#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on June 04, 2020; 11:12 GMT TreeBASE (cc) 1994-2008 Study reference: Adamcik S., Slovak M., Eberhardt U., Ronikier A., Jairus T., Hampe F., & Verbeken A. 2016. Molecular inference, multivariate morphometrics and ecological assessment are applied in concert to delimit species in the Russula clavipes complex. Mycologia, 108(4): 716-730. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17208] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=79; TAXLABELS 'Russula amoenoides SAV_F_1340' 'Russula amoenoides SAV_F_1341' 'Russula amoenoides STU_UE2006_11_15_02' 'Russula clavipes FR_652' 'Russula clavipes SAV_F_1323' 'Russula clavipes SAV_F_1324' 'Russula clavipes SAV_F_1325' 'Russula clavipes SAV_F_1327' 'Russula clavipes SAV_F_1328' 'Russula clavipes SAV_F_1331' 'Russula clavipes STU_UE2005_09_07_10' 'Russula clavipes TU_102003' 'Russula clavipes TU_102004' 'Russula clavipes TU_102006' 'Russula clavipes TU_102029' 'Russula clavipes TU_102030' 'Russula clavipes TU_102036' 'Russula clavipes TU_102041' 'Russula clavipes UPS_UE22_08_2004_2' 'Russula decolorans TUB_HUE039' 'Russula faginea C_JV02_386' 'Russula faginea C_PH00_083' 'Russula faginea SAV_F_1336' 'Russula faginea SAV_F_1337' 'Russula faginea SAV_F_354' 'Russula faginea SAV_F_997' 'Russula favrei IB_1995_0098' 'Russula favrei IB_1996_0021' 'Russula favrei SAV_F_1333' 'Russula favrei SAV_F_1334' 'Russula favrei SAV_F_1335' 'Russula favrei SAV_F_2254' 'Russula favrei SAV_F_2263' 'Russula favrei UPS_UE03_07_2003_10' 'Russula favrei UPS_UE06_09_2003_9' 'Russula graveolens SAV_F_1338' 'Russula graveolens SAV_F_1339' 'Russula graveolens SAV_F_1342' 'Russula graveolens SAV_F_1343' 'Russula graveolens UPS_UE2005_08_10_04' 'Russula graveolens UPS_UE20_09_2004_12' 'Russula nitida KR_0004221' 'Russula nitida UPS_UE08_07_2004_2' 'Russula nuoljae SAV_F_1320' 'Russula nuoljae SAV_F_1321' 'Russula nuoljae SAV_F_3022' 'Russula nuoljae SAV_F_3092' 'Russula nuoljae STU_EE04_41' Russula_nuoljae_TU102014 'Russula nuoljae TU_102008' 'Russula nuoljae TU_102011' 'Russula nuoljae UPS_UE23_08_2004_10' 'Russula nuoljae UPS_UE24_08_2004_09' 'Russula nuoljae UPS_UE25_08_2004_06' 'Russula pascua IB_1998_0124' 'Russula pascua IB_2004_0149' 'Russula pascua IB_2005_0022' 'Russula pascua IB_2005_1153' 'Russula pascua KRAM_F_45044' 'Russula pascua KRAM_F_45045' 'Russula pascua KRAM_F_45046' 'Russula pascua KRAM_F_45047' 'Russula pascua KRAM_F_45048' 'Russula pascua KRAM_F_45051' 'Russula pascua KRAM_F_45052' 'Russula pascua KRAM_F_45053' 'Russula pascua SAV_F_1322' 'Russula subrubens C_JV02_624' 'Russula subrubens C_JV98_294' 'Russula subrubens G_KR73_332' 'Russula subrubens IB_1990_0076' 'Russula subrubens IB_1991_986' 'Russula subrubens STU_UE19_08_2002_02' 'Russula subrubens STU_UE19_08_2002_08' 'Russula subrubens STU_UE20_08_2002_1' 'Russula xerampelina SAV_F_3236' 'Russula xerampelina TUB_FO46888' 'Russula xerampelina UPS_UE14_09_2004_3' 'Russula xerampelina UPS_UE21_09_2003_17' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M40666] TITLE Russula_clavipes_complex; LINK TAXA = Taxa1; DIMENSIONS NCHAR=738; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Russula amoenoides SAV_F_1340' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCC{CT}GAGCGCTCTC{AG}CACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTTGATACAGTGTAGAATGT----TT{CT}TC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--TCCTTTTTTTTCTTTGAACCATTG{CT}GGT-CGGGAAAAGG{AG}GGGTTTTGGACTTGGAGG--TT{CT}AATGCTCGCCCTTTCT----TTC-GAAAGTGTGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCTCTGTTCCTTTGGATGCCTGCTCCTAACCGTCTCATTGACAATGATGGTGCTCTGGTCCACCG{CT}C-GTCTACATCGGCGGGAGGCTGGACCCACGAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula amoenoides SAV_F_1341' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCTGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTTGATACAGTGTAGAATGT----TTTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCG???AAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--TCCTTTTTT--CTTTGAACCATTGTGGT-CGGGAAAAGGAGGGTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAAGTGTGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATG{CT}TTCTACGTTTTGGGTTTAGCTCTGTTCCTTTGGATGCCTGCTCCTAACCGTCTCATTGACGATGATGGTGCTCTGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACGAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACT--- 'Russula amoenoides STU_UE2006_11_15_02' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCGCACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTTGATACAGTGTAGAATGT----TTTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--TCCTTTTTTTTCTTTGAACCATTGTGGT-CGGGAAAAGG{AG}GGGTTTTGGACTTGGAGG--TTCAATGCTCGCCCTTTCT----TTC-GAAAGTGTGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCTCTGTTCCTTTGGATGCCTGCTCCTAACCGTCTCATTGACGATGATGGTGCTCTGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACGAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes FR_652' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes SAV_F_1323' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes SAV_F_1324' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACC-------------------------------------- 'Russula clavipes SAV_F_1325' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCT{AT}ATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGC--------- 'Russula clavipes SAV_F_1327' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA-CCCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes SAV_F_1328' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCAT?????????????AGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes SAV_F_1331' --------ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA- 'Russula clavipes STU_UE2005_09_07_10' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCT{AT}ATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes TU_102003' -----------------------------CTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes TU_102004' -----------------------------CTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes TU_102006' -----------------------------CTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes TU_102029' -----------------------------CTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTTCCCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes TU_102030' -----------------------------CTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes TU_102036' -----------------------------CTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes TU_102041' -----------------------------CTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula clavipes UPS_UE22_08_2004_2' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTCGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula decolorans TUB_HUE039' -------------------------------GCGGAAGGATCATTATTGTAAAACCGAGGCACAAAGAGCTGTCGCTGACCTTC-AAAGGTTGTGCACGCTCGAGTGCTCTCACAC-ATCCATCTCACCCCTTTTGTGCATCACCGCGTGGGC-CCTCCTTT--GCAGGAGGGCTTGCGTTTTCACAT-AAAACTTGATACAGTGTAGAATGTTTTCTTTTC-TTTTGCGGTCAAACGCAATTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCATCAAAA--CCTTTTCCT---TTGATCCTCTTTTGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--TTCTATGCTCGCT----------TTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCTGCTTTGCTGATCCTTGAC-GTGATAAGATGTTTCTACGTTTTGGATTTGGCACTG-TCCCTTGGACGCCTGCTCCTAACCGTCTGTTGGACGACGATGGTGCTTCGGT-CACTGCC-ATCTACATTGGCGGGAGGCTGGACCCACAAAA--AAGACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula faginea C_JV02_386' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGTACAACTGAGGTGCAAAG-GCTGTCGCTGACCCTCTAAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT--CTTTGAACCATTGTGGT-CGGGAAAAGGA--CTTTTGGACTTGGAGG-TTTTAATGCTCACCCTTTCT----TTT-GAAA--GTGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACGTCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA- 'Russula faginea C_PH00_083' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGTACAACTGAGGTGCAAAG-GCTGTCGCTGACCCTCTAAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT--CTTTGAACCATTGTGGT-CGGGAAAAGGA--CTTTTGGACTTGGAGGTTTTTAATGCTCACCCTTTCT----TTT-GAAA--GTGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACGTCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA- 'Russula faginea SAV_F_1336' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGTACAACTGAGGTGCAAAG-GCTGTCGCTGACCCTCTAAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT--CTTTGAACCATTGTGGT-CGGGAAAAGGA--CTTTTGGACTTGGAGG--TTTAATGCTCACCCTTTCT----TTT-GAAA--GTGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACGTCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula faginea SAV_F_1337' -AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGTACAACTGAGGTGCAAAG-GCTGTCGCTGACCCTCTAAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCAGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT--CTTTGAACCATTGTGGT-CGGGAAAAGGA--CTTTTGGACTTGGAGG-TTTTAATGCTCACCCTTTCT----TTT-GAAA--GTGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACGTCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula faginea SAV_F_354' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGTACAACTGAGGTGCAAAG-GCTGTCGCTGACCCTCTAAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTG?????????????????????GCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT--CTTTGAACCATTGTGGT-CGGGAAAAGGA--CTTTTGGACTTGGAGG-TTTTAATGCTCACCCTTTCT----TTT-GAAA--GTGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACGTCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGA------------------- 'Russula faginea SAV_F_997' --GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGTACAACTGAGGTGCAAAG-GCTGTCGCTGACCCTCTAAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT--CTTTGAACCATTGTGGT-CGGGAAAAGGA--CTTTTGGACTTGGAGG-TTTTAATGCTCACCCTTTCT----TTT-GAAA--GTGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACGTCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula favrei IB_1995_0098' -----GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACTGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TCTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTCACGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA-CCCCCTTTTT-TCTTTGAACCATTGTGGT-CG{AG}AAAAAGGG-ATTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----CTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAG{AG}AAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula favrei IB_1996_0021' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACTGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TCTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTCACGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-T{CT}TTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA-CCCCCTTTTT-TCTTTGAACCATTGTGGT-CGGAAAAAGGG-ATTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----CTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCT{AG}CGTTTTGGGTTT{AG}GCACTG-TCCCTTGGATGCCTGCTGCTAA{AC}CGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGGAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula favrei SAV_F_1333' -----GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACTGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TCTGTGCATCACCGCGTGGGTCCCCCT-TT--GCGGGAGGGCTCACGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCCTTTTT-TCTTTGAACCATTGTGGT-CG{AG}AAAAAGGG-ATTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----CTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula favrei SAV_F_1334' -----------AGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACTGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TCTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTCACGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA-CCCCCTTTTT-TCTTTGAACCATTGTGGT-CGGAAAAAGGG-ATTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----CTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGAC---------------- 'Russula favrei SAV_F_1335' ---TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACTGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TCTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTCACGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA-CCCCCTTTTT-TCTTTGAACCATTGTGGT-CGGAAAAAGGG-ATTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----CTT-GAA{AG}--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACT--- 'Russula favrei SAV_F_2254' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACTGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TCTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTCACGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA-CCCCCTTTTT-TCTTTGAACCATTGTGGT-CGGAAAAAGGG-ATTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----CTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAG{AG}AAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula favrei SAV_F_2263' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACTGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TCTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTCACGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCCTTTTT-TCTTTGAACCATTGTGGT-CGGAAAAAGGG-ATTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----CTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula favrei UPS_UE03_07_2003_10' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACTGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TCTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTCACGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA-CCCCCTTTTT-TCTTTGAACCATTGTGGT-CGGAAAAAGGG-ATTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----CTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACATCGGCGGGAGGCTGGACCC{AC}CAAAAAG{AG}AAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula favrei UPS_UE06_09_2003_9' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACTGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TCTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTCACGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAACCCCCCTTTTT-TCTTTGAACCATTGTGGT-CGGAAAAAGGG-ATTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----CTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula graveolens SAV_F_1338' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCA{AG}AG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCC-TTTGCGGGGAGGGCTTGCGTTTTCACA{CT}-AAAACTTGATACAGTGTAGAATG------TTTCTTTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--TCCTTTTTT--CTTT--------------------{AG}AGGG--GTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAA--GTGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCTCTG-TTCCTTGGACGCCTGCTCCTAACTGTCTCATTGACAATGATGGTGCTCTGGT-CACTGCCGGTCTACATCGGCGGGAGGCTGGACCCACA{AG}AAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula graveolens SAV_F_1339' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCC-TTTGCGGGGAGGGCTTGCGTTTTCACAC-AAAACTTGATACAGTGTAGAATG------TTTCTTTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--TCCTTTTTT--CTTT--------------------AAGGG--GTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAA--GTGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCTCTG-TTCCTTGGACGCCTGCTCCTAACCGTCTCGTTGACAATGATGGTGCTCTGGT-CACTGCCGGTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula graveolens SAV_F_1342' -----GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCC-TTTGCGGGGAGGGCTTGCGTTTTCACAT-AAAACTTGATACAGTGTAGAATG------TTTCTCTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--TCCTTTTTT--CTTT--------------------GAGGG--GTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAA--GTGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCTCTG-TTCCTTGGACGCCTGCTCCTAACCGTCTCGTTGACAATGATGGTGCTCTGGT-CACTGCCGGTCTACATCGGCGGGAGGCTGGACCCACAGAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula graveolens SAV_F_1343' --GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCC-TTTGCGGGGAGGGCTTGCGTTTTCACAT-AAAACTTGATACAGTGTAGAATG------TTTCTTTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--TCCTTTTTT--CTTT--------------------{AG}AGGG--GTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAA--GTGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCTCTG-TTCCTTGGACGCCTGCTCCTAAC{CT}GTCTC{AG}TTGACAATGATGGTGCTCTGGT-CACTGCCGGTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA- 'Russula graveolens UPS_UE2005_08_10_04' -----GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCCTTTTGCGGGGAGGGCTTGCGTTTTCACAT-AAAACTTGATACAGTGTAGAATG------TTTCTTTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--TCCTTTTTT--CTTT--------------------GAGGG--GTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAA--GTGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCTCTG-TTCCTTGGATGCCTGCTCCTAACTGTCTCATTGACAATGATGGTGCTCTGGT-CACCGCCGGTCTACATCGGCGGGAGGCTGGACCCACAGAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula graveolens UPS_UE20_09_2004_12' -----GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAGAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCC-TTTGCGGGGAGGGC{GT}TGCGTTTTCACAT-AAAACTTGATACAGTGTAGAATG------TTTCTTTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--TCCTTTTTT--CTTT--------------------GAGGG--GTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAA--GTGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-G{AT}GATAAAATGTTTCTACGTTTTGGGTTTAGCTCTG-TTCCTTGGACGCCTGCTCCTAACTGTCTCATTGACAATGATGGTGCTCTGGT-CACTGCCGGTCTACATCGGCGGGAGGCTGGACCCACAGAAAGAAAACCTTGACCTCAAATC------------------------- 'Russula nitida KR_0004221' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAGG-GCTGTCGCTGACCGTC-AAAGGTCGTGCACGCTCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACATAAAAACTCGATACAGTGTAGAATG------TTAC-TTTTGCGATCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTT----CTTTGATCCATTTTGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--TTCAATGCTCGCCCTTTCT----TTT-GAAA--GCGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAGATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGACGCCTGCTCCTAACCGTCTCACGGACAATGATGGTGCTCTGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACGAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula nitida UPS_UE08_07_2004_2' --------ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAGG-GCTGTCGCTGACCGTC-AAAGGTCGTGCACGCTCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACATAAAAACTCAATACAGTGTAGAATG------TTAC-TTTTGCGATCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTT----CTTTGATCCATTTTGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--TTCAATGCTCGCCCTTTCT----TTT-GAAA--GCGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAGATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGACGCCTGCTCCTAACCGTCTCACGGACAATGATGGTGCTCTGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACGAAAAGAAAAC{CT}TTGACCTCAAATCGGGTGAGAC---------------- 'Russula nuoljae SAV_F_1320' --GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCCCGCCCTTTCT----TTTTGAAAGCGCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TTCCTTGGATGCCTGCTCCTAATCGTCTCAT{CT}GACAATGATGGTGCTCTGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTT{AG}ACCTCAAATCGGGTGAGACTACCCGCTGA------ 'Russula nuoljae SAV_F_1321' -----GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA-CCCCTTTTTT-CCTTTGAACCATTGCGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--CTCAATGCCCGCCCTTTCT----TTTTGAAAGCGCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TTCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCTGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula nuoljae SAV_F_3022' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--CTCAATGCCCGCCCTTTCT----TTTTGAAAGCGCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TTCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTC{CT}GGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula nuoljae SAV_F_3092' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--CTCAATGCCCGCCCTTTCT----TTTTGAAAGCGCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TTCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCTGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula nuoljae STU_EE04_41' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTTCCCTTTGAACCATTGCGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--CTCAATGC{CT}CGCCCTTTCT----TTTTGAAAGCGCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGACGGTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-T{CT}CCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTC{CT}GGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA- Russula_nuoljae_TU102014 ---------------------------ACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--CTCAATGCC{CT}GCCCTTTCT----TTTTGAAAGCGCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-T{CT}CCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCTGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula nuoljae TU_102008' -----------------------------CTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--CTCAATGCCCGCCCTTTCT----TTTTGAAAGCGCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TTCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCTGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula nuoljae TU_102011' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--CTCAATGCCCGCCCTTTCT----TTTTGAAAGCGCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TTCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCTGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula nuoljae UPS_UE23_08_2004_10' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--CTCAATGCCCGCCCTTTCT----TTTTGAAAGCGCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TTCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCTGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA- 'Russula nuoljae UPS_UE24_08_2004_09' -----------------------GTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTTCCCTTTGAACCATTGCGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--CTCAATGC{CT}CGCCCTTTCT----TTTTGAAAGCGCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-T{CT}CCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTC{CT}GGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAA---------------------------- 'Russula nuoljae UPS_UE25_08_2004_06' ----CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--CTCAATGCCCGCCCTTTCT----TTTTGAAAGCGCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TTCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCTGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA- 'Russula pascua IB_1998_0124' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGC{CT}CCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula pascua IB_2004_0149' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula pascua IB_2005_0022' ---TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGC{CT}CCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula pascua IB_2005_1153' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGC{CT}CCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula pascua KRAM_F_45044' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGC{CT}CCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula pascua KRAM_F_45045' ------------------------TGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGC{CT}CCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTG-------------------- 'Russula pascua KRAM_F_45046' -----GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula pascua KRAM_F_45047' -----GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGC{CT}CCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula pascua KRAM_F_45048' -------AACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGC{CT}CCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGA------------------- 'Russula pascua KRAM_F_45051' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCCCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAA----- 'Russula pascua KRAM_F_45052' -----GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGC{CT}CCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula pascua KRAM_F_45053' ------------------------------------AGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGC{CT}CCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACC-------------------------------------- 'Russula pascua SAV_F_1322' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCGAAG-GCTGTCGCTGACCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATC????AAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT-CCTTTGAACCATTGCGGTCCGGGAAAAGGA--TTTTTGGACTTGGAGG--CTTAATGCTCGCCCTTTCT----TTTTGAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTCCTAATCGTCTCATTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula subrubens C_JV02_624' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGGCCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTTGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT--CTTTGAACCATCGTGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAA--GCGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGACGCCTGCTCCTAACTGTCTCGTTGACAATGATGGTGCTCCGGT-CATCGCC-GTCTACATCGGCGGGAGGCTGGACCCACGAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA- 'Russula subrubens C_JV98_294' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGGCCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTTGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT--CTTTGAACCATCGTGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAA--GCGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGACGCCTGCTCCTAACTGTCTCGTTGACAATGATGGTGCTCCGGT-CATCGCC-GTCTACATTGGCGGGAGGCTGGACCCACGAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula subrubens G_KR73_332' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT--CTTTGAACCATCGTGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAA--GCGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGACGCCTGCTCCTAACTGTCTCGTTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACGAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula subrubens IB_1990_0076' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGGCCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACT{CT}GATACAGTG{CT}AGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Russula subrubens IB_1991_986' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGGCCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Russula subrubens STU_UE19_08_2002_02' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGTACAACTGAGGCGCAAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CTCCT-TT--GCGGGAGGGCTCACGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTTGCACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--ACCCTTTTT-TCTTTGAACCATTGTGGT-CGGAAAAAGGA--TTTTTGGACTTGGAGG-CTTTAATGCTTGCCCTTTCTTTTCTTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACTGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACGTCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula subrubens STU_UE19_08_2002_08' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGGCCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT--CTTTGAACCATCGTGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAA--GCGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGACGCCTGCTCCTAACTGTCTCGTTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACGAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula subrubens STU_UE20_08_2002_1' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGGCCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT--CTTTGAACCATCGTGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAA--GCGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGACGCCTGCTCCTAACTGTCTCGTTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACGAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA- 'Russula xerampelina SAV_F_3236' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACTGAGGCACAAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAGTGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTCA{CT}GTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCGCACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--ACCCTTTTT-TCTTTGAACCATTGTGGT-CGGAAAAAGGA--TTTTTGGACTTGGAGG-CTTTAATGCTTGCCCTTTCTTTTTTTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACGTCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula xerampelina TUB_FO46888' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACTGAGGCGCAAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAGTGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CTCCT-TT--GCGGGAGGGCTCACGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCGCACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--ACCCTTTTT-TCTTTGAACCATTGTGGT-CGGAAAAAGGA--TTTTTGGACTTGGAGG-CTTTAATGCTTGCCCTTTCTTTTCTTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGCC-GTCTACGTCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAA 'Russula xerampelina UPS_UE14_09_2004_3' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGTACAACTG??GCGCAAAG-GCTGTCGCTGACCCTC-AAGGGTTGTGCACGCCCGAG{CT}GCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-C{CT}CCT-TT--GCGGGAGGGCTCACGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGT{CT}GCACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--ACCCTTTTTTTCTTTGAACCATTGTGGT-CGGAAAAAGGA--TTTTTGGACTTGGAGG-CTTTAATGCTTGCCCTTTCTTTT{CT}TTT-GAAA--GCGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGATGCCTGCTGCTAACCGTCTCATTGACAATGATGGTGCTCCGGT-CACTGC{CT}-GTCTACGTCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA- 'Russula xerampelina UPS_UE21_09_2003_17' AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAG-GCTGTCGCTGGCCCTC-AAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACC---TTTGTGCATCACCGCGTGGGT-CCCCT-TT--GCGGGAGGGCTTGCGTTTTCACAT-AAAACTCGATACAGTGTAGAATG------TTTC-TTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAA--CCCTTTTTT--CTTTGAACCATCGTGGT-CGGGAAAAGGA--TTTTTGGACTTGGAGG--TTTAATGCTCGCCCTTTCT----TTC-GAAA--GCGAGCTCCTCTCAAATGAATCAGTGGGGTCCGCTTTGCTGATCCTTGAC-GTGATAAAATGTTTCTACGTTTTGGGTTTAGCACTG-TCCCTTGGACGCCTGCTCCTAACTGTCTCGTTGACAATGATGGTGCTCCGGT-CACCGCC-GTCTACATCGGCGGGAGGCTGGACCCACGAAAAGAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA- ; END; BEGIN TREES; TITLE Russula_clavipes_complex; LINK TAXA = Taxa1; TRANSLATE 1 'Russula amoenoides SAV_F_1341', 2 'Russula amoenoides SAV_F_1340', 3 'Russula amoenoides STU_UE2006_11_15_02', 4 'Russula xerampelina UPS_UE14_09_2004_3', 5 'Russula xerampelina TUB_FO46888', 6 'Russula xerampelina SAV_F_3236', 7 'Russula subrubens STU_UE19_08_2002_02', 8 'Russula clavipes UPS_UE22_08_2004_2', 9 'Russula clavipes STU_UE2005_09_07_10', 10 'Russula clavipes SAV_F_1323', 11 'Russula clavipes SAV_F_1327', 12 'Russula clavipes SAV_F_1328', 13 'Russula clavipes SAV_F_1324', 14 'Russula clavipes SAV_F_1331', 15 'Russula clavipes SAV_F_1325', 16 'Russula clavipes FR_652', 17 'Russula clavipes TU_102003', 18 'Russula clavipes TU_102004', 19 'Russula clavipes TU_102006', 20 'Russula clavipes TU_102029', 21 'Russula clavipes TU_102030', 22 'Russula clavipes TU_102036', 23 'Russula clavipes TU_102041', 24 'Russula decolorans TUB_HUE039', 25 'Russula faginea C_PH00_083', 26 'Russula faginea C_JV02_386', 27 'Russula faginea SAV_F_1336', 28 'Russula faginea SAV_F_997', 29 'Russula faginea SAV_F_354', 30 'Russula faginea SAV_F_1337', 31 'Russula favrei UPS_UE06_09_2003_9', 32 'Russula favrei UPS_UE03_07_2003_10', 33 'Russula favrei IB_1996_0021', 34 'Russula favrei IB_1995_0098', 35 'Russula favrei SAV_F_2263', 36 'Russula favrei SAV_F_2254', 37 'Russula favrei SAV_F_1335', 38 'Russula favrei SAV_F_1334', 39 'Russula favrei SAV_F_1333', 40 'Russula graveolens UPS_UE20_09_2004_12', 41 'Russula graveolens UPS_UE2005_08_10_04', 42 'Russula graveolens SAV_F_1343', 43 'Russula graveolens SAV_F_1339', 44 'Russula graveolens SAV_F_1342', 45 'Russula graveolens SAV_F_1338', 46 'Russula nitida UPS_UE08_07_2004_2', 47 'Russula nitida KR_0004221', 48 'Russula nuoljae UPS_UE24_08_2004_09', 49 'Russula nuoljae UPS_UE23_08_2004_10', 50 'Russula nuoljae STU_EE04_41', 51 'Russula nuoljae UPS_UE25_08_2004_06', 52 'Russula nuoljae TU_102008', 53 Russula_nuoljae_TU102014, 54 'Russula nuoljae TU_102011', 55 'Russula nuoljae SAV_F_3022', 56 'Russula nuoljae SAV_F_3092', 57 'Russula nuoljae SAV_F_1321', 58 'Russula nuoljae SAV_F_1320', 59 'Russula pascua SAV_F_1322', 60 'Russula pascua IB_2005_0022', 61 'Russula pascua IB_1998_0124', 62 'Russula pascua KRAM_F_45053', 63 'Russula pascua KRAM_F_45052', 64 'Russula pascua KRAM_F_45048', 65 'Russula pascua IB_2005_1153', 66 'Russula pascua IB_2004_0149', 67 'Russula pascua KRAM_F_45047', 68 'Russula pascua KRAM_F_45046', 69 'Russula pascua KRAM_F_45044', 70 'Russula pascua KRAM_F_45051', 71 'Russula pascua KRAM_F_45045', 72 'Russula subrubens IB_1990_0076', 73 'Russula subrubens STU_UE19_08_2002_08', 74 'Russula subrubens G_KR73_332', 75 'Russula subrubens C_JV02_624', 76 'Russula subrubens C_JV98_294', 77 'Russula subrubens STU_UE20_08_2002_1', 78 'Russula xerampelina UPS_UE21_09_2003_17', 79 'Russula subrubens IB_1991_986'; TREE 'PAUP_1' = [&R] (24:0.03852,((46:0.001518,47:1.0E-8):0.014148,(((27:1.0E-8,(26:1.0E-8,(30:0.001477,(28:1.0E-8,(25:1.0E-8,29:1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):0.007657,((6:0.002171,(5:1.0E-8,(4:1.0E-8,7:0.002912):0.002922):0.002223):0.009541,(35:1.0E-8,(31:1.0E-8,((39:1.0E-8,(37:1.0E-8,38:1.0E-8):1.0E-8):1.0E-8,(36:1.0E-8,(32:1.0E-8,(33:2.12961E-5,34:1.0E-8):0.0):0.0):0.001444):1.0E-8):1.0E-8):0.006591):0.010602):0.005655,((79:1.0E-8,((72:1.0E-8,(73:1.0E-8,(78:1.0E-8,(77:1.0E-8,(76:0.003004,(74:1.0E-8,75:0.001507):1.0E-8):0.001465):1.0E-8):1.0E-8):0.005977):0.001526,((2:1.0E-8,(1:0.001481,3:0.002925):0.001449):0.001958,(41:0.003352,(43:0.003436,(42:1.0E-8,(44:0.002071,(40:1.0E-8,45:1.0E-8):0.004337):0.001777):0.0):0.004405):0.013225):0.01237):2.51175E-7):0.004975,((50:1.0E-8,(48:1.0E-8,(58:0.001466,(55:1.0E-8,(53:1.0E-8,(56:1.0E-8,(54:1.0E-8,(49:1.0E-8,(51:1.0E-8,(52:1.0E-8,57:1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):0.0):0.0):0.006098,((66:1.0E-8,(69:1.0E-8,(59:1.0E-8,(68:1.0E-8,(65:1.0E-8,(61:1.0E-8,(60:1.0E-8,(67:1.0E-8,(63:1.0E-8,(64:1.0E-8,(71:1.0E-8,(62:1.0E-8,70:1.0E-8):0.0):0.0):0.0):0.001441):7.53167E-8):0.0):0.0):2.10052E-5):1.0E-8):1.0E-8):1.0E-8):1.0E-8,(8:1.0E-8,(10:1.0E-8,(16:1.0E-8,(9:1.0E-8,(11:1.0E-8,(14:1.0E-8,(15:1.0E-8,(12:1.0E-8,(18:1.0E-8,(22:1.0E-8,(17:1.0E-8,(19:1.0E-8,(21:1.0E-8,(23:1.0E-8,(13:1.0E-8,20:1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):0.001453):1.0E-8):0.008932):1.0E-8):0.011667):0.03852); END;