCGAAGAACTATGGTAGAGCAGTTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAGAATGTTAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAATCACAGGCTGAAACAGGTGAAATCAAAGGGCATTATTTGAATGCTACTGCGGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGTTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCACGCTGTTATTGATAGACAGAAGAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCTTTACGTCTATCTGGTGGAGATCATGTTCACGCGGGTACAGTAGTAGGTAAACTTGAAGGAGACAGGGAGTCAACTTTGGGCTTTGTTGATTTACTGCGCGATGATTATGTTGAAAAAGATAGAAGCCGCGGTATCTTTTTCACTCAAGATTGGGTCTCACTACCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGATTCTGTACTACAATTCGGTGGAGGAACTTTAGGCCACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAACCGAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Arabis_hirsuta ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCTTTT-GGCCGAGGGCACGTCTGCCT---GGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACCTGTCC-AAAACAGAA-TAACCCGCG-AACAAATGATCATCACTCTCGGTTGGCCGGTTTCTTGACCGAT--------CCTGC-GCCT--GCCGA-TTCCGTGGT-TTCGCGTATTGAGCAT-ATCAAGATT-------------TCTTGGTCGGATCATGCGCGTAGCTTCCGGAT--AT-CACAAAACCCCGGCACG-AAAAGTGTC-AAGGAACATGC-AACTAAG---CAGCC-----TGCCTTTGCCGCCCCGGAGACGG--TG-T--GTGTGCTTAA-----GCTGTGCTGCAA--TATAAAGTCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGAAATTTCAA------GGATATTTAGAGTTCGATGAGGCACGGCAACAGAGTTTTCTATATCCACTTTTTTTTCGGGAGTATATTTATGTACTTGCTTATGATCACGGTTTAAATAGATTAAATAAAAATCGCTCTATTTTCTTGGAAAATGCGGATTATGCCAAAAAATATA------GTTCACTAATTGTGAAACGTATAATTT------------TGCGAATGTATGAACAAAATCGT------TTTATTATTCCCACTACGGATTTGCACAAAAAT---------------------CCCTTTTTGGGGCATACCAATCTTTTGTATTATCA------AATGATATCTGTTTTATTTGCAGTGATTGTAGAAATTCCGTTTTCCCTAAGATTAGGATCCTCTTTCG--------------AAGGAAACCAATTAAAAA------AATCTTATAATTTACAATCAATTCATTCAATATTTCCCTTTTTAGAAGACAAATTATCACATTTCAATTATGTGTTAGATGTACTAATACCTTACCCGATTCATCTAGAAATCTTGGTTCAAACCCTACGTTACCGGGTAAAAGATGCCTCTTCTTT--GCATTTTTT------TCGGTTCTGTCTATACG-------AGTATTGCAAT------TGGAA---GAATTTTGATATTAAAA------AAAAAT------------------------GCATTTT---------------GAATCCAAG------ATTTTTATTGTTCTTATATAATTCTCATATATGTGAATACGAATCCATCTTTTTTTTTCTACGCAAGCGGTCTTCTCATTTACGATCGACAGCTTATGAAGTCTTTTTTGAGCGAATTTTATTCTATGG---------------AAAAATA------CAAAATTTTT------------TAAAAG------TCTTTGTTAATAATTTTCCATCG---ACCCTA------GGGTTGCTCAAGGATCCTTTCCTACATTATGTTAGATATCACGGAAAAAGTATTCTGGCAACAAAGGATACGCCGCTTCTGATGAATAAATGGAAATTTT-ATTTTGTTAAT---TTATGGCAATGTTATTTTTCCATATGGGTTCAATCGCAAAAGGTCAATATAAA------TCAATTATCTAAAGATAATTTAGAGTTTCTGGGTTATCTGTCAAGTT------TGCGATTAAATCCTTTAGTGGTACGTAGTCAAATGCTAGAAAACTCGTTTCTAATAGATAA------TATTAGAATCAAATTGGATAGCAAAATTCCAATTTCTTCGATTATTGGATCGTTGGCTAAAGATAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAAGCGACCTGGACAGATTCGTCAGATTCTGATATTCTCAACCGATTTGTGCGTATATGCAGAAACATTTCTCATTATTACAGCGGATCTTCAAAAAAAAAGAATTTGTATCGAATAAACTATATACTTCGTCTTTGTTGTGTTAAAACTTTGG-CTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAG---GTTGGGCTCGGGT---TTATTGGAAGAATTCCTTACGGGGGAAGACCAAGT------TCTTTCTTTAATCTTCCCAAGAAGTTATTCTGTTTCTAAAAGATTATATCGAGTGCGGAT---TTGGTATTTGGATATTCTTTATCTTAATGATTTGGTCAATCATGAATAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Aralia_nudicaulis -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTA-GGCCGAGGGCACGTCTGCCT---GGGC-GTCACG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACCTGC-AC--AGCAGAA-CGACCCGCG-AACACGTTACAACACCGGGTGAGGGACGAAGGGTGCGCAA----------GCTCCCCAAGTCGCGAACCCATGGCCGGGGA-CCGCCC-----------------------------------TTCGGGTGTTCCTCGTCCGAACAACGA--CCCCC-C-------GGCGCG-GAATGCGCC-AAGGAAA--TCAAACT---GAACTGCA---CGCAT----CCCCCCCGTT-CGCGGGCGGCGGAG-GCGTCTTTCTAAAACACA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTCACATTTCATTTATGTTTTAGAGATACTAATACCCTACCCAGTCCATCTGGAAATCTTGGTTCAAACTCTTCGCTACTGGGTAAAAGATGCTTCTTCTTT--GCATTTATT------ACGATTCTTTCTCCACG-------AGTATTG------TAATTGGAA---TA---------------CTCCAAATAAAGCCGGTTCTT---------------CTTTTTCAAAA---------AGAAATCAAAG------ACTATTCTTCTTCCTATATAATTCTCATCTATGTGAATACGAATCCATCTTCATCTTTCTCCGTAACCAATCTTCTCATTTACGCTCAACATCTTCTGGAACCCTTCTTGAACGAATATATTTCTATGG---------------AAAAATA------AAATATCTTG------------TAAAAGTCTTTGT------TAAGGCTTTT-CAAGTC--AATCTA------TTGTTGTTGAAGGATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATCAATTCTCGCTTCAAAAGGGACGCCCTTTTTGATGAAAAAATGGACATATT-ACTTTGTTAAT---TTATGGCAATGTCATTTTTACCTGTGGTCTCAACCGGGAAGGATCTGTATAAAC------CAATTATACAATCATTCCCTCGACCTTCTGGGCTATCTATCAAGT------GCGCGGCTAAACCCTTCAATGGTACGCGGTCAAATGCTAGAAAATTCATTTCTAATTGATAA------TGCTATTACTAAGTTCGATACTATTGTTCCAATTATTCCTCTGATTGGATCATTGGCTAAAGCGAAATTTTGTAACGTATTGGGACATCCTATTAGTAAGGCGGTTTGGACCGATTTATCAGATTCTGATATTATTGACCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATCATAGTGGATCCTCACAAAAAAAGAGTTTGTATCGAATAAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGTGTTGGATTCAAAGCTGGT-GTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGACCCCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAAAATCGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGTG--------GTGGACTTGATTTTACCAAAGACGATGAGAACGTGAACTCCCAACCATTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Arctostaphylos uva-ursi' ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAACGACTCTCGGCAACGGATATCTCGG---CTCTTGCATCG-ATGAAGAACGCAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCC-ATTAGGTTGAAGGCACGTCTGCCT---GGGC-GTCACGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATGCCAAGCAGAAAGA-----CCTGCGAACATGTTATGTATACTTATGGAAAA---AATTGAGCGG-------------TGGACCTAGTTGTCG--CCTTCTATTTGTTCCTTCTCA--AG-TGGGTGCAAG------------GTCCTTCTGGAAACTTGTTC-ATTCACTTGTCA--AATAAC-GAAACCCGGCGCA-AACCGCGCC-AAGGAAAATCTTGGAAAAAA--ATGCA---TGC--CTACAC----CCATTCGT-GGGATGT---G---GCGCTCGCA-TATTTCGTAAAAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGGAATTCAAAAGAGATTTAGAACTAGATAGATCTCAGCAACACGACTTCATATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGCTCATGATCGTGGTTTAAATAGATCTATTG---TTTTA------------GAAAATCCGGGTTATGACAATAAATCTA------GCTTACTAATTGTGAAACGTTTAATTATTCATTTAATTACTCAAATGTATCAACAGAATCAT------TTTCTTTTTTCTGCTAATGATTCTAACAAAAAAAAAATT---------------------GTGGGGTACAACACAAATTTTTATTCGCA------AATGATATTC?AAGGATTTGCAGTCGTTGTGGAAATTCCATTTTCTCTAC?ATTACTATCTTCCCTAGAAGGG--------------AAA------GAAATAGTAAAATCTCAAAATTTCCAATCAAT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--?????TATT------ACGATTTTTCCTCCACG-------CGTATCA------TAATTGGAA---TAGTCTTAT------GACTCAAAAGAAATCTAGTTTTT---------------CTTTTTCAAAA---------AAAAATAAAAG------ATTATTCTTGTTCCTATATAATTTTCATGTATGTGAATATGAATCTATCTTCGTTTTTCTCCGCAACCAATCTTCTCATTTACGTTCAATATCTTCTGAAACCTTTCTTGAACGAATATATTTCTATAG---------------AAAAATA------GAAC------------------TA?AAGTCTTTAC------TAAGGATTTT-AAGGCT--ATTCTA------TGGGTGTTCAAA?ATCCTTTCCTGCATTATGTTAGGTATCAAGGAAAATCCACTTTGGCTTCAAAAGGGACGTCTCTTTTAATGAATAAATGGAAATATT-ACCTTGTCAAG---TTCTGGCAATGTTATTTTTACATGTGGTCTCAACCAAGAAGGATCCATATAAAC------CAATTATCCAATGATTCCCTCGACTTTCTGGGCTATCTTTCAAGT------GTGCGATTAAACCCTTTAATGGTACGGAGTCAAATGCTAAAAAATGCATTTCTAATAGGGAA------TGCTTTTAA?AAGTTCGATACCCTAGTGCCAATTATTCCAATGATTGGATCATTGTCTAAAGCGAAATTTGGTAACGTCTTAGGACATCCCATGAAT?AATCAGTCTGGGCTGATTTATCAAATCCTGATATTATGGACCGATTC?GGCGT?TATTTAGAAATCTTTCTCATTATCATAGCGGATCCTTAAAAAAAATGAGTTTGTATCGAGTAAAGTATATACTTCGACTTTCTTGTGCTAGAACTTTGG-CTCGTAAACACAAAAGTACGGTACGTGCTTTTTTGAAAA------GATTAGGAGTGGGATTATTGGAAGAATTTTTTACGGAGGAAGAACAAGT------TTTTTATTTGACCTTCCCAAAAGCTTCTTCTAGTTCAGGGGAGTTATATAGAAGGCGGAT---TTGGTATTTGGATATT---ATTTGTATCAATGAGCTGGCAAATCATTCATGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTGACTTATTATACTCCTAAATATGAAACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCCGCGGTAGCTGCAGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACTAGCCTTGATCGTTACAAAGGGCGATGCTATCACATCGAGCCTGTTCCTGGAGACGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCCGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTACGAATCCCTCCTGCGTATTCTAAAACTTTCCAAGGGCCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCAAAATTGGGGTTATCTGCTAAAAACTATGGGCGAGCAGTTTATGAATGTCTCCGTG--------GTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTTTAAAGCACAAGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGAGCTGTATTTGCCAGAGAATTAGGAGTTCCTATCGTAATGCATGACTATTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCCGTTATTGATAGACAGAAGAATCATGGTATCCATTTTCGTGTACTAGCTAAAGCGTTACGTATGTCTGGCGGAGATCATATCCACTCTGGTACCGTAGTAGGTAAACTTGAAGGTGAAAGAGACATCACTTTGGGCTTTGTTGATTTACTGCGTGATGATTTTATTGAAAAAGATCGAGCCCGCGGTATTTATTTCTCTCAAGATTGGGTCTCTCTACCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCCTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTG--AGGGTAATGAAATTATCCGCGAGG----------------------------------------------------------------------------------------------------------------------------------- Arenaria_fendleri -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Arenaria_hookeri -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Arenaria_serpyllifolia -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTT--GGCCGAGGGCACGTCTGCCT---GGGC-GT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTCGAAACC--TGCCC-AGCAGAG-CGACCA-GCGAACATGTTT-AACTCTCTCGGGTGCAGGGGGA--TGTGG--------GTAGCTTTG----CTCCT----ACTCCTCCCGCGCTTGAGCCGGGGTGT-A-------------GGCCTCTT---GTGGGCTTCCTCCTTGGC---------A--TCTCAACGAACCCCGACGTGAAA-AGCGTC-AAGGAACATAAACAACA--TATGAGCT---TGCTCTTGCTGCCCGGTTAGC-CGGTGCACGTA--GGTGTAGGGCCATGTCATA-ACATTA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGATGCCCCGTCTTT--ACATTTATT------ACGATTCTTTCTTTATC-------AGTATCAT------AATTCCAA---TACTCTTATTAT------TCCAAAAAAATTGATTTC------------------CATTTTTAGAAA------AAAGAATCAAAA------ATTTTTCTTGTTCTTATATAACTTTTATGTATGTGAATACGAATCCATTTTCTTTTTTTTTTGCAACCAATTCTCTCATTTAAGATCAACATCTTACAAAGCTCTTCTTGAACGCATTTATTTCTATGG---------------AAAATTA------GAACATTTAG------------TTAATCTT------TTGACTAAAGATTTT-AGCGTT--ATCTTA------TGGTTTTTCAAAGACCCCTCCCCCCATTCTGTTAGATATAAAGGAAAATCCATTATAGCCTCAAAAGGGACATCCCTTTTGATCCAGAAATGGAAATTTT-ATCTTATTCAT---TTCTGGCAATGTTATTTTTCTGTGTGGTCTCAACCAAGAAGAATATATATTAAT------CGATTATCAACCCATTTTCTTGACTTTATGGGTTTTCTTTCAAGT------GTACAACTCACTTTTTCTGTGGTACGGAATCAAATGTTAGAAAATGCCTTTATAATCGATAA------TACGATTAAGAAGTTCGATCCAAAAATTTCAATTAGTCCTCTGATCATATCGTTGGCTAAAGCGAAATTTTGTAACGTATTGGGGCATCCTATTAGTAAGTCGATTTGGATCGATTTATCGGATTCTGATATTATTGATCGATTTGGTCGTATATGCGTAAATCTTTCTCATTATTATAGTGGCTCTTCAAGAAAAAAGAGTTTGTATCGACTAAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGTGTTGGATTTAAAGCTGGT-GTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAAACCCTGGATACTGATATCTTGGCAGCATTCCGAGTAACGCCTCAACCTGGAGTTCCGCCCGAAGAAGCAGGGGCCGCAGTAGCCGCCGAATCTTCTACTGGTACATGGACAACTGTATGGACCGACGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATTTGTTATGTAGCTTATCCCTTAGACCTTTTTGAGGAAGGCTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCTTGCGTGCTCTACGCTTGGAGGATTTGCGAATCCCTGTTGCTTATATAAAAACTTTCCAGGGCCCGCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTATTGGGATGCACTATTAAACCAAAATTGGGGTTATCCGCTAAAAACTATGGGCGAGCAGTTTATGAATGTCTTCGCG--------GTGGACTTGATTTTACTAAAGATGA{GT}GAAAACGTGAACTCCCAACCATTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Arenaria_tetraquetra ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCC-TCT-GGCTGAGGGCACGTCTGCCT---GGGC-GT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCAAAACC--TGCCC-AGCAGCA-TGACCA-GCGAACACGTTC---TATACTCGGTTGTGGAGCGC--TGTCG--------GGTGTCTTGTG--CACTC----GCTCGCTCCACGATCG-GCCGGGGGG----------------TCTCTCTT---GAG{AT}GACC--ACCCTAGC---------A--CAACAACAAAACCCGGCGCGAAA--GCGTC-AAGGAAAATAACTTCAA--TGTGTGCA---ACC-TCCCATGCCAGGTAATT-CCGGGCACG----GGTGTGATGCCATGTAATA-ACAATAAACGACTCTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGATACCCCGTCTTT--ACATTTATT------ACGATTCTTTCTTTATG-------AGTATCAT------AATTCCAA---TACTATTATTAT------TCAAAAAAATTTGATTTC------------------AATTTTTATAAA------AAGGAATCAAAA------ATTTTTCTTGTTCTTATATAACTTTTATGTATGTGAATACGAATCCATTTTCTTTTTTTTTTGCAACCAATCCTCTCATTTAAGATCAACATATTACAAAGCTCTTCTTGAACGCATTTATTTCTATGG---------------AAAATTC------GAACATTTAG------------TTAATCTT------TTGACTAAAGATTTT-AGCGTT--ATCTTA------TGGTTTTTCAAAGACCCCTCCCCCCATTCTGTTAGATATAAAGGAAAATCCATTATGGCCTTAAAGGGGACATCCTTTTTGATCCAGAAATGGAAATTT--ATCTTATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Arnica -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Arnica_chamissonis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCT-GGTTGAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAT---AGCAGAA-CGACCTG-TGAACACGT-A-CAACAACATGG-CCTAAAGAGGACCGGA---TC--------ATTGTTTTT------GGTCCTCGTTAA--GCTACGTCGACATTGTGTTTATGATCTCCTT------T--T--TAGGGCTCATGGACATCATGTTGGCAC--AACAACAA-CCCCCGGCACA-ACATGTGCC-AAGGAAAACCA-AACTTAAGAAG-GCC---TGTGGCATGAC-ACCCCGTTTCTGG--TGGT--GCTCATTGTTTTTTGGCTTCTTTCAAATCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Arnica_cordifolia ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCT-GGTTGAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCGT---AGCAGAA-CGACCCG-TGAACACGT-A-CAACAACATGG-CCTAAAGAGGACCGAT---CC--------ATTTGTTTC------GGGCCTCATTAA--GCCACGTCGACATTGTGTTTATGATCTCCTT------T--T--TAGGACTCATGGACATCATGCCGGCAC--AACAACAA-CCCCCGGCACA-ACATGTGCC-AAGGAAAACCA-AACTTAAGAAT-GCC---CGTGCCATGAC-ACCCCGTTTCTGG--TGGT--GTTCATTGTGTGT-GGCTTCTTTCAAATCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Arnica_latifolia ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCT-GGTTGAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAT---AGCAGAA-CGACCTG-TGAACATGT-A-CAACAACATGG-CCTAAAGAGGACCGAT---CC--------ATTTGTTTC------GGGCTTCGTTAA--GCCACGTCGACATTGTGTTTATGATCTCCTT------T--T--TAGGACTCGTGGACATCATGCCGGCAC--AACAACAA-CCCCCGGCACA-ACATGTGCC-AAGGAAAACCA-AATTTAAGAAG-GCC---CGTGCCATGAC-ACCCCGTTTTTGG--TGGT--GCTCATTGTGCGT-GGCTTCTTTCAAATCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Arnica_mollis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCCTTCT-GGTTGAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAT---AGCAGAA-CGACCCG-TGAACACGT-A-CAACAACATGG-CCTAAAGAGGATCGGA---TC--------ATCTGTTTC------GGTCCTCGTTAA--GCCACGTCGACATTGTGTTTATGATCGCCTT------T--T--TAGGACTCATGGACATCATGCTGGCAC--AACAACAA-CCCCCGGCACA-ACATGTGCC-AAGGAAAACCA-AACTTAAGAAG-GCC---TGTGCCATGAC-ACCCCGTTTCTGG--TGGT--GCTTATTGTGCGT-GGCTTCTTTCAAATCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Arnica_parryi ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCCTTCT-GGTTGAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAT---AGCAGAA-CGACCCG-TGAACACGT-A-CAACAACATGG-CCTAAAGAGGATCGGA---TC--------ATCTGTTTC------GGTCCTCGTTAA--GCCACGTCGACATTGTGTTTATGATCTCCTT------T--T--TAGGACTCATGGACATCATGCTGGCAC--AACAACAA-CCCCCGGCACA-ACATGTGCC-AAGGAAAACCA-AACTTAAGAAG-GCC---CGTGCCATGAC-ACCCCGTTTCTGG--TGGT--GCTTATTGTGCGT-GGCTTCTTTCAAATCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Arnica_rydbergii ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTT-GGTCGAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAT---AGCAGAA-TGACCCG-TGAACATGT-A-CAACAACATGG-CCTAAAAAGAACCGGA---TC--------ATTTGTTTC------GGGCCTTGTTAA--GCCACGTTGACATTGTGCTTATGATCTCCTT------T--T--TAGGACTCATGGACATAATGTCGGCAA--AACAACAA-CCCCCGGCACA-ACATGTGCC-AAGGAAAACCA-AACTTAAGAAG-GCC---CGTGCCATGAC-ACCCCGTTTTTGG--TGGT--GCTCATTGTGCGT-GGCTTCTTTCAAATCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Artemisia -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Artemisia_arbuscula ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAAACAACCGAG-TGTCGATTGGATCAAG--------------CGCTTGTTT-----GATCCTCTCGAC--GCTTTGTCGATGC-GCGTTCACTCGAGTTCT------TT----TGGACCGTGTGAATGTGTC{AG}T{CT}GGCGC--ATTAACAA-CCCCCGGCACA-ATGTGTGCC-AAGGAAAACTA-AACTCTAGAAGGCTC---GTTTTCATGTTGCCCCCGTTCGCGG--TG-T--GCTCATGGGATGT-GGCTTCTTTATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Artemisia_arctica ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCACAAACGACTCTCGGCAACGGATATCTCGG---CTCATGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTT-GGCCGAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAA---AGCAGAA-CGACCCG-TGAACACGT-AAAAACAACCGAG-TGTCGATTGGATCAAG--------------CGCTTGTTT-----GATCCTCTCGAC--GCTTTGTCGATGC-GCATTTACTCGTGTTCT------TT----TGGACCTTGTGAATGTGTCATTGGCGC--ATTAACAA-CCCCCGGCACA-ATGTGTGCC-AAGGAAAACTA-AACTCAAGAAGGCTC---GTTT-CATGTTGCCCCCGTTCGCGG--TG-T--GCTCATGGGATGT-GGCTTCTTTATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Artemisia_campestris ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCACAAACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTT-GGCCGAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAA---AGCAGAA-CGACCCG-TGAACGCGT-AAAAACAACCGAG-TGTCGTTAGGATCAAG--------------CGCTCGTTT-----GATCCTCTCGAC--GCTCTGC{CG}GATGT-GCGTTCGCTCGAGTCCT------TT----TGGACCTCGTGTGAATGTCGTCGGCGC--AATAACAA-CCCCCGGCACA-ATGTGTGCC-AAGGAAAACTA-AACTCAAGAAGGCTC---GTTT-CGTGTAGC-CCCGTTCGCGG--TG-C--GCTCATGGGACGC-GGCTTCTTTATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Artemisia_cana ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCACAAACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTT-GGCCGAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAA---AGCAGAA-CGACCCG-TGAACACGT-AAAAACAACCGAG-TGTCGATTGGATCAAG--------------CGCTTGTTT-----GATCCTCTCGAC--GCTTTGTCGATGC-GCGTTCACTCGAGTTCT------TT----TGGACCGTGTGAATGTGTCGTCGGCGC--ATTAACAA-CCCCCGGCACA-ATGTGTGCC-AAGGAAAACTA-AACTCTAGAAGGCTC---GTTTTCATGTTGCCCCCGTTCGCGG--TG-T--GCTCATGGGATGT-GGCTTCTTTATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Artemisia_frigida ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCACAAACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTT-GGCCGAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAA---AGCAGAA-CGACCCG-CGAACACGT-AAAAACAACCGAG-CGTCG{AG}TCGGATCAGG--------------CGATCGCTT-----GATCCTCTCGAC--GCTTTGCCGATGC-GCATTCGCTCGGGTTCT------TT----TGGACCCTGTGAGTGCGTCGTTGGCGC--ATTAACAA-CCCCCGGCACA-ATGTGTGCC-AAGGAAAACTA-AACTCGAGAAGGCTC---GTTT-CGTGTTGCACCCGTTCGCGG--TG-T--GCTCATGGGACGC-GGCTTCTTTATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Artemisia_ludoviciana ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCACAAACGACTCTCGGCAACGGATATCTCGG---CTCACGCATCG-ATGAAGAACGTAGCAAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTT-GGC{CG}GAGGGCACGTCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAA---AGCAGAA-CGACCCG-TGAACGCGT-AAAACCAACTGAG-CGTCGATCGGATCAAG--------------CGCTAGTTT-----GATCCTTTCGAC--GCTTTGCCGATGC-GCATTCGCTCGAGTTCT------TT----CGGACCTTGCGGGTGTCTCGTTGGCGC--ATTAACAA-CCCCCGGCACA-ATGCGTGCC-AAGGAAAACTA-AACTCTAGAAGGCTC---GTTCTCATGTTGCCCCCGTTCGCGG--TG-T--GCTCATGGGACGC-GGCTTCTTTATAATCAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Artemisia_scopulorum -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Artemisia_tridentata ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------------------------------------------------------------------------------------------------------------------------T{AC}GAACCCTGCAA---AGCAGAA-CGACCCG-TGAACACGT-AAAAACAACCGAG-TGTCGATTGGATCAAG--------------CGCTTGTTT-----GATCCTCTCGAC--GCTTTGTCGATGC-GCGTTCACTCGAGTTCT------TT----TGGACCGTGTGAATGTGTCGTCGGCGC--ATTAACAA-CCCCCGGCACA-ATGTGTGCC-AAGGAAAACTA-AACTCTAGAAGGCTC---GTTTTCATGTTGCCCCCGTTCGCGG--TG-T--GCTCATGGGATGT-GGCTTCTTTATAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGAAATTTCAAAGCTATTTAGGGCTAGATAGATCTCAACAACACTCTTTCTTATATCCACTTATCTTTCAGGAGTATATTTATGTACTTGCTCATGATCATGGTTTAAATAGATCTATTT---TGTTG------------GAAAATGTAGGTTATGACAATAAATTCA------GCTTACTAATTGTGAAACGTTTAATCATTCG------------AATGTATCAACAGAATCAT------TTTATTCTTTCTGTTAATGATTCTAAACAA------------------------------TTGGGGCACAACAATAATTTTTATTCGCA------AGTAATGTCAGAGGTTTCTTCAATTATTCTGGAAATTCCATTGTCTCTGCGATTAATATCTTCCCTAGAAAAG--------------AAAAAGAAAGGGTTAGTTAAATTCGATAATTTACGATCAATTCATTCAATATTTTCTTTTTTAGAGGACAACTTTTCACATTTAAATTATGTATTAGATATACTAATACCTTACCCAGCCCATCTGGAAATCTTGGTTCAGGCTCTTCGCTATTGGATAAAAGATGCTTCCTCTTT--GCATTTATT------AAGATTCTTTCTCCATG-------AGTGTCA------TAATTGGGA---TAGTCTTATTACTTCAAATTCAAAGAAAGTTAGTTCTT---------------CTTTTTCAAAA---------AGAAAAAACAG------ATTATTCTTCTTCCTATATACTTTTCATGTATGTGAATATGAATCTGGCTTCCTATTTCTCCGTAACCAGTCTTCTCACTTACGATCAACATCTTCTGGAGCCCTTATTGAACGAATAAATTTCTATGG---------------AAAAATA------GAGCATCTTG------------CAGAAGTCTTTGT------CAGGTCTTTT-CAAGCA--AATTTA------TGGTTGTTCAAAGATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATCCATTCTTGCTTCAAAAGGGACGTTTCTTTTGATGAATAAATGGAAATATT-ACTTTGTCAAT---TTCTGGAAATATTATTTTTACCTGTGGCCTCAACCAGGAAGGATTTATATAAAC------CAATTATCCAATCATTCCCTTGACTTTCTGGGTTATCGTTCAAGT------GTGCGGCTAAATCCTTCAACGGTACGCAGTAAAATGCTAGAAAATGCATTTCTAATCGATAA------TGCTATTAAGAAGTTTGATACTCTTGTTCCAATTATGCCTCTGATTGGATCACTGGCTAAATCGAAATTTTGTAACGCATTGGGGCATCCTATTGGCAAGGCGATTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Astragalus -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Astragalus_borealimongolicus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGAATGACTCTCGGCAACGGATATCTAGG---CTCTTGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCC-ATTAGGTTGAGGGCACGTCTGCCT---GGGC-GTCACAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGATGCC--TTACA-TGCAGAC-CAACTA-GTGAATCTGTTTGAATACTTAGGGATGGCT-GGGGTGTTTTG-----------CACCACGACCTCCCTTTGGGT--GGGGGG-TGGCG-C------------------------------------GCAATGCGTTCCCCCTC----CTGCCC--GAACACAAA-CCCCGGCGCTCA-ATGCGCC-AAGGAAC-T-AAAATTC--GATCAATG---TGCCCC---GTCGGCCCGGAGACGGTGCTTC-GG-CGG-TGGTGCCTTGTCACATGATAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------------------------------GGGTTCAAAGCTGGT-GTTAAAGATTATAAATTGACGTATTATACTCCTGATTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGTGCTGCGGTAGCTGCCGAATCTTCCACTGGGACATGGACAACTGTGTGGACCGATGGGCTTACCAGTCTTGATCGTTATAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACCTCCATTGTTGGTAATGTATTTGGATTCAAGGCTTTGCGCGCTCTACGTTTGGAGGATTTGCGAATCCCTACTGCTTATGTTAAAACTTTCCAAGGTCCGCCTCACGGAATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTATTGGGATGTACCATTAAACCTAAATTGGGCTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTTCGTG--------GAGGACTTGATTTTACCAAAGATGATGAAAATGTGAACTCTCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGACATTATTTGAATGCTACCGCGGGTACATGTGAAGAAATGATGAAAAGAGCTATATTTGCCAGAGAATTGGCTGTTCCTATCGTCATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTGGCTCACTATTGCCGGGATAATGGTCTACTTCTTCATATCCACCGTGCAATGCATGCAGTTATCGATAGACAGAAAAATCATGGTATGCACTTTCGTGTATTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAAAGGGAGATTACTTTAGGTTTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGATCGCAGTCGCGGTATTTATTTCACTCAGGATTGGGTTTCTTTACCAGGTGTTTTGCCGGTTGCTTCCGGGGGTATTCACGTTTGGCATATGCCCGCTCTGACCGAGATCTTTGGAGATGATTCCGTACTCCAATTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCAGGTGCCGTAGCTAATCGAGTAGCTCTTGAAGCATGTGTACAAGCTCGGAATGAGGGACGTGATCTTGCTCGTG--AGGGTAATGAAATTATCCGTGAAGCTGCCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAA--------------------------------------------------------------------------- Astragalus_mongholicus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGAATGACTCTCGGCAACGGATATCTAGG---CTCTTGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCC-ATTAGGTTGAGGGCACGTCTGCCT---GGGC-GTCACAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGATGCC--TTACA-TGCAGAC-CAACTA-GTGAATCTGTTTGAATACTTAGGGATGGCT-GGGGTGTTTTG-----------CACCACGACCTCCCTTTGGGT--GGGGGG-TGGTG-C------------------------------------GCAATGCGTTCCCCCTC----CTGCCC--GAACACAAA-CCCCGGCGCTCA-ATGCGCC-AAGGAAC-T-AAAATTC--GATCAATG---TGCCCC---GTCGGCCCGGAGACGGTGCTTC-GG-CGG-TGGTGCCTTGTCACATGATAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTTTT--TCATTTCTT------ACGGTTGTTTCTTTATA-------ATTTTTGTAAT------AGGAA---TAGTTTTCTTACTCCCA------AAAAATCGATTT------------------CGACTTTTTCA------AAAAGTAATCCGAG------ATTATTCTTATTCCTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGC---------------AAAAAGA------GAACATCTTG------------TAGAAGT------TTTTGCTAAGGATTTTTCGTCT---ACCTTA------ACATTCTTCAAGGATCCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCTCTTTTGATGAATAAATGGAAAGACT-ATTTTATCCAT---TTATGGGAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAA------ACAATTATCCGAACATTCATTTTACTTTTTAGGCTATTTTTCAAATG------TGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAAT------TGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGGCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAACCTTTCTCATTATTACAACGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGTTCAAAGCTGGT-GTTAAAGATTATAAATTGACGTATTATACTCCTGATTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGTGCTGCGGTAGCTGCCGAATCTTCCACTGGGACATGGACAACTGTGTGGACCGATGGGCTTACCAGTCTTGATCGTTATAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACCTCCATTGTTGGTAATGTATTTGGATTCAAGGCTTTGCGCGCTCTACGTTTGGAGGATTTGCGAATCCCTACTGCTTATGTTAAAACTTTCCAAGGTCCGCCTCACGGAATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCCTATTGGGATGTACCATTAAACCTAAATTGGGCTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTTCGTG--------GAGGACTTGATTTTACCAAAGATGATGAAAATGTGAACTCTCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGACATTATTTGAATGCTACCGCGGGTACATGTGAAGAAATGATGAAAAGAGCTATATTTGCCAGAGAATTGGCTGTTCCTATCGTCATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTGGCTCACTATTGCCGGGATAATGGTCTACTTCTTCATATCCACCGTGCAATGCATGCAGTTATCGATAGACAGAAAAATCATGGTATGCACTTTCGTGTATTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAAAGGGAGATTACTTTAGGTTTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGATCGCAGTCGCGGTATTTATTTCACTCAGGATTGGGTTTCTTTACCAGGTGTTTTGCCGGTTGCTTCCGGGGGTATTCACGTTTGGCATATGCCCGCTCTGACCGAGATCTTTGGAGATGATTCCGTACTCCAATTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCAGGTGCCGTAGCTAATCGAGTAGCTCTTGAAGCATGTGTACAAGCTCGGAATGAGGGACGTGATCTTGCTCGTG--AGGGTAATGAAATTATCCGTGAAGCTGCCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAA--------------------------------------------------------------------------- Astragalus_parryi -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Avenula_hookeri ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTC-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTGACCCTGA-----CCAAAA-TAGACCG-TGAACGCGT--------AATCC-AGCCCGCCGT-CGGCGA------------------CTCAC--CTCGTCGTTCGGCCAA-GTCCTCG-------ACAACCTCCT-CTC------------CTCGGAGCGGG---GGC-T-----CGGGGT--AAAAGAA{AC}CCAC-GG-CGCCT-AAGGCGTC-AAGGAACACTG-----TGCCTAACTCGGGG-ACGCGGCTGG---CTTGCTGGCCGCC------CCACGTGTTGCAAAGC--TAT-ATAATCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAAAATTCGAAGGGTATTCAGAAAAACAAAAATCTCGTCAACAATACTTTGTCTACCCACTACTCTTTCAGGAGTATATTTATGCATTTGCCCATGATTATGGATTAAATGATTCTGAACCTGTGGAAATTTTT------------------TGTTGTAATAACAAAAAATTTAGTTCACTACTTGTGAAACGTTTAATTA------------CTCGAATGTATCAGCAGAATTTT------TGGATTAACTCGGTTAATCATCCTAACCAAGATCAATTA---------------TTGGATTACAAAATTGGTTTTTATTCTGAGTTTTATTCTCATATTCTATCTGAGGGATTTGCGATCGTTGTAGAAACCCCATTCTCGCTACGAGAATTACCTTGTCCGA--------------------AAGAAAAAGAAATACCCAAGTTTCAGAATTTACGCTCTATTCATTCAATATTTCCCTTTTTAGAAGACAAATTTTTGCATTTGGATTATTTATCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCAAATTGGA------ATAGT---TTTATTAC------TTCAATGAAATCTATTT------------------TTCTTTTTAAA------AAAGAAAATAAAAG------ACTATTTCGATTCCTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTGCTTACCATTAGCAT{CT}TTCTGGAACTTTTTTGGAACGAATCCACTTTTCTAG---------------GAAGATG------GAACATTTT---------------------GGGATAATGTACCCTGGTTTTTTTAGGAAAACCATA------TGGTTTTTTATGGATCCTCTTATGCATTATGCTCGATATCAAGGAAAGGCCTTTTTTGCATCAAAAGGTACTCTTTTTTTGAACAAAAAATGGAAATGGT-ACCATATCAAT---TTATGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGAATCCATCTAAAC------CAATTAGCAAACTCTTGCTTTGATTTTATGGGGTACCTTTCAAGTG------TACCAAAAAGTCCTTTGTTAGTAAGGAATCAAATGCTGGAGAATTCATTTCTAATAGATAC------TCGAATGCAAAAATTAGATACCATAGTTCCCGCTACTGCCCTCATAGGATACTTATCAAAAGCTCAATTTTGTACTGGATCGGGCCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGGATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACGGACTTTGTATCGACTAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTAG-CTCGTAAACATAAAAGCACGGTACGAACTTTTATGCAAC------GATTAGGTTCGACATTTTTAGAAGAATTTTTTACCGAAGAAGAGCTCGT------TTTTTCTTTGATGTTCACCAAAACAACCCTTTTTCCTTTCCGTGGATCGC{AC}CAGTGAACGTATTTGGTATTTTGATATTATACGTATCAACGACCTGGTGAAGCCT{CT}TTAATTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Barbarea_vulgaris ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCT-GGCCGAGGGCACGTCTGCCT---GGGT-GTCACAA-----------------------------------------------------------------------------------------GTCGGTGATGTCGGATCGCGGCGACGTGGGTGGTTCGCGCCTGCGACGTCACGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGTCC-AAAACAGAA-CGACCCGCG-AACCAAATATCATCACTCTCGGTGGGCCGGTTTCTTAGCTGAG--------ATCGT-GTCTCTGCCGA-ATCCGTGGT-TTCGTGAACAATCCTT-ACCGGGAGCTCTCT--------CTCTGTTTGGGTTGTGCGCGTAGCTTCCGGAT--AT-CACAAAACCACGGCACG-AAAAGTGTC-AAGGAACATGC-ATATGAA---CAGCA-----AGCCTTCGCCTCTCCAGAGACGG--TG-T--GCGTGCGTTT-----GGTGAGCTGCGA--TCAAAAGTCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGAAATTTCAA------GGATATTTAGAGTTCGATGGGGCTCGGCAACAGAGTTTTCTATATCCACTTTTTTTTCGGGAGTATATTTATGTACTTGCTTATGATCATGGTTTAAATAGATTAAATAGAAATCGCTCTATTTTATTCGAAAATGTGGATTATGAAAAAAAATATA------GTTCATTAATTGTGAAACGCTTAATTT------------TGCGAATGTATGAACAGAATCGT------TTGATTATTCCCACTAAAAATTTGAACCAAAAT---------------------TACTTTTTTGGGCATACCAGTCTTTTCTATTATCA------AATGATATCTGTTTTATTTGCAGTGATTGTAGAAATTCCATTTTCCCTAAGATTAGGATCCTCTTTCG--------------AAGGAAAACAATTAAAAA------AATCTTATAATTTACAATCAATTCATTCAATATTTCCCTTTTTAGAAGACAAGTTATCACATTTTAATTATGTGTTAGATGTAGTAATACCTTATCCCATCCATCTAGAAATCTTAGTTCAAACCCTACGTTACCGGGTAAAAGATGCCTCTTCTTT--GCATTTTTT------TCGATTCTGTCTATACG-------AATATTGCAAT------TGGAA---GGATTTTTCTATTAAAA------AAAAAT------------------------CAATTTT---------------GAATCCAAG------ATTTTTCTTGTTCTTATATAATTCTCATGTATGTGAATACGAATCCATCTTTTTTTTTCTACGCAAGCGGTCTTCGCATTTACGATCGACATCTTATGAAGTCCTTTTTGAGCGAATTTTATTCTATGG---------------AAAAATA------CAACATTTTT------------TTAAAG------TCTTTGTTAAAAATTTTCCGGCG---ATCCTA------GGGTTGCTCAAGGATCCTTTAATACATTATGTTAGATATCACGGAAGATGCATTCTGGCAACAAAGGATACGCCGCTTCTGATGAATAAATGGAAATATT-ATTTTGTTAAT---TTATGGCAATGTTATTTTTCCGTATGGTTTCAATCGCAAAAGGTCAATATAAA------TCAATTATCTAAAGATAATTTAGAGTTTCTGGGTTATCTGTCAAGTT------TGCGATTAAACCCTTTAGTGGTACGTAGTCAAATGCTAGAAAACTCATTTCTAATAGATAA------TGTTAGAATCAAATTGGATAGCAAAATTCCAATTTCTTCTATTATTGGATCATTGGCTAAAGATAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAAGCGGTCTGGACAGATTCATCAGATTCTGATATTCTCAACCGATTTGTGCGTATATCCAGAAATATTTCTCATTATTACAGCGGATCTTCAAAAAAAAAAAATTTGTATCGAATCAAATATATACTTCGTCTTTGTTGTGTTAAAACTTTAG-CTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAG---GTTAGGCTCGGGT---TTATTGGAAGAATTCCTTACGGGGGAAGACCAAGT------TCTTTCTTTAATCTTCCCAAGAAGTTATTATGCTTCTAAAAGATTATATCGAGTGCGAAT---TTGGTATTTGGATATTCTTTATCTTAATGATTTGGTCAATCATGAATAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGGT-GTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCAGGAGAAGAAACTCAATTTATTGCGTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCGGTTACTAACATGTTTACCTCGATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGGCTGCTCTACGTCTAGAGGATCTGCGAATCCCTCCTGCTTATACTAAAACTTTCCAGGGACCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGACGTCCCCTATTAGGCTGTACTATTAAACCAAAATTGGGGTTATCCGCGAAGAACTATGGTAGAGCAGTTTATGAATGTCTACGCG--------GTGGACTTGATTTTAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Betula_nana ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACCT-GGCCGAGGGCACGTCTGCCT---GGGT-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACC--TGCCC-AGCAGAA-CGACCC-GTGAACCTGTTGAAACAACTGGGGGTG{GT}---GGGGCGATC---------------TCGCCCCTTGCCCCCGAAC-GGTAGGG-AGACA--------------------------------------CTTGTGCATCCC----------TGCCG--AACAACGAA-CCCCGGCGCGGT-C{CT}GCGCC-AAGGAAC-TTTAACGA------AAGAG---TGCCTCCG-GCCGCCTCGGAAACGGTGTGCG-TG-CGGGAGGTGAATCTTGTCTAGAACCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGGAATTTCAAGGATATTTAGAACTAGATAGATTTAGGCAACATGACTTCCTATACCCACTTATCTTTCGGGAGTATATTTATGCACTTGCTCATGATCATGGTTTA------AATAGAGTGATTTTGT---------TGGAAAATGTAACTTATGATAATAAATCTA------GTTTACTGATTGTAAAACGTTTAATTA------------CGCGAATGTATCAACAGAATCAT------TTGATGATTTCCGCCAATGATTCTAACCAAAATAAATTTTTGG---------------GATACAACAA------GAATTTGTATTCTCA------AATTCTATCAGAAGGATTTGCAATCATTGCGGAAATTCCATTTTCTCTACGATTAATATTTTCTTTGG--------------AAGGGTCACAAATCGTAA------GATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAAATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTTCAGACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTT--ACATTTATT------GCGGTTCTTTCTTCATG-------AGTATTCTAATG------GTAA---TATTCTTATTATTCTAA------ATAAATCTATTT------------------CTATTTTTTCA------AAAAGTAATTCAAG------ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCGTTTTCCTTTTTCTCCGTAACCAATCTAATCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAG---------------AAAAATG------GAAGATCTTG------------TCGAAGT------CTTTGTTAATGATTTTCAGGGC---ATCCTA------TGCTTCCTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGATACGCCTCTTCTGATGAATAAATGGAAATATT-ACCTTGTCAGT---TTATGGCAATGTCATTTTTTTGTATGGTCTCGCCCAGGAAGGATCTATATAAA------CCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTG------TGCCACTAAATCCTTCAATGGTGCGGAGTCAAATGCTAGAAAATTCATTTATAATAAATAA------TGCTCCCAAGAAGCTCGATACAATAGTTACAATTATTCCTCTGATTGGATCATTGGCTAAAGCGAAATTTTGTAACGCATTAGGACATCCCATTAGTAAGCCGACTTGGGCCGATTTATCGGATTTTGATATTATCAATCGATTTGTGCGTATATGCAAAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGGGTATGTATCGAATAAAATATATACTTCGACTTTCGTGTGTTAAAACTTTGG-CCCGTAAACACAAAAGTACTATACGCGCTTTTTTAAAAAG---ATTAGGTTCGGAA---TTATTCGAAGAATTCTTTACCGAGGAAGAAGAGTT------TCTTTCTTTGATCTTCCCAAGAACTTCTTTTACTTTGCGTAGGTTATATAGAGGGCGAGT---TTGGTATTTGGATATTATTTGCATGAATGGTCTGGCCAATCATGAATGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCAGCAGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCAGTTGCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Betula_occidentalis ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACCT-GGCCGAGGGCACGTCTGCCT---GGGT-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACC--TGCCC-AGCAGAA-CGACCC-GTGAACCTGTTGAAACAACTGGGGGCGT---GGGGCGATC---------------TCGCCCCTTGCCCCCGAAC-GGTAGGG-AGACA--------------------------------------CTTGTGCATCCC----------TGCCG--AACAACGAA-CCCCGGCGCGGT-CTGCGCC-AAGGAAC-TTTAACGA------AAGAG---TGCCTCCG-GCCGCCTCGGAAACGGTGTGCG-TG-CGGGAGGTGAATCTTGTCTAGAACCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATTTATGCACTTGCTCATGATCATGGTTTA------AATAGAGTGATTTTGT---------TGGAAAATGTAACTTATGATAATAAATTTA------GTTTACTGATTGTAAAACGTTTAATTA------------CGCGAATGTATCAACAGAATCAT------TTGATGATTTCCGCCAATGATTCTAACCAAAATAAATTTTTGG---------------GATACAACAA------GAATTTGTATTCTCA------AATTCTATCAGAAGGATTTGCAATCATTGCGGAAATTCCATTTTCTCTACGATTAATATTTTCTTTGG--------------AAGGGTCACAAATCGTAA------GATCTTACAATTTACGATCCATTCATTCAATATTTCCTTTTTTAGAGGACAAATTCCCACATTTAAATTATGTGGCAGATGTACTAATACCCTACCCCATCCATCTAGAAATCTTGGTTCAGACCCTTCGCTACCGGGTGAAAGATGCCTCCTCTTT--ACATTTATT------GCGGTTCTTTCTTCATG-------AGTATTCTAATG------GTAA---TATTCTTATTATTCTAA------ATAAATCTATTT------------------CTATTTTTTCA------AAAAGTAATTCAAG------ATTATTATTATTCCTATATAATTCTTATATATGTGAATACGAATCCGTTTTCCTTTTTCTCCGTAACCAATCTAATCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTACATAG---------------AAAAATG------GAAGATCTTG------------TCGAAGT------CTTTGTTAATGATTTTCAGGGC---ATCCTA------TGCTTCCTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGATACGCCTCTTCTGATGAATAAATGGAAATATT-ACCTTGTCAGT---TTATGGCAATGTCATTTTTTTGTATGGTCTCGCCCAGGAAGGATCTATATAAA------CCAATTATCCAAGCATTCCCTCGACTTTTTGGGTTATTTTTCAAGTG------TGCCACTAAATCCTTCAATGGTGCGGAGTCAAATGCTAGAAAATTCATTTATAATAAATAA------TGCTCCCAAGAAGCTCGATACAATAGTTACAATTATTCCTCTGATTGGATCATTGGCTAAAGCGAAATTTTGTAACGCATTAGGACATCCCATTAGTAAGCCGACTTGGGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCAGCAGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCAGTTGCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGATTCAAGGCCCTGCGTGCTCTACGTCTGGAGGATTTGCGAATCCCTCCTGCTTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTAAACAAATATGGCCGCCCCCTATTAGGATGTACTATTAAACCTAAATTGGGATTATCCGCTAAGAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Blepharoneuron_tricholepis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCAAAATGCGATACCTGGTGTGA-ATTGC-AAAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTTT-GGTTGAGGGCACGTCTGCCT---GGGC-GTCACGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGACCTGCGGAAGGATCATTGTCGTGACCCTGA-----CCAAAA-CAGACCG-TGAACATGT--------CATCC-ATGCCGCTGGTTGATGGG-----------------GCTTGCACCTGTCACCCAGCAC----GGGGC-------ACAGA--CCTTCTT------------CTAGAAGTGAA---AT-GT-----CCCA----AAAAGAACCCAC-GG-CGCCGTATGGCGTC-AAGGAACACTG-ATAAATCCTTGCTCGGGG-GCACGTCTGG---CTTGCCGGACG-AA-----CCCCGTGCAGCGGTAGC-TATGTGAATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Bouteloua_gracilis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCAAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAGGCCTTCT-GGCTGAGGGCACGTCTGCCT---GGGC-GTCACGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGACCTGCGGAAGGATCATTGTCGTGACCCTGA-----CCAAAA-CAAACAG-TGAACGTGT--------TACCC-ATGCCGCCGGTTGATGGG-----------------TGTCGCACCTGTCTCTCGGATC----AGGGT-------GCCAA----CCTTC------------TTCAGAGGGGC---GGGCA-----CCCT----AAAAGAACCCAC-GG-CGCCGTATGGCGTC-AAGGAACACTG-ATGCTGCCTTGCACAAGT-GCG-GACCGG---CATGCCGGTTCCAC-----CCTTGCGCAACGATTA--TCAATTAATC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-------------------------------------------------------------------------------------------------------GAATACGAAACTAAGGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAGCCCGGGGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAACCCGTTCCTGGAGAAGATAGTCAATATATCTGTTATATAGCTTATCCATTAGATCTATTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAACGTATTTGGTTTCAAAGCCCTACGTGCTCTACGTTTGGAGGATCTACGAATTCCTCCTGCTTATGCAAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAAAGGGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAATTACGGTAGAGCATGTTATGAGTGTCTACGCG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGCTGGAGAGACCGTTTTGTCTTTTGTGCCGAAGCTATTTATAAAGCACAAGCCGAAACCGGCGAAATCAAGGGGCATTACTTGAATGCGACTGCGGGTACATGCGAAGAAATGATTAAGAGAGCTGTATTTGCGAGGGAATTAGGGGTTCCTATTGTAATGCATGACTACATAACTGGAGGATTCACCGCAAATACTAGTTTGGCTCATTATTGCCGCGACAACGGCCTACTTCTTCACATTCACCGAGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTATTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATCCACTCTGGTACGGTAGTAGGTAAGTTAGAAGGGGAACGGGAAATGACTTTAGGTTTTGTTGATTTATTGCGCGATGATTATATTGAAAAAGATCGTTCTCGCGGTATCTTTTTCACGCAGGACTGGGTATCCATGCCAGGTGTTATACCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCAGCTCTGACCGAAATCTTTGGAGACGATTCCGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGCAATGCACCAGGTGCAGCAGCTAATCGGGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGTG--AAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGC--------------------------------------------------------------------------------------------------------------------- Brassica -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Brassica_juncea ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCT-GGCCGAGGGCACGTCTGCCT---GGGT-GTCACAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTACCCTG----GAAACAGAA-CGACCTGAG-AACGATGAAACATCACTCTCGGTAGGCCGGTTTCTTA---------------CTGT-GCCT--GCTGA-TTCCGTGGT-TATGCGT-TCATCCTTGGCCAAGACTTCAGT---------TTTGGTTGGATCGTACGCATAGCTTCCGGAT--AT-CACCAAACCCCGGCACG-AAAAGTGTC-AAGGAAAATGC-AACTAAA---CAGCC-----TGCTTTCGCCAACCCGGAGACGG--TG-T--TTGTTCGGAA-----GCAGTGCTGCAA--TGTAAAGTCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGTCATTTCAGAACTCAAGAAAATAAAGACTTTACTTTTAGTTCAAATCGAATTTTAATCCAAATGGAGAAATTTCAA------GGATATTTAGAGTTCGATGGGGCTCGTCAACAGAGTTTTCTATATCCACTTTTTTTTCGGGACTATATTTATGTACTTGCTTATGATCACGGTTTAAATAGATTAAATAGAAACCGCCCTATTTTCTTGGAAAATGCGGATTATGACAAAAAATATA------GTTCACTAATTGTGAAACGCTTAATTT------------TGCGAATGTACGAACAGAATCGT------TTGATTATTCCCACTAAGGATTTGAACAAAAAT---------------------C------TGGGGCATACCAATAATTTCTATTATCA------AATGATATCTGTTTTATTTGCAGTGATTGTAGAAATTCCATTTTCCCTAAGGTTGGGATCCTCTATCG--------------AAGGAAAAAATGTAAAAA------AATCTTACAATTTACAATCACTTCATTCAATATTTCCCTTTTTAGAAGACAAACTCTCACATTTTAATTATGTATTAGATGTACTAATACCTTACCCCATCCATCTAGAAATCTTGGTTCAAACCCTACGTTACCGGGTAAAAGATGCCTCTTCTTT--GCATTTTTT------TCGGTTCTGTCTATACG-------AGTATTGCAAT------TGGAA---GAATTTTGATAGTAAAA------AAAAAT------------------------CAATTTT---------------GAATCCAAG------ATTTTTATTGTTCTTATATAATTCTCATGTATGTGAATACGAATCCATCTTTTTTTTTCTACGCAAGCAGTCTTCTCATTTACGATCGACATCTTATGACGTCTTTTTTGAGCGAATTTTATTCTATGG---------------AAAAATA------CAACATTTTT------------TTAAAG------TCTTTGTTAATAATTTTTCGGCG---CTCTTA------GGGTTGCTCAAGGATCCTTTCCTACATTATGTTCGATATCATGGAAAATACATTCTGGCAACAAAGGATACGCCACTTCTGATGAATAAATGGAAATATT-ATTTTGTTAAT---TTATGGCAATGTTATTTTTCCGTATGGTTTCAATCGCAAAAGGTTAATATAAA------TCAATTATCTAAAGATAATTTAGAATTTCTGGGTTATCTATCAAGTT------TGCGACTAAACCCTTTAGTGGTACGTAGTCAAATGCTAGAAAACTCATTTCTAATAGATAA------TGTTAGAATAAAATTGGATAGCAACATTCCAATTTCTTCTATTATTGGGTCGTTGGCTAAAGATAAATTTTGTAATGTATTAGGGCATCCGATTAGTAAAGCGACCTGGACGGATTCATCAGATTCTGATATTCTCAACCGATTTGTGCGTATATGCAGAAATATTTCGCATTATTACAGCGGATCTTCAAACAAAAAGAATTTGTATCGAATAAAATATATACTTCGTCTTTGTTGTGTTAAAACTTTGG-CTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAG---GTTGGGCTCGGGT---TTATTAGAAGAATTCCTTACGGGGGAAGACCAAGT------TCTTTCTTTAATCTTCCCAAGAAGTGATTATGCTTCTAAAAGATTATATCGAGTGCGGGT---TTGGTATTTGGATATTCTTTATCTTAATGATTTAGTCAATCATGAATAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAGCAAGTGTTGGATTCAAAGCTGGT-GTTAAAGAGTATAAATTAAATTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGACCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCAGGAGAAGAAACTCAATTTATTGCGTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGGTCTGTTACTAACATGTTTACCTCAATTGTGGGTAACGTATTTGGGTTCAAAGCCCTGGCTGCTCTACGTCTAGAGGATCTGCGAATCCCTCCGGCTTATACTAAAACTTTCCAGGGACCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGACGTCCCCTATTAGGATGTACTATTAAACCTAAGTTGGGGTTATCCGCGAAGAACTATGGTAGAGCAGTTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAGAATGTGAACTCTCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAATCACAGGCTGAAACAGGTGAAATCAAAGGACATTATTTGAAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Brassica_napus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCT-GGCCGAGGGCACGTCTGCCT---GGGT-GTCACAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTACCCTG----GAAACAGAA-CGACCTGAG-AACGATGAAACATCACTCTCGGTAGGCCGGTTTCTTA---------------CTGT-GCCT--GCTGA-TTCCGTGGT-TATGCGT-TCATCCTTGGCCAAGACTTCAGT---------TTTGGTTGGATCGTACGCATAGCTTCCGGAT--AT-CACCAAACCCCGGCACG-AAAAGTGTC-AAGGAAAATGC-AACTAAA---CAGCC-----TGCTTTCGCCAACCCGGAGACGG--TG-T--TTGTTCGGAA-----GCAGTGCTGCAA--TGTAAAGTCT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTAGATGTACTAATACCTTACCCCATCCATCTAGAAATCTTGGTTCAAACCCTACGTTACCGGGTAAAAGATGCCTCTTCTTT--GCATTTTTT------TCGGTTCTGTCTATACG-------AGTATTGCAAT------TGGAA---GAATTTTGATAGTAAAA------AAAAAT------------------------CAATTTT---------------GAATCCAAG------ATTTTTATTGTTCTTATATAATTCTCATGTATGTGAATACGAATCCATCTTTTTTTTTCTACGCAAGCAGTCTTCTCATTTACGATCGACATCTTATGACGTCTTTTTTGAGCGAATTTTATTCTATGG---------------AAAAATA------CAACATTTTT------------TAAAAG------TCTTTGTTAATAATTTTTCGGCG---CTCTTA------GGGTTGCTCAAGGATCCTTTCCTACATTATGTTAGATATCATGGAAAATACATTCTGGCAACAAAGGATACGCCACTTCTGATGAATAAATGGAAATATT-ATTTTGTTAAT---TTATGGCAATGTTATTTTTCCGTATGGTTTCAATCGCAAAAGGTTAATATAAA------TCAATTATCTAAAGATAATTTAGAATTTCTGGGTTATCTATCAAGTT------TGCGACTAAACCCTTTAGTGGTACGTAGTCAAATGCTAGAAAACTCATTTCTAATAGATAA------TGTTCGAATAAAATTGGATAGCAACATTCCAATTTCTTCTATTATTGGGTCGTTGGCTAAAGATAAATTTTGTAATGTATTAGGGCATCCGATTAGTAAAGCGACCTGGACGGATTCATCAGATTCTGATATTCTCAACCGATTTGTGCGTATATGCAGAAATATTTCGCATTATTACA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGGT-GTTAAAGAGTATAAATTGAATTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGACCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCAGGAGAAGAAACTCAATTTATTGCGTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGGTCTGTTACTAACATGTTTACCTCAATTGTGGGTAACGTATTTGGGTTCAAAGCCCTGGCTGCTCTACGTCTAGAGGATCTGCGAATCCCTCCGGCTTATACTAAAACTTTCCAGGGACCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGACGTCCCCTATTAGGATGTACTATTAAACCTAAGTTGGGGTTATCCGCGAAGAACTATGGTAGAGCAGTTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAGAATGTGAACTCTCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAATCACAGGCTGAAACAGGTGAAATCAAAGGACATTATTTGAATGCTACTGCGGGTACATGCGAAGAAATGATGAAAAGAGCTATATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGTTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCACGCTGTTATTGATAGACAGAAGAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCTTTACGTCTATCGGGTGGAGATCATGTTCACGCGGGTACAGTAGTAGGTAAACTTGAAGGAGACAGGGAGTCAACTTTGGGCTTTGTTGATTTACTGCGCGATGATTATGTTGAAAAAGACCGAAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCACTACCAGGTGTTCTACCTGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGATTCCGTACTACAATTTGGTGGCGGAACTTTAGGCCACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAACCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCAGTCG--AGGGTAATGAAATTATCCGTGAGGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCACATTTAACTT------------------------------------------------------------------- Brickellia_grandiflora ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------------------------------------------------------------------------------------------------------------------------TCGAATCCTGCAT---GGCAGAA-CAACTTG-TGAACATGT-AACTACAAAATGG-CTTGGCGCGGATTGAT---CA--------TTTAGTTTC------AAACCTCGTTAG--GCCTTGTCGGCGT-GTGTTTGCGGTGTCTCT------T-TA--TTGTACTCGTGAACATCATGTTGACCC--AACAACAA-CCCCCGGCACA-GCACGTGCC-AAGGAAAACGA-AACTTAAGAAG-GCC---TGTGCGATGAT-GCCATGAATGTGG--TG-C--GTTCATTGTATGT-GGCTTCTTTGTAATCCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Bromus -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Bromus_arvensis ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------------------------------------------------------------------------------------------------------------------------TCGTGACCCTGA-----CCAAAA-CAGACCG-CGAACGTGT--------CATCC-AATCCGTCGA-TGATGGG-----------------CATTG--TCCATCGCTCGGCCT---ACCACG-------ATGACCT-CCCCTC------------CTTGGAGTGGG-GG---CT-----CGGGGT--AAAAGAACCCAC-GG-CGCCG-AAGGCGTC-AAGGAACACCG-----TGTCTAACCCAAGG-GCATGGCTAG---CTTGCTGGTCATC------CCTTGCGTCACATTTA--TAT-TTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCGAATTCGA------ATAGT---TTTATTAC------TTCAATGAAATCCATTT------------------TTATTTTAAAA------AAAGAAAATAAAAG------ACTATTTCGATTCCTATATAACTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTGCTTACCATTAGCATCTTCTGGAACTTTTCTGGAACGAATCCACTTTTCTAG---------------GAAGATG------GAACATTTT---------------------TGGATAATGTACCCCCGTTTTTCTCGGAAAAACCGA------TGGTTCTTTATGGATCCTCTTATACATTATGTTCGATATCAAGGAAAAGCAATTCTTGCGTCAAAAGGCACTTTTTTTTTGAAGAAGAAATGGAAATGCT-ACCATATAAAT---TTATGGCAATATTTTTTCCGTTTTTGGACTCAGCCGCGAAGGATCCAAATAAAC------CAATTAGCAAACTCTTGCTTCGATTTTATGGGGTACCTTTCCAGTG------TACCAAAAAGTCCTTTGTTAGTAAGGAATAAAATGCTGGAGAATTCATTTCTAATAGATAC------TCGAATGAAAAAATTCGATACCATAGTCCCCGCTACTCTCCTCATAGGATACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGGATATGTAGAAATCTTTTTCACTATCATAGTGGATCTTCGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTCACCACAAACAGAAACTAAAGCAGGTGTTGGATTTCAAGCTGGT-GTTAAAGATTATAAATTGACTTACTACACCCCAGAGTATGAAACTAAGGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAGCCTGGGGTTCCGCCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACGTGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCTGTTGCTGGGGAAGACAACCAATGGATCTGTTATGTAGCTTATCCATTAGACCTATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTGGGTAACGTGTTTGGTTTCAAAGCCCTACGTGCTCTACGTTTGGAGGATCTACGAATTCCCCCTACTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAATTATGGTAGAGCGTGTTATGAGTGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGCTGGAGAGACCGTTTTGTCTTTTGTGCTGAAGCTATTTATAAATCACAGGCCGAAACCGGTGAAATCAAGGGGCATTACTTGAATGCGACTGCGGGTACATGTGAAGAAATGATTAAGAGAGCTGTATTTGCTAGAGAATTAGGGGTTCCTATTGTAATGCACGACTACTTAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGTGACAATGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTATTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATCCACTCCGGTACAGTAGTAGGTAAGTTAGAAGGGGAACGCGAAATGACTTTAGGTTTTGTTGATTTATTGCGCGATGATTTTATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAGGACTGGGTATCCATGCCAGGTGTTATACCGGTAGCTTCAGGTGGTATTCATGTTTGGCATATGCCAGCTCTGACCGAAATCTTTGGGGACGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGCG--AAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCGGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGAGCCGGTAGATACTATCGATTAA------------------------------------------ Bromus_carinatus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTC-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGA-----CCAAAA-CAAACCG-CGCACGCGT--------CATCC-AATCCGTCGA-TGATGGG-----------------CATCG--TCCATTGCTCGGCCA---TCCTCC-------GTCACCT-ACACTC------------CTCGGAGTGGG-GTG--CT-----CGGGGT--AAAAGAACCCCC-GG-CGCCG-AAGGCGTC-AAGGAACACTG-----TGTCTAACCCGAGG-GCATGGCTAG---CTTGCTGGTCATC------TCTTGTGTTGCAATCG--TAT-TTAATC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Bromus_ciliatus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTC-GGTCGAGGGCACGCCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTGACCCTGA-----CCAAAA-CAGACCG-CGCACGCGT--------CATCC-AATCCGTCGA-CGATGGG-----------------CATCG--TCCATCGCTCGGCCA---TCCTCG-------ATCACCT-CCCCTC------------CTCGGAGTGGG-GGG--CT-----CGGGGT--AAAAGAACCCAC-GG-CGCCG-AAGGCGTC-AAGGAACACTG-----TGTCTAACCCGAGG-GCATGCCTAG---CTTGCTGGTCATC------CCTCGTGTTGCAATTA--TAT-TTAATC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Bromus_hordeaceus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTC-GGTCGAGGGCACGCCTGCTT---GGGC-GTCACGCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGTGACCCTGA-----CCAAAA-CAGACAG-CGCACTTGT--------CATCC-AATCCGTCGA-TGATGGG-----------------CATCG--TCCATTGCTCGGCCT---ACCACG-------ATCACCTTCCCCTC------------CTCGGAGTGGG-AGG--CT-----CGGGGT--AAAAGAACCCAC-GG-CGCCG-AAGGCGTC-AAGGAACACTG-----TGTGTAACTCGAGG-GCATGACTAG---CTTGCTGGTCAGC------CCTTGTGTAGCAATTA--TAT-TTAATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCGAATTCGA------ATAGT---TTTATTAC------TTCAATGAAATCCATTT------------------TTATTTTTAAA------AAAGAAAATAAAAG------ACTATTTCGATTCCTATATAACTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTGCTTACCATTAGCATCTTCTGGAACTTTTCTGGAACGAATCCACTTTTCTAG---------------GAAGATG------GAACATTTT---------------------TGGATAATGTACCCCCGTTTTTCTCGGAAAAACCGA------TGGTTCTTTATGGATCCTCTTATACATTATGTTCGATATCAAGGAAAAGCAATTCTTGCGTCAAAAGGCACTTTTTTTTTGAAGAAGAAATGGAAATGCT-ACCATATAAAT---TTATGGCAATATTTTTTCCGTTTTTGGACTCAGCCGCGAAGGATCCAAATAAAC------CAATTAGCAAACTCTTGCTTCGATTTTATGGGGTACCTTTCCAGTG------TACCAAAAAGTCCTTTGTTAGTAAGGAATAAAATGCTGGAGAATTCATTTCTAATAGATAC------TCGAATGAAAAAATTCGATACCATAGTCCCCGCTACTCTCCTCATAGGATACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGGATATGTAGAAATCTTTTTCACTATCATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAGCAGGTGTTGGATTTCAAGCTGGT-GTTAAAGATTATAAATTGACTTACTACACCCCAGAGTATGAAACTAAGGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAGCCTGGGGTTCCGCCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACGTGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCTGTTGCTGGGGAAGACAACCAATGGATCTGTTATGTAGCTTATCCATTAGACCTATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTGGGTAACGTGTTTGGTTTCAAAGCCCTACGTGCTCTACGTTTGGAGGATCTACGAATTCCCCCTACTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAATTATGGTAGAGCGTGTTATGAGTGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGCTGGAGAGACCGTTTTGTCTTTTGTGCTGAAGCTATTTATAAATCACAGGCCGAAACCGGTGAAATCAAGGGGCATTACTTGAATGCGACTGCGGGTACATGTGAAGAAATGATTAAGAGAGCTGTATTTGCTAGAGAATTAGGGGTTCCTATTGTAATGCACGACTACTTAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGTGACAATGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTATTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATCCACTCCGGTACAGTAGTAGGTAAGTTAGAAGGGGAACGCGAAATGACTTTAGGTTTTGTTGATTTATTGCGCGATGATTTTATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAGGACTGGGTATCCATGCCAGGTGTTATACCGGTAGCTTCAGGTGGTATTCATGTTTGGCATATGCCAGCTCTGACCGAAATCTTTGGGGACGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGCG--AAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCTGC------------------------------------------------------------------------------------------------------- Bromus_inermis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTC-GGTCGAGGGCACGCCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTGACCCTGA-----CCAAAA-CAAACCG-TGCACGCGT--------CATCC-AATCCGTCGA-CGATGGG-----------------CATCG--TCCATCGCTCGGCCA---TCCTCG-------GTTACCT-ACACTC------------CTCAGAGT?GG-GTG--AT-----CGGGGT--AAAAGAACCCAC-GG-CGCCG-AAGGCGTC-AAGGAACACTA-----TGTCTAACCCGAGG-GCATGGCTAG---CTTGCTGGTCATC------TCTTGTGTTGCAATCG--TAT-TTAATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAAAATTCGAAGGGTATTCAGAAAAACATAAATCTCGTCAACAATACTTTGTCTACCCACTTCTCTTTCAGGAGTATATTTATGCATTTGCCCATGATTATGGATTAAATGGTTCTGAACCTGTGGAAATAGTT------------------AGTTGTAATAACAAGAAATTTAGTTCACTACTTGTGAAACGTTTAATTA------------TTCGAATCTATCAGCAGAATTTT------TGGGATAACTCGGTTAATCATCCTAACCAAGATCGATTG---------------TTGTATTACAAAAATTATTTTTATTCTGAGTTTTATTCTCAGATTCTATCTGAGGGATTTGCGATCCTTGTAGAAATCCCATTTTCGCTACGAGAATTATCTTGTCCGA--------------------AAGAAAAAGAAATACCAAAATTTCAGAATTTACGCTCTATTCATTCAATATTTCCCTTTTTAGAAGACAAATTTTTGCATTTGGATTATCTATCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCGAATTCGA------ATAGT---TTTATTAC------TTCAATGAAATCCATTT------------------TTATTTTTAAA------AAAGAAAATAAAAG------ACTATTTCGATTCCTATATAACTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTGCTTACCATTAGCATCTTCTGGAACTTTTCTGGAACGAATCCACTTTTCTAG---------------GAAGATG------GAACATTTT---------------------TGGATAATGTACCCTGGTTTTTCTCGGAAAAACCTA------TGGTTCTTTATGGATCCTCTTATACATTATGTTCGATATCAAGGAAAAGCAATTCTTGCATCAAAAGGCACTTTTTTTTTGAAGAAGAAATGGAAATGCT-ACCATATAAAT---TTATGGCAATATTATTTCCGTTTTTGGACTCAGCCGCGAAGGATCCATATAAAT------CAATTAGCAAACTCTTGCTTCGATTTTATGGGGTACCTTTCCAGTG------TACCAAAAAGTCCTTTGTTAGTAAGGAATAAAATGCTGGAGAATTCATTTCTAATAGATAC------TCGAATGAAAAAATTCGATACCATAGTCCCCGCTACTCTCCTCATAGGATACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGGATATGTAGAAATCTTTTTCACTATCATAGTGGATCTTCGAAAAAACAGACTTTGTATCGACTAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTAG-CTCGTAAACATAAAAGCACGGTACGAACTTTTATGCAAC------GATTGGGTTCGGTATTTTTAGAAGAATTTTTTACGGAAGAAGAGCAAAT------TTTTTGTTTGATGTTCACCAAAACTACTCTTTTTTCTTTCAGTGGATCACACACTGAGCGTATTTGGTATTTGGATATTATACGTATCAATGACCTGGTGAACCCTCTTAATTAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTCACCACAAACAGAAACTAAAGCAGGTGTTGGATTTCAAGCTGGT-GTTAAAGATTATAAATTGACTTACTACACCCCAGAGTATGAAACTAAGGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAGCCTGGGGTTCCGCCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCTGTTGCTGGGGAAGACAGCCAATGGATCTGTTATGTAGCTTATCCATTAGTCCTATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTGGGTAACGTGTTTGGTTTCAAAGCCCTACGTGCTCTACGTTTGGAGGATCTAGCAATTCCCCCTACTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAATTATGGTAGAGCGTGTTATGAGTGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCA????????????????????????????????????????????????????????????????????????????????????????????????????????????????AAGAAATGATTAAGAGAGCTGTATTTGCTAGAGAATTAGGGGTTCCTATTGTAATGCACGACTACTTAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGCGACAATGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTATTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATCCACGCCGGTACAGTAGTAGGTAAGTTAGAAGGGGAACGCGAAATGACTTTAGGTTTTGTTGATTTATTGCGCGATGATTTTATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACACAGGACTGGGTATCCATGCCAGGTGTTATACCGGTAGCTTCAGGTGGTATTCATGTTTG?CATATGCCAGCTCTGACCGAAATCTTTGGGGACGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGCG--AAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGAGCCGGTAGATACTATCGATAAATAA--------------------------------------- Bromus_lanatipes ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTC-GGTCGAGGGCACGCCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTGACCCTGA-----CCAAAA-CAGACCG-CGCACGCGT--------CATCC-AATCCGTCGA-CGATGGG-----------------CATCG--TCCATCGCTCGGCCA---TCCTCG-------ATCACCT-CCCCTC------------CTCGGAGTGGG-GGGGGCT-----CGGGGT--AAAAGAACCCAC-GG-CGCCG-AAGGCGTC-AAGGAACACTA-----TGTCTAACCCGAGG-GCATGGCTAG---CTTGCTGGTCATC------CCTTGTGTTGCAATTA--TAT-TTAATC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Bromus_porteri ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTC-GGTCGAGGGCACGCCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTGACCCTGA-----CCAAAA-CAGACCG-CGCACGCGT--------CATCC-AATCCGTCGA-TGATGGG-----------------CATCG--TCCATCGCTCGGCCA---TCCTCG-------ATCACCT-CCCCTC------------CTCGGAGTGGG-GGGGGCT-----CGGGGT--AAAAGAACCCAC-GG-CGCCG-AAGGCGTC-AAGGAACACTA-----TGTCTAACCCGAGG-GCATGGCTAG---CTTGCTGGTCATC------CCTTGTGTTGCAATTA--TAT-TTAATC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Bromus_tectorum ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTC-GGTCGAGGGCACGCCTGCCT---GGGC-GTCACGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTGACCCTGA-----CCAAAA-CAAACCG-CGCACGCGT--------TATCC-AATCCGTCGA-CGATGGG-----------------CATCG--TCCATTGCTCGGCCA---TCCTCG-------GTCACCT-ACACTT------------CTCGGAGTGGG-GTG--CT-----CGGGGT--AAAAGAACCCAC-GG-CGCCG-AAGGCGTC-AAGGAACACTG-----TGTCTAACCCGAGG-GCATGGCTAG---CTTGCTGGTCATC------TCTTGGGTTGCAATCG--TAT-TTAATCCAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Calamagrostis -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calamagrostis_canadensis -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGCAGCAAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTC-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACGCAAAACACGCTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGA-----CCAAAA-CAGACCG-CGCACGCGT--------CATCC-AGCCTGCCGG-CGGCAG------------------CACCG--TTTGTCGCTCGGCCAA-GTCCTTG-------ATAACCTCCT-CTC------------CTCGGAGTGGG---GGC-T-----CGGGGT--AAAAGAACCCAC-GA-CGCCT-AAGGCGTC-AAGGAACACTG-----TGCCTAGCCCGGGG-ACGCGGACGG---CTTGCTGGCCGCC------CCCCGTGCTGCAATGC--TAT-TTAATCCACATGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAAAATTTCAAGGGTATTCAGAAAAACATAAATCTCGTCAACAATACTTTGTCTACCCACTTCTCTTTCAGGAGTATATTTATGCATTTGCCCATGATTATGGATTAAATGATTCCGAACCTGTGGAAATTGTT------------------AGTTGTAATAACAAGAAATTTAGTTCACTACTTGTGAAACGTTTAATTA------------CTCGAATGTATCAGCAGAATTTT------TGGATTAACTCGGTTAATCATCCTAACCAAGATCGATTG---------------TTGGATTACAAAATTGGTTTTTATTCTGAGTTTTATTCTCAGATTCTACCTGAGGGGTTTGCGATCGTTGTAGAAATCCCATTCTCGCTACGAGAATTATCTTGTCCGA--------------------AAGAAAAAGAAATACCAAAGTTTCAGAATTTACGCTCTATTCATTCAATATTTCCCTTTTTAGAAGACAAATTTTTGCATTTGGATTATCTTTCACATATAGAAATACCCTATCCTATCCATTTGGAAATCTTGGTGCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTT--GCATTTATT------GCGATTCTTTCTCAACT-------ACTATTCAAATTGGA------ATAGT---TTTATTAC------TTCAATGAAATCTATTT------------------TTCTTTTTAAA------AAAGAAAATAAAAG------ACTTTTTCGATTCTTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTGCTTACCATTATCATCTTCTGGAACTTTTCTGGAACGAATCATCTTTTCTAG---------------GAAGATG------GAACATTTT---------------------GGGATAATGTACCCTGGTTTTTTTCGGAAAACCATA------TGGTTCTTTATGGATCCTCTGATGCATTATGTTCGATATCAAGGAAAGGCAATTCTTGCATCAAAAGGAACTCATTTTTTGAACAAGAAATGGAAATGGT-ACCTTATCAAT---TTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAAC------CAATTAGCAAACTCTTGCTTCGATTTTCTGGGGTACCTTTCAAGTG------TACCAAAAAGTACTTTGTTAGTAAGGAATCAAATGCTGGAGAATTTATTTCTAATAGATAC------TCGAATGAAAAAATTCGATACCATAGTTCCCGCTACTGCCCTCATAGGATACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGCATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACAGACTTTGTATCGACTAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTAG-CTCGTAAACATAAAAGCACGGTACGAACTTTTATGCAAC------GGTTGGGTTCGGCATTTTTAGAAGAATTTTTTACCGAAGAAGAGTTAGT------TTTTTCTTTGATGTTCACCAAAACAACCCTTTTTTCTTTCCGTGGATCGCACAGTGAGCGTATTTGGTATTTTGATATTATACGTATCAACGACCTGGTAAAGCCTCTTAATTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Calamagrostis_purpurascens -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTCGGCAACGGATATCTCGG---CTCTCGCATCG-GATGAAGACGCAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTC-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACGCAAAACACGCTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGA-----CCAAAA-CAGACCG-CGCACGCGT--------CATCC-AGCCTGCCGG-CGGCGG------------------CACCG--TTCGTCGCTCGGCCAA-GTCCTCG-------ATAACCTCCT-CTC------------CTCGGAGTGGG---GGC-T-----CGGGGT--AAAAGAACCCAC-GA-CGCCT-AAGGCGTC-AAGGAACACTG-----TGCTTAGCCCGGGG-ACGCGGACGG---CTTGCTGGCCGCC------CCCCGTGCTGCAATGC--TAT-TTAATCCACACGAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Calamagrostis_stricta -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACCTGGTGTGA-ATTGC-AGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTC-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACGCAAAACACGCTC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTGACCCT{AG}A-----CCAAAA-CAGACCG-TGCACGCGT--------CATCC-AGCCTGCCGG-CGGCAG------------------CACCG--TTTGTCGCTCGGCCAA-GTCCT{CT}G-------ATAACCTCCT-CTC------------CTCGGAGTGGG---GGC-T-----CGGGGT--AAAAGAACCCAC-GA-CGCCT-AAGGCGTC-AAGGAACACTG-----TGCCTAGCCCGGGG-ACGCGGACGG---CTTGCTGGCCGCC------CC{CT}CGTGCTGCAATGC--TAT-TTAATCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Callitriche_deflexa ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTGGGTAAAAGATGCCTCTTCTTT--GCATTTATT------ACGATTATTTCTTAACG-------AGTATTG------TAATTGGAA---TAGTCTTATTTC------TCCAAAGAAAGATAATTTCT---------------TTTTGAAAAAAAG---------AAATCAAAG------ATTCGTTTTTTTCTTATATAATTTTTATGTATGTGAATACGAATTCATTTTCGTCTTTCTACGTAACCAAGCTTTTCATTTACGATCAACATCTTTTGGAGTTCTTCTTGAACGAATCTATTTCTATGG---------------AAAAGTA------GAACGTCTTG------------TGAACGTTTTTGTTAAGGTTAAGGATTGT-CAGGCG--GACCTT------TGGTTCTTCAAAGAACCTTGTATGCATTATGTTAGGTATCAAAGAAAATCAATTCTGGCTTCCAAAGGGACATTTTTTTTGATGAATAAATGGAAATGTT-ACCTTATCACT---TTTTGGCAATGGCATTTTTCGTTGTGGTTTGATCCACGAAGAATTTATATAAAC------CAATTATCCAACCATTTCCTTGAATTTGTGGGCTATCTTTCAGGC------GTGAGAATAAATCCTGCAGTGGTACGGAGTACAATTTTAGAAAATTCATTTCTAATCAATAA------TACTATTAAGAAGTTCGATACACTTGTTCCAATTAGTTCTCTGATTGCGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGATTTGGGCTGATTTATCCGATTCTAATATTATTGACCGCTTTTGGAATATCTGCAGAAATCTTTCTCATTATCATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGGT-GTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCCGCTGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCAAATTGAGCCCGTTCCTGGAGAACCAGATCAATATATCTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTTCGAATCCCTGTAGCTTATGTTAAAACTTTTCAAGGCCCGCCTCACGGGATCCAAGTTGAGCGGGATAAATTGAACAAGTATGGTCGTCCTCTGTTGGGATGTACTATTAAACCTAAATTAGGGTTATCTGCTAAAAACTATGGTAGAGCATGTTATGAATGTCTTCGAG--------GTGGACTTGATTTTACCAAAGATGACGAGAACGTAAACTCCCAGCCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCCATTTATAAATCCCAGGCGGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCGGGTACCTGCGAAGAAATGATGAAAAGAGCTATATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGAGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCTTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATACACTTCCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACCGTAGTAGGTAAACTTGAAGGAGAAAGAGACATCACTTTGGGCTTTGTTGATTTACTACGTGATGATTATATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACCCAAGATTGGGTCTCTCTACCAGGTGTTATTCCCGTGGCTTCTGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCGGTACTACAGTTCGGTGGAGGAACTTTAGGCCACCCTTGGGGTAATGCGCCAGGTGCCGTAGCTAACCGAGTAGCTCTAGAAGCGTGTGTACAAGCTCGTAATGAAGGGCGTGATCTTGCTGTTG--AGGGTAATACAATTATCCGTGAGGCTTGCAAATGGAGTCCTGAACTAGCTGCCGCT--------------------------------------------------------------------------------------------------- Callitriche_palustris -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Callitriche_stagnalis ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTTAGATATACTAATACCCCACCCTCTACATGCGGAAATCCTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTT--GCATTTATT------ACGATTATTTCTTAACG-------AGTATTG------TAATTGGAA---TAGTCTTATTTC------TCCAAAGAAAGATAATTTCT---------------TTTTGAAAAAAAG---------AAATCAAAG------ATTCGTTTTTTTCTTATATAATTTTTATGTATGTGAATACGAATTCATTTTCGTCTTTCTACGTAACCAAGCTTTTCATTTACGATCAACATCTTTTGGAGTTCTTCTTGAACGAATCTATTTCTATGG---------------AAAAGTA------GAACGTCTTG------------TGAACGTTTTTGTTAAGGTTAAGGATTGT-CAGGCG--GACCTT------TGGTTCTTCAAAGAACCTTGTATGCATTATGTTAGGTATCAAAGAAAATCAATTCTGGCTTCCAAAGGGACATTTTTTTTGATGAATAAATGGAAATGTT-ACCTTATCACT---TTTTGGCAATGGCATTTTTCGTTGTGGTTTGATCCACGAAGAATTTATATAAAC------CAATTATCCAACCATTTCCTTGAATTTGTGGGCTATCTTTCAGGC------GTGAGAATAAATCCTGCAGTGGTACGGAGTACAATTTTAGAAAATTCATTTCTAATCAATAA------TACTATTAAGAAGTTCGATACACTTGTTCCAATTAGTTCTCTGATTGCGTCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGATTTGGGCTGATTTATCCGATTCTAATATTATTGACCGCTTTTGGAATATCTGCAGAAATCTTTCTCATTATCATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGGT-GTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCCGCTGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGGACCGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTACCAAATTGAGCCCGTTCCTGGAGAACCAGATCAATATATCTGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTTCGAATCCCTGTAGCTTATGTTAAAACTTTTCAAGGCCCGCCTCACGGGATCCAAGTTGAGCGGGATAAATTAAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTATGGTAGAGCATGTTATGAATGTCTTCGAG--------GTGGACTTGATTTTACCAAAGATGACGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCCATTTATAAATCTCAGGCGGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCGGGTACCTGCGAAGAAATGATGAAAAGAGCTATATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACAGGAGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCTTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATACACTTCCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACCGTAGTAGGTAAACTTGAAGGAGAAAGAGACATCACTTTGGGCTTTGTTGATTTACTACGTGATGATTATATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTATTCCCGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCGGTACTACAGTTCGGTGGAGGAACTTTAGGCCACCCTTGGGGTAATGCGCCAGGTGCCGTAGCTAACCGAGTAGCTCTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTGCTG--AGGGTAATACAATT--------------------------------------------------------------------------------------------------------------------------------------------- Caltha_appendiculata ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAATGACTCTCGGCAACGGATATCTTGG---CTCTTGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCC-ACTAGGTCGAGGGCACGTTTGCCT---GGGT-GTCACAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGAA-CGACCAG-TGAATTTGTGAAAC-AAGCTT-T--GGTCGAGATAGGGTGCAATA---------TCTTACTCGTCCATATTGTTGGGATATGGAATCAACCAAAATTCTCATAT--TCAT------------GTGAATGTGGTTGACCCATGGTTCTCGCAC--AAACAAAAAACCCGG-CGCAA-TATGTGCC-AAGGAAATCTTA-----GCGGAAATAGGAGCGTTATTCCCA---TT------TGGT-----AATGGCGC-TTCTAATCCGATACTC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------------------------AGTGTTGGCTTCAAAGCAGGT-GTTAAAGATTACAAATTGACTTATTATACTCCTGAATATACACCCAAAGATACTGATACCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCTGTAGCTGCCGAATCTTCTACAGGTACATGGACAACTGTGTGGACCGATGGACTTACTAGCCTTGATCGTTACAAAGGACGATGCTACCACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATTTGTTATGTAGCGTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCGCTACGCGCTCTACGTCTGGAGGATTTGCGAATTCCTGTTGCTTATGTTAAAACTTTCCAAGGTCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCTAAGAACTACGGTAGAGCGGTTTATGAATGTCTCCGCG--------GTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAACCCTTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCTGAAGCACTTTATAAAGCACAAGCCGAAACAGGCGAAATCAAAGGACATTACTTGAATGCTACTGCGGGTACATGTGAAGAAATGATAAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTACCCATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCTAATACTAGTTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCACGGTATACATTTCCGTGTACTAGCTAAAGCGTTACGTATGTCTGGCGGAGATCATATTCACTCTGGCACCGTAGTAGGTAAACTGGAAGGGGAAAGAGAGATCACCTTGGGCTTTGTTGATTTACTACGTGATGATTTCATTGAAAAAGACCGAAGTCGCGGTATTTACTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTCTACCCGTTGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTAGCCCTAGAAGCCTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTG--AAGGTAATGAAATTATCCGTGAGGCTTGCAAATGGAGTCTTGAACTAGCCGCTGCTTGTGAGGTATGGAAGGAAATCAAATTCGAATTTGAAGCAATGGATACTTTGTAA--------------------------------------------- Caltha_leptosepala ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAATGACTCTCGGCAACGGATATCTCGG---CTCTTGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCC-ACTAGGTTGAGGGCACGTCTGCCT---GGGC-GTCACAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCTTT----GCAGAA-CGACCTG-TGAATTTGTGAAAC-AAACTT-TTTGGGCAAGATAGGGTACAACAA------GCTCTTACTCGTCCATTTTGTTGGGATGTGGAATCAACCAAAATTTGCATAT--TCAT------------GTGAATGCGGTTGACCCATG-TTCTCGCAC--AAACAAAAAACCCGG-CGCAA-TATGTGCC-AAGGAAATCATA-----GCGGAAATAGG-GTGTTATTCCCA---TT------TGGT-----GATGGCAT-CGCTAATCCGATACTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Calypso_bulbosa ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTGTCGGCCA-AGGGCACGTCTGCCTGGGCGTCATGCGTTGCATTCGCTC-C--GTGCCAACACCATCACACCTATGAGTGT-TTGGGGAAGGCTCGGATGTGC---ATATTGGCTCATCGTGCCCATTGGCGCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAGAC----CG-AAG-TATATGG-AGTGA-TT---------CAGCGAACTC-----GTGAAATTA----G------CGATTGCAACTG-ATGTTGTGATTA--GCCGTCCCAATTGTTTTCCCCACGGTTTCAT------------CGAGGGGTAGCGATGAAGG-----ATGGAT--TAAAACTCAAACCGG-CGCAGTTACGCGCC-AAGGGAATATC------GAAAGACACGAG---------------CCTTTCATTGGGT-------TTAGTGTTGTGGAGTG-CATTG----CACACCATACGGATTGACATGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGCGAACCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGATTTCGGCAACAAAACTTCCTATATCCACTACTCCTTCAGGAGTATATTTACTCACTTGCTCATTATCATAGCTTCAATAGTTTGATTTTTTACGAACCTGTAGA------------AATTCTCGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTA------------CTCGAATGTATCAACAGAAATCT------TTGATTTCTTCGGTGAATGATTCTAACCAAAATGAATTT---------------TGGGGGTACAAGAATTCTTTTTCTTCTCATTTTTCTTCTCAAATGGTATCAGAAGGTTTTGGAGTCATTCTGGAAATTCCATTCTCATCGCGATTAGTATCTTCCCTTG--------------------AAAAAAAAAGAATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAGGATAAATTATCACATTTAAATTATGTGTCAGATCTACTAATACCCCATCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTT--GCATTTATT------GCGATTGTTTTTCCACG-------AATATCACAATTTGA------ATAGC---CTCTTTAC------TTCAAAGAAATCCATTT------------------ACGTCTTTTCA------AAAAGAAACAAAAG------ATTCTTTGGTTTCTTACATAATTCTTATGTATATGAATGCGAATATCTATTTCTGTTTCTTTGTAAAAAGTCTTCTTATTTACGATCAATATCTTCTGGAGTCTTTCTTGAGCGAACACATTTTTATGG---------------AAAAATA------GAATATCTT---------------------ATAGTCGTGTGTTGCAATTCTTTTCAGAGAATCCTA------TGGTTCCTCAAAGATACTTTCATACATTATGTTCGATATCAAGGAAAAGCAATTCTGGCTTCAAAAGGAACTCTTATTCTGATGAAGAAATGGAAATTTC-ATCTTGTGAAT---TTTTGGCAATCTTATTTTCACTTTTGGTTTCAACCTTATAGGATCCATATAAAG------CAATTAACCAATTATTCCTTCTCTTTTCTGGGGTATTTTTCAAGTG------TGCTAAAAAATCATTTGGTAGTAAGAAATCAAATGCTAGAGAATTCATTTCTAATAAATAC------TCTGACTAATAAATTAGATACCATAGCCCCAGTGATTTCTCTTATTGGATCATTGTCAAAAGCTCAATTTTGTACTTTATTGGGTCATCCTATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAGAAACAGGTTTTGTATCGTATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGG-CTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAA------GATTAGGTTCGGGATTCTTAGAAGAATTTTTCTTGGAAGAAGAACAATA------TCTTTCTTTAATCTTCCTCCAAAAAATCCCTTTTATTTTACACGGATTACATAGAGAACGTATTTGGTATTTGGACATTATCCGTATCAACGATCTGGTGGATCATTCATGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCGGGAGTTCCGCCTGAAGAAGCGGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGGCTGTTGTTGGGGAGGAAAATCAATATTTTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCCTGCGAGCTCTACGTCTGGAAGATCTGCGAATTCCCCCTTCTTATTCCAAAACTTTCCAAGGTCCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTACGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGGG--------GTGGACTTGATTTTACTAAGGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCTCTTTATAAAGCGCAAGCCGAAACGGGTGAAATTAAAGGACATTACTTGAATGCAACTGCGGGTACATGTGAAGAAATGATCAAAAGAGCGGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACTGGGGGGTTCACCGCAAATACTAGTTTGGCTCATTATTGCCGCGACAATGGTCTACTTCTTCACATCCATCGTGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATCCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCCGGTACAGTAGTGGGTAAACTGGAGGGGGAACGTGAGATGACTTTGGGTTTTGTTGATTTGTTACGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTTTTTCACTCAAGACTGGGTCTCTATGCCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTAACCGAAATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGGCACCCTTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTGGCTTTAGAAGCATGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTG--AGGGTAATGATATTATTCGTGAAGCTACCAAATGGAG---------------------------------------------------------------------------------------------------------------------- Camelina_microcarpa -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGATACCTGTCC--AAACAGAA-CGACCCGCG-AACCAACGATCACCACTCTCGGTAGGCCGGTTTCTTAGCTGAT--------CCCGTTGCCT--GCCGT-CTCCGTGGT-TTCGCGTATCTTCCCG-GTCGAGAGCTCTAT--------CTCGGTCTGG-TCGTGCGCGTTGCTTCCGGAT--AT-CACAAAACCCCGGCACG-AAAAGTGTC-AAGGAACATGC-AACCGAA---CGGCT---TTGGCATTCGCCTCCCCGGAGACGG--TG-T--GTGCGCGGAT-----GCTGAGCTGCGA--TCTAAAGTCTACCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGAAATTTCAA------GGATATTTAGAGCTCGATGGGGCTCGGCAACAGAGTTTTCTATATCCACTTTTTTTTCGGGAGTATATTTATGTACTTGCTTATGATCATGGTTTAAATAGATTAAATAGAAATCCCTCTATTTTCTTGGAAAATACGGATTATGACAAAAAATATA------GTTTACTAATTGTGAAACGCTTAATTT------------TGCGAATGTATGAACAGAATCGT------TTGATTATTCCCACTAAGGATTTGAACCAAAAC---------------------TCCTTTTTGGGGCATACCAGCCTTTTCTATTATCA------AATGATATCCGTTTTATTTGCAGTGATTGTAGAAATTCCATTTTCCCTAAGATTAGGATCCTCTTTTC--------------AAGGAAAACAATTAAAAA------AATCTTATAATTTACAATCAATTCATTCAATATTTCCCTTTTTAGAAGACAAATTAACACATTTTAATTATGTGTTAGATGTACTAATACCTTACCCCATCCATCTAGAAATCTTGGTTCAAACCCTACGTTACCGGGTAAAAGATGCCTCTTCTTT--GCATTTTTT------TCGGTTCTGTTTATACG-------AGTATTGCAAT------TGGAA---GAATTTTTATATTAAAA------AAAAAT------------------------CAATTTT---------------GAATCCAAG------ATTTTTCTTGTTCTTATATAATTCTCATGTATGTGAATACGAATCGATCCTTTTCTTTCTACGCAATAGGTCTTCGCATTTACGATCGACATCTTATGAAGTCCTTTTTGAACGAATTTTATTCTATGG---------------AAAAATA------CAACATTTTT------------TAAAAG------TTTTTGTTAATAATTTTCCGGTG---ATCCTA------GGGTTGCTCAAGGATCCTTTCATACATTATGTTAGATATCACGGAAGATGCATTCTGGCAACAAAGGATACGGCGCTTCTGATGAATAAATGGAAATATT-ATTTTGTTAAT---TTCTGGCAATGTTATTTTTCCGTATGGTTTCAATCGCAAAAGGTCAAGATAAA------TAAATTATCTAAAGAAAATTTAGAGTTTCTGGGTTATCTGTCAAGTT------TGCAATTAAACCCTTTAGTGGTACGTAGTCAAATGCTAGAAAACTCATTTCTAATCGATAA------TGTTAGAATAAAATTGGATAGCAAAATTCCAATTTCTTCTATTATTGGATCATTGGCTAAAGATAAATTTTGTAATATATTAGGGCATCCCATTAGTAAAGCGACCTGGACGGATTCATCAGATTCTGATATTCTCAACCGATTTGTGCGTATATGCAGAAATATTTCTCATTATTACAGCGGATCTTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGTCTTTGTTGTGTTAAAACTTTGG-CTCGTAAACACAAAAGTACTGTACGTGCTTTTTTAAAAAG---GTTGGGCTCGGGT---TTATTGGAAGAATTCCTTACGGGCGAAGACCAAGT------TCTTTCTTTAATCTTCCCAAGAAGTTATTATGCTTCTAAAAGATTATATCGAGTGCGAAT---TTGGTATTTGGATATTCTTTATCTTAATGAATTGGTCCATCATGAATAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Campanula -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Campanula_parryi ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGACTCTCGGCAACGGATATCTTGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTA-GGCTGAGGGCACGTCTGCAT---GGGC-GTCACGCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAT---AGCAGAA-CAACCCG-CGAACACGTTGAACAACACATTC-GAGGGGACATTTGTATAG----------GAAAAGGCTAATTAATGCCCCCCATGCATTTGACCCCTTCCTTGTTGTGTTTGAGCAA--------------ACGAGCGAAAGCGCGTGAGCTTCGACCCTCAAGAAACCAACCCCGGCGCA-ATTCGCGCC-AAGGAAAACTTTAAACTCAAGGGTGTA-CTATCCCCATGTCGACCCCGTTTGCGGG-TGTGCGATTGG-TGATTGGTCACTCCTTAGTGAAAAACAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAGAATTTCAAAGCGCTTTAGAGTTCGATAGATTTCAACAACATGATTTCTTATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGCTCATGATCATGGTTTAAATGGATCCATTT---TGTTG------------AAAAATGTAGGTTATGACAATCAATTCA------GCTTACTAATTGTGAAACGGTTAATTCTTCG------------AATGTATGACCAGAATTAT------TTGATTCATTCTACGAATGATTGTAAACAAAAGCCATTT---------------------TGGGGACGCAGCAAGAATTTTGAGTCTCA------AATCATATCAGAAGCATTTTCGGTCATTCTGGAAATTCCATTTTCTCGACGATTACTATCTTCGCTAGAAAAGT-----TCGAAAAGAAGGGGGAAGGTAGAGTTAAATCCGAAAATTTACGATCAATTCATTCAATATTTTCTTTTTTAGAGGATAAAATTGACCATTTACATTATCTGTTCGATATACTAATACCTTACCCAATCCATCTAGAAATATTGGTTCAAGCTCTTCGCTACTGGCTAAAAGATGCTTCGGCTTT--GCATTGCGT------AAGAGTCTTTCTCCACG-------AGTTTCA------TAGTTGGAA---TAGTCTTATTAC------GTCAAAGAAAGTAGGTCTTT---------------CTTTTTCAGAA---------AGAAATCAGAG------ATTTTTATTCTTCCTATATAATTCTCATGTATGTGAATATGAATCCATCTTTGTCTTTCTCCTGAACCAATCTTCTCATTTACGATCAACATCTTCTAGAGCCCTTGGTGAACGAATCTATTTCTATGG---------------AAAAATA------GAGCATCTTG------------GAGAAGTCTTGTC------CAGGGCTTTT-CAAGCC--AATCTA------GGGATATTCACCGATTCTTTCATGCATTATGTTAGGTATCAAGGAAAATCAATTATCGTTTCAAAAGGTACGTCTCTTGTGATGAATAAATGGCAATATT-ACTTTGTAAAT---TTATGGCAATCTTATTTTTACTTGTGGTCTCAACCAAGAAGGATCCATATAAAT------CAATTATCCAATCATTCCCTTGACTTTCTCGCTTATTTTTCAAGT------GTGCGGCGAAGGACTTCAACAGTACGCAATCAAATGCTAGCAAAGTTATTTCTAAGCGATAA------TGCTATTAAGAAGTTTGATACTTTTGTTCCAATTATTCCCCTGATTGGATCATTGGCTAAATCCAAATTTTGTAATAGAGCAGGTTATCCCAGTAGTAAGGCGGTTTGGGTCGATTTAGCAGATTCTGATATTATTGACCGATTCGGGCGTATATCCAGAAATCTTTCTCATTATTATAGTGGATCCTCAAAAAAAAAGAGTTTGTCTCGAATAAAGTATATACTTCAACTTTCTTGTGCTAGAACTTTAG-CTCGTAAACACAAAAGTACTGTAAGGTCTTTTTTCAAAA------GATTCGGATCGGAATTATTGGAAGAATTCTTTACGGCGGACGAACAAGC------TCTTTCCTTGACCTTTCCCAGAGCTTCTTCTATTTCGCGTAGGTTATATAGCGAGAGGCT---TTGGTATTTGGATATTATTAGTTGTATCAATCAGTTGGACAATCCTAACTGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGCTGGT-GTAAAAGATTATAAATTAACTTATTATACTCCGGACTATGAAACCAAGGATACCGATATTTTGGCAGCCTTTCGAGTAACTCCTCAACCCGGAGTTGCCCCGGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCGTCTACTGGTACATGGACAACTGTGTGGACTGATGGGCTTACGAGCCTTGATCGTTACAAAGGGAGATGCTATCACATCGAGCCCGTTGCCGGAGAAGAAACTCAATTTATTGCTTATGTAGCTTACCCATTAAACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGATTTAAAGCACTGCGTGCTCTACGTCTAGAAGATTTGCGAATCCCACCTCCGTATATTAAAACATTCCAAGGCCCACCTCACGGCATCCAAGTTGAAAGAAAAAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCAAAATTAGGGTTATCCGCAAAAAACTACGGCAGAGCAGTTTATGAATGTCTTCGTG--------GTGGACTTGACTTTACTAAAGATGATGAGAACGTCAACTCCCAACCCTTTATGCGGTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCGGGTACATCCGAAGAAATGATGAAAAGGGCTGTATTTGCCAGAGAGTTGGGAGTTCCTATCATAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATATTTGTCTACTTCTTCACATCCACCGCGCAATGCATGCCGTTATTGATAGACAGAAGAATCATGGTATGCACTTTCGTGTATTAGCTAAAGCCTTACGTATGTCTGGTGGAGATCATATTCACTCCGGGACAGTAGTATGTAAACTTGAAGGGGAAAGAGAGATCACTTTGGGCTTTGTTGATTTACTGCGCGATGATTTTGTTGAAAAAGATCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTCTGCCTGTGGCTTCAGGCGGTATTCACGTTTGGCATATGCCTGCTCTGACGGAGATTTTTGGGGATGATTCCGTACTACAGTTCGGGGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCCCGTAATGAGGGACGTGATCTTGCTCGTG--AGGGTAATGAAATTATCCGGAAGGCTGCCAAATGGAGTCCTGAGCTATTTTCTGCTTGTGAGGTATGGAAAGAGA-------------------------------------------------------------------------------- Campanula_rotundifolia ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGACTCTCGGCAACGGATATCTTGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTA-GGCCGAGGGCACGTCTGCAT---GGGC-GTCACGCAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAA---AGCAGAA-CAACCCG-CGAACACGTTGAACAACACATTC-GAGGGGACATTTGTATAG----------GAAAAGGCTAATTAATGCCCCCCGTGCATTTGACCCCTTCCTTGTCGTGTTGGAGCAA--------------ACGAGCGAAAGCGCGTGAGCTTCAGCCCTCAAGAAACCAACCCCGGCGCA-ATTCGCGCC-AAGGAAAACTTTAAACTCAAGGGTGTA-CTATCCCCATGTCGACCCCGTTTGCGGG-TGCGCGATTGG-TGATTGGTCACTCCTTAGTGAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAGAATTTCAAAGCGCTTTAGAGTTCGATAGATTTCAACAACATGACTTCTTATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGCTCATGATCATGGTTTAAATGGATCCATTT---TGTTG------------AAAAATGTAGGTTATGGCAATAAATTCA------GCTTACTAATTGTGAAACGGTTAATTCTTCG------------AATGTATGACCAGAATTAT------TTGATTCATTCTACGAATGATTGTAAACAAAAGCCATTT---------------------TGGGGGCGCAGCAAGAATTTTGAGTCTCA------AATCATATCAGAAGCATTTTCGGTCATTCTGGAAATTCCATTTTCTCGACGATTACTATCTTCGCTAGAAAAGT-----TCGAAAAGAAGGGGGACGGTAGAGTTAAATCCGAAAATTTACGATCAATTCATTCAATATTTTCTTTTTTAGAGGATAAAATTTCCCATTTACATTATCTGTTCGATATACTAATACCTTACCCAATCCATCTAGAAATATTGGTTCAAGCTCTTCGCTACTGCCTAAAAGATGCTTCGGCTTT--GCATTGCGT------AAGAGTCTTTCTCCACG-------AGTTTCA------TCATTGGAA---TAGTCTTATTAC------GTCAAAGAAAGTAGGTCTTT---------------CTTTTTCAGAA---------AGAAATCAAAG------ATTTTTATTCTTCCTATATAATTCTCATGTATGTGAATATGAATCCATCTTTGTCTTTCTCCTGAACCAATCTTCTCATTTACGATCAACATCTTCTAGAGCCCTTGGTGAACGAATCTATTTCTATGG---------------AAAAATA------GAGCATCTTG------------GAGAAGTCTTGTC------CAGGGCTTTT-CAAGCC--AATCTA------GGGATATTCACCGATTCTTTCATGCATTATGTTAGGTATCAAGGAAAATCAATTCTCGTTTCAAAAGGTACGTCTCTTGTGATGAATAAATGGCAATATT-ACTTTGTAAAT---TTATGGCAATCTTATTTTTACTTGTGGTCTCAACCAAGAAGCATCCATATAAAT------CAATTATCCAATCATTCCCTTGACTTTCTCGCTTATTTTTCAAGT------GTGCGGCGAAGGACTTCAACAGTACGCAATCAAATGCTATCAAAGTTATTTCTAAGCGATAA------TGCTATTAAGAAGTTTGATACTTTTGTTCCAATTATTCCCCTGATTGGATCATTGGTTAAATACAAATTTTGTAATAGAGCAGGTTATCCCAGTAGTAAGGCGGTTTGGGTCGATTTAACAGATTCTCATATTATTGACCGATTCGGGCGTATATCCAGAAATCTTTCTCATTATTATAGTGGATCCTCAAAAAAAAAGAGTTTGTCTCGAATAAAGTATATACTTCAACTTTCTTGTGCTAGAACTTTAG-CTCGTAAACACAAAAGTACTGTAAGGTCTTTTTTCAAAA------GATTCGGATCGGAATTATTGGAAGAATTCTTTACGGCGGACGAACAAGC------TCTTTCCTTGACCTTTCCCAGAGCTTCTTCTATTTCGCGTAGGTTATATAGCGAGAGGGT---TTGGTATTTGGATATTATTAGTTGTATCAATCAGTTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATGTTGGATTTAAGGCTGGT-GTAAAAGATTATAAATTAACTTATTATACTCCGGACTATGAAACCAAGGATACCGATATTTTGGCAGCCTTTCGAGTAA?TCCTCAACCCGGAGTTCCCCCGGAAGAAGCAGGGGCGGCAGTAGCTGCTGAAT?GTCTACTGGGACATGGACAACTGTGTGGACTGATGGGCTTACGAGCCTTGATCGTTACAAAGGGAGATGCTATCACATCGAGCCCGTTGCCGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGATTTAAAGCACTGCGTGCTCTACGTCTAGAAGATTTGCGAATCCCACCTGCGTATATTAAAACATTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCAAAATTAGGGTTATCCGCAAAAAACTACGGCAGAGCAGTTTATGAATGTCTTCGTG--------GTGGACTTGACTTTACTAAAGATGATGAGAACGTCAACTCCCAACCCTTTATGCGGTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGCGAAATCAAAGGACATTACTTGAATGCTACTGCGGGTACATCCGAAGAAATGATGAAAAGGGCTGTATTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACATAACCGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCCGTTATTGATAGACAGAAGAATCATGGTATACACTTTCGTGTATTAGCTAAAGCCTTACGTATGTCTGGGGGAGATCATATTCACTCCGGGACAGTAGTAGGTAAACTTGAAGGGGAAAGAGAGATCACTTTGGGCTTTGTTGATTTACTGCGCGATGATTTTGTTGAAAAAGATCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTCTGCCCGTGGCTTCAGGCGGTATTCACGTTTGGCATATGCCTGCTCTGACGGAGATTTTTGGGGATGATTCCGTACTACAGTTCGGGGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCCCGTAATGAGGGACGTGATCTTGCTCGTG--AGGGTAATGAAATTATACGGAAGGCTGCCAAATGGAGTCCTGAGCTATTTTCTGCTTGTGAAGTATGGAAAGAGATCAAATTTGAGTTTGCCGCAATGGATACGTTATAA--------------------------------------------- Campanula_uniflora ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTA-GGCCGAGGGCACGTCTGCAT---GGGC-GTCACGCAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAACCCTGCAT---AGCAGAA-CAACCCG-TGAACACGTTGAAAAACACATTTTGGGGGGATGTGTGT-TCG----------GACAAGGCG----ACAGCCCCCCGTGCATGCATCCCTTGACTTGTGGTGTCGTAGCAA--------------GCGAGCGAAAGCGCGTGAGCTTTGGCCCCCAAGTAACTAACCCCGGCGCA-ATACGCGCC-AAGGAAAACTTAAAACTCAAGGGCGTATCCATCCTCTTGTTGCCCCCGTTTTCGGG-TGCGCGACTGGGTGTTTGGACGCTCCTTAGTGAAAA-CACA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGGAATTTCAAAGCGCTTTAGAGCTCGATAGATTTCAACAACATGACTTCTTATATCCACTTATCTTTCAGGAATATATTTATGCACTTGCTCATGATCATGGTTTGAATGGATCCATTT---TATTG------------AAAAATGTAGGTTATGAGAATAAATTCA------GCTTACTAATTGTGAAACGGTTAATTCCTCG------------AATGTATGACCAGAATTAT------TTGATTCATTCTACAAATGATTGTAAACAAAAGCCATTT---------------------TGGGGACGCACCAATAATTTTGAGTCTCA------AATGATATCAGAAGCATTTTCGGTCATTATGGAAATTCCATTTTCTCTACGATTACTATCTTGTCTAGAAAAGT-----TCGAAAAGAAGGGGGAAGGTAGAGTAAAATCCGATAATTTACAATCAATTCATTCAATATTTTCTTTTTTAGAGGATAAAATTTTACATTTACATTATGTCTTAGATATACTAATACCTTACCCAATCCATCTAGAAATCTTGGTTCAAGCTCTTCGCTACTGGCTAAAAGATGCTTCGGCTTT--GCATTTTGT------AAGATTCTTTCTCCACG-------AGTTTCA------TAATTGGAA---TAGTCTTATTAC------GTCAAAGAAAGTCGGTCCTT---------------CTTTTTCAGAA---------AGAAATCAAAG------ATTCTTCTTCTTCCTATATAATTCTCATGTATGTGAATATGAATCCATCTTTGTCTTTCTCCG?????????????????????????????????????????TTGTTGAACGAATCTATTTCTATGG---------------AAAAATA------GCGCATCTTG------------GAGAAGTCTTGTC------CAGGGCTTTT-CAAGCC--AATCTA------TGGATATTCACCGATTCTTTCATGCATTATGTTAGGTATCAAGGAAAATCAATTCTCGCATCAAAAGGTACGTCTCTTGTGATGAATAAATGGCAATATT-ACTTTGTAAAT---TTATGGCAAGCTTATTTTTACCTGTGGTCTCAACCAAGAAGGATCCATATAAAC------CAATTAGCCAATCATTCCCTTGACTTTCTAGCTTATTTTTCAAGT------GTGCGGCGAAGGCCTTCAATGATACGCAATCAAATGCTAGCAAAGTTATTTCTAAGCGAGAA------TGCTTTTAAAAAGTTTGATACTTTTGTTCCAATTATTCCCCTGATTGGATCATTGGCTAAATCCAAATTTTGTAATAGAGCAGGTTATCCGAGTAGTAAGGCGGTTTGGGTCGATTTATCAGATTCTGATATTATTGATCGATTCGGGCGTATATCCAGAAATCTTTCTCATTATCATAGTGGATGCTCAAAAAAAAAGAGTTTGTTTCGAATAAAGTATATACTTCAACTTTCTTGTGCTAGAACTTTAG-CTCGTAAACACAAAAGTACTGTAAGGGCTTTTTTGCAAA------GATTCGGATCGGAATTATTGGAAGAATTCTTTACGGCGGAAGAACAAGT------TCTTTCCTTGACCTTTCCCAGAGCTTCTTCTATTTCGCGTAGGTTATATAGCGAGAGGGT---TTGGTATTTGGATATT---AGTTGTATCAATGAATTGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTATAAATTAACTTATTATACTCCGGACTATGAAACCAAAGATACCGATATTTTGGCAGCCTTTCGAGTAACTCCTCAACCCGGAGTTCCCCCGGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCGTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACGAGCCTTGATCGTTACAAAGGGAGATGCTATCACATCGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGATTTAAAGCACTGCGTGCTCTACGTCTAGAAGATTTGCGCATCCCACCTGCGTATATTAAAACATTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCAAAATTAGGGTTATCCGCTAAAAACTACGGCAGAGCAGTTTATGAATGTCTTCGTG--------GTGGACTTGATTTTACTAAAGATGATGAGAACGTCAACTCCCAACCCTTTATGCGGTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGGGAAATCAAAGGACATTACTTGAATGCTACTGCGGGTACATCCGAAGACATGATGAAAAGGGCTGTATTTGCCAGAGAGTTGGGAGTTCCTATCATAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCACTTTCGTGTATTAGCTAAAGCCTTACGTATGTCTGGTGGAGATCATATTCACTCCGGGACCGTAGTAGGTAAACTTGAAGGGGAAAGAGAGATCACTTTGGGCTTTGTTGATTTACTGCGCGATGATTTTGTTGAAAAAGATCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTCTGCCCGTGGCTTCGGGCGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATTTTTGGGGATGATTCTGTACTACAGTTCGGGGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCTAATCGAGTCGCTCTAGAAGCATGTGTACAAGCCCGTAATGAGGGACGTGATCTTGCTCGTG--AGGGTAATGAAATTATCCGGAAGGCTGCCAAATGGAGTCC------------------------------------------------------------------------------------------------------------------- Cardamine_cordifolia ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCT-GGCCGAGGGCACGTCTGCCT---GGGT-GTCACAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGTCC-AAAACAGAAACGACCCGCGTAACCAAAGATCACCACCCACGGTGGGCCGGTTTCTTAGCTGTG--------ATCGT-GCCT--GCCGA-ATCCGTGGT-TTCGCGAACAATCCTT-ACCGGGAGCTCTAT--------CTCCGTTTGGGTTGTGCGCGTTGCTTCCGGAT--AT-CACAAAACCACGGCACG-AAAAGTGTC-AAGGAACATGC-AATTTAA---CAGCC-----AGCCTTCGCCTCCCCGGAGACGG--TG-T--GTGTGCGGAT-----GCTGCGCTGCGA--TCTAAAGTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cardamine_pensylvanica ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCT-GGCCGAGGGCACGTCTGCCT---GGGT-GTCACAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTATCCTGTCC-AAAACAGAA-CGACCCGCG-AACCAAAGATCATCACTCACGGTGAGCCGGTTTCTTAGCTGAG--------ATCGT-GCCT--GCCGA-ATCCGTGGT-TTCGCGAACAATCCTT-ACCGGGAGCTTTAT--------CTCTGTTTGGATTGTGCGCGTTGCTTCCGGAT--AT-CACAAAACCACGGCACG-AAAAGTGTC-AAGGAACATGC-AATTGAA---CAGCC-----AGCCTTCGCCTCCCCGGAGACGG--TG-T--GTGTGCGGAT-----GCTGCGCTGCGA--T-TAAAGTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-----------------------------------------------AAGTGTTGGATTCAAAGCTGGT-GTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCCGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGACGGGCTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCAGGAGAAGAAACTCAATTTATTGCGTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCGGTTACTAACATGTTTACCTCGATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGGCTGCTCTACGTCTAGAGGATCTGCGAATCCCTCCTGCTTATACTAAAACTTTCCAGGGACCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGACGTCCCCTATTAGGATGTACTATTAAACCAAAATTGGGGTTATCCGCGAAGAACTATGGTAGAGCAGTTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAGAATGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAGTCACAGGCTGAAACAGGTGAAATCAAAGGGCATTATTTAAATGCTACTGCGGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGTTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCACGCTGTTATTGATAGACAGAAGAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCTTTACGTCTATCTGGTGGAGATCATGTTCACGCGGGTACAGTAGTAGGTAAACTTGAAGGAGACAGGGAGTCAACTTTGGGCTTTGTTGATTTACTGCGCGATGATTATGTTGAAAAAGATCGAAGCCGCGGTATCTTTTTCACTCAAGATTGGGTCTCACTACCAGGTGTTCTGCCTGTGGCTTCGGGGGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGATTCCGTACTACAATTCGGTGGCGGAACTTTAGGCCACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAACCGAGTAGCTCTGGAAGCATGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCAATCG--AGGGTAATACAATTATCCGTGAGGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCT--------------------------------------------------------------------------------------------------- Carex -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Carex_albonigra ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAATATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTGTCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_aquatilis ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-G-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-CTCCA-----GAAACA-CGACCGT-CGAACACGT------GACAGAA--TGCTGCCGCGGAGGCG----------------CCTGCC-----GCCTCCTCGGCCCC-ACCGGCCTCC--TCC--CTCTCGCCCTT--------------CGGGGCGCGTTGGTTGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGG------TAAA--GCTGAGGCAC-CGGCGA--GCCGCTCAAGGTCTC------CGTCGGTTGCCAA-GGCCAAAAAAAAAAAAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATAATGTATTGGATATATTAATACCTTATCCTGTCCATTTTGAAATCTTAGTTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTTTT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTTTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTT{AT}ACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAGGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTGGTCTAT---TTTGGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCATTCTACTTTATCGGTTATTTTTTAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCAGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGTTGGA?AA?AAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAA?AAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAA?ACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTA?AGCATGTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Carex_arapahoensis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--TGCTGTCGGGGAGGTG----------------CTTGTT-----GCCTCCTTGGCCCC-ACCGGCCTCG--TCC--CTCTAGCCCT---------------TCGGGCGAGTTGGATGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GCCGTCAAAGGGCTTG-----CATCGGGTGCCGA-GGCCAATGAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATACTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCATAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TCAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_athrostachya ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--TGCTGTCGGGGAGGTG----------------CTTGTT-----GCCTCCTCGGCCCC-ACCGGCCTCG--TCC--CTCTAGCCCT---------------TCGGGCGAGTTGGATGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GCCGTCAAAGGTCTTG-----CATCGGGTGCCGA-GGCCAATGAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_atrosquama -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Carex_bella --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-TTCCG-----AAAACA-CGACCGT-CGAACACGT------GACAGAA--TGCTGCCGCGGGGGCG----------------CTTGCC-----GCCTCCTCGGCCCC-ACCGGCCTCA--TCC--CTCTCGCCCGA--------------C-GGGCGCGTTGGTTGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------GAAAA-GCTAAGGAAC-CGGCGA--GCCGCACACGGGCTC------TGCCGGTTGCCAA-GGCCAACAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_brunnescens ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--CGCTGCCGGGGAGGTG----------------CTAGCT-----GCCTCCTCGGCCCT-ACCGTCCTCG--TCC--CTCTAGCCCT---------------TCGGGCGTGTTGGATGT-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GCCGTCAAAGGTTCTG-----CGTCGGGTGCCGA-GGCAAATGAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTTG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACCATTAAGATCTTTTCTAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAATAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGGATTTTGTATCGAATGAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_canescens ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACAAGT------GACAGAA--CGCTGCCGGGGAGGTG----------------CTTGCT-----GCCTCCTCGGCCCC-ACCGGCCTCG--TCC--CTCTAGCCTT---------------TCAGGCGAGTTGGATGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GCCGCTAAAGGGCTGG-----CGTCGGGTGCCCA-GGCCAATGAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATACTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCCGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATTTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------AAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TAAAAATAAACTACTTGGAGGTAAGGAGTCAAATCCTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAGCAGGTGTTGGGTTTAAAGCAGGG-GTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCACCTGAAGAAGCAGGAGCTGCAGTAGCGGCAGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGCTTAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTG--AAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------------------------------- Carex_capillaris ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-TTCAA-----AAAACA-CGACCGT-CGAACACGT------GACAGAA--TGCTGCCGCTGAGGCG----------------CTTGCC-----GCCTCTCCGGCCCC-ACCGGCCTCC--TCC--CTCTCGCCCTC--------------C-GGGCGCGTTGGTTGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAA--GCTGAGGCAC-CGG-----------------CTC------TGTCGGTTGCCAA-GGCCAACAAAAGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGGTCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTATTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAGATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAACCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTTTAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCAGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGTTGGA?AAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGA?TGCTACTGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Carex_deweyana ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-CTCGA-----AAAACA-CGACCGT-TGAACACGT------GACAGAA--CGCTGCCGGAGAGGCG----------------CTCGCC-----GCCTCCTCGGCCCC-ACCGGCCTCG--TCC--CTCTAGCCCT---------------CCGGGCGAGTTGGATGC-----TG--GC--CGGAACACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTGAGGCAC-CGGCCG--GCCGCTTAAGGGCCTG-----CGCCGGGCGCCGA-GGCCAACGAAAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATTCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAACAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACGATTAAGATCTTTTCTAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATTGGTTATTTTATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTCTATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGATAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_disperma ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCAAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-CTCGA-----AAAACA-TGACCGT-TGCACACGT------GACAGAA--CGCTGTCGGGGAGGTG----------------CTTGTT-----GCCTCTTCGGCCCC-ACCGGCCTCG--TCC--CTCTAGCCCT---------------TCGAGCGAGTTGGATGA-----TG--GC--CGGAAAACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GCCGTCAAAGGGCTTG-----CATCGGGTGCCGA-GGCCAATGAAAAAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACCATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAATAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTAAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTCCATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_duriuscula ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACAAGT------GACAGAA--TGCTGCCGGAGAGGTG----------------CTTGCT-----GCCTCCTCGGCCCC-ACCGGCCTCG--TCC--CTCTAGCCTT---------------TCGGGCGAGTTGGATGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAGAA-GCTGAGGCAC-CGGCAG--G{CT}CGCTAAAGGGCTGG-----CGTCGGGTGCCAA-GGCCAACGAAAAAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATTATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACCGTTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAATAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTCATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_ebenea ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--TGCTGTCGGGGAGGTG----------------CTTGTT-----GCCTCCTCGGCCCC-ACCGGCCTCG--TCC--CTCTAGCCCT---------------TCGGGCGAGTTGGATGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GCCGTCAAAGGGCTTG-----CATCGGGTGCCGA-GGCCAATGAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCATAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGTCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_echinata ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACACGT------GACAGAACATGCTGTCGGGGAGGTG----------------CTTGCT-----GCCTCCTCGGCCCC-ACCGGCCTCG--TTC--CTCTAGCCCT---------------TCGGGCGAGTTGGATGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTATAGCCGCTAAAGGGCTTG-----CGCCGGATGCCAA-GGCCAATGAAAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTTTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------GAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTTTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TAAAAATAAATTACTTGGAGGTAAAGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGGG-GTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCAGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCGGCAGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Carex_elynoides -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Carex_engelmannii ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTATTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---GTCAATAC------TTCAAAGAGATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGGTCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CTATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTGTAAGTG------TAAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCGATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAAAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_filifolia -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTCAT---GGGG-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTGCCT--TGAA-----AAAACA-CGACCGT-TCCACACGT------GATAGAA--TGCTACCAAAGAGGTG----------------CTTGCT-----GCCTCCTTGGCCCCAGCCGGCCTCT--TCC--CTCTCGCCTTG--------------TGGG-CGCGTTGGTGGC-----TG--AC--CGAAATACGACGCGG-GAT-G--ACAC--C-AAAGAACAACA------TAAAG--ATGAGGCAT-CGGCGA--GGCGCTCAATGG-TTG-----CGCCGGTTGCCGA-GGCCAATGAAAAAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTATTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATTATTCTAATTCGA------ATAGT---GTTATTTC------CTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAATTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTGTAAGTG------TAAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTAATAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCGATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAAAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_geophila ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCACGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-TTCC------AAAACA-CGACCGT-CGAACACGT------GACAGAA--TGCTGCCGCGGAGGTG----------------CTTGCC-----GCCTCCTCGGCCCC-ACCGGCCTCA--CCC--CTCTCGCCCT---------------C-GGGCGCGTCGGTTGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------GAAA--GCTGAGGCAC-CGGCGA--GCCGCACAAGGGCTC------CGTCGGTTGCCAA-GGCCAAACAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTTTAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAATCCTTTCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTATAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTCTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_geyeri -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTCAC---GGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-CT--G-----AAAACA-CGACCGC-TGAACACGT------GACACAA--CGCTGCCGGGGAGGTG----------------CTTGCT-----GCCTCCTCGGCCCT-ACCGGCCTCT--TCC--CTCGCGCCCC---------------TCGGGCGCGTCGGTCGC-----TG--TC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGG------TAGAG--CCGGGGCAC-CGGCGA--GCCGCTCAA-GGCTCG-----CGTCGGTCGCCGA-GGCCAATGAAAAACAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTATTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---GTCAGTAT------TTCAAATAAATCGGTTT------------------CTATATTCTCA------AAAGGAAATATAAG------ACTCTCTCGTTTTTTATATAATTCTTATGTATCAGAATATGATTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTGTAAGTG------TAAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAAAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_hallii ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCGTTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTTGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTGTCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_haydeniana ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--TGCTGTCGGGGAGGTG----------------CTTGTT-----GCCTCCTCGGCCCC-ACCGGCCTCG--TTC--CTCTAGCCCT---------------TCGGGCGAGTTGGATGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GCCGTCAAAGGGCTTG-----CATCGGGTGCCGA-GGCCAATGAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTTTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCATTCTACTTTATCGGTTATTTTTTAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATATTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTATATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_heteroneura ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-TTCCG-----AAAACA-CGACCGT-CGAACACGT------GACAGAA--TGCTGCCGCGGAGGCG----------------CTTGCC-----GCCTCCTCGGCCCC-ACCGGCCTCA--TCC--CTCTCGCCCGA--------------C-GGGCGCGTTGGTTGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------GAAAA-GCTAAGGAAC-CGGCGA--GCCGCACAAGGGCTC------TGTCGGTTGCCAA-GGCCAACAAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATTTTTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTGTCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_illota ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--CGCTGCCGGGGAGGTGGTG-------------CTTGCT-----GCCTCCTTGGCCCC-ACCGGCCTCG--TCC--CTCTAGCCCT---------------TCGGGCGAGTTGGATGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GCCGTCAAAGGGCATG-----CGCCGGGTGCCGA-GGCCAATGAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTTTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------AAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTTTAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_inops ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCACGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-TTCC------AAAACA-CGACCGC-TGAACACGT------GACAGAA--TGCTGCCGCGGAGGTG----------------CTTGCC-----GCCTCCTCGGCCCC-ACCGGCCTCA--CCC--GTCTCGCCCT---------------C-GGGCGCGTCGGTTGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------GAAA--GCTGAGGCGC-CGGCGA--GCCGCACAAGGGCTC------TGTCGGTTGCCAA-GGCCAACAAAAAAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTTTAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTTCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTATAGTAGGACATCCTACTAGTAAGCCAATTTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTCTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_jonesii -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGA-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--CGCTGCCGGAGAGGTG----------------CTTGCT-----GCCTCCTCGGCCCC-ACCGGCCTGG--TCC--CTCTGGCCCT---------------TCGGGCGAGTCGGATGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGT------TAAAA-GCTAAGGCAC-CGGCCA--GCCGCTAAAGGGCCTG-----TGTCGGGTGCCAA-GGCCAATGAAAGAAAAAAAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACAATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTCTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATTGGTTATTTCATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCAAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_lachenalii ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--TGCTGCCGGGGAGGTG----------------CTTGCT-----GCCTCCTCGGCCCT-ACCGTCCTCG--TCC--CTCTAGCCCT---------------TCGGGCGAGTTGGATGT-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GCCGTCAAAGGTTCTG-----CGTCGGGTGCCG{AG}-GGCAAATGAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTATGAGCCTAATAGGTTTCATAGAAAC------AAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATACATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCACCTGAAGAAGCAGGAGCTGCAGTAGCGGCAGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGTTGGA?AAGAAAATCAATTTATTGCCTATGTAGCTTATCCTCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Carex_limosa ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTGCCT-TTCCA-----GAAACA-CGACCGT-TGAACATGT------GACAGAT--TGCTGCCGCGGAGGCG----------------CT?GCC-----GCCTCCTCGGCCCC-ACCGGCCTCC--TCC--CTCTCGCCCTT--------------CGGGGCGCGTTGGTTGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAA--GCTGAGGCAC-CGGTGA--GCCCCTCAAGGTCTC------CGTCGGTTGCCAA-GGCCAACAAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTTTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTTACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCATTCTACTTTATCGATTATTTTTTAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATATTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_magellanica ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGTTGCCT-TTCCA-----GAAACA-CGACCGT-CGAACACGT------GACAGAA--TGCTGCCGCGGAGGCG----------------CTCGCC-----GCCTCCTCGGCCCC-ACCGGCCTCC--TCC--CTCTTGCCCTT--------------CGGGGCGCGTCGGTTGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGG------TAAA--GCTGAGGCAC-CGGCGA--GACGCTCAAGGTCTC------CGTCGGTTGCCAA-GGCCATCAAAAAAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ACAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTTTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTTACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCATTCTACTTTATAGGTTATTTTTTAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATATTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAGCAAGTGTTGGGTTTAAAGCAGGG-GTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCAGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGCTTAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTG--AAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------------------------------- Carex_microptera ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------------------------------------------------------------------------------------------------------------------------TTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--TGCTGTCGGGGAGGTG----------------CTTGTT-----GCCTCCTCGGCCCC-ACCGGCCTCG--TCC--CTCTAGCCCT---------------TCGGGCGAGTTGGATGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GCCGTCAAAGGG{AC}TTG-----CATCGGGTGCCGA-GGCCAATGAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCATAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGTCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_nardina ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCACGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGTTGCCT-TTCGA-----AAAACA-CGACCGT-TGCACGCGT------GACAGAA--TGCTGCCGGGGAGGCG----------------CCCGCC-----GCCTCCCCCGGCCCCACCGGCCTCC--TCC--TTCCCGCCCT---------------CCGGGCGCGTCGGTCGC-----TG--GC--CGGAACACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------GAAAG--CCGAGTCAC-CGGCGG--GCCGCCCGGCGG-TCG-----CGCCGGTTGCATTCGGCCAGCGAAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCAGGATCCAAGATATTTATTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---GTCATTTC------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAATTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAT------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTGTAAGTG------TAAAAATAAATTACTTGGTGGTAACGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTTTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCGATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAAAGAATTTTGTATCGAATGAAGTATATACTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAA?AAGCAGGAGCTGCAGTA?CGGCA?AATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAGCCTGTTGTTGGA?AA?AAAATCAATTTATTGCCTATGTA?CTTATCCTTTA?ATCTTTTTGAA?AAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTAC?A?CTCTACGCTTGGAA?ACTTAC?AATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGA?ATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAATTACGGTA?AGCATGTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Carex_nelsonii ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTGTCAGATTTTGATATTATTAGTCGATTTGGTCGAATATATAAAAATATTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_nigricans ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-TTCGA-----AAAACA-CGACCGT--GCACACGT------GACAGAA--TGCTGCCGGGGAGGTG----------------CTTGCT-----GCCTCCTCGGCCCC-ACCGGCCTCC--TCC--CTCTCGCCCTT--------------CGGGGCGCGTCGGTCGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------GAAAG--CTGAGGCGC-CGGCGA--GCCGCTCAGTGG-TTG-----CGCCGGTTGCCAA-GGCCAATGAAAAAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATACTGGATCCAAGATATTTATTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAAT---ATCATTAC------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAATAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTGTAAGTG------TAAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTTTTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCGATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAAAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_norvegica -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAACCTGCGGAGGATCATTGTCGTCGCCT-TTCCG-----AAAACA-CGACCGT-CGAACACGT------GACAGAA--TGCTGCCGCGGAGGCG----------------CTCGCC-----GCCTCCCCGGCCCC-ACCGGCCTCA--TCC--CTCTCGCCCGA--------------C-GGGCGCGTTGGTTGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------GAAAA-GCTAAGGAAC-CGGCGA--GCCGCACAAGGGCTC------TGCCGGTTGCCAA-GGCCAACAAAAAAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TCAAAATAAATTACTTGATGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCGTTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTGTCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_nova ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTGTCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_occidentalis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-CTC-A-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--CGCTGCCGGGGAGGTG----------------CTTGCT-----GCCTCCTCGGCCCC-ACCGGCCTCG--TCC--CTCTCGCCTT---------------TCGGGCGCGTTGGTCAG-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGTGA--GTCGCCCGAGGGCTTG-----CGTCGGGTGCCGA-GGCCAATGATAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_phaeocephala ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATACTTCAATGCTGGGTTCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCATAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_praeceptorum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCGAGGGCCCGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-CTCGA-----AAAAAA-CGACCGT-TGCACAAGT------GACAGAA--CGCTGCCGGGGAGGTG----------------CTTGCT-----GCCTCCTCGGCCCC-ACCGGCCTCG--TCC--CTCTAGCCTT---------------TCGGGCGAGTTGGATGC-----TG--GT--CGGAATAGGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GCCGCTAAAGGGCTGG-----CGTCGGGTGCCCA-GGCCAATGAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATACTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCCGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATTTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------AAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_praegracilis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACAAGT------GACAGAA--CGCTGCCGGAGAGGTG----------------CTTGCT-----GCCTCCTCGGCCCC-ACCGGCCACG--TCC--CTCTAGCCTTC------------TTTCGGGCGAGTTGGATGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GTCGCTAAAGGGCTGG-----CGTCGGGTGCCAA-GGCCAATGAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTTG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAGTTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATACACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATGTTATAAGTG------TAAAAATAAATTACTTGGGGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_praticola ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ATCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--TGCTGTCGGGGAGGTG----------------CTTGTT-----GCCTTCTCGGCCCC-ACCGGCCTCG--TCC--CTCTAGCCCT---------------TCGGGCGAGTTGGATGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAAA-GCTAAGGCAC-CGGCTA--GCCGTCAAAGGGCTCG-----CATCGGGTGCCGA-GGCCAATGAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATACTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCATAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_pyrenaica ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-TTCGA-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--TGCTGCCGGGGAGGTG----------------CTTGCT-----GCCTCCTCGGCCCC-ACCGGGCACAA-TCC--CTCTCGCCCTT--------------CGGGGCGCGTTGGTTGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------CAAAG--CTGAGGCGC-CGGCAA--GCCGCTCAGTGG-TTG-----CGCCGGTTGCCAA-GGCCAATGAAAAAAAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_rossii ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCACGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-TTCC------AAAACA-CGACCGT-CGAACACGT------GACAGAA--TGCTGCCGCGGAGGTG----------------CTTGCC-----GCCTCCTCGGCCCC-ACCGGCCTCA--CCC--TTCTCGCCCT---------------C-GGGCGCGTCGGTTGC-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------GAAA--GCTGAGGCAC-CGGCGA--GCCGCACAAGGGCTC------TGTCGGTTGCCAA-GGCCAACAAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAACTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTTTAAGTG------TCAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTTCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTATAGTAGGACATCCTACTAGTAAGCCAATTTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTCTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_rupestris ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-CTCGA-----AAAACA-CGACCGT-TGCACGCGT------GACAGAA--TGCTGCCGGGGAGGTG----------------CTCGCT-----GCCTCCCCGGCCCC-ACCGGCCTCT--TCC--CTCTCGCCCTT--------------CGGGGTGCGTCGGTCGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------GAAAG--CTGAGGCAC-CGGCGA--GCCGCTCAGCGG-CCG-----CGCCGGGTGCCGA-GGCCAATGAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGTTGGATCCAAGATATTTATTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---GTCATTAC------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAGAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATTTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTAATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGTCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTGTAAGTG------TAAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCGATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAAAGAATTTTGTATCGAATGAAGTATATACTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAA?AAGCAGGAGCTGCAGTAGCGGCAGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAGCCTGTTGTTGGA?AA?AAAATCAATTTATTGCCTATGTAGCTTATCCTTTA?ATCTTTTTGAA?AAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAA?ACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTC?CAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Carex_saxatilis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------{AT}{AT}TATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGA{AC}CCATCG{AT}GTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTA{AGT}AA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTCG{GT}TGCCT-TTCCA-----GAAACA-CGACCGT-CGAACACGT------GACAGAA--TGCTGCCGCGGAGGCG----------------CTTGCC-----GCCTCCTCGGCCCC-GCCGGCCTCC--TCC--CTCTCGCCCTT--------------CCGGGCGCGTTGGTTGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGG------TAAA--GCTGAGGCGC-CGGCGA--GCCGCTCGAGGTCTC------C{AG}TCGGTTGCCAA-GGCCAACAGAAA{AC}AAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATAATGTATTGGATATATTAATACCTTATCCTGTCCATTTTGAAATCTTAGTTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTTC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTAAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGTCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTT?ATCGGTTATTT?GTAAGTG------TCAAAGTAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCTAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCAGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGTTGGA?AAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Carex_scopulorum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-CTCTA-----GAAACA-CGACCGT-CGAACACGT------GATAGAA--TGCTGCCGCGGAGGCG----------------CTTGCT-----GCCTCCTCGGCCCC-ACCGGCCTCC--TCC--CTCTCGTCCTT--------------CGGGGCGCGTTGGTTGT-----TG--GT--CGGAATACGGCGCGG-GAT-G--ACGC--C-AGGGAACACGG------TAAA--GCTGAGGCAC-CGGTGA--GCCGCTCAAGGTCTC------CCTCGGTTGCCAA-GGCTAATAAAAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTTTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTTACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCATTCTACTTTATCGGTTATTTTTTAAGTG------TAAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_siccata -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCCT-CTC-A-----AAAACA-CGACCGT-TGCACACGT------GACAGAA--TGCTGTCGGGGAGGTG----------------CTTGTT-----GCCTCCTCGGCCCC-ACCGGCCTCG--TCC--CTCTCGCCTT---------------TCGGGCGCGTTGGTCAG-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGA------TAAA--GCTAAGGCAC-CGGTGA--GCCGCTCGAGGGCTTG-----CGTCGGGTG{CT}TGA-GGCCAATGAAAAAAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------ACGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAT------TTCAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCGTCTTGTTTACGATTAAGATCTTTTATAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTTAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGACTGATCTTTTTATGAAGAAATTGAAATCTT-ACCTTGTCTAT---TTCTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTATAAGTG------TAAAAATAAATTACTTGGAGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATAAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATTTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_utriculata ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTAAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGTCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTTTAAGTG------TCAAAGTAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCGAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_vesicaria ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACGTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGG-ACCC-TCCCGAGGGCACGCCTGCCTCATGGGC-GTTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGTTGCCT-TTCCA-----GAAACA-CGACCGT-CGAACACGT------GACAGAA--TGCTGCCGCGGAGGCG----------------CTTGCC-----GCCTCCTCGGCCCC-GCCGGCCTCC--TCC--CTCTCGCCCTT--------------CCGGGCGCGTTGGTTGC-----TG--GC--CGGAATACGGCGCGG-GAT-G--ACGC--C-AAGGAACACGG------TAAA--GCTGAGGCGC-CGGCGA--GCCGCTCGAGGTCTC------CGTCGGTTGCCAA-GGCCAACAGAAAAAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAATCCTTCAATGCTGGATCCAAGATATTTCTTCTTT--GCATTTATT------GCGATTTTTTCTCTTCG-------ATCATTCTAATTCGA------ATAGT---ATCATTAC------TTTAAAGAAATCGGTTT------------------CTATATTCTCA------AAAGAAAATATAAG------ACTCTCTCGTTTCTTATACAATTCTTATGTATCAGAATATGAGTTTTTATTCCTGTTTTTTCGTAAAAAATCTTCTTGTTTACGATTAAGATCTTTTAGAAGCTTTCTTGAAAGAATTTACTTCTATGG---------------AAAAATA------GAACATTTT---------------------AGAATAGTGCATCATGTTTTTTTGAAGAAAACTTTA------TGGATCTTCACAGATCCTCTCATGCACTATCTTCGATATCAAGGTAAAGCTATTCTAGCATCAAAAGGGGCTGATCTTTTTATGAAGAAATTAAAATCTT-ACCTTGTCTAT---TTTTGGCAATATTATTTTCATTTTTGGTCTGAGTCTAATAGGTTTCATAGAAAC------CAATTCTCTTATTATTCGTTCTACTTTATCGGTTATTTTGTAAGTG------TCAAAGTAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATAC------TCTTATTAAGAGATTTGATACTTTAGTTCCAGTCCTTCCTCTCATTAGATCATTGTCTAAAGCTTCACTTTGTACTGTAGTAGGACATCCTACTAGTAAGCCAATCTGGACAGATTTATCAGATTATGATATTATTAGTCGATTTGGTCTAATATATAAAAATCTTTTTCATTTTTATAGTGGATCTTCTAAAAAGAGAATTTTGTATCGAATGAAGTATATACTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Castilleja -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Castilleja_flava -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Castilleja_linariifolia ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAGGAAATCCAAAGATATTTACAGCTAGAGAGATCCCAACAACACGACTTCCTATATCCACTTATTTTTCAGGAGTATATTTATACATTTGCTCATGATCGTGGTTTCGGTAGATCAATTT---TGTCG------------GAAAATCCAGGTTATGACAACAAATACA------GTTTACTGATTGTGAAACGGTTAATTACTCG------------AATGTATCAACAGAATCAT------TTGATTATTTCTCCTAATGATTCTAACCAAAATCAGTTT---------------------TTGGGGCGCAACAAAAATTTGTATTCTCA------AATCATATCAGAGGGGTTTGCTTTTATTGTGGAAATTCCATTTTCTCTACGATTAATATCTTGTCTAGAAGGG--------------AAAAATAAAAAAATAATAAAATCTCAGAATTTACGATCAATTCTTTCAATATTTCCCTTTTTAGAGGACAATTTTTCACATTTAAATTTAGTATTAGATATACTAATACCCCACCCCGTCCATGGGGAAATCTTGGTTCAAACTCTTCGCTATTGGGTAAAAGATGCCTCTTCTTT--GCATTTATT------ACGATTCTTTCTGAACA-------AG------------AATTGGAA---TAGTCTTATTAC------TCCAAAGAAAGCCAGTTCCT---------------CTTTTTTAAAAAG---------AAATCAAAG------ATTATTCTTATTCTTATATAATTCTCATGTATGTGAATACGAATCTGTTTTCGTCTTTCTACGTAACCAATCTTCTCATTTACGATCAACACCTTTTGGAGTTTTTCTTGAACGAATCTATTTCTATGG---------------AAAAATA------GAACGTCTTG------------TGAATGTCTTTGTAAAGGTTAAGGATTTT-CAGGCG--AACCTG------TGGTTGGTCAAGGAACCTTGCATCCATTATATTAGGTATCAAAGAAAAGCCATTCTGGCTTCCAAAGGGACGTCTCTTTTCATGAATAAATGGAAATGTT-ACCTTATCACT---TTTTGGCAATGGCATTTTTCGCTGTGGTTTTATCCAAGAAGGATTTATATAAAC------CAATTATCCAATCATTCCTTTGAGTTTTTGGGCTATCAGTCAAGC------TTGCGAATGAACCCTTCAGTGGTACGGAGTCAAATTTTAGAAAATTCATTTCTAATCAATAA------TGCTATTAAGAAAGTCGATACCTTTATTCCAATTATTCCTCTGATTGTGTCATTGGCTAAAGCGAAATTTTGTAACGTA?TAGGGCATCCCATTAGTAAGCCGGTCCGGGCTGATTTATCAGATTCTAATATTATTGACCGATTTGGGTGTATATGCAGAAATTTTTCTCATTATCATAGTGGATCTTCCAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCTTGTGCTAGAACTTTGG-CTCGGAAACATAAAACTACTGTGCGTACTTTTTTGAAAA------GATTAGGCTCAGAGTTGTTGGAAGAATTTCTTCTGTCGGAAGAAGACGT------TCTTTTTTTGACGTTCCCAAAAGCTTCTTCCAGTTTGCAGGGAGTATATAGAAATCGAAT---TTGGTATTTGGATATTATTTCGATTAATGATTTGGCCGATCACAAATCCAAATTATGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGTGTTGGATTCAAAGCGGGT-GTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAACCTGGCGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGAGAAACAGATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGAAATGTATTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATGTTAAAACTTTCCAAGGCCCGCCTCACGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCACTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGCG--------GTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAGCCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTGAATGCTACCGCGGGTACATGCGAAGAAATGATCAAAAGGGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGAGGATTCACTGCAAATACTCGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAGAAGAACCATGGTATACACTTCCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACCGTAGTAGGTAAACTTGAAGGAGAAAGAGACATCACTTTGGGCTTTGTTGATTTACTGCGTGATGATTTTATTGAAAAAGATAGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTATTCCCGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTTTAACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGTAATGCGCCAGGTGCCGTAGCTAACCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTGCTG--AGGGTAATACAATTATCCGTGAGGCTAGCAAAT-------------------------------------------------------------------------------------------------------------------------- Castilleja_miniata --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCAC-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACGCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTCGAATCCTGCAAG--AGCAGA-----CC-GCG-CACACGTTAAACCA---AACAAGGCACTTGGCCC----GGGG-----CAACCCTGGCTCT-CGTGCCCCTCCCGCAGCGAGCGCGTCT-----------------------------------CG-GCG-CGCGCGGTGC-GGGCTAACG--AACCC-C-------GGCGCG-GAACGCGCC-AAGGAAAACTAATGGG----AGCGCCC---G-CCGCCCGTCGCCCC-GTTCGCGG--TGTGCGAAGGGTGGAGCGAGCGCCTCTTCGAAGT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Castilleja_occidentalis --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATAACGACTCTCGGCAACGAATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCAC-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACGCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTCGAATCCTGCAAG--AGCAGA-----CC-GCG-CACACGTTAAACCA---AACAAGGCACTTGGCCC----GGGG-----CAACCCTGGCTCT-CGTGTCCCTCCCGCAGCGAGCGCGTCT-----------------------------------CG-GCG-CGCGCGGTGC-GGGCTAACG--AACCC-C-------GGCGCG-GAACGCGCC-AAGGAAAACTAATGGG----AGCGCCC---G-CCGCCCGTCGCCCC-GTTCGCGG--TGTGCGAAGGGTGGAGCGAGCGCCTCTTCGAAGT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Castilleja_puberula -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Castilleja_rhexiifolia -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Castilleja_sulphurea ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCAC-GGCCGAGGGCACGCCTGCCT---GGGC-GTCACGCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGA-----CC-GCG-CACAC?TTAA-CCA---AACAAGGCACGTGGCCC----GGGG-----CAA{AC}CCTGGCTCT-CGTGCCCCTCCCGCA{AG}CGAGCGCGTCT-----------------------------------CG-GCG-CGCGCGGTGC-GGGCTAACG--AACCC-C-------GGCGCG-GAACGCGCC-AAGGAAAACTAATGGG----AGCGCCC---GTCCGCCCGTCGCCCC-GTTCGCGG--TGTGCGA?GGGTGGAGCGAGCGCCTCTTCGAAGTCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Ceanothus_cordulatus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCC-ATTAGGCCGAGGGCACGTCTGCCT---GGGC-GTCACA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACC--TGCCT-AGCAGAA-CGACCC-GTGAACCTGTAAAAACATACCGGGGG-GCTCGGGGCCTTTAG-----------GCCTCGGA---CTCTCTTGGTCGGTGGG--CTGTATCCTGTGCCTTGC------------TTGTCGATG----CACGGGTGCTGCTTTTT----CGGCCG--CACAAACGAACCCCGGCGCAAAACCGCGCC-AAGGATCATCTAACGAA--TTGGCAC----TGCCCTGTCGC---CCCAGAGATGGTGTGCG--GTTGGGTG--TGCGTCGTATTCTA-TATGTC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAGAGTTTCAA------GGATATTTCGAACTAAATAGATCTCGGCAACACGATCTCCTATACCCACTTATCTTTCGGGAGTATATTTATGCATTTGCTCATGATCATGGTTTA------AATAGATCGAGTTTGC---------TGGAAAATGTAGGTTATGACAATAAATCTA------GTTTACTAATTGTAAAACGTTTAATTA------------CTCGAATGTATCACCAGAATCAT------TTGATTATTTCCGCTAATGATTCTGACCAAAATAAATGTTTTG---------------GGTACAACAA------GAATTTGTATTCTCA------AATGATATCAGAGGGCTTTGCAGTCATTGTGGAAATTCCATTTTCCTTACGATTCCTACGATTAGTAT---CTT--------CGAGGCCAGAAATCGTAA------AATATTCTAATTTACGATCAATTCATTCAATATTTCCATTTTTAGAGGACAAATTCCCACATTTAAATTATGTATCAGATATACGAATACCCTACCCCATTCATCTGGAAATCTTGATTCAAACCCTTCGCTATTGGGTGAAAGATGCCTCTTCTTT--GCATTTATT------ACGGCTTTTTCTTCACG-------AGTATTATAAT------TGGAA---TAGTTTTATTACTCCAA------AAAAATCTATTT------------------CTTTTTTTTTG------AAAAGTAATTCAAG------ATTTTTCTTGTTCCTATATAATTCTCATGTTTGTGAATACGAATCCATCTTACTTTTTCTCCGTAACCAATCTTCTCATTTACGATTAACATCTTCTGGGGTATTTTTTGAGCGAATTTATTTCTATGG---------------AAAAATA------AAAGATCCTG------------TAGAAGAA---GTCTTTTCTAATGATTTTCCGGCG---ATCTTA------TGGTTCTTCACGGAGCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTTTGGTTTCAAAAGATACGCCTCTTCTAATGAATAAATGGAAATATT-ATCTTGTCCTT---TTATGGCAAGGTCATTTTTATGTGTGGGCTCAACCAGGAAGGATCTATATAAA------CCAATTAGGCAACCATTCCGTCGGCTTTTTGGGCTATCTTTCAAGTG------TGCGACTAAATCTTTCAGTGGTACGGAGTCAAATGCTCGAAAATTCTTTTATAATGGATAA------TGCTATAAAGAAGCTTGATACATTAGTTCCAATTAGTCCAATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTGGATTCAAAGCCGGT-GTTAAAGATTATAAATTGACTTATTACACTCCTGACTATGAAACAAAAGATACTGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGACGGGCTTACCAGTCTTGATCGTTACAAAGGTCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTTTTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTCCTGCTTATTCTAAAACTTTCCAAGGACCGCCTCACGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGCCGCCCCCTATTGGGATGTACTATTAAACCTAAACTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTTCGCG--------GTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCCCTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATTAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATTGTAATGCATGATTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATACACTTTCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACTGTAGTAGGTAAACTTGAAGGTGAAAGAGAAATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Ceanothus_fendleri ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTA-GGCCGAGGGCACGTCTGCCT---GGGC-GTCACA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACC--TGCCT-AGCAGAA-CGACCC-GTGAACCTGTAAAAACATACCGGGGG-GCTCGGGGCCTTTAG-----------GCCTCGGA---CTCTCTTGGTCGGTGGG--CTGTATCCTGTGCCTTGC------------TTGTCGATG----CACGGGTGCTGCTTTTT----CGGCCG--CACAAACGAACCCCGGCGCAAAACCGCGCC-AAGGATCATCTAACGAA--TTGGCAC----TGCCCTGTCGC---CCCAGAGATGGTGTGCG--GTTGGGTG--TGCGTCGTATTCTA-TATGTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Ceanothus_sanguineus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCC-ATTAGGCCGAGGGCACGTCTGCCT---GGGC-GTCACA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACC--TGCCT-AGCAGAA-CGACCC-GTGAACCTGTAAAAACATACCGGGGG-GCTCGGGGCCTTTAG-----------GCCTCGGA---CTCTCTTGGTCGGTGGG--CTGTATCCTGTGCCTTGC------------TTGTCGATG----CACGGGTGCTGCTTTTT----CGGCCG--CACAAACGAACCCCGGCGCAAAACCGCGCC-AAGGATCATCTAACGAA--TTGGCAC----TGCCCTGTCGC---CCCAGAGATGGTGTGCG--GTTGGGTG--TGCGTCGTATTCTA-TATGTC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAGAGTTTCAA------GGATATTTCGAACTAAATAGATCTCGGCAACACGATCTCCTATACCCACTTATCTTTCGGGAGTATATTTATGCATTTGCTCATGATCATGGTTTA------AATAGATCGAGTTTGC---------TGGAAAATGTAGGTTATGACAATAAATCTA------GTTTACTAATTGTAAAACGTTTAATTA------------CTCGAATGTATCACCAGAATCAT------TTGATTATTTCCGCTAATGATTCTGACCAAAATAAATGTTTTG---------------GGTACAACAA------GAATTTGTATTCTCA------AATGATATCAGAGGGCTTTGCAGTCATTGTGGAAATTCCATTTTCCTTACGATTCCTACAATTAGTAT---CTT--------CGAGGCCAGAAATCGTAA------AATATTCTAATTTACGATCAATTCATTCAATATTTCCATTTTTAGAGGACAAATTCCCACATTTAAATTATGTATCAGATATACGAATACCCTACCCCATTCATCTGGAAATCTTGATTCAAACCCTTCGCTATTGGGTGAAAGATGCCTCTTCTTT--GCATTTATT------ACGGCTTTTTCTTCACG-------AGTATTATAAT------TGGAA---TAGTTTTATTACTCCAA------AAAAATCTATTT------------------CTTTTTTTTTG------AAAAGTAATTCAAG------ATTTTTCTTGTTCCTATATAATTCTCATGTTTGTGAATACGAATCCATCTTACTTTTTCTCCGTAACCAATCTTCTCATTTACGATTAACATCTTCTGGGGTATTTTTTGAGCGAATTTATTTCTATGG---------------AAAAATA------AAAGATCCTG------------TAGAAGAA---GTCTTTTCTAATGATTTTCCGGCG---ATCTTA------TGGTTCTTCACGGAGCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTTTGGTTTCAAAAGATACGCCTCTTCTAATGAATAAATGGAAATATT-ATCTTGTCCTT---TTATGGCAAGGTCATTTTTATGTGTGGGCTCAACCAGGAAGGATCTATATAAA------CCAATTAGGCAACCATTCCGTCGGCTTTTTGGGCTATCTTTCAAGTG------TGCGACTAAATCTTTCAGTGGTACGGAGTCAAATGCTCGAAAATTCTTTTATAATGGATAA------TGCTATAAAGAAGCTTGATACATTAGTTCCAATTAGTCCAATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTGGATTCAAAGCCGGT-GTTAAAGATTATAAATTGACTTATTACACTCCTGACTATGAAACAAAAGATACTGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGACGGGCTTACCAGTCTTGATCGTTACAAAGGTCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTTTTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTCCTGCTTATTCTAAAACTTTCCAAGGACCGCCTCACGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGCCGCCCCCTATTGGGATGTACTATTAAACCTAAACTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTTCGCG--------GTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCCCTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATTAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATTGTAATGCATGATTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATACACTTTCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACTGTAGTAGGTAAACTTGAAGGTGAAAGAGAAATAACTTTAGGCTTTGTTGATTTACTACGTGATGATTTTATTGACAAAGATCGAAGCCGTGGTATTTATTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTG--AGGGTAATGAAATTATCCGTGAGGCTAGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTCGAAGCAATGGATACTTTGTAA--------------------------------------------- Ceanothus_velutinus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGACTCTCGGCAACGGATATCTCGG---CTCTCGCATCG-ATGAAGAACGTAGCGAAATGCGATACTTGGTGTGA-ATTGC-AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCC-ATTAGGCCGAGGGCACGTCTGCCT---GGGC-GTCACA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGAAACC--TGCCT-AGCAGAA-CGACCC-GTGAACCTGTAAAAACATACCGGGGG-GCTCGGGGCCTATAG-----------GCCTCGGA---CTCTCTTGGTCGGTGGG--CTGTATCCTGTGCCTTGC------------TTGTCGATG----CACGGGTGCTGCTTTTT----CGGCCG--CACAAACGAACCCCGGCGCAAAACCGCGCC-AAGGATCATCTAACGAA--TTGGCAC----TGCCCTGTCGC---CCCAGAGATGGTGTGCG--GTTGGGTG--TGCGTCGTATTCTA-TATGTC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAGAGTTTCAA------GGATATTTCGAACTAAATAGATCTCGGCAACACGATCTCCTATACCCACTTATCTTTCGGGAGTATATTTATGCATTTGCTCATGATCATGGTTTA------AATAGATCGAGTTTGC---------TGGAAAATGTAGGTTATGACAATAAATCTA------GTTTACTAATTGTAAAACGTTTAATTA------------CTCGAATGTATCACCAGAATCAT------TTGATTATTTCCGCTAATGATTCTGACCAAAATAAATGTTTTG---------------GGTACAACAA------GAATTTGTATTCTCA------AATGATATCAGAGGGCTTTGCAGTCATTGTGGAAATTCCATTTTCCTTACGATTCCTACGATTAGTAT---CTT--------CGAGGCCAGAAATCGTAA------AATATTCTAATTTACGATCAATTCATTCAATATTTCCATTTTTAGAGGACAAATTCCCACATTTAAATTATGTATCAGATATACGAATACCCTACCCCATTCATCTGGAAATCTTGATTCAAACCCTTCGCTATTGGGTGAAAGACGCCTCTTCTTT--GCATTTATT------ACGGCTTTTTCTTCACG-------AGTATTATAAT------TGGAA---TAGTTTTATTACTCCAA------AAAAATCTATTT------------------CTTTTTTTTTG------AAAAGTAATTCAAG------ATTTTTCTTGTTCCTATATAATTCTCATGTTTGTGAATACGAATCCATCTTACTTTTTCTCCG??????????????????????????????TTCTGGGGTATTTTTTGAGCGAATTTATTTCTATGG---------------AAAAATA------AAAGATCCTG------------TAGAAGAA---GTCTTTTCTAATGATTTTCCGGCG---ATCTTA------TGGTTCTTCACAGAGCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTTTGGTTTCAAAAGATACGCCTCTTCTAATGAATAAATGGAAATATT-ATCTTGTCCTT---TTATGGCAAGGTCATTTTTATGTGTGGGCTCAACCAGGAAGGTTCTATATAAA------CCAATTAGGCAACCATTCCGTCGGCTTTTTGGGCTATCTTTCAAGTG------TGCGACTAAATCTTTCAGTGGTACGGAGTCAAATGCTCGAAAATTCTTTTATAATGGATAA------TGCTATAAAGAAGCTTGATACATTAGTTCCAATTAGTCCAATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cerastium -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cerastium_arvense ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATTAAT------CCATTATCAACCC?TTTTCTTGACTTTATTGGTTTTCTTTCAAGT------GTACAACTCACTTCTTTAGTGGTACGGAGTCAAATGTTAGAAAATGCATTTCTAATAGATAA------TACGATTAAGAAATTTGATCCGAAAATTCCAATCAGTTCTCTGATCCTATCGTTGGCGAAAGCGAAATTTTGTAACGGATTAGGGCATCCTATTAGTAAGCCGACTTGGATCGATTTATCGGATTCTGATATTATTGATCGATTTGGGCTTATATGCCAAAATCTTTTTCATTATTATAGTGGCTCTTCAAGAAAAAAGAGTTTGTATCGACTAAAGTATATACTTAAAATTTCTTGTGCTAGAACTTTGG-CTCGTAAACACAAAAGCGCTGTGCGTGCTTTTTTGAAAA------GATTAGGTTCAGAATTTTTTGGAGAGTTTTTAACTCAGGAAGAAAAAGT------TCTTTCTTTGATCTTAACAAAAAATTCCTCTAACTTGCGAAGATTCTATAGAGGGTGTAT---TTGGTATTTGGATATTTTTTGTATTCATAATTTGGCTAATGATGAATGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cerastium_beeringianum -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cerastium_brachypodum -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cerastium_fontanum ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATGTTT-AATCCATTCGAGCGTCGAGCGAGTTGTAG--------GTAGCCTTGTGCTCCTCT----CCTTTATCGGTGTTCGAGCCTAGGGGG-A-------------TGTCACTC---GTGG-CTTCTTCCTTGGC---------A--AATAAACGAACCCCGGCGCGAAA-AGCGTC-AAGGAACATAA-CTACA--TATGAGCT---CACGCCCGCTGCCCGGTTAGC-CGGTGCACG----GTTGTGGTGCCATGTCATA-ACATT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGAACAATTCCAAGGATATATAGAACTAGAAGGTTTTTGGCAACACAACTTTTTCTATCCACTTATCTTTCAGGAATATATTTTTTCGTTTGCATATGGTCATGATTTAAAGAAATTTATTTTGTTGAAA---------------ACTTCAGGCGGTAGGAAATTTA-GT------TTACTAGTTGTGAAACGTT--TAATAAATCGAATGTATCAACAGAATTTTTTTATTCTTTCG------GCTAATTATT------------CTAACCAAAACGACTTT---------------------TTGGGGCACAAACATGATTTTTATTCGCA------AATGATATCTGAAGTATTTGCAGTCATTGTGGAAATTCCACTTTCCTTAGCTTCTATAGAGATAGAGAAAAAAAAAAA??????????????????????????????????????????????CAATTCATTCAATATTTCCTTTTTTAGAGGACAACGTTTTACATTTAAATTTTGTGTTAGATATATTAATACCTTACCCCGTCCATCTGGAAATTTTAGTTCAAACCCTTCGGTACTGGGTGAAAGATGCCCCGTCTTT--GCATCTA{AT}T------ACGATTCTTTCTTTATG-------AATCTCAT------AATTGCAA---TAGTCTTATAAA------AAAAAATAAATATTTATT------------------TTTTTTTATAAA------AAGGACTCAAAG------ATTTTTTTTGTTCTTATATAATTTCCATGTATGTGAACACGAATTTATTTTATTGTTTCTTTGCAACCAATCCTCTCATTTACGATCAACATCTTACAGATCCTTTCTTGAACGCACTTTTTTCTACAG---------------AAAATTA------GAATATTTAG------------TCAAACTT------TTTAATAAGGATTTT-GACGTT--ATTTTA------TGGCTTTTTAAAGACCCCTACCCGTATTCTGTTAGGTATAAAGGACAATATATTATGGCCTCAAAAGGGACATCCCTTTTGATGCATAAATTTAAATTTT-ACCTT??????---????????????????????????????????????????????????????ATTAA--TCGATTATCAACCC-TTTTCTTGACTTTATTGGTTTTCTTTCAAGT------GTACAACTTACTTCTTTAGTGGTACGGAGTCAAATGTTAGAAAATGCATTTCTAATAGATAA------TACGATTAAGAAGTTTGATCCGAAAATTCCAATTAGTGCTCTGATTTTATCGTTGTCGAAAGCGAAATTTTGTAACGGATTAGGGCATCCTATTAGTAAGCCGACTTGGATCGATTTATCGGATTCTGATATTATTGATCGATTTGGGCTTATATGCCAAAATCTTTTTCATTATTACAGTGGCTCTTCAAGAAAAAAGAGTTTGTATCGACTAAAGTATATACTTAAAATTGCTTGTGCTAGAACTTTGG-CTCGTAAACACAAAAGCGCTGTGCGTGCTTTTTTGAAAA------GATTAGGTTCAGAATTTTTTGGAGAGTTTTTAACTCAGGAAGAAAAAGT------TCTTTCTTTGATCTTAACAAAAAATTCCTCTAACTTGCGAAGATTCTATAGAGGG---TGTATTTGGTATTTGGATATTTTTTGTATTAATAATTTGGCTAATGATAAATGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGGT-GTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAAACCCTGGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAAGAAGCAGGGGCCGCAGTAGCCGCCGAATCCTCGACTGGTACATGGACAACTGTATGGACCGACGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGAGAAGAAAATCAATATATTTGTTATGTAGCTTACCCCTTAGACCTTTTTGAGGAAGGCTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTCAAAGCCTTGCGTGCGCTACGCTTGGAAGATTTGCGAATTCCTGTTGCTTATATAAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGCCGTCCCCTATTGGGATGCACCATTAAACCGAAATTAGGGTTATCCGCTAAAAACTATGGTCGAGCAGTTTATGAATGTCTTCGCG--------GTGGACTTGATTTTACCAAAGATGATGAAAACGTGAACTCTCAACCATTTATGCGCTGGAGAGACCGCTTCTTATTTTGTGCCGAAGCCATTTATAAAGCACAAGCCGAAACAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cercocarpus_montanus ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAGAATTTCAA------GGATATTTAGAACTAGATAGATCTCAGCAACATGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTCATGATCATGGTTTAAATAGAT---------------CGATTTTGTTGGATAATGTAGGTTATGACAATAAATCTA------GTTTATTAATTATAAAACGTTTAATTA------------GTCGAATGTATCAACAGAATCAT------TTGATTATTTCCCCTAATCATTCTAATCAAAAA---------------------AAAATTGGGGGGTACAACAAAAATTTGTATTGTCA------AATGATATCGGAGGGATTTGCAGTCATTGTGGAAATTCCGTTTTCCCTACGATTAGTATCCTCCTTAG--------------AGGGGACAGAAATCGTAA------AATCTTATAATTTACGATCAATTCATTCAATATTTCCTTTTTTAGAGGACAAATTCTCACATTTAAATTATGTATCAGATGTACTAATACCCTACCCCATTCATCTGGAAATCTTGGTTCAAACCCTTCGCTACTGGGCGAAAGATCCCTCTTATTT--GCATTTATT------ACGACTCTTTCTTCACG-------ATTATTATAAT------TTGAA---TAGTCTTATTACTAAAA------ATAAAT------------------------CTATTTT------TTCAAAAAGTAATCCACG------ATTATTCTTGCTCCTATATAATTCTTATGTATGTGAATACGAATCCATCTTACTTTTTCTCCGTAACCAATCTTCTCATTTACAATTTACCTCTTCTTGGATCTTTTTTGAGCGAATACATTTCTATGA---------------AAAAATA------AAATATCCTG------------TAGAAGAA---GTTTTTGCTAATGATTTTCCGGCC---ATCTTA------TGGTTCTTCAAAGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGATACCCCTCTTCTGATGAATAAGTGGAAATATT-ATCTTGTCAAT---TTATGGCAATGCCATTTTTATGTATGGTCTCAACCAGGAAGGATCTATATAAA------CCAATTATCCAAGCATTCCCTTGATTTTTTGGGTTATCTTTCAAGTA------TACGACCAAATCTTTCGGTGGTACGAAGTCAAATGCTAGAAAATTCATTTATAATGGATAA------TGCTAGGAAGAAGTTCGATACATTAGTTCCAATTATTCCTTTGATTGGATCATTGGCTAAAGTGAAATTTTGTAATGCATTGGGGCATCCTATTAGTAAGTCGACCTGGGCGGATTCGTCGGATTTTGATATTATCGACCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGACTTTCTTGTGTTAAAACTTTGG-CTCGTAAACACAAAAGTACTGTACGCACTTTTTTGAAAAG---ATTAGGTTCGAAA---TTATTGGAAGAATTCTTTACGGAAGAAGAACAGAT------TCTTTCTTTGATCTTCCCAAGAGCTTCTTCTACTTTGACGAGGTTTTATAGAGGGCGAAT---TTGGTATTTGGATATTTTTTGTATCAATGATCTAGTCAATCATGAATGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Chamerion_angustifolium ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------------ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCCGGC-GTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCAGAGTATCTCCGCAACCCGGAGTTCCACCTGAGGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACCTGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTATAAAGGAAGATGCTACCACATCGAGCCTGTTGTGGGAGAGGAAAATCAATATATATGTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTACGTCTGGAGGATCTGAGAATCCCTCCTGCTTATGTTAAAACTTTCCAAGGTCCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTTGTCCCCTATTGGGATGTACCATTAAACCTAAATTAGGTTTATCCGCTAAGAACTACGGTAGAGCTGTTTATGAATGTCTTCGTG--------GTGGACTTGATTTTACCAAGGATGATGAAAACGTCAACTCCCAGCCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAGGCTGAAACTGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCGGGTACATGCGAAGAAATGATCAAAAGGGCTGTATTTGCCAGAGAATTAGGGGTTCCCATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAACGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATCCACTTTCGTGTACTAGCTAAAGCCTTACGTATGTCTGGTGGAGATCATATTCACTCAGGTACCGTAGTAGGTAAACTTGAAGGAGAAAGAGACATTACTTTAGGCTTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGCCGCGGTATTTATTTCACTCAAGATTGGGTCTCCCTACCTGGTGTCTTGCCTGTGGCCTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAAATCTTTGGAGATGATTCCGTACTACAATTCGGCGGTGGAACTTTAGGACACCCTTGGGGAAATGCACCGGGTCGTGTAGCGAATCGAGTAGCTTTAGAAGCATGCGTACAAGCTCGTAATGAGGGGCGTGATCTTGCTCGTG--AGGGTAATGAAATCATACGTGAGGCTTGCAAATGGAGTCCGGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCAAATTTGAATTC------------------------------------------------------------------ Chenopodium -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Chenopodium_atrovirens ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------