#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 20:41 GMT TreeBASE (cc) 1994-2008 Study reference: Coetzee M., Wingfield B.D., Zhao J., Van coller P., & Wingfield M.J. 2015. Phylogenetic relationships among biological species of Armillaria from China. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17215] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=126; TAXLABELS Armillaria_altimontana_JF313117_USA Armillaria_altimontana_JF313118_USA Armillaria_altimontana_JF313120_USA Armillaria_borealis_CMW31072_China Armillaria_borealis_CMW31075_Belarus Armillaria_borealis_CMW31077_China Armillaria_borealis_HQ285901_Finland Armillaria_borealis_JN657494_Finland Armillaria_borealis_JN657495_Germany Armillaria_borealis_JN657496_Switzerland Armillaria_calvescens_CMW31078_USA Armillaria_calvescens_CMW31079_USA Armillaria_calvescens_CMW31080_USA Armillaria_calvescens_JF313129_USA Armillaria_calvescens_JF313130_USA Armillaria_calvescens_JF313138_Canada Armillaria_cepistipes_AB510790_Japan Armillaria_cepistipes_AB510793_Japan Armillaria_cepistipes_CMW31082_Finland Armillaria_cepistipes_CMW31083_Italy Armillaria_cepistipes_EU251395_CzechRep Armillaria_cepistipes_JF313115_USA Armillaria_cepistipes_JF313116_Canada Armillaria_cepistipes_JF746917_UK Armillaria_cepistipes_JN657474_Ukraine Armillaria_cepistipes_KJ414319_Finland Armillaria_cepistipes_KJ414320_Finland Armillaria_cepistipes_KJ414321_Italy Armillaria_gallica_AB510760_Japan Armillaria_gallica_AB510761_Japan Armillaria_gallica_CMW31086_Russia Armillaria_gallica_CMW31087_China Armillaria_gallica_CMW31088_China Armillaria_gallica_CMW31090_Italy Armillaria_gallica_CMW31091_Italy Armillaria_gallica_CMW31093_China Armillaria_gallica_JF313123_Canada Armillaria_gallica_JF313125_USA Armillaria_gallica_JF313126_USA Armillaria_gallica_JF746920_France Armillaria_gallica_JN657480_France Armillaria_gallica_JN657482_Ukraine Armillaria_gallica_JN657485_Ukraine Armillaria_gallica_KJ200952_Germany Armillaria_gallica_KJ200955_Iran Armillaria_gemina_CMW31094_USA Armillaria_gemina_CMW31095_USA Armillaria_gemina_JF313133_USA Armillaria_gemina_JF313135_USA Armillaria_gemina_JF313136_USA Armillaria_mellea_AB510801_Japan Armillaria_mellea_AB510802_Japan Armillaria_mellea_CMW31161_China Armillaria_mellea_CMW31171_USA Armillaria_mellea_CMW31172_China Armillaria_mellea_JF313127_USA Armillaria_mellea_JF313128_USA Armillaria_mellea_JF313137_USA Armillaria_mellea_JN657491_France Armillaria_mellea_JN657493_Ukraine Armillaria_nabsnona_AB510764_Japan Armillaria_nabsnona_AB510766_Japan Armillaria_nabsnona_CMW31100_Canada Armillaria_nabsnona_CMW31101_USA Armillaria_nabsnona_JF313119_USA Armillaria_nabsnona_JF313122_Canada Armillaria_nabsnona_JF313124_USA Armillaria_ostoyae_AB510781_Japan Armillaria_ostoyae_AB510782_Japan Armillaria_ostoyae_CMW31102_China Armillaria_ostoyae_CMW31103_China Armillaria_ostoyae_CMW31104_China Armillaria_ostoyae_CMW31107_Finland Armillaria_ostoyae_CMW31110_China Armillaria_ostoyae_EU251400_CzechRep Armillaria_ostoyae_HQ285903_France Armillaria_ostoyae_JF313139_USA Armillaria_ostoyae_JF313140_USA Armillaria_ostoyae_JF313141_USA Armillaria_ostoyae_JN657486_France Armillaria_ostoyae_JN657489_Ukraine Armillaria_sinapina_AB510774_Japan Armillaria_sinapina_AB510776_Japan Armillaria_sinapina_CMW31112_China Armillaria_sinapina_CMW31113_China Armillaria_sinapina_CMW31115_China Armillaria_sinapina_JF313114_Canada Armillaria_sinapina_JF313131_USA Armillaria_sinapina_JF313132_USA Armillaria_sp_CMW31153 Armillaria_sp._CBS_C_CMW31123 Armillaria_sp._CBS_C_CMW31124 Armillaria_sp._CBS_F_CMW31127 Armillaria_sp._CBS_F_CMW31128 Armillaria_sp._CBS_F_CMW31129 Armillaria_sp._CBS_F_CMW31130 Armillaria_sp._CBS_G_CMW31132 Armillaria_sp._CBS_G_CMW31133 Armillaria_sp._CBS_G_CMW31134 Armillaria_sp._CBS_H_CMW31136 Armillaria_sp._CBS_H_CMW31138 Armillaria_sp._CBS_H_CMW31139 Armillaria_sp._CBS_J_CMW31140 Armillaria_sp._CBS_J_CMW31142 Armillaria_sp._CBS_L_CMW31144 Armillaria_sp._CBS_L_CMW31145 Armillaria_sp._CBS_N_CMW31146 Armillaria_sp._CBS_N_CMW31148 Armillaria_sp._CBS_O_CMW31150 Armillaria_sp._CBS_O_CMW31151 Armillaria_sp._NAG_E_AB510768_Japan Armillaria_sp._NAG_E_AB510769_Japan Armillaria_sp._NAG_E_AB510771_Japan Armillaria_tabescens_AB510804_Japan Armillaria_tabescens_AB510805_Japan Armillaria_tabescens_CMW31118_China Armillaria_tabescens_CMW31119_Italy Armillaria_tabescens_CMW31120_Italy Armillaria_tabescens_HQ285906_Ukraine Armillaria_tabescens_HQ285907_Ukraine Armillaria_tabescens_HQ285908_Ukraine Armillaria_tabescens_JF313111_USA Armillaria_tabescens_JF313112_USA Armillaria_tabescens_JF313113_USA Armillaria_tabescens_JF746929_France Armillaria_tabescens_JF746930 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=128; TAXLABELS Armillaria_altimontana_AY509179_USA Armillaria_altimontana_AY509180_USA Armillaria_altimontana_AY509181_USA Armillaria_borealis_CMW31072_China Armillaria_borealis_CMW31075_Belarus Armillaria_borealis_CMW31077_China Armillaria_borealis_HQ232279_Finland Armillaria_borealis_JN657440_Finland Armillaria_borealis_JN657441_Germany Armillaria_borealis_JN657442_Switzerland Armillaria_calvescens_AY509163_Canada Armillaria_calvescens_AY509164_USA Armillaria_calvescens_AY509166_USA Armillaria_calvescens_CMW31078_USA Armillaria_calvescens_CMW31079_USA Armillaria_calvescens_CMW31080_USA Armillaria_cepistipes_AB510818_Japan Armillaria_cepistipes_AB510849_Japan Armillaria_cepistipes_AY509183_Canada Armillaria_cepistipes_AY509184_USA Armillaria_cepistipes_CMW31082_Findland Armillaria_cepistipes_CMW31083_Italy Armillaria_cepistipes_EU257709_CzechRep Armillaria_cepistipes_JF288720_UK Armillaria_cepistipes_JN657420_Ukraine Armillaria_cepistipes_KJ414316_Finland Armillaria_cepistipes_KJ414317_Finland Armillaria_cepistipes_KJ414318_Italy Armillaria_gallica_AB510834_Japan Armillaria_gallica_AB510842_Japan Armillaria_gallica_AY509171_Canada Armillaria_gallica_AY509172_USA Armillaria_gallica_AY509173_USA Armillaria_gallica_CMW31086_Russia Armillaria_gallica_CMW31087_China Armillaria_gallica_CMW31088_China Armillaria_gallica_CMW31090_Italy Armillaria_gallica_CMW31091_Italy Armillaria_gallica_CMW31093_China Armillaria_gallica_JF288737_France Armillaria_gallica_JN657426_France Armillaria_gallica_JN657428_Ukraine Armillaria_gallica_JN657431_Ukraine Armillaria_gallica_KJ200946_Germany Armillaria_gallica_KJ200949_Iran Armillaria_gemina_AY509158_USA Armillaria_gemina_AY509160_USA Armillaria_gemina_AY509162_USA Armillaria_gemina_CMW31094_USA Armillaria_gemina_CMW31095_USA Armillaria_jezoensis_D89921_Japan Armillaria_mellea_AB510820_Japan Armillaria_mellea_AB510833_Japan Armillaria_mellea_AY509185_USA Armillaria_mellea_AY509187_USA Armillaria_mellea_AY509188_USA Armillaria_mellea_CMW31161_China Armillaria_mellea_CMW31171_USA Armillaria_mellea_CMW31172_China Armillaria_mellea_JN657437_France Armillaria_mellea_JN657439_Ukraine Armillaria_nabsnona_AB510850_Japan Armillaria_nabsnona_AB510851_Japan Armillaria_nabsnona_AY509174_USA Armillaria_nabsnona_AY509176_Canada Armillaria_nabsnona_AY509178_USA Armillaria_nabsnona_CMW31100_Canada Armillaria_nabsnona_CMW31101_USA Armillaria_ostoyae_AB510847_Japan Armillaria_ostoyae_AB510848_Japan Armillaria_ostoyae_AY509154_USA Armillaria_ostoyae_AY509155_USA Armillaria_ostoyae_AY509157_USA Armillaria_ostoyae_CMW31102_China Armillaria_ostoyae_CMW31103_China Armillaria_ostoyae_CMW31104_China Armillaria_ostoyae_CMW31107_Finland Armillaria_ostoyae_CMW31110_China Armillaria_ostoyae_EU257711_CzechRep Armillaria_ostoyae_HQ232281_France Armillaria_ostoyae_JN657432_France Armillaria_ostoyae_JN657435_Ukraine Armillaria_sinapina_AB510827_Japan Armillaria_sinapina_AB510836_Japan Armillaria_sinapina_AY509167_Canada Armillaria_sinapina_AY509168_USA Armillaria_sinapina_AY509169_USA Armillaria_sinapina_CMW31112_China Armillaria_sinapina_CMW31113_China Armillaria_sinapina_CMW31115_China Armillaria_singula_D89926_Japan Armillaria_sp_CMW31153_China Armillaria_sp._CBS_C_CMW31123 Armillaria_sp._CBS_C_CMW31124 Armillaria_sp._CBS_F_CMW31127 Armillaria_sp._CBS_F_CMW31128 Armillaria_sp._CBS_F_CMW31129 Armillaria_sp._CBS_F_CMW31130 Armillaria_sp._CBS_G_CMW31132 Armillaria_sp._CBS_G_CMW31133 Armillaria_sp._CBS_G_CMW31134 Armillaria_sp._CBS_H_CMW31136 Armillaria_sp._CBS_H_CMW31138 Armillaria_sp._CBS_H_CMW31139 Armillaria_sp._CBS_J_CMW31140 Armillaria_sp._CBS_J_CMW31142 Armillaria_sp._CBS_L_CMW31144 Armillaria_sp._CBS_L_CMW31145 Armillaria_sp._CBS_N_CMW31146 Armillaria_sp._CBS_N_CMW31148 Armillaria_sp._CBS_O_CMW31150 Armillaria_sp._CBS_O_CMW31151 Armillaria_sp._NAG_E_AB510828_Japan Armillaria_sp._NAG_E_AB510840_Japan Armillaria_sp._NAG_E_AB510845_Japan Armillaria_tabescens_AB510823_Japan Armillaria_tabescens_AB510824_Japan Armillaria_tabescens_AY509189_USA Armillaria_tabescens_AY509191_USA Armillaria_tabescens_AY509192_USA Armillaria_tabescens_CMW31118_China Armillaria_tabescens_CMW31119_Italy Armillaria_tabescens_CMW31120_Italy Armillaria_tabescens_HQ232284_Ukraine Armillaria_tabescens_HQ232285_Ukraine Armillaria_tabescens_HQ232286_Ukraine Armillaria_tabescens_JF288740_France Armillaria_tabescens_JF288741_France ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M32339] TITLE 'Armillaria from China Fig1 IGS-1'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=787; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Armillaria_altimontana_AY509179_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCG{CT}GCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGCTGGTAACA???????????????????????????????????????????? Armillaria_altimontana_AY509180_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGCTGGTAACA???????????????????????????????????????????? Armillaria_altimontana_AY509181_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGCTGGTAACA???????????????????????????????????????????? Armillaria_borealis_CMW31072_China ACGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTACGAGCCTTGAAGGCATAGAGGGAACTCGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGCTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTGTGATTGAAACGGCCTTAGAAGCTAAGTAAG--CTAGGCTACGCTAC-GATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAATTTTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATGAA?TGC???????????????????????????? Armillaria_borealis_CMW31075_Belarus ACGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTACGAGCCTTGAAGGCATAGAGGGAACTCGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGCTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTGTGATTGAAACGGCCTTAGAAGCTAAGTAAG--CTAGGCTACGCTAC-GATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAATTTTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATGAA?TGC???????????????????????????? Armillaria_borealis_CMW31077_China ACGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTACGAGCCTTGAAGGCATAGAGGGAACTCGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGCTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTGTGATTGAAACGGCCTTAGAAGCTAAGTAAG--CTAGGCTACGCTAC-GATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAATTTTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATGAA?TGC???????????????????????????? Armillaria_borealis_HQ232279_Finland CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTACGAGCCTTGAAGGCATAGAGGGAACTCGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGCTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTGTGATTGAAACGGCCTTAGAAGCTAAGTAAG--CTAGGCTACGCTAC-GATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAATTTTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACCCAATGAAATGCATA????????????????????????? Armillaria_borealis_JN657440_Finland CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTACGAGCCTTGAAGGCATAGAGGGAACTCGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGCTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTGTGATTGAAACGGCCTTAGAAGCTAAGTAAG--CTAGGCTACGCTAC-GATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAATTTTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAGACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACCCAATGAAATGCATA????????????????????????? Armillaria_borealis_JN657441_Germany CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTACGAGCCTTGAAGGCATAGAGGGAACTCGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGCTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTGTGATTGAAACGGCCTTAGAAGCTAAGTAAG--CTAGGCTACGCTAC-GATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAATTTTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAGACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACCCAATGAAATGCATA????????????????????????? Armillaria_borealis_JN657442_Switzerland CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTACGAGCCTTGAAGGCATAGAGGGAACTCGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGCTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTGTGATTGAAACGGCCTTAGAAGCTAAGTAAG--CTAGGCTACGCTAC-GATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAATTTTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATGAAATGCATACTTGTTATCC??????????????? Armillaria_calvescens_AY509163_Canada CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTA-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGG-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_calvescens_AY509164_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTA-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAG{GT}-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_calvescens_AY509166_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATGGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_calvescens_CMW31078_USA ?????TACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------CCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CCGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTG---AACAAACGCAATAAAATGTA??????????????????????????? Armillaria_calvescens_CMW31079_USA ????GTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------CCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTCGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CCGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACACAATAAAATGTATACTTGT???????????????????? Armillaria_calvescens_CMW31080_USA ?????TACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATGGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTTCCATGATTGAAAAGGCCTTGGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGCATA????????????????????????? Armillaria_cepistipes_AB510818_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAT-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTATACTTGTT??????????????????? Armillaria_cepistipes_AB510849_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGACAGGGTAGGCTGACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTATACTTGTT??????????????????? Armillaria_cepistipes_AY509183_Canada CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTT{AC}GATTC{AG}AAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAG{CT}AAG--TTAA-----GCTAC-GGTTACC-TTTTTA{CG}CCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------{AG}GGTTTGCTAAGTAAACCATTGGTCAAGA{CT}CGGTTTGCAACAATTTTG{AG}T{AG}G-CTGTA-GGGCGAGTTTTCATTGACTT-GGC{CT}TATAGTGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_cepistipes_AY509184_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTT{AC}GATTC{AG}AAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAG{CT}AAG--TTAA-----GCTAC-GGTTACC-TTTTTA{CG}CCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------{AG}GGTTTGCTAAGTAAACCATTGGTCAAGA{CT}CGGTTTGCAACAATTTTG{AG}T{AG}G-CTGTA-GGGCGAGTTTTCATTGACTT-GGC{CT}TATAGTGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_cepistipes_CMW31082_Findland ?????TACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTCGATTCAAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGCAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAATAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAA????????????????????????????????? Armillaria_cepistipes_CMW31083_Italy CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTCGATTCAAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGCAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAATAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCACACTT?????????????????????? Armillaria_cepistipes_EU257709_CzechRep CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCAAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAAC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGCAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTAGGGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCA??????????????????????????? Armillaria_cepistipes_JF288720_UK CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTCGATTCAAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCA{CT}GAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGCAAG--TTAA-----GCTAC-GGTTACC-TTTCTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAATAATTTTGGTGG-CTGTA-GGGCGAGTTTT{CG}ATTGACTT-GGCCTATAGTGCGAGTTGGTAACA-AACCCAATAAAATGCACACTTGTATCCACGGCCATA??????? Armillaria_cepistipes_JN657420_Ukraine CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTCGATTCAAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGCAAG--TTAA-----GCTAC-GGTTACC-TTTCTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAATAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCACACTTGTTATCCACGGCCATAGGACT? Armillaria_cepistipes_KJ414316_Finland CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTTCTTTGAATCACGAGTTATTATGAGCCTTGAAGACTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAAT?????????????????????????????? Armillaria_cepistipes_KJ414317_Finland CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCACGAGTTATTATGAGCCTTGAAGACTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAAT?????????????????????????????? Armillaria_cepistipes_KJ414318_Italy CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTCGATTCAAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAAC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGCAAG--TTAA-----GCTAC-GGTTACC-TTTCTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAATAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAAT?????????????????????????????? Armillaria_gallica_AB510834_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCAAACAA-CAATGCC-TTGGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGAAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC--TTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCAGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAATGCAATAAAATGCATACTTGTT??????????????????? Armillaria_gallica_AB510842_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGA-TTGTTCAACTTTGTTGGACTTTCTC-------------TTTTC-TTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTCACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACAGACTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCGACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTGCTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTGGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTT??????????????????? Armillaria_gallica_AY509171_Canada CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTA{GT}TTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTA{AG}-----GCTA{CT}-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AAC{CT}GGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_gallica_AY509172_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTA-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGG-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-C{CT}GTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_gallica_AY509173_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------CCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTC{AG}ACCGTTTACTTAGT-TTTCG-AGGGCTA{CT}GTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CCGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAA{CT}GCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_gallica_CMW31086_Russia CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCAAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTATACTT?TT??????????????????? Armillaria_gallica_CMW31087_China ?CGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCATGAGTTATTATGAGCCTTGAAGACTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAAC??AATAAAATGCATACTTGT???????????????????? Armillaria_gallica_CMW31088_China CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTC-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCGACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTGCTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAAC?CAATAAAATGCATACTTGT???????????????????? Armillaria_gallica_CMW31090_Italy CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAATGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTCGCTAAGTAAACCATTGGTCAAGACCTGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTACACTTGTTATCCC?????????????? Armillaria_gallica_CMW31091_Italy ????GTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGTTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAA??CAATAAAATGTATA?T??????????????????????? Armillaria_gallica_CMW31093_China CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTC-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCGACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTGCTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTTTCC???????????????? Armillaria_gallica_JF288737_France CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTCGCTAAGTAAACCATTGGTCAAGACCTGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTACACTTATTATC???????????????? Armillaria_gallica_JN657426_France CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCATGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTATACTTGTTATC???????????????? Armillaria_gallica_JN657428_Ukraine CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCGACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAG-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTGCTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGCTGGTA??????????????????????????????????????????????? Armillaria_gallica_JN657431_Ukraine CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTC{AG}AAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTA{GT}TTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTC{AG}ACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTA{AG}-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAG{CT}-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AAC{CT}GGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGA{CT}CGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCA??????????????????????????? Armillaria_gallica_KJ200946_Germany CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCGACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAG-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTGCTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGCTGGTAACAAAACGCAATAAAAT?????????????????????????????? Armillaria_gallica_KJ200949_Iran CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGTGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCGACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAG-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTGCTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGCTGGTAACAAAACGCAATAAAAT?????????????????????????????? Armillaria_gemina_AY509158_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTAACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGTGAGTTAATGAGTGATTTGCGGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGGTTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-GATTACC-TTTCTAGGCTTTGTAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACTGGTTTGCAACAATTTTGGTGG-CTGCA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACA???????????????????????????????????????????? Armillaria_gemina_AY509160_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGTGAGTTAATGAGTGATTTGCGGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGGTTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-GATTACC-TTTCTAGGCTTTGTAACCGTTTACTTAGC-TTTC{GT}-AGGGCTACGTTCAA-A{CT}TTTGAACGGC-AACTGGTCC{CT}GAAT{CG}GAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGAC{CT}{GT}GTTTGCAACAA{AT}TTTGGTGG-CTGCA-GG{AG}CGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACA???????????????????????????????????????????? Armillaria_gemina_AY509162_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCG{CT}TGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGTGAGTTAATGAGTGATTTGCGGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGGTTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-GATTACC-TTTCTAGGCTTTGTAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACTGGTTTGCAACAATTTTGGTGG-CTGCA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACA???????????????????????????????????????????? Armillaria_gemina_CMW31094_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGTGAGTTAATGAGTGATTTGCGGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGGTTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-GATTACC-TTTCTAGGCTTTGTAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCCGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACTGGTTTGCAACAATTTTGGTGG-CTGCA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATAAAA??????????????????????????????? Armillaria_gemina_CMW31095_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGTGAGTTAATGAGTGATTTGCGGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGGTTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-GATTACC-TTTCTAGGCTTTGTAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACTGGTTTGCAACAATTTTGGTGG-CTGCA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATAAAAAACACACTTGTTAT????????????????? Armillaria_jezoensis_D89921_Japan ????????????????????????????????????????????????????????????????????????????AACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACACCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTGGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACAGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCGACGACTGATTTTCTGGATCGTT-AGTGAGCCTGA-GGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTGCTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAAT??AATGCATACTTGTT??????????????????? Armillaria_mellea_AB510820_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTATAAAGATTTGTTCAACTTTGTTGAACTTTCTCT-TTCTC------TTTTTTCTTTACATGCTGA-ATGGTGAGGGCCGGGATAGTATCCTTTGTGCACT-CCCAACAGCA--TGTT--------TCGAACTTGTAAA--GCTAA-------------CGTT---------TTCGTTACCTT----TCTTGTAAGAATCATGAGG--------------------TAGAAGGGGTCTGGTTAGCAAGCTTTCTTTCTTTGAACGCGCGCTGAC---------TCTTTACCTTGTACTTGGATATCGGCCTTATGGTCGATATTCG-GTATATGGTATAGCCAAAGGACTCCTAA----------------------AAAGGCATTC-AGTGCGACTGGATTGCCTTTTTTAGGCC-------TTGAAATCGTCTTTGGGACTAAGTAAG--CTAA-----GCTAT-GGTTACT-TTTGTAACCGTTGCGACTGTTTGCTTGGG-TTTCA-AGGTGAA-----------TTGAAGGGT-AACTGGTACTGAACTGAAAGGTTTACT------------AAGTTTACTAAGTAAACCATTCATCAAGTCCGGTTTGTGATAATCTTGGGGG-CTCTA-AAGCGTGTTTTGTAAGAGCTGGGACTATAGT-TGAGTTGGTAACGAAACGCAATAAGATGCATTACAATT??????????????????? Armillaria_mellea_AB510833_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTCTCTTTATCTTTTTTCTTTACATGCTGA-ATGGTGAGGGCCGGGATAGTATCCTTTGTGCACT-CCCAACAGCA--TGTT--------TCGAACTTGTAAA--GTTAA-CG------TTTTCGTT---------TTCGTTACCTT----TCTTGTAAGAATCATGAGG--------------------TAGAAGGGGTCTGGTTAGCAAGCTTTCTTTCTTTGAACGCGCGCTGAC---------TCTTTACCTTGTACTTGGATATCGGCCTTATGGTTGATATTCG-GTATATGGTATAGCCAAAGGACTCCTAA----------------------AAGGGCATTC-AGTGCGACTGGATTGCCTTTTTTAGGCC-------TTGAAATCGTCTTTGGGACTAAGTAAG--CTAA-----GCTAT-GGTTACT-TTTGTAACCGTTGCGACTGTTTGCTTGGG-TTTCA-AGGCGAA-----------TTGAAGGGT-AACTGGTACTGAACTGAAAGGTTTACT------------AAGTTTACTAAGTAAACCATTCATCAAGTCCGGTTTGTGATAATCTTGGGGG-CTCTA-AAGCGTGTTTTCTAAGAGCTGGGACTATAGT-TGAGTTGGTAACAAAACGCAATAAGATGCATTACAGTT??????????????????? Armillaria_mellea_AY509185_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTTTCTTTACATGCTGA-ACGCTGAGGGCCGGGATAGTCTATCTCGTGCACT-CGCAACAGCA--TGTTTCTTAGGTTCGAACGGGTAAAGTGCTAA-------------CGAT---------TTCGTTACCTT----TCTTGTAAGAATCATGAA---------------------CATAAGGGATCTGGTTAGCAACC-------GTTTGAACGCGCGCTGAC---------TCTTTACCTTGTACTT-GATATCGGCCTTATGGTCGATATTCC-GTATATGGTATAGCCAAAGGACCCCTAA----------------------TTAGGCATTC-AGTGCGACTGGATTGCCCGATTTAGGCC-------TTGAAATGGTCTTTGGGACTAAGTAAGCGCTTA-----GCTAT-GGTTACT-TTTGTAGCCGTTGCGACTGCTTGCTTGGG-TTTCA-AGGCCTA-----------TTGAAGGGT-AACTGGTACTGAATCGAAAGGTTTATTTGGTGAATCGAAAGGTTTACTAAGTAAACCATTGGTGAAGTCCGGTTTGTGATAATCTTGGGGG-CTCTA-AGGCGTGTTTTCTAAGAGCT-GGACTATAGT-CGAGTTGGTAACA???????????????????????????????????????????? Armillaria_mellea_AY509187_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTTTCTTTACATGCTGA-ACGCTGAGGGCCGGGATAGTCTATCTCGTGCACT-CGCAACAGCA--TGTTTCTTAGGTTCGAACGGGTAAAGTGCTAA-------------CGAT---------TTCGTTACCTT----TCTTGTAAGAATCATGAA---------------------CATAAGGGATCTGGTTAGCAACC-------GTTTCAACGCGCGCTGAC---------TCTTTACCTTGTACTT-GATATCGGCCTTATGGTCGATATTCC-GTATATGGTATAGCCAAAGGACCCCTAA----------------------TTAGGCATTC-AGTGCGACTGGATTGCCCGATTTAGGCC-------TTGAAATGGTCTTTGGGACTAAGTAAGCACTTA-----GCTAT-GGTTACT-TTTGTAGCCGTTGCGACTGCTTGCTTGGG-TTTCA-AGGCCTA-----------TTGAAGGGT-AACTGGTACTGAATCGAAAGGTTTATTTGGTGAATCGAAAGGTTTACTAAGTAAACCATTGGTGAAGTCCGGTTTGTGATAATCTTGGGGG-CTCTA-AGGCGTGTTTTCATTGAGCT-GGACTATAGT-CGAGTTGGTAACA???????????????????????????????????????????? Armillaria_mellea_AY509188_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTTTCTTTACATGCTGA-ACGCTGAGGGCCGGGATAGTCTATCTCGTGCACT-CGCAACAGCA--TGTTTCTTAGGTTCGAACGGGTAAAGTGCTAA-------------CGAT---------TTCGTTACCTT----TCTTGTAAGAATCATGAA---------------------CATAAGGGATCTGGTTAGCAACC-------GTTTCAACGCGCGCTGAC---------TCTTTACCTTGTACTT-GATATCGGCCTTATGGTCGATATTCC-GTATATGGTATAGCCAAAGGACCCCTAA----------------------TTAGGCATTC-AGTGCGACTGGATTGCCCGATTTAGGCC-------TTGAAATGGTCTTTGGGACTAAGTAAG--CTTA-----GCTAT-GGTTACT-TTTGTAGCCGTTGCGACTGCTTGCTTGGG-TTTCA-AGG{CG}CTA-----------TTGAAGGGT-AACTGGTACTGAATCGAAAGGTTTATTTGGTGAATCGAAAGGTTTACTAAGTAAACCATTGGTGAAGTCCGGTTTGTGATAATCTTGGGGG-CTCTA-AGGCGTGTTTTCATTGAGCT-GGACTATAGT-CGAGTTGGTAACA???????????????????????????????????????????? Armillaria_mellea_CMW31161_China CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTCTC------TTTTTTCTTTACATGCTGA-ATGGTGAGGGCCGGGATAGTATCCTTTGTGCACT-CCCAACAGCA--TGTT--------TCGAACTTGTAAA--GCTAA-CG------TTTTCGTT---------TTCGTTACCTT----TCTTGTAAGAATCATGAGG--------------------TAGAAGGGGTCTGGTTAGCAAGCTTTCTTTCTTTGAACGCGCGCTGAC---------TCTTTACCTTGTACTTGGATATCGGCCTTATGGTTGATATTCG-GTATATGGTATAGCCAAAGGACTCCTAA----------------------AAAGGCATTC-AGTGCGACTGGATTGCCTTTTTTAGGCC-------TTGAAATCGTCTTTGGGACTAAGTAAG--CTAA-----GCTAT-GGTTACT-TTTGTAACCGTTGCGACTGTTTGCTTGGG-TTTCA-AGCCGAA-----------TTGAAGGGT-AACTGGTACTGAACTGAAAGGTTTACT------------AAGTTTACTAAGTAAACCATTCATCAAGTCCGGTTTGTGATAATCTTGGGGG-CTCTA-AAGCGTGTTTTCTAAGAGCTGGGACTATAGT-TGAGTTGGTAACGAAACGCAATAAGATGCATTACAATTTCA???????????????? Armillaria_mellea_CMW31171_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTTTCTTTACATGCTGA-ACGCTGAGGGCCGGGATAGTCTATCTCGTGCACT-CGCAACAGCA--TGTTTCTTAGGTTCGAACGGGTAAAGTGCTAA-------------CGAT---------TTCGTTACCTT----TCTTGTAAGAATCATGAA---------------------CATAAGGGATCTGGTTAGCAACC-------GTTTGAACGCGCGCTGAC---------TCTTTACCTTGTACTT-GATATCGGCCTTATGGTCGATATTCC-GTATATGGTATAGCCAAAGGACCCCTAA----------------------TTAGGCATTC-AGTGCGACTGGATTGCCCGATTTAGGCC-------TTGAAATGGTCTTTGGGACTAAGTAAG--CTTA-----GCTAT-GGTTACT-TTTGTAGCCGTTGCGACTGCTTGCTTGGG-TTTCA-AGGCCTA-----------TTGAAGGGT-AACTGGTACTGAATCGAAAGGTTTATTTGGTGAATCGAAAGGTTTACTAAGTAAACCATTGGTGAAGTCCGGTTTGTGATAATCTTGGGGG-CTCTA-AGGCGTGTTTTCTAAGAGCT-GGACTATAGT-CGAGTTGGTAACAAAACGCAATAAGATGCATTAGAGTTATCCC?????????????? Armillaria_mellea_CMW31172_China CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTCTCT-----TTTTTTCTTTACATGCTGA-ATGGTGAGGGCCGGGATAGTATCCTTTGTGCACT-CCCAACAGCA--TGTT--------TCGAACTTGTAAA--GCTAA-------------CGTT---------TTCGTTACCTT----TCTTGTAAGAATCATGAGG--------------------TAGAAGGGGTCTGGTTAGCAAGCTTTCTTTCTTTGAACGCGCGCTGAC---------TCTTTACCTTGTACTTGGATATCGGCCTTATGGTCGATATTCG-GTATATGGTATAGCCAAAGGACTCCTAA----------------------AAAGGCATTC-AGTGCGACTGGATTGCCTTTTTTAGGCC-------TTGAAATCGTCTTTGGGACTAAGTAAG--CTAA-----GCTAT-GGTTACT-TTTGTAACCGTTGCGACTGTTTGCTTGGG-TTTCA-AGGTGAA-----------TTGAAGGGT-AACTGGTACTGAACTGAAAGGTTTACT------------AAGTTTACTAAGTAAACCATTCATCAAGTCCGGTTTGTGATAATCTTGGGGG-CTCTA-AAGCGTGTTTTCTAAGAGCTGGGACTATAGT-TGAGTTGGTAACGAAACGCAATAAGATGCATGACAATATCC???????????????? Armillaria_mellea_JN657437_France CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCTCTTCTCT-----TTCTTTTTTTACATGCTGA-ACGCTGAGGGCCGGGATTGTATCCTTTGTGCACT-CGCGTCAGCA--TGTTTCTTAGGTTCGAACTTGTAAA--GCTAA-------------CCAT---------TTCGTTACCTT----TCTTGTAAGAATCATGAGATATCATCAGTCTTGAAGACTTATAAGGGATCTGGTTAGCAAGC--------TTTGAACGCGCGCTGAC---------TCTTTACCTTGTACTT-GATATCGGCCTTATGGTCGATATTCG-GTATATGGTATAGCCAAAGGATCCCTAA----------------------AAAGGCATTC-AGT--GACTGGATTGCCGGATTTAGGCC-------TTGAAATGGTCTTTGGGACTAAGTAAG--CTTA-----GCTAT-GGTTACT-TTTGTAGCCGTTGCGACTGCTTGCTTGTG-TTTCG-AAGCCTA-----------TTGAAGGGT-AACTGGTACCGAATCCAAAGGTTTACTTGGTGAATCGAAAGGTTTACTAAGTGAACCATTGGTGAAGTCCGGTTTGCGATAATCTTGGGGGTTTCTA-AGGCGGATTTTCTAAGAGCT-GGACTATAGT-CGAGTGTACAAAC--GCATAATGCAGCGTACG????????????????????????? Armillaria_mellea_JN657439_Ukraine CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCTCTTCTCT-----TTCTTTTTTTACATGCTGA-ACGCTGAGGGCCGGGATTGTATCCTTTGTGCACT-CGCGTCAGCA--TGTTTCTTAGGTTCGAACTTGTAAA--GCTAA-------------CCAT---------TTCGTTACCTT----TCTTGTAAGAATCATGAGATATCATCAGTCTTGAAGACTTATAAGGGATCTGGTTAGCAAGC--------TTTGAACGCGCGCTGAC---------TCTTTACCTTGTACTT-GATATCGGCCTTATGGTCGATATTCG-GTATATGGTATAGCCAAAGGATCCCTAA----------------------AAAGGCATTC-AGT--GACTGGATTGCCGGATTTAGGCC-------TTGAAATGGTCTTTGGGACTAAGTAAG--CTTA-----GCTAT-GGTTACT-TTTGTAGCCGTTGCGACTGCTTGCTTGTG-TTTTG-AAGCCTA-----------TTGAAGGGT-AACTGGTACCGAATCCAAAGGTTTACTTGGTGAATCGAAAGGTTTACTAAGTGAACCATTGGTGAAGTCCGGTTTGCGATAATCTTGGGGGTTTCTA-AGGTGGATTTTCATTGAGCT-GGACTATAGT-CGAGTTGGTAAAC???????????????????????????????????????????? Armillaria_nabsnona_AB510850_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCCAAAGGGTAAGCTAACAACCGCCTTC-TTAGTG-T---------TTTGTTACCTT----TCTCGTTTGAATCACGAGTTATTATGAGCCT----------------------TTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTTTTTACCTTATACTT-GATATCGACCTTATGGGCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTGAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACATTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTG-CTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTT??????????????????? Armillaria_nabsnona_AB510851_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCCAAAGGGTAAGCTAACAA-CGCCTTC-TTAGTG-T---------TTTGTTACCTT----TCTCGTTTGAATCACGAGTTATTATGAGCCT----------------------TTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTTTTTACCTTATACTT-GATATCGACCTTATGGGCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTGAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTT??????????????????? Armillaria_nabsnona_AY509174_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTC-TTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCCAAAGGGTAAGCTAACAA-CGCCTTC-TTAGTG-T---------TTTGTTACCTT----TCTCGTTTGAATCACGAGTTATTATGAGCCTTGAAGGCCTATAAGGAACTTAGTTAGCAAGC--------CCTAACCGCGC{CG}CTGACTTGGAACGGTTTTTACCTTATACTT-GATATCGACCTTATGGGCGATATCCC-GTATATGGTATAGCCAAGATCCTTGGAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGCTTGTCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAATGAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGTCTATAGTGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_nabsnona_AY509176_Canada CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTC-TTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCCAAAGGGTAAGCTAACAA-CGCCTTC-TTAGTG-T---------TTTGTTACCTT----TCTCGTTTGAATCACGAGTTATTATGAGCCTTGAAGGCCTATAAGGAACTTAGTTAGCAAGC--------CCTAACCGCGCGCTGACTTGGAACGGTTTTTACCTTATACTT-GATATCGACCTTATGGGCGATAT{CT}CC-GTATATGGTATAGCCAAGATCCTTGGAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGCTTG{CT}CCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAATGAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GG{CT}CTATAGTGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_nabsnona_AY509178_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCCAAAGGGTAAGTTAACAA-CGCCTTC-TTAGTG-T---------TTTGTTACCTT----TCTCGTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGAACTTAGTTAGCAGGC--------TCTAACCGCGCGCTGACTTGGAACGGTTTTTACCTTATACTT-GATATCGACCTTATGGGCGATATTCC-GTATATGGTATAGCCAAGATCCTTGGAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGCTTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAATGAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_nabsnona_CMW31100_Canada CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCCAAAGGGTAAGTTAACAA-CGCCTTC-TTAGTG-T---------TTTGTTACCTT----TCTCGTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGAACTTAGTTAGCAGGC--------TCTAACCGCGCGCTGACTTGGAACGGTTTTTACCTTATACTT-GATATCGACCTTATGGGCGATATTCC-GTATATGGTATAGCCAAGATCCTTGGAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGCTTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAATGAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACACAATAAAATGCGTA????????????????????????? Armillaria_nabsnona_CMW31101_USA ????????TGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCCAAAGGGTAAGTTAACAA-CGCCTTC-TTAGTG-T---------TTTGTTACCTT----TCTCGTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGAACTTAGTTAGCAGGC--------TCTAACCGCGCGCTGACTTGGAACGGTTTTTACCTTATACTT-GATATCGACCTTATGGGCGATATTCC-GTATATGGTATAGCCAAGATCCTTGGAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGCTTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAATGAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACACAATAAAATGCGTACTTGTTATCACGC?C?????????? Armillaria_ostoyae_AB510847_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCTTTCGAACGGGTAAGCTAACAA----CAAC-TTTGTG-T---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTGCCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GCATATGGTATAGCCAAGATCCTTGAAAGAGCGAGTTAATGAGTGATTTTCTGGTTCGTC-AGTGAGCTTGAATGCCTGCCCTAAGGTTGCCATGAATGAAATGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-GGTTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTTCT-AGGGCTACGTTCAA-ACTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCTGTTTGCAACAAATTTGGTGG-CTGCA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATAAAATGCATACTTGTT??????????????????? Armillaria_ostoyae_AB510848_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCTTTCGAACGGGTAAGCTAACAA----CAAC-TTTGTG-T---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTGCCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GCATATGGTATAGCCAAGATCCTTGAAAGAGCGAGTTAATGAGTGATTTTCTGGTTCGTC-AGTGAGCTTGAATGCCTGCCCTAAGGTTGCCATGAATGAAATGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-GGTTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTTCT-AGGGCTACGTTCAA-ACTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCTGTTTGCAACAAATTTGGTGG-CTGCA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATAAAATGCATACTTGTT??????????????????? Armillaria_ostoyae_AY509154_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGT----------CTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GCATATGGTATAGCCAAGATCCTTGAAAGAGCGAGTTAATAAGTGATTTGCTGGATCGTC-AGTGAGCTTGAATGCCTGCCCTAAGGTTGCCATGAATGAAATGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-GGTTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCT--AGGGCTACGTTCAA-ACTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCTGTTTGCAACAAATTTGGTGG-CTGCA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACA???????????????????????????????????????????? Armillaria_ostoyae_AY509155_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----C{AG}CC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTT{AG}TTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GCATATGGTATAGCCAAGATCCTTGAAAGAGCGAGTTAATAAGTGATTTGCTGGATCGTC-AGTGAGCTTGAATGCCTGCCCTAAGGTTGCCATGAATGAAATGGCCTTAGGA{CG}CTAAGTAAG--CTAA-----GCTAC-GGTTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCT--AGGGCTACGTTCAA-AGTTTGAACGGCAAACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCTGTTTGCAACAAATTTGGTGG-CTGCA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACA???????????????????????????????????????????? Armillaria_ostoyae_AY509157_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTTTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GCATATGGTATAGCCAAGATCCTTGAAAGAGCGAGTTAATAAGTGATTTGCTGGATCGTC-AGTGAGCTTGAATGCCTGCCCTAAGGTTGCCATGAATGAAATGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-GGTTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCT--AGGGCTACGTTCAA-AGTTTGAACGGCAAACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCTGTTTGCAACAAATTTGGTGG-CTGCA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACA???????????????????????????????????????????? Armillaria_ostoyae_CMW31102_China CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTT-TTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTCTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAATGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGATTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAT-GATTACC-TTTCTAGCTGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATAAAATGCACA????????????????????????? Armillaria_ostoyae_CMW31103_China ?CGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTT--TTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTCTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAATGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGATTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAT-GATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATAAAATGCACACT??????????????????????? Armillaria_ostoyae_CMW31104_China ?GGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTT-TTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTCTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAATGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGATTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAT-GATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAGCGCA????????????????????????????????????? Armillaria_ostoyae_CMW31107_Finland CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTT-CGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTCTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCCGACTTGGAATGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTGGCTATGATTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-AATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATAAAATGCATACTTGTTATCCCG????????????? Armillaria_ostoyae_CMW31110_China CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTT-TTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTGCGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTCTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCTGACTTGGAATGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGATTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAT-GATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATAAAATGCACACTTGTTA?????????????????? Armillaria_ostoyae_EU257711_CzechRep CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTT-CGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTCTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCCGACTTGGAATGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGATTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-AATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGCTTTCTG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGATTT-GGCCTATAGCGAAAGTTGGTAACAAAACGCAATAAAATGCA??????????????????????????? Armillaria_ostoyae_HQ232281_France CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGGTTACTTCGTTCGAACGGGTAAGCTAACAA----CGCCTTTGGTGTT---------TTTGTTACCTT----TCTCGTCTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCCGACTTGGAATGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCCTGCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGATTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTACAAATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAG-TTTCATTGATTT-GGCCTATAGCGAAAGTGTACA??????????????????????????????????????????????? Armillaria_ostoyae_JN657432_France CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTT-CGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTCTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCCGACTTGGAATGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGATTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-GATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAG-TTTCATTGATTT-GGCCTATAGCGAAAGTGTACAA------ACGCATAAATGCATACTTGT???????????????????? Armillaria_ostoyae_JN657435_Ukraine CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTT-CGTTCGAACGGGTAAGCTAACAA----CGCC-TTGGTGTT---------TTTGTTACCTT----TCTCGTCTGAATCATGAGTTATTATGAGCCTTGAAGGCTTAGAAGGAACTTGGTTAGCAAGC--------TCTAAACGCGCGCCGACTTGGAATGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCT-GCATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTTAATGAGTGATTTGCTGGATCGTC-AGTGAGCTTGAAGGCCTGCCCTAAGGTTGCTATGATTGAAACGGCCTTAGGAGCTAAGTAAG--CTAA-----GCTAC-AATTACC-TTTCTAGCCGTTGTAACCGTTTACTTAGC-TTCTG-AGGGCTACGTTCAA-ATTTTGAACGGC-AACTGGTCCTGAATCGAA---------------------AGGTTTGCTATGTAAACCTTTAGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAG-TTTCATTGATTT-GGCCTATAGCGAAAGTGTACAA------ACGCATAAATGCATACTTGTT??????????????????? Armillaria_sinapina_AB510827_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGCCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGTCCTTGGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTATACTTGTT??????????????????? Armillaria_sinapina_AB510836_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTC-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGGTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GAGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTATACTTGTT??????????????????? Armillaria_sinapina_AY509167_Canada CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTCGATTCAAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACCTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGC{CT}TGAGGGCCTGCCCTAAGGTTGCC{AT}TGATTGAAAAGGCCTTAGAAGCTAAGCAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_sinapina_AY509168_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_sinapina_AY509169_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTT{AC}GATTC{AG}AAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCAC{CT}TAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGC{CT}TGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAG{CT}AAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAG{CT}-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AAC{CT}GGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGA{CT}CGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACA???????????????????????????????????????????? Armillaria_sinapina_CMW31112_China CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCATGTGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTGGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTATACTTGTTATCCACGG??????????? Armillaria_sinapina_CMW31113_China CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAGCGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCATGAGTTATTATGAGCCTTGAAGACTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTTAT????????????????? Armillaria_sinapina_CMW31115_China CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCATGTGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTGGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTATACTTGTTACCCC?????????????? Armillaria_singula_D89926_Japan ??????????????????AGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTC-TTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTCACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACAGACTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCGACGACTGATTTTCTGGATCGTTCAGTGAGCCTGAGGGCCTGCCCTAAGGTTCCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTGCTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGATCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTTATCCACGGCCATAGGACT? Armillaria_sp_CMW31153_China ACGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACTCCCCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATGAA?TGC???????????????????????????? Armillaria_sp._CBS_C_CMW31123 ?GGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCATGAGTTATTATGAGCCTTGAAGACTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAGGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTT?????????????????????? Armillaria_sp._CBS_C_CMW31124 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TCAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTATACTTGTTAT????????????????? Armillaria_sp._CBS_F_CMW31127 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AAGTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GAGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTT??????????????????? Armillaria_sp._CBS_F_CMW31128 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AAGTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GAGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTTAT????????????????? Armillaria_sp._CBS_F_CMW31129 ?GGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCCACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTGGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTATACTT?????????????????????? Armillaria_sp._CBS_F_CMW31130 ?CGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCTTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTATTTAGCAAGC--------TCTAACCGTGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCGAGTCCACGACTGATTTTCTGGATCGTT-AGTGAGCCTGAGGGCCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTGGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAGCCGTTTCAACCGTTTACTTAGT-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACCGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGCGAGTTTTCATTGACTT-GGCCTATAATGCGAGTTGGTAACAAAACGCAATAAAATGTATACTTGT???????????????????? Armillaria_sp._CBS_G_CMW31132 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTCTCT-----TTTTTTCTTTACATGCTGA-ATGGTGAGGGCCGGGATAGTATCCTTTGTGCACT-CCCAACAGCA--TGTT--------TCGAACTTGTAAA--GCTAA-------------CGTT---------TTCGTTACCTT----TCTTGTAAGAATCATGAGG--------------------TAGAAGGGGTCTGGTTAGCAAGCTTTCTTTCTTTGAACGCGCGCTGAC---------TCTTTACCTTGTACTTGGATATCGGCCTTATGGTCGATATTCG-GTATATGGTATAGCCAAAGGACTCCTAA----------------------AAAGGCATTC-AGTGCGACTGGATTGCCTTTTTTAGGCC-------TTGAAATCGTCTTTGGGACTAAGTAAG--CTAA-----GCTAT-GGTTACT-TTTGTAACTGTTGCGACTGTTTGCTTGGG-TTTCA-AGGCGAA-----------TTGAAGGGT-AACTGGTACTGAACTGAAAGGTTTACT------------AAGTTTACTAAGTAAACCATTCATCAAGTCCGGTTTGTGATAATCTTGGGGG-CTCTA-AAGTGTGTTTTCTAAGAGCTGGGACTATAGT-TGAGTTGGTAACGAAACGCAATAAGATGCATTACAATTTC????????????????? Armillaria_sp._CBS_G_CMW31133 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTCTC------TTTTTTCTTTACATGCTGA-ATGGTGAGGGCCGGGATAGTATCCTTTGTGCACT-CCCAACAGCA--TGTT--------TCGAACTTGTAAA--GCTAA-------------CGTT---------TTCGTTACCTT----TCTTGTAAGAATCATGAGG--------------------TAGAAGGGGTCTGGTTAGCAAGCTTTCTTTCTTTGAACGCGCGCTGAC---------TCTTTACCTTGTACTTGGATATCGGCCTTATGGTTGATATTCG-GTATATGGTATAGCCAAAGGACTCCTAA----------------------AAAGGCATTC-AGTGCGACTGGATTGCCTTTTTTAGGCC-------TTGAAATCGTCTTTGGGACTAAGTAAG--CTAA-----GCTAT-GGTTACT-TTTGTAACCGTTGCGACTGTTTGCTTGGG-TTTCA-AGCCGAA-----------TTGAAGGGT-AACTGGTACTGAACTGAAAGGTTTACT------------AAGTTTACTAAGTAAACCATTCATCAAGTCCGGTTTGTGATAATCTTGGGGG-CTCTA-AAGTGTGTTTTCTAAGAGCTGGGACTATAGT-TGAGTTGGTAACGAAACGCAATAAGATGGATTAC??????????????????????? Armillaria_sp._CBS_G_CMW31134 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTCTCT-----TTTTTTCTTTACATGCTGA-ATGGTGAGGGCCGGGATAGTATCCTTTGTGCACT-CCCAACAGCA--TGTT--------TCGAACTTGTAAA--GCTAA-CG------TTTTCGTT---------TTCGTTACCTT----TCTTGTAAGAATCATGAGG--------------------TAGAAGGGGTCTGGTTAGCAAGCTTTCTTTCTTTGAACGCGCGCTGAC---------TCTTTACCTTGTACTTGGATATCGGCCTTATGGTCGATATTCG-GTATATGGTATAGCCAAAGGACTCCTAA----------------------AAAGGCATTC-AGTGCGACTGGATTGCCTTTTTTAGGCC-------TTGAAATCGTCTTTGGGACTAAGTAAG--CTAA-----GCTAT-GGTTACT-TTTGTAACCGTTGCGACTGTTTGCTTGGG-TTTCA-AGGCGAA-----------TTGAAGGGT-AACTGGTACTGAACTGAAAGGTTTACT------------AAGTTTACTAAGTAAACCATTCATCAAGTCCGGTTTGTGATAATCTTGGGGG-CTCTA-AAGCGTGTTTTCTAAGAGCTGGGACTATAGT-TGAGTTGGTAACGAAACGCAATAAGATGCATTACAATTAC????????????????? Armillaria_sp._CBS_H_CMW31136 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-TTTTGTTACCTTTGTTACCTT----TCTCCTTTGAATCACGAGTTATTATGAGCCTTGAAGACTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTT?????????????????????? Armillaria_sp._CBS_H_CMW31138 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCACGAGTTATTATGAGCCTTGAAGACTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAGCGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAG--TTCATTGACTT--GCCTATAGTGCGAGTTGGTAACAAAACGCAATAAA?TGCATACTTGT???????????????????? Armillaria_sp._CBS_H_CMW31139 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCACGAGTTATTATGAGCCTTGAAGACTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTTATCCA?????????????? Armillaria_sp._CBS_J_CMW31140 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCACGAGTTATTATGAGCCTTGAAGACTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTTATCCACGGC?A???????? Armillaria_sp._CBS_J_CMW31142 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCACGAGTTATTATGAGCCTTGAAGACTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTT??????????????????? Armillaria_sp._CBS_L_CMW31144 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CGATGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCCAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTACAGAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCACACTTGTTATCC??????????????? Armillaria_sp._CBS_L_CMW31145 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAATCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAGGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGCTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGG-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTTAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAATTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTTATCCACG???????????? Armillaria_sp._CBS_N_CMW31146 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGCTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATAC???????????????????????? Armillaria_sp._CBS_N_CMW31148 ??GGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCACGAGTTATTATGAGCCTTGAAGGCTTATAAGGCATTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACACAATAAAATGCATACTT?????????????????????? Armillaria_sp._CBS_O_CMW31150 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCACGAGTTATTATGAGCCTTGAAGACTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTGAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTT---------AACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACACC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTT?????????????????????? Armillaria_sp._CBS_O_CMW31151 CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAAACCTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTTGAAAGAGTAAGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTT----TCTCCTTTGAATCACGAGTTATTATGAGCCTTGAAGACTTATAAGGCACTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACTTTATGGCCGATATCCC-GTATATGGTATAGCCAAGATCCTTGAAAGGGCAAGTCAACGACTGATTTTCTGGATCGTT-AGTGAGCTTAAGGGTCTGCCCTAAGGTTGCCATGATTGAAAAGGCCTTAGAAGCTAAGTAAG--TTAA-----GCTAC-GGTTACC-TTTTTAACCGTTTCAACCGTTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACAGC-AACTGGTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCATTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGTTTTCATTGACTT-GGCCTATAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTT?????????????????????? Armillaria_sp._NAG_E_AB510828_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACGTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTTACCCTTCTCTTTGAATCACGAGTTATTATGAGCCTTGAAGACTTATAAGGCATTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGGCGATATCCC-GTATATGGTATAGCCAAGATCCTTAAAAGGGCAAGTCAGCGACTGATTTTCTGGATCGCT-AGTGAGCTTTAATGTCTGCCCTAAGGTTGCCATGATTGAAAAGGGCTTAAAAGCCAAGTAAG--TTAA-----GCTAC-GGTTGCCTTTTTTAGCTGTTTCCACCATTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAACGGC-AACTGTTTCTGAAACGAA---------------------AGGTTTGTTAAGTAAACCGTTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGATTTCATTGACTT-GGCCTACAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTT??????????????????? Armillaria_sp._NAG_E_AB510840_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACGTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTTACCCTTCTCTTTGAATCACGAGTTATTATGAGCCTTGAAGACTTATAAGGCATTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGGCGATATCCC-GTATATGGTATAGCCAAGATCCTTAAAAGGGCAAGTCAGCGACTGATTTTCTGGATCGCT-AGTGAGCTTTAATGTCTGCCCTAAGGTTGCCATGATTGAAAAGGGCTTAAAAGCCAAGTAAG--TTAA-----GCTAC-GGTTGCCTTTTTTAGCCGTTTCCACCATTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAATGGC-AACTGTTTCTGAAACGAA---------------------AGGTTTGCTAAGTAAACCGTTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGATTTCATTGACTT-GGCCTACAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTT??????????????????? Armillaria_sp._NAG_E_AB510845_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTC-------------TTTTCTTTTTACATGCTGAGACGTTGAGGGCCGGGATAGTATCCTTTGTGCACT-CGCGACAGCA--TGTTACTTAGATTCGAAAGGGTAGGCTAACAA-CAACGCC-TTAGTG-T---------TTTGTTACCTTACCCTTCTCTTTGAATCACGAGTTATTTTGAGCCTTGAAGGCTTATAAGGCATTTAGTTAGCAAGC--------TCTAACCGCGCGCTGACTTGGAACGGTCTTTACCTTGTACTT-GATATCGACCTTATGGGCGATATCCC-GTATATGGTATAGCCAAGATCCTTAAAAGGGCAAGTCAGCGACTGATTTTCTGGATCGCT-AGTGAGCTTTAATGTCTGCCCTAAGGTTGCCATGATTGAAAAGGGCTTAAAAGCCAAGTAAG--TTAA-----GCTAC-GGTTGCTTTTTTTAGCCGTTTCCACCATTTACTTAGC-TTTCG-AGGGCTACGTTCAA-AATTTGAATGGC-AACTGTTTCTGAAACGAA---------------------AGGTTTGTTAAGTAAACCGTTGGTCAAGACCGGTTTGCAACAATTTTGGTGG-CTGTA-GGGTGAGATTTCATTGACTT-GGCCTACAGTGCGAGTTGGTAACAAAACGCAATAAAATGCATACTTGTT??????????????????? Armillaria_tabescens_AB510823_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TTTTCTTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTTTGTGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AAGGCTTAGAAGGAACCTGGTTAGCAAAC------------------CGCTGACTTGGAATGTTCTTAGTCTTGTACTT-GGTATCGGTGCTTTGGCCGAGATAAC-TTATAAGGTATAGGCAGAAAGCTTGAAAGCGCAAGTTAGTGATTGTACTAATGGACCGTT-AATGAGCTTGAGGGCCTGCCCTTAAGCATGCCTTGTTGAAATGCCCTTAGGAGCTAAGCGAA--TGAA-----GCTAA-GGTTACC-TTTTTAACTGCGCTAAATGTTTACTTGGC-TTTCGAAGGGTTAGGTTCAA-ATTTTGAACGAC-AACTGGCTCCGAAATGAA---------------------GGGTTTGCTAAGTAAACCCTGTGTTAAGAGCGGCGTGCAACGATTTTGGCAG-CGATA-GGTCGAGTTTTCATTAACTT-GACCTGTTATGCAGGTCGGTAACAAAACGCAATAACATGCATACTTGTT??????????????????? Armillaria_tabescens_AB510824_Japan CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TTTTCTTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTTTGTGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AAGGCTTAGAAGGAACCTGGTTAGCAAAC------------------CGCTGACTTGGAATGTTCTTAGTCTTGTACTT-GGTATCGGTGCTTTGGCCGAGATAAC-TTATAAGGTATAGGCAGAAAGCTTGAAAGCGCAAGTTAGTGATTGTACTAATGGACCGTT-AATGAGCTTGAGGGCCTGCCCTTAAGCATGCCTTGTTGAAATGCCCTTAGGAGCTAAGCGAA--TGAA-----GCTAA-GGTTACC-TTTTTAACTGCGCTAAATGTTTACTTGGC-TTTCGAAGGGTTAGGTTCAA-ATTTTGAACGAC-AACTGGCTTCGAAATGAA---------------------GGGTTTGCTAAGTAAACCCTTTGTTAAGAGCGGCGTGCAACGATTTTGGCAG-CGATA-GGTCGAGTTTTCATTAACTT-GACCTGTTATGCAGGTCGGTAACAAAACGCAATAACATGCATACTTGTT??????????????????? Armillaria_tabescens_AY509189_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TT---TTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTTTGCGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AAGGCTTAGAAGGAACCTGGTTAGCAAAC------------------CGCTGACTTGGAAC{AG}TTCTTAGTCTTGTACTT-GGTATCGGTGC{AT}TTGGCCGAG{AG}TAAC-TTATAAGGTATAGGCAGAAAG{CT}TTGAAAGCGCAAGTTAGTGATTGTACTAATGGACCGTT-AATGAGCT{CT}GAGG{AG}CCTGCCCTTAAGCATGCCTTGTTGAAATGCCCTTAGGAGCTAAGCGAA--CGAA-----GCTAA-GGTTACC-TTTTTAACTGCGCTAAGCGTTTACTTGGC-TTTCGAAGGGTTAGGTTCAA-ATTTTGAACGGC-AACTGGCTTCGAAATGAA---------------------GGGTTTGCTAAGTAAACCCTTCGTTAAGAGCGGCGTGCAACGATTTTGG{CT}AG-CGGTA-GGTCGAGTTTTCATTGACTT-GACCTGTTATGCAGGTCGGTAACA???????????????????????????????????????????? Armillaria_tabescens_AY509191_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TTTTCTTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTCTGTGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AA{AG}GCTTAGAAGGAACCTGGTTAGCAAAC------------------CGCTGACTTGGAACGTTCTTAGTCTTGTACTT-GGTATCGGTGCATTGGCCGAGATAAC-TTATAAGGTATAGGCAGAAAGCTTGAAAGCGCAAGTTAGTGATTGTACTAATGGACCGTT-AATGAGCTCGAGGACCTGCCCTTAAGCATGCCTTGTTGAAATGCCCTTAGGAGCTAAGCGAA--{CT}GAA-----GCTAA-GGTTACC-TTTTTA{AG}CTGCGCTAAGCGTTTACTTGGC-TTTCGAAGGGTTAGGTTCAA-ATTTTGAACGGC-AACTGGCTTCGAAAT{CG}AA---------------------GGGTTTGCTAAGTAAACCCTTCGTTAAGAGC{GT}GCGTGCAACGATTTTGGCAG-CGGTA-GGTCGAGTTTTCATTGACTT-GACCTGTTATGCAGGTCGGTAACAAAACGCAATAACATGCATACTTGTT??????????????????? Armillaria_tabescens_AY509192_USA CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TTTTCTTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTCTGTGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AAGGCTTAGAAGGAACCTGGTTAGCAAAC------------------CGCTGACTTGGAAC{AG}TTCTTAGTCTTGTACTT-GGTATCGGTGCATTGGCCGAGATAAC-TTATAAGGTATAGGCAGAAAGCTTGAAAGCGCAAGTTAG{CT}GATTGTACTAATGGACCGTT-AATGAGCTCGAGGACCTGCCCTTAAGCATGCCTTGTTGAAATGCCCTTAGGAGCTAAGCGAA--{CT}GAA-----GCTAA-GGTTACC-TTTTTA{AG}CTGCGCTAAGCGTTTACTTGGC-TTTCGAAGGGTTAGGTTCAA-ATTTTGAACGGC-AACTGGCTTCGAAATGAA---------------------GGGTTTGCTAAGTAAACCCTTCGTTAAGAGC{GT}GCGTGCAACGATTTTGGCAG-CGGTA-GGTCGAGTTTTCATTGACTT-GACCTGTTATGCAGGTCGGTAACAAAACGCAATAACATGTATACTTGTT??????????????????? Armillaria_tabescens_CMW31118_China CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TTTTCTTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTTTGTGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AAGGCTTAGAAGGAACCTGGTTAGCAAAC------------------CGCTGACTTGGAATGTTCTTAGTCTTGTACTT-GGTATCGGTGCTTTGGCCGAGATAAC-TTATAAGGTATAGGCAGAAAGCTTGAAAGCGCAAGTTAGTGATTGTACTAATGGACCGTT-AATGAGCTTGAGGGCCTGCCCTTAAGCATGCCTTGTTGAAATGCCCTTAGGAGCTAAGCGAA--TGAA-----GCTAA-GGTTACC-TTTTTAACTGCGCTAAATGTTTACTTGGC-TTTCGAAGGGTTAGGTTCAA-ATTTTGAACGAC-AACTGGCTTCGAAATGAA---------------------GGGTTTTCTAAGTAAACCCTTTGTTAAGAGCGGCGTGCAACGATTTTGGCAG-CGATA-GGTCGAGTTTTCATTAACTT-GACCTGTTATGCAGGTCGGTAACAAAACGCAATAACATGCATACTT?????????????????????? Armillaria_tabescens_CMW31119_Italy ?GGGGTACTGTAA?TGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TTTTCTTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTCTGTGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AAGGCTCAGAAGGAACCTGGTTAGCAAAC------------------CGCTGACTTGGAATGTTCTTAGTCTTGTACTT-GGTATCGGTGCTTTGGCCGAGATAAC-TTATAAGGTATAGGCAGAAAGCTTGAAAGCGCAAGTTAGTGATTGTACTAATGGACCGTT-AATGAGCTTGAGTGCCTGCCCTTAAGCATGCCTTGTTGAAATGCCCTTAGGAGCTAAGCAAT--CGAA-----GCTAA-GGTTACC-TTTTTAACTGCGCTAAGTGTTTACTTGGC-TTTCAAAGGGTTAGGTTCAA-ATTTTGAACGGC-AACTGGCTTCGAAATGAA---------------------AGGTTTGCTAAGTAAACCCTTCGTTAAGAGCGGCGTGCAACGATTTTGGCAG-CGGTA-GGTCGAATTCTCATTGACTT-GACCTGTTATGCAGGTTGGTAATAAAACGCAATAACATGCACACTTGTATC????????????????? Armillaria_tabescens_CMW31120_Italy CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TTTTCTTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTCTGTGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AAGGCTTAGAAGGAACCTGGTTAGCAAAC------------------TGCTGACTTGGAACGTTCTTAGTCTTGTACTT-GGTATCGGTGCTTTGGCCGAGATAAC-TTATAAGGTATAGGCAGAAAGCTTGAAAGCGCAAGTTAGTGATTGTACTAATGGACCGTT-AATGAGCTTGAGTGCCTGCCCTTAAGCATGCCATGTTGAAATGCCCTTAGGAGCCAAGCGAA--CGAA-----GCTAA-GGTTACC-TTTTTAACTGCGCTAAGTGTTTACTTGGC-TTTCAAAGGGTTAGGTTCAA-ATTTTGAACGGC-AAATGGCTTCGAAATGAA---------------------GGGTTTGCTAAGTAAACCCTTCGTTAAGAGCGGCGTGCAACGATTTTGGCAG-CGGTA-GGTCGAGTTTTCATTGACTT-GACCTGTTATGCAGGTCGGTAACAAAACGCAATAACATGCATACTTGTTATC???????????????? Armillaria_tabescens_HQ232284_Ukraine CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TTTTCTTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTCTGTGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AAGGCTTAGAAGGAACCTGGTTAGCAAAC------------------TGCTGACTTGGAACGTTCTTAGTCTTGTACTT-GGTATCGGTGCTTTGGCCGAGATAAC-TTATAAGGTATAGGCAGAAAGCTTGAAAGCGCAAGTTAGTGATTGTACTAATGGACCGTT-AATGAGCTTGAGTGCCTGCCCTTAAGCATGCCATGTTGAAATGCCCTTAGGAGCCAAGCGAA--CGAA-----GCTAA-GGTTACC-TTTTTAACTGCGCTAAGTGTTTACTTGGC-TTTCAAAGGGTTAGGTTCAA-ATTTTGAACGGC-AACTGGCTTCGAAATGAA---------------------GGGTTTGCTAAGTAAACCCTTCGTTAAGAGCGGCGTGCAACGATTTTGGCAG-CGGTA-GGTCGAGTTTTCATTGACTT-GACCTGTTATGCAGGTCGGTAACAAAACGCAATAACATGCATACTTGTTATCC??????????????? Armillaria_tabescens_HQ232285_Ukraine CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TTTTCTTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTCTGTGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AAGGCTTAGAAGGAACCTGGTTAGCAAAC------------------TGCTGACTTGGAACGTTCTTAGTCTTGTACTT-GGTATCGGTGCTTTGGCCGAGATAAC-TTATAAGGTATAGGCAGAAAGCTTGAAAGCGCAAGTTAGTGATTGTACTAATGGACCGTT-AATGAGCTTGAGTGCCTGCCCTTAAGCATGCCATGTTGAAATGCCCTTAGGAGCCAAGCGAA--CGAA-----GCTAA-GGTTACC-TTTTTAACTGCGCTAAGTGTTTACTTGGC-TTTCAAAGGGTTAGGTTCAA-ATTTTGAACGGC-AACTGGCTTCGAAATGAA---------------------GGGTTTGCTAAGTAAACCCTTCGTTAAGAGCGGCGTGCAACGATTTTGGCAG-CGGTA-GGTCGAGTTTTCATTGACTT-GACCTGTTATGCAGGTCGGTAACAAAACGCAATAACATGCATACTTGTTATCCACGGCCATAGGACT? Armillaria_tabescens_HQ232286_Ukraine CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TTTTCTTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTCTGTGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AAGGCTTAGAAGGAACCTGGTTAGCAAAC------------------TGCTGACTTGGAACGTTCTTAGTCTTGTACTT-GGTATCGGTGCTTTGGCCGAGATAAC-TTATAAGGTATAGGCAGAAAGCTTGAAAGCGCAAGTTAGTGATTGTACTAATGGACCGTT-AATGAGCTTGAGTGCCTGCCCTTAAGCATGCCATGTTGAAATGCCCTTAGGAGCCAAGCGAA--CGAA-----GCTAA-GGTTACC-TTTTTAACTGCGCTAAGTGTTTACTTGGC-TTTCAAAGGGTTAGGTTCAA-ATTTTGAACGGC-AACTGGCTTCGAAATGAA---------------------GGGTTTGCTAAGTAAACCCTTCGTTAAGAGCGGCGTGCAACGATTTTGGCAG-CGGTA-GGTCGAGTTTTCATTGACTT-GACCTGTTATGCAGGTCGGTAACAAAACGCAATAACATGCATACTTGTTATCCACGGCCATAGGACT? Armillaria_tabescens_JF288740_France CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TTTTCTTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTCTGTGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AAGGCTTAGAAGGAACCTGGTTAGCAAAC------------------TGCTGACTTGGAACGTTCTTAGTCTTGTACTT-GGTATCGGTGCTTTGGCCGAGATAAC-TTATAAGGTATAGGCAGAAAGCTTGAAAGCGCAAGTTAGTGATTGTACTAATGGACCGTT-AATGAGCTTGAGTGCCTGCCCTTAAGCATGCCATGTTGAAATGCCCTTAGGAGCCAAGCGAA--CGAA-----GCTAA-GGTTACC-TTTTTAACTGCGCTAAGTGTTTACTTGGC-TTTCAAAGGGTTAGGTTCAA-ATTTTGAACGGC-AACTGGCTTCGAAATGAA---------------------GGGTTTGCTAAGTAAACCCTTCGTTAAGAGCGGCGTGCAACGATTTTGGCAG-CGGTA-GGTCGAGTTTTCATTGACTT-GACCTGTTATGCAGGTCGGTAACAAAACGCAATAACATGCATACTTGTTATCCACGC??????????? Armillaria_tabescens_JF288741_France CGGGGTACTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGTTAAGCCCTTGTTCTAAAGATTTGTTCAACTTTGTTGGACTTTCTCT-TTC--------TTTTCTTTTTACATGCTGAATGCTTGAGGGCCGGGATCGTCTTCTCTGTGCACT-CGCGACAGCA--TGTT-----------------------AACAT----TGCC-TTGAAC-----------CCTGTTAT----------------------------------------AAGGCTTAGAAGGAACCTGGTTAGCAAAC------------------TGCTGACTTGGAACGTTCTTAGTCTTGTACTT-GGTATCGGTGCTTTGGCCGAGATAAC-TTATAAGGTATAGGCAGAAAGCTTGAAAGCGCAAGTTAGTGATTGTACTAATGGACCGTT-AATGAGCTTGAGTGCCTGCCCTTAAGCATGCCATGTTGAAATGCCCTTAGGAGCCAAGCGAA--CGAA-----GCTAA-GGTTACC-TTTTTAACTGCGCTAAGTGTTTACTTGGC-TTTCAAAGGGTTAGGTTCAA-ATTTTGAACGGC-AACTGGCTTCGAAATGAA---------------------GGGTTTGCTAAGTAAACCCTTCGTTAAGAGCGGCGTGCAACGATTTTGGCAG-CGGTA-GGTCGAGTTTTCATTGACTT-GACCTGTTATGCAGGTCGGTAACAAAACGCAATAACATGCATACTTGTTATCCACGC??????????? ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M32340] TITLE Armillaria_from_China_Fig2_TEF1a; LINK TAXA = Taxa1; DIMENSIONS NCHAR=594; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Armillaria_altimontana_JF313117_USA ?????????????????????????ATCACTGGTACCTCCCAGGCTGATTGTGCTATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTATGAGATCT-CTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTTCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCTAAGTAAGTC-TTTACCCAACTA-TGATCAGT{AG}CTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAGGGATACCAAGGCCGGTGCCGTCAAGGG{CT}AAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_altimontana_JF313118_USA ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCTATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTATGAGATCT-CTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTTCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCTAAGTAAGTC-TTTACCCAACTA-TGATCAGTACTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAGGGATACCAAGGCCGGTGCCGTCAAGGGTAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_altimontana_JF313120_USA ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCTATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTATGAGATCT-CTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTTCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCTAAGTAAGTC-TTTACCCAACTA-TGATCAGTACTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAGGGATACCAAGGCCGGTGCCGTCAAGGGTAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_borealis_CMW31072_China ????????????????????ACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACTAAGGTACGAGATCTGCCGCTTTGCTTTTT-CTTTAGTCAAATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCTAAGTAAGTC-CTTACCCAAGTA-TGACCAGTACTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCC???????????????????? Armillaria_borealis_CMW31075_Belarus ???????????????????AACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACTAAGGTACGAGATCTGCCGCTTTGCTTTTT-CTTTAGTCAAATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCCAAGTA-TGACCAGTACTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCG?? Armillaria_borealis_CMW31077_China ????????????????????ACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACTAAGGTACGAGATCTGCCGCTTTGCTTTTT-CTTTAGTCAAATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCTAAGTAAGTC-CTTACCCAAGTA-TGACCAGTACTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCC???????????????????? Armillaria_borealis_HQ285901_Finland ????CGTGACTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACTAAGGTACGAGATCTGCCGCTTTGCTTTTT-CTTTAGTCAAATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCCAAGTA-TGACCAGTACTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_borealis_JN657494_Finland ????CGTGACTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAATTCGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTTCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTTAACAAGATGGACACCACCAAGGTACGAGAACTACTGTTTTACCTTTTTCCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCTCTTACCCAACTA-TGACCAGTGCTGGTTCTTAACATCCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_borealis_JN657495_Germany ????CGTGACTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACTAAGGTACGAGATCTGCCGCTTTGCTTTTT-CTTTAGTCAAATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCTCTTACCCAAGTA-TGACCAGTACTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_borealis_JN657496_Switzerland ???????????????????????????????????????????????????TGCCATTCTCATCATCGCTGGTGGAACTGGTGA{AG}TTCGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCT{CT}CTTGCCTTCACCCTCGGTGTCAGGCAGCTCAT{CT}GT{CT}GCCGT{CT}AACAAGATGGACACCACCAAGGTACGAGA{AT}CTAC{CT}GTTTT{AG}CCTTTTTC{CT}TTAG{GT}CAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAA{CT}GAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC{CT}CTTACCCAACTA-TGACCAGTGCTG{CG}{CT}TCTTAACAT{CT}CTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGA{AG}CCCCCTGTCCGTC?????????????????????????????????????????????????? Armillaria_calvescens_CMW31078_USA ?????????????????????CATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT-GTTTAGCCAAATCTAACTGTTATCTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTTAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTTCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAAATA-TGATCAATGCTGCCTCTTAACGTTCTT--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAG?????????????????? Armillaria_calvescens_CMW31079_USA ?????????????????????CATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT-GTTTAGCCAAATCTAACTGTTATCTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTTAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTTCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAAATA-TGATCAATGCTGCCTCTTAACGTTCTT--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGG????????????????? Armillaria_calvescens_CMW31080_USA ?????????????????????CATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT-GTTTAGCCAAATCTAACTGTTATCTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTTAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTTCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAAATA-TGATCAATGCTGCCTCTTAACGTTCTT--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCT?????????????????????? Armillaria_calvescens_JF313129_USA ?????????????????????????ATCAC{CT}GGTACCTCCCAGGCTGATTGTGCCATTCT{CT}ATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTAC{AG}AGATC{CT}GCTGCTTTGCCTTTT-GTTTAGCCAAATCTAACTGT{CT}A{AT}CTCAGTGGAG{CT}GAGGA{CT}CGGTTCAA{CT}GAAATCGTTAAGGAAACCTC{CT}ACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTTCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTA{CT}CCAAATA-TGATCAATGCTGCCTCTTAACGTTCTT--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGC{AC}GGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCT{CT}CCTCTCCAGGATGTCTACAAAATCGGG Armillaria_calvescens_JF313130_USA ?????????????????????????ATCAC{CT}GGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTAC{AG}AGATC{CT}GCTGCTTTGCCTTTT-GTTTAGCCAAATCTAACTGT{CT}A{AT}CTCAGTGGAGCGAGGA{CT}CGGTTCAA{CT}GAAATCGTTAAGGAAACCTC{CT}ACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTTCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTA{CT}CCAAATA-TGATCAATGCTGCCTCTTAACGTTCTT--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGC{AC}GGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_calvescens_JF313138_Canada ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACAAGATCCGCTGCTTTGCCTTTT-GTTTAGCCAAATCTAACTGTTAACTCAGTGGAGCGAGGATCGGTTCAACGAAATCGTTAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTTCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAAATA-TGATCAATGCTGCCTCTTAACGTTCTT--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_cepistipes_AB510790_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTCCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCCCTTATTCAACTA-TGACTAGGGCTGCTTCTTAATGTTATC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_cepistipes_AB510793_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTCCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAATGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCCCTTACTCAACTA-TGACTAGGGTTGCTTCTTAATGTTATC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_cepistipes_CMW31082_Finland ???????????????????????TGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTTACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTCCTTAGGCATATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCCCCAAGTAAGTCCCTTACCCAACTA-TGACCAGGGCTGCTTCTTAATGTTCTC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGG????????????????? Armillaria_cepistipes_CMW31083_Italy ??????????????????GAACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTTACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTCCTTAGGCATATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCCCCAAGTAAGTCCCTTACCCAACTA-TGACCAGGGCTGCTTCTTAATGTTCTC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCC???????????????????? Armillaria_cepistipes_EU251395_CzechRep ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTCCTTAGGCATATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCCCCAAGTAAGTCCCTTACCCAACTA-TGACCAGGGCTGCTTCTTAATGTTCTC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTA?????????? Armillaria_cepistipes_JF313115_USA ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTTATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTACCTTTT-GTTTAGCCTAATCTGATTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATTGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTC-TTTACCCAACTA-GGATCAGTGCTGCCTCTTAACATTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_cepistipes_JF313116_Canada ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTTATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTACCTTTT-GTTTAGCCTAATCTGATTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATTGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTC-TTTACCCAACTA-GGATCAGTGCTGCCTCTTAACATTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_cepistipes_JF746917_UK ??????????????????????????????????????????????????????????????????????????????????????TCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTCCTTAGGCATATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCCCCAAGTAAGTCCCTTACCCAACTA-TGACCAGGGCT{AG}CTTCTTAATGTTCTC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCG???????????????????????????????????????????? Armillaria_cepistipes_JN657474_Ukraine ????CGTGACTTCATCAAGAACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTCCTTAGGCATATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCCCCAAGTAAGTCCCTTACCCAACTA-TGACCAGGGCTGCTTCTTAATGTTCTC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_cepistipes_KJ414319_Finland ??????????????????????????????????????????????????????????????????????????????????????TCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTTACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTCCTTAGGCATATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCCCCAAGTAAGTCCCTTACCCAACTA-TGACCAGGGCTGCTTCTTAATGTTCTC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCG???????????????????????????????????????????? Armillaria_cepistipes_KJ414320_Finland ??????????????????????????????????????????????????????????????????????????????????????TCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTCCTTAGGCATATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCCCCAAGTAAGTCCCTTACCCAACTA-TGACTAGGGCTGCTTCTTAATGTTCTC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCG???????????????????????????????????????????? Armillaria_cepistipes_KJ414321_Italy ??????????????????????????????????????????????????????????????????????????????????????TCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTCCTTAGGCATATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCCCCAAGTAAGTCCCTTACCCAACTA-TGACCAGGGCTGCTTCTTAATGTTCTC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCG???????????????????????????????????????????? Armillaria_gallica_AB510760_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTACCTTTT-GTTTAGCCAAATCTAACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATTGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGTTTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_gallica_AB510761_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTATCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACTCAACTA-TGACCAATGCTGTTTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_gallica_CMW31086_Russia ?????????????????????CATGATCACCGGTACCTCCCAAGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCAATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGTCCCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACTAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGATGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAG?????????????????? Armillaria_gallica_CMW31087_China ??????????????????????????TCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGACAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTACCTTTT-GTTTAGCCACATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-TGATCAGTGCTGCCTCTTAACGTTCTC--TGCAGCATGCCATGGTACAAGGGCTGGACCAAGGAGAACAAGGCCGGTGTCGTCAAGGGCAAGACACTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGCCCCTCCGACAAGCCTCTCCGTCTCCCTCTCC???????????????????? Armillaria_gallica_CMW31088_China ????????????????TAGAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT-GTTTAGCCAAATTCAACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTAGGTC-TTTACCCAGCTA-TGATCAGTGCTGCCTCTTAACGTTCTT--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGACGCTATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCA??????????????????? Armillaria_gallica_CMW31090_Italy ??????????????????GAACATGATCACCGGTACCTCCCAAGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCAATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTC-TTTACGCAACTA-TGATCAGTGCTGTCCCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACTAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGATGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_gallica_CMW31091_Italy ???????????????????????????CACCGGTACCTCCCAAGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCATTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCAATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGTCTCTTAACGTTCTC--TGTAGCATGCCATGGTATAAGGGCTGGACTAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCT???????????????????????????? Armillaria_gallica_CMW31093_China ??????TGACTTCATCAAGAACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATCCTCATCATCGCTGGTGGAACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCCCCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTTAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGCGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCTAAATA-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAAACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGAC??????????????? Armillaria_gallica_JF313123_Canada ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGA{AG}TTCGAAGCCGGTATCTCCAAGGACGGTCAGACTCG{AG}GA{AG}CACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTA{CT}GAGAT{CT}TG{CT}T{AG}C{GT}TTGCCAT{CT}T-GTTTAGCCAAATCT{AG}ACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAAT{CT}GT{CT}AAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGG{CT}GATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TT{CT}ACCCAA{AC}TA-TGATCAGTGCT{AG}CCTCTTAA{CT}GTTCTT--{CT}GTAGCATGCCATGGTACAAGGGCTGGACCAAGGA{AG}ACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCT{CT}CAGGATGTCTACAAAAT{CT}GGG Armillaria_gallica_JF313125_USA ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTG{CT}TGCTTTGCCTT{GT}T-GTTTAGCCAAATCTAACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGCCTCTTAACGTGTTT--TGTAGTATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTTAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_gallica_JF313126_USA ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCAT{CT}GTCGC{CT}GTCAACAAGATGGACACCACCAAGGTACGAGATCTGTTGCTTT{AG}CCTTGT-GT{AT}TAGCCAAATCTAACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGG{CT}GATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACC{CT}AACT{AG}-TGATCAGTGCTGC{AC}TCT{GT}AACGT{GT}{CT}T{CT}--TGTAG{CT}ATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGC{CT}GGTGTCGT{CT}AAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_gallica_JF746920_France ??????????????????????????????????????????????????????????????????????????????????????TCGAAGCCGGTATCTCCAAGGACGGTCAGACCAGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGCTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCAATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGTCCCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACTAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGATGCCATTGAGCCCCCTGTCCGTCCCTCCG???????????????????????????????????????????? Armillaria_gallica_JN657480_France ????CGTGACTTCATCAAGAACATGATCACCGGTACCTCCCAAGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCAATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTC-TTTACGCAACTA-TGATCAGTGCTGTCCCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACTAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGATGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_gallica_JN657482_Ukraine ????CGTGACTTCATCAAGAACATGATCACTGGTACCTCCCAAGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCAGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCAATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGTCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACTAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGATGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_gallica_JN657485_Ukraine ????CGTGACTTCATCAAGAACATGATCACCGGTACCTCCCAAGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCAGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCAATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGTCCCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACTAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGATGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_gallica_KJ200952_Germany ??????????????????????????????????????????????????????????????????????????????????????TCGAAGCCGGTATCTCCAAGGACGGTCAGACCAGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCAATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGTCCCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACTAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGATGCCATTGAGCCCCCTGTCCGTCCCTCCG???????????????????????????????????????????? Armillaria_gallica_KJ200955_Iran ??????????????????????????????????????????????????????????????????????????????????????TCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAACTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCATTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCAATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGTCTCTTAACGTTCTC--TGTAGCATGCCATGGTATAAGGGCTGGACTAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTGTCCGTCCCTCCG???????????????????????????????????????????? Armillaria_gemina_CMW31094_USA ??????????????????????ATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAATTCGAAGCCGGTATTTCAAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACCTTTTTCCTTAGGCAAATCTGACTGTCATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCTATCTCTGGATGGCACGGTGATAACATGTTGGAGGAATCCGCCAAGTAAGTCCCTTACCCAACTA-TGATCAGTGCTGGCTCTTAACGTGCTC--TGCAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTTGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAG?????????????????? Armillaria_gemina_CMW31095_USA ????????????????????????GATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACCTTTTTCCATAGGCAAATCTGACTGTCATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTAGAGGAATCCGCCAAGTAAGTCCCTTACCCAACTA-TGATCAGTGCTGGCTCTTAACGTGCTCTGTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTTGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCC???????????????????? Armillaria_gemina_JF313133_USA ?????????????????????????ATCAC{CT}GGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAATTCGAAGCCGGTATTTCAAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACCTTTTTCCTTAGGCAAATCTGACTGTCATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCTATCTCTGGATGGCACGGTGATAACATGTTGGAGGAATCCGCCAAGTAAGTCCCTTACCCAACTA-TGATCAGTGCTGGCTCTTAACGTGCTC--TGCAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTTGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_gemina_JF313135_USA ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACCTTTTTCCATAGGCAAATCTGACTGTCATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAATCCGCCAAGTAAGTCCCTTACCCAACTA-TGATCAGTGCTGGCTCTTAACGTGCTCTGTGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTTGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_gemina_JF313136_USA ?????????????????????????ATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAATTCGAAGCCGGTATTTCAAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACCTTTTTCCTTAGGCAAATCTGACTGTCATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCTATCTCTGGATGGCACGGTGATAACATGTTGGAGGAATCCGCCAAGTAAGTCCCTTACCCAACTA-TGATCAGTGCTGGCTCTTAACGTGCTC--TGCAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTTGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCG{CT}CTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_mellea_AB510801_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTAC?GGATCTGCTGTTTCAGTTTTT----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGG?TACAACCCCAAGGCTGTTGCTTTCGTCCCCAT?TCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTA?GTC-CTTACTTAACTA-TGATCCGTACTG?ATCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGG?TGGACCAAGGAGA?TAAGGCCGGTGTCG?CAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTG???????????????????????????????????????????????????????? Armillaria_mellea_AB510802_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGTTTTT----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATTTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAGGTC-CTTACTTAACTA-TGATCCGTACTGTATCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTG???????????????????????????????????????????????????????? Armillaria_mellea_CMW31161_China ??????????????????????ATGATCACCGGTACCTCGCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGTTTTT----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTC-CTTACTTAACTA-TGATCCGTACTGTAACTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGCCTTCCTCTCCAGGA???????????????? Armillaria_mellea_CMW31171_USA ???????????????????AACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATTGCTGGCGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGCTTTT-CTTTAGTCAAATCTGATTGTTATCTCAGTGGAGCGAGGACCGATTCAATGAAATTGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTC-CTTACTCAACTC-TGATCCGTACTGGGTCTGAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGACGTCTACAAGATCG?? Armillaria_mellea_CMW31172_China ?????????????????????CATGATCACCGGTACCTCGCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGTTTTT----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTC-CTTACTTAACTA-TGATCCGTACTGTAACTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGCCTTCCTCTCC???????????????????? Armillaria_mellea_JF313127_USA ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGCGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGCTTTT-CTTTAGTCAAATCTGATTGTTATCTCAGTGGAGTGAGGACCGTTTCAATGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTC--CTACTCAACTC-TGATCCGTACTGGGTCTGAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_mellea_JF313128_USA ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATCAT{CT}GCTGGCGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGCTTTT-CTTTAGTCAAATCTGATTGTTATCTCAGTGGAGCGAGGACCGATTCAATGAAAT{CT}GTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTC--CTACTCAACTC-TGATCCGTACTGGGTCTGAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_mellea_JF313137_USA ?????????????????????????ATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGCGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGCTTTT-CTTTAGTCAAATCTGATTGTTATCTCAGTGGAGTGAGGACCGTTTCAATGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTC--CTACTCAACTC-TGATCCGTACTGGGTCTGAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_mellea_JN657491_France ????CGTGACTTCATCAAGAACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACAGGATCTGCTGTTTCAGTTTTT-CTTTAGTCAAATCTGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTC-CTTACTTAACTA-TGATCCGTACTGAGTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGAGTAAGGCTGGTGTCGCCAAAGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_mellea_JN657493_Ukraine ????CGTGACTTCATCAAGAACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACAGGATCTGCTGTTTCAGTTTTT-CTTTAGTCAAATCTGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTC-CTTACTTAACTA-TGATCCGTACTGAGTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGAGTAAGGCTGGTGTCGCCAAAGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_nabsnona_AB510764_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGCC-TTTACCCAACTA-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTTGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_nabsnona_AB510766_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGCC-TTTACCCAACTA-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTTGTCAAGGGCAAGACTCTCCTCGATGCCATTGATGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_nabsnona_CMW31100_Canada ?????????????????????CATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACTCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGCC-TTTACCCAACTATTGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTATAAGGGCTGGACCAAGGAGACCAAGGCCGGCGTTGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAG?????????????????? Armillaria_nabsnona_CMW31101_USA ???????????????????AACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACTCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGCC-TTTACCCAACTATTGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTATAAGGGCTGGACCAAGGAGACCAAGGCCGGCGTTGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGAC??????????????? Armillaria_nabsnona_JF313119_USA ?????????????????????????ATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCAC{CT}CTCGGTGTCAGGCAGCTCATTGTTGC{CT}GTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGT{CT}ATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTC{CT}GCCAAGTAAGCC-TTTACCCAACTATTGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTATAAGGGCTGGACCAAGGAGACCAAGGCCGG{CT}GTTGTCAAGGGCAAGACTCTCCTCGATGC{AC}ATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_nabsnona_JF313122_Canada ?????????????????????????ATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACTCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGCC-TTTACCCAACTATTGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTATAAGGGCTGGACCAAGGAGACCAAGGCCGGCGTTGTCAAGGGCAAGACTCTCCTCGATGC{AC}ATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_nabsnona_JF313124_USA ???????????????????????????????????????????????ATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACTCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCTTTT-GTTTAGCCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGCC-TTTACCCAACTATTGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTATAAGGGCTGGACCAAGGAGACCAAGGCCGGCGTTGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_ostoyae_AB510781_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTTCCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAAGTA-TGACCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_ostoyae_AB510782_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTTCCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAAGTA-TGACCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_ostoyae_CMW31102_China ????????????????AAGAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTTCCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAAGTA-TGACCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTC????????????????????? Armillaria_ostoyae_CMW31103_China ????????????????AAGAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTTCCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAAGTA-TGACCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGG????????????????? Armillaria_ostoyae_CMW31104_China ???????????????????????AGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTTCCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAAGTA-TGACCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCC{CG}TCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACG?????????????? Armillaria_ostoyae_CMW31107_Finland ??????????????????GAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACTCGAGAGCACGCCCTCCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTACCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAAGTA-TGACCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAG?????????????????? Armillaria_ostoyae_CMW31110_China ???????????????????AACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACTCGAGAGCACGCCCTCCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTACCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAAGTA-TGACCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGA???????????????? Armillaria_ostoyae_EU251400_CzechRep ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAATT{CT}GAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCT{CT}CTTGCCTTCACCCTTGGTGTCAGGCAGCTCAT{CT}GT{CT}GCCGTCAACAAGATGGACACCACCAAGG{CT}ACGAGATCTATCGTTTTAC{CT}TTTTACCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAAGTA-TGACCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_ostoyae_HQ285903_France ????CGTGACTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACTCGAGAGCACGCCCTCCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTACCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAAGTA-TGACCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_ostoyae_JF313139_USA ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATCAT{CT}GCTGGTGGAACTGGTGA{AG}TTCGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCATGCCCTCCTTGCCTTCACCCT{AC}GGTGTCAGGCAGCTCATCGTCGCCGTCAACAAAATGGACACCACCAAGGTACGAGATCTACTGTTTTACCTTTTTCCTTAGGCAAATCTGACTGTCATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAATCCGCCAAGTAAGTCCCTTACCCAACTA-TGACCAGTGCTGGCTCTTAACGTGCTC--TGTAGTATGCCATGGTACAAGGGCTGGACCAAGGAGACTAAGGCTGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_ostoyae_JF313140_USA ?????????????????????????ATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATTGCTGGTGGAACTGGTGAATTCGAAGCCGGTATTTCCAAGGA{AC}GGCCAGACCCGAGAGCA{CT}GCCCTCCTTGCCTTCACCCT{AC}GGTGTCAGGCAGCTCATCGTCGCCGTCAACAA{AG}ATGGACACCACCAAGGTACGAGATCTACTGTTTTACCTTTTTCCTTAGGCAAATCTGACTG{CT}{CT}ATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAATCCGCCAAGTAAGTCCCTTACCCAACTA-TGACCAGT{AG}{CT}TGGCTCTTAACGTGCTC--TGTAGTATGCCATGGTACAAGGGCTGGACCAAGGAGACTAAGGCTGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_ostoyae_JF313141_USA ?????????????????????????ATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCAT{CT}GC{CT}GGTGGAACTGGTGAGTTCGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCATGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAAATGGACACCACCAAGGTACGAGATCTACTGTTTTACCTTTTTCCTTAGGCAAATCTGACTGTCATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAATCCGCCAAGTAAGTCCCTTACCCAACTA-TGACCAGTGCTGGCTCTTAACGTGCTC--TGTAGTATGCCATGGTACAAGGGCTGGACCAAGGAGACTAAGGCTGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_ostoyae_JN657486_France ????CGTGACTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACTCGAGAGCACGCCCTCCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTACCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAAGTA-TGACCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_ostoyae_JN657489_Ukraine ????CGTGACTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAATTTGAAGCCGGTATTTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTATCGTTTTACCTTTTACCTTAGGCAAATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACTTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-CTTACCTAAGTA-TGACCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCT??????????? Armillaria_sinapina_AB510774_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTGGAAGCCGGTATCTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTT-CCTTGGGCAAATCTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_sinapina_AB510776_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTT-CCTTGGGCAAATCTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTACTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_sinapina_CMW31112_China ??????????????????GAACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTT-CCTTGGGCAAATTTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGA???????????????? Armillaria_sinapina_CMW31113_China ??????????????????GAACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTCTTACTTTTT-CCTTGGGCAAATTTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGA???????????????? Armillaria_sinapina_CMW31115_China GGATCGTGACTTACACAAGAACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTT-CCTTGGGCAAATTTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCACCAAGATCGGA Armillaria_sinapina_JF313114_Canada ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTT-CCTTGGGCAAATCTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGA{CT}GCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATTGGG Armillaria_sinapina_JF313131_USA ?????????????????????????ATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTC{AG}GTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTT-CCTTGGGCAAATCTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTC{CT}GCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGATGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTACAAAATTGGG Armillaria_sinapina_JF313132_USA ?????????????????????????ATCACCGGTACCTCCCAAGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGCGAGTTCGAAGCCGGTATCTCCAAGGACGGCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTT-CCTTGGGCAAATTTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGT{AC}GGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTACCCAACTA-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCC{AC}TCCGACAAGCCTCTCCGTCTCCCTCTCCAGGATGTCTA{CT}AAAATTGGG Armillaria_sp_CMW31153 ????????????????AAGAACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACTCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTAC{CT}GTTTTACTTTTTTCCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTTGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTC{CT}GCCAAGTAAGTCCTTTACCCAACTA-TGACTAGGGCTGCTTCTTAATGTTTTC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGA???????????????? Armillaria_sp._CBS_C_CMW31123 ??????????????????????????TCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGACAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTGCCTTTT-GTTTAGCCACATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-TAATCAGTGCTGCCTCTTAACGTTCTC--TGCAGCATGCCATGGTACAAGGGCTGGACCAAGGAGAACAAGGCCGGTGTCGTCAAGGGCAAGACACTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGCCCCTCCGACAAGCCTCTCCGTCTCCCTCTC????????????????????? Armillaria_sp._CBS_C_CMW31124 ???????????????????AACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGACAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTACCTTTT-GTTTAGCCACATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-TGATCAGTGCTGCCTCTTAACGTTCTC--TGCAGCATGCCATGGTACAAGGGCTGGACCAAGGAGAACAAGGCCGGTGTCGTCAAGGGCAAGACACTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGCCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGA???????????????? Armillaria_sp._CBS_F_CMW31127 ??????????????????????ATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTTATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTATTTCCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACTTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAAGAGTCCGCCAAGTAAGTCTCTTACCCAACTA-TGACTAGGGCTGCTTCTTAATGTTATC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTC????????????????????? Armillaria_sp._CBS_F_CMW31128 ??????????????????GAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATTCTTATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTATTTCCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACTTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAAGAGTCCGCCAAGTAAGTCTCTTACCCAACTA-TGACTAGGGCTGCTTCTTAATGTTATC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCA??????????????????? Armillaria_sp._CBS_F_CMW31129 ??????????????????????ATGATTACCGGTACCTCCCAAGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTCCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTTAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTTGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCTGCCAAGTAAGTCCTTTACCCAACTA-TGACTAGGGCTGCTTCTTAATGTTTTC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_sp._CBS_F_CMW31130 ????????????????????ACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACTCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTTCCTTAGGCACATCTGACTGGTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAGGTCCCTTACTTAACTA-TGACTAGGGCTGCTTCTTAATGTTATC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGG????????????????? Armillaria_sp._CBS_G_CMW31132 ?????????????????????????????CCGGTACCTCGCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGTTTTT----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTC-CTTACTTAACTA-TGATCCGTACTGTAACTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGCCTTCCTCTCC???????????????????? Armillaria_sp._CBS_G_CMW31133 ?????????????????????????????CCGGTACCTCGCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGTTTTT----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTC-CTTACTTAACTA-TGATCCGTACTGTAACTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGCCTTCCTCTCCAGGA???????????????? Armillaria_sp._CBS_G_CMW31134 ?????????????????AGAACATGATCACCGGTACCTCGCAGGCTGATTGTGCCATTCTCATCATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGGGATCTGCTGTTTCAGTTTTT----TAGTCAAATATGATTGTTATCTCAGTGGAGCGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCTACCTTCATCAAGAAGGTCGGCTACAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTACGTC-CTTACTTAACTA-TGATCCGTACTGTAACTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACTAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAACCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGCCTTCCTCTCCAGGC???????????????? Armillaria_sp._CBS_H_CMW31136 ???????????????????????AGATCACCGGTACCTCCCAGGCTGATTGTGCCATT{CT}TCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTGCCTTTT-GTTTAGCCACATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGAACAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGCCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCA??????????????????? Armillaria_sp._CBS_H_CMW31138 ??????????????????GAACATGATCACCGGTACTTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTGCCTTTT-GTTTAGCCACATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGAACAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGCCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAG?????????????????? Armillaria_sp._CBS_H_CMW31139 ???????????????????AACATGATCACCGGTACTTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTGCCTTTT-GTTTAGCCACATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGAACAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGCCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAG?????????????????? Armillaria_sp._CBS_J_CMW31140 ????????????????????????GATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTGCCTTTT-GTTTAGCCACATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTTAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGAACAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGCCCCTCCGACAAACCTCTCCGTCTCCCTCTCC???????????????????? Armillaria_sp._CBS_J_CMW31142 ????????????????????????GATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGATATTTGCTACTTTGCCTTTT-GTTTAGCCACATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCTAAGTAAGTC-TTTATCCAACTT-TGATCAGTGCTGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGAACAAGGCCGGTGCCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGCCCCTCCGACAAGCCTCTCCGTCTCCCTCTC????????????????????? Armillaria_sp._CBS_L_CMW31144 ?????????????????????CATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAAACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTGCCTTTT-GTTTAGCCACATCTGACTGTTATCTTAGTGGAGCGAGGACCGGTTCAACGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-TGATCAATGCTGCCTCTTAACGTTCTC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGATACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCC???????????????????? Armillaria_sp._CBS_L_CMW31145 ??????????????????????ATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAAACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTGCCTTTT-GTTTAGCCACATCTGACTGTTATCTTAGTGGAGCGAGGACCGGTTCAACGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-TGATCAATGCTGCCTCTTAACGTTCTC--TATAGCATGCCATGGTACAAGGGCTGGACCAAGGATACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTTCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCC???????????????????? Armillaria_sp._CBS_N_CMW31146 ???????????????????AACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATTGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAAACCCGAGAGCACGCTCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTGCCTTTT-GTTTAGCCACATCTGACTGTTATCTTAGTGGAGCGAGGACCGGTTCAACGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-CGATCAATGCTGCCTCTTAACGTTCTC--TGCAGCATGCCATGGTACAAGGGCTGGACCAAGGATACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGA???????????????? Armillaria_sp._CBS_N_CMW31148 ????????????????????????GATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATTGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAAACCCGAGAGCACGCTCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTGCCTTTT-GTTTAGCCACATCTGACTGTTATCTTAGTGGAGCGAGGACCGGTTCAACGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-TGATCAATGCTGCCTCTTAACGTTCTC--TGCAGCATGCCATGGTACAAGGGCTGGACCAAGGATACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAAGCCTCTCCGTCTCCCTCTCC???????????????????? Armillaria_sp._CBS_O_CMW31150 ??????????????????GAACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCATGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTGCCTTTT-GTTTAGCCACATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-TGATCGGTGCCGCCTCTTAACGTTCTC--TGCAGCATGCCATGGTACAAGGGCTGGACCAAGGAAACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGCCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGAC??????????????? Armillaria_sp._CBS_O_CMW31151 ??????????????????GAACATGATCACCGGTACCTCCCAGGCTGATTGTGCCATTCTCATTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCATGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATTTGCTACTTTGCCTTTT-GTTTAGCCACATCTGACTGTTATCTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCTAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTC-TTTATCCAACTT-TGATCGGTGCCGCCTCTTAACGTTCTC--TGCAGCATGCCATGGTACAAGGGCTGGACCAAGGAAACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGCCCCTCCGACAAGCCTCTCCGTCTCCCTCTCCAGGAC??????????????? Armillaria_sp._NAG_E_AB510768_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAAGCCGGTATCTCTAAGGACGGTCAGACCCGAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCCTTT-GTTTAGCCAAATTTGACTGTTATCTCAGTGGAGCGAGGATCGATTCAATGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTT-CTTACCATGGTA-TGATCAGTGCCGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_sp._NAG_E_AB510769_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAAGCCGGTATCTCTAAGGACGGTCAGACCCGAGAACACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCCTTT-GTTTAGCCAAATTTGACTGTTATCTCAGTGGAGCGAGGATCGATTCAATGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTT-CTTACCATGGTA-TGATCAGTGCCGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_sp._NAG_E_AB510771_Japan ?????????????????????????????????????????????????????????????????????????GGAACTGGTGAGTTCGAAGCCGGTATCTCTAAGGACGGTCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCCGTCAACAAGATGGACACCACCAAGGTACGAGATCTGCTGCTTTGCCCTTT-GTTTAGCTAAATTTGACTGTTATCTCAGTGGAGCGAGGATCGATTCAATGAAATTGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTT-CTTACCATGGTA-TGACCAGTGCCGCCTCTTAACGTTCTC--TGTAGCATGCCATGGTACAAGGGCTGGACCAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_tabescens_AB510804_Japan ?????????????????????????????????????????????????????????????????????????GGTACTGGTGAATTCCAAGCCGGTATCTCCAAGGATGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTTCGCGAAGTCCGACATTTGTCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTAAGTC-ATTACCATATTA-TGAGCGATGCGGCGGCTTAACGTTATT--GAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCACGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_tabescens_AB510805_Japan ?????????????????????????????????????????????????????????????????????????GGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGATGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTTCGCGAAGTCCGACATTTGTCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTAAGTC-ATTACCATATTA-TGAGCGATGCGGCGGCTTAACGTTATT--GAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTG???????????????????????????????????????????????????????? Armillaria_tabescens_CMW31118_China ??????????????????????ATGATCACTGGTACCTCCCAAGCTGATTGTGCCATCCTTATCATTGCTGGTGGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGATGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTTCGCGAAGTCCGACATTTGTCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTAAGTC-ATTACCATATTA-TGAGCGATGCGGCGGCTTAACGTTATT--GAAAGTATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTGTCCGACCCTCCGACAAGCCTCTTCGTCTTCCTCTCC???????????????????? Armillaria_tabescens_CMW31119_Italy ???????????????????????TGATCACTGGTACCTCCCAGGCTGATTGTGCCATCCTTATCATTGCTGGTGGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTTCGCGAAGTCCGACATTTATCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAATATGTTGGAGGAGTCCGCCAAGTAAGTC-ATTACCATATTA-TGAGCGATGCGGCGGCTTAACGTTGTT--GAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCTGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTGTCCGACCCTCCGACAAGCCTCTCCGTCTTCCTCTCC???????????????????? Armillaria_tabescens_CMW31120_Italy ??????????????????GAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATCCTTATCATTGCTGGTGGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTCCGCGAAGTCCGACATTTATCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAATATGTTGGAGGAGTCCGCCAAGTAAGTC-ATTACCATATTA-TGAGCGATGCGGCGGCTTAACGTTGTT--GAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTGTCCGACCCTCCGACAAGCCTCTCCGTCTTCCTCTCC???????????????????? Armillaria_tabescens_HQ285906_Ukraine ????CGTGACTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATCCTTATCATTGCTGGTGGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTTCGCGAAGTCCGACATTTATCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAATATGTTGGAGGAGTCCGCCAAGTAAGTC-ATTACCATATTA-TGAGCGATGCGGCGGCTTAACGTTGTT--GAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTGTCCGACCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_tabescens_HQ285907_Ukraine ????CGTGACTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATCCTTATCATTGCTGGTGGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGATGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTTCGCGAAGTTCGACATTTATCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTAAGTC-ATTACCATATTA-TGAGCGATGCGGCGGCTTAACGTTGTT--GAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTGTCCGACCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_tabescens_HQ285908_Ukraine ????CGTGACTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGTGCCATCCTTATCATTGCTGGTGGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTTCGCGAAGTCCGACATTTATCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAATATGTTGGAGGAGTCCGCCAAGTAAGTC-ATTACCATATTA-TGAGCGATGCGGCGGCTTAACGTTGTT--GAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTGTCCGACCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGACGTCTACAAGATCGG? Armillaria_tabescens_JF313111_USA ?????????????????????????ATCACTGGTACCTCCCAGGCTGATTGTGCCATCCTTATCATTGCTGGTGGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGATGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTTCGCGAAGTCTGACATTTATCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAGTCCGTTGCTTTCGTCCCCATCTCGGGATGGCACGGTGATAACATGTTGGAGGAGTCCGTCAAGTAAGTC-ATTACCATATTA-TGAGCGATACGGCTTCTTAACGTCGTT--GAAAGCATGCCATGGTACAAGGGTTGGACGAAGGAGACCAAGGCTGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGATGCCATTGAGCCCCCTGTCCGACCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_tabescens_JF313112_USA ???????????????????????????????????????????????ATTGTGCCATCCTTATCATTGCTGGTGGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGATGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTTCGCGAAGTCTGACATTTATCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGT{AC}GGCTACAACCCCAAGTCCGTTGCTTTCGTCCCCATCTCGGGATGGCACGGTGATAACATGTTGGAGGAGTCCGTCAAGTAAGTC-ATTACCATATTA-TGAGCGATACGGCTTCTTAACGTCGTT--GAAAGCATGCCATGGTACAAGGGTTGGACGAAGGAGACCAAGGCTGGTGTCGTCAAGGGCAAGACTCTCCTCGA{CT}GCCATTGATGCCATTGAGCCCCCTGTCCGACCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_tabescens_JF313113_USA ?????????????????????????ATCACTGGTACCTCCCAGGCTGATTGTGCCATCCTTATCATTGCTGGTGGTACTGGTGAATTCGAAGCCGGTATCTCCAAGGATGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTTCGCGAAGTCTGACATTTATCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGT{AC}GGCTACAACCCCAAGTCCGTTGCTTTCGTCCCCATCTCGGGATGGCACGGTGATAACATGTTGGAGGAGTCCGTCAAGTAAGTC-ATTACCATATTA-TGAGCGATACGGCTTCTTAACGTCGTT--GAAAGCATGCCATGGTACAAGGGTTGGACGAAGGAGACCAAGGCTGGTGTCGTCAAGGGCAAGACTCTCCTCGA{CT}GCCATTGATGCCATTGAGCCCCCTGTCCGACCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTCTACAAAATCGGG Armillaria_tabescens_JF746929_France ??????????????????????????????????????????????????????????????????????????????????????TCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTTCGCGAAGTCCGACATTTATCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAATATGTTGGAGGAGTCCGCCAAGTAAGTC-ATTACCATATTA-TGAGCGATGCGGCGGCTTAACGTTGTT--GAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTGTCCGACCCTCCG???????????????????????????????????????????? Armillaria_tabescens_JF746930 ?????????????????????????????????????????????????????????????????????????????????????TTCGAAGCCGGTATCTCCAAGGACGGTCAGACCCGAGAGCACGCCCTTCTTGCCTTCACTCTTGGTGTCAGGCAGCTCATTGTTGCCGTCAACAAGATGGACACCACCAAGGTACGAACCCTACCCCATCGCTTTTT-CTTTCGCGAAGTCCGACATTTATCTTAGTGGAGTGAGGACCGATTCAACGAAATCGTCAAGGAAACCTCCACCTTCATCAAGAAGGTCGGCTACAACCCCAAATCTGTTGCTTTCGTCCCCATCTCTGGATGGCACGGTGACAATATGTTGGAGGAGTCCGCCAAGTAAGTC-ATTACCATATTA-TGAGCGATGCGGCGGCTTAACGTTGTT--GAAAGCATGCCATGGTACAAGGGCTGGACGAAGGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCTATTGATGCCATTGAGCCCCCTGTCCGACCCTCCGACAAG??????????????????????????????????????? ; END; BEGIN TREES; TITLE Armillaria_from_China_IGS1_Trimmed; LINK TAXA = Taxa2; TRANSLATE 1 Armillaria_altimontana_AY509179_USA, 2 Armillaria_altimontana_AY509180_USA, 3 Armillaria_altimontana_AY509181_USA, 4 Armillaria_borealis_CMW31072_China, 5 Armillaria_borealis_CMW31075_Belarus, 6 Armillaria_borealis_CMW31077_China, 7 Armillaria_borealis_HQ232279_Finland, 8 Armillaria_borealis_JN657440_Finland, 9 Armillaria_borealis_JN657441_Germany, 10 Armillaria_borealis_JN657442_Switzerland, 11 Armillaria_calvescens_AY509163_Canada, 12 Armillaria_calvescens_AY509164_USA, 13 Armillaria_calvescens_AY509166_USA, 14 Armillaria_calvescens_CMW31078_USA, 15 Armillaria_calvescens_CMW31079_USA, 16 Armillaria_calvescens_CMW31080_USA, 17 Armillaria_cepistipes_AB510818_Japan, 18 Armillaria_cepistipes_AB510849_Japan, 19 Armillaria_cepistipes_AY509183_Canada, 20 Armillaria_cepistipes_AY509184_USA, 21 Armillaria_cepistipes_CMW31082_Findland, 22 Armillaria_cepistipes_CMW31083_Italy, 23 Armillaria_cepistipes_EU257709_CzechRep, 24 Armillaria_cepistipes_JF288720_UK, 25 Armillaria_cepistipes_JN657420_Ukraine, 26 Armillaria_cepistipes_KJ414316_Finland, 27 Armillaria_cepistipes_KJ414317_Finland, 28 Armillaria_cepistipes_KJ414318_Italy, 29 Armillaria_gallica_AB510834_Japan, 30 Armillaria_gallica_AB510842_Japan, 31 Armillaria_gallica_AY509171_Canada, 32 Armillaria_gallica_AY509172_USA, 33 Armillaria_gallica_AY509173_USA, 34 Armillaria_gallica_CMW31086_Russia, 35 Armillaria_gallica_CMW31087_China, 36 Armillaria_gallica_CMW31088_China, 37 Armillaria_gallica_CMW31090_Italy, 38 Armillaria_gallica_CMW31091_Italy, 39 Armillaria_gallica_CMW31093_China, 40 Armillaria_gallica_JF288737_France, 41 Armillaria_gallica_JN657426_France, 42 Armillaria_gallica_JN657428_Ukraine, 43 Armillaria_gallica_JN657431_Ukraine, 44 Armillaria_gallica_KJ200946_Germany, 45 Armillaria_gallica_KJ200949_Iran, 46 Armillaria_gemina_AY509158_USA, 47 Armillaria_gemina_AY509160_USA, 48 Armillaria_gemina_AY509162_USA, 49 Armillaria_gemina_CMW31094_USA, 50 Armillaria_gemina_CMW31095_USA, 51 Armillaria_jezoensis_D89921_Japan, 52 Armillaria_mellea_AB510820_Japan, 53 Armillaria_mellea_AB510833_Japan, 54 Armillaria_mellea_AY509185_USA, 55 Armillaria_mellea_AY509187_USA, 56 Armillaria_mellea_AY509188_USA, 57 Armillaria_mellea_CMW31161_China, 58 Armillaria_mellea_CMW31171_USA, 59 Armillaria_mellea_CMW31172_China, 60 Armillaria_mellea_JN657437_France, 61 Armillaria_mellea_JN657439_Ukraine, 62 Armillaria_nabsnona_AB510850_Japan, 63 Armillaria_nabsnona_AB510851_Japan, 64 Armillaria_nabsnona_AY509174_USA, 65 Armillaria_nabsnona_AY509176_Canada, 66 Armillaria_nabsnona_AY509178_USA, 67 Armillaria_nabsnona_CMW31100_Canada, 68 Armillaria_nabsnona_CMW31101_USA, 69 Armillaria_ostoyae_AB510847_Japan, 70 Armillaria_ostoyae_AB510848_Japan, 71 Armillaria_ostoyae_AY509154_USA, 72 Armillaria_ostoyae_AY509155_USA, 73 Armillaria_ostoyae_AY509157_USA, 74 Armillaria_ostoyae_CMW31102_China, 75 Armillaria_ostoyae_CMW31103_China, 76 Armillaria_ostoyae_CMW31104_China, 77 Armillaria_ostoyae_CMW31107_Finland, 78 Armillaria_ostoyae_CMW31110_China, 79 Armillaria_ostoyae_EU257711_CzechRep, 80 Armillaria_ostoyae_HQ232281_France, 81 Armillaria_ostoyae_JN657432_France, 82 Armillaria_ostoyae_JN657435_Ukraine, 83 Armillaria_sinapina_AB510827_Japan, 84 Armillaria_sinapina_AB510836_Japan, 85 Armillaria_sinapina_AY509167_Canada, 86 Armillaria_sinapina_AY509168_USA, 87 Armillaria_sinapina_AY509169_USA, 88 Armillaria_sinapina_CMW31112_China, 89 Armillaria_sinapina_CMW31113_China, 90 Armillaria_sinapina_CMW31115_China, 91 Armillaria_singula_D89926_Japan, 92 Armillaria_tabescens_AB510823_Japan, 93 Armillaria_tabescens_AB510824_Japan, 94 Armillaria_tabescens_AY509189_USA, 95 Armillaria_tabescens_AY509191_USA, 96 Armillaria_tabescens_AY509192_USA, 97 Armillaria_tabescens_CMW31118_China, 98 Armillaria_tabescens_CMW31119_Italy, 99 Armillaria_tabescens_CMW31120_Italy, 100 Armillaria_tabescens_HQ232284_Ukraine, 101 Armillaria_tabescens_HQ232285_Ukraine, 102 Armillaria_tabescens_HQ232286_Ukraine, 103 Armillaria_tabescens_JF288740_France, 104 Armillaria_tabescens_JF288741_France, 105 Armillaria_sp_CMW31153_China, 106 Armillaria_sp._CBS_C_CMW31123, 107 Armillaria_sp._CBS_C_CMW31124, 108 Armillaria_sp._CBS_F_CMW31127, 109 Armillaria_sp._CBS_F_CMW31128, 110 Armillaria_sp._CBS_F_CMW31129, 111 Armillaria_sp._CBS_F_CMW31130, 112 Armillaria_sp._CBS_G_CMW31132, 113 Armillaria_sp._CBS_G_CMW31133, 114 Armillaria_sp._CBS_G_CMW31134, 115 Armillaria_sp._CBS_H_CMW31136, 116 Armillaria_sp._CBS_H_CMW31138, 117 Armillaria_sp._CBS_H_CMW31139, 118 Armillaria_sp._CBS_J_CMW31140, 119 Armillaria_sp._CBS_J_CMW31142, 120 Armillaria_sp._CBS_L_CMW31144, 121 Armillaria_sp._CBS_L_CMW31145, 122 Armillaria_sp._CBS_N_CMW31146, 123 Armillaria_sp._CBS_N_CMW31148, 124 Armillaria_sp._CBS_O_CMW31150, 125 Armillaria_sp._CBS_O_CMW31151, 126 Armillaria_sp._NAG_E_AB510828_Japan, 127 Armillaria_sp._NAG_E_AB510840_Japan, 128 Armillaria_sp._NAG_E_AB510845_Japan; TREE Fig._1 = [&R] ((((60:0.007966206000000003,61:0.006679778999999997):0.03836296,(54:9.727394999999861E-4,58:8.516645999999961E-4,(55:9.650659999999867E-4,56:8.583496000000024E-4):0.006368701000000004):0.017678450000000012):0.0105315,(114:8.945281000000138E-4,(112:0.0031677679999999875,(52:0.004606373999999996,59:0.003339755):0.001978249999999987,(53:0.005088061000000005,(57:0.0010590669999999969,113:0.003187414999999999):0.003063590000000005):0.0023779319999999993):0.0019242909999999946):0.031474660000000015):0.1298384,((94:0.0023979090000000036,(95:8.23527699999993E-4,96:0.001930712000000001):0.004094757000000004,(92:0.0031653859999999923,93:8.090766000000138E-4,97:0.0019927060000000107):0.009808947000000012,(98:0.01613060999999999,(99:0.0019531789999999993,100:8.098055999999909E-4,101:7.929691999999933E-4,102:7.834013999999945E-4,(103:8.060055000000121E-4,104:7.988669000000004E-4):0.0015732270000000104):0.004423051000000011):0.0038736080000000006):0.1211451,((((69:7.649912999999897E-4,70:7.519641000000021E-4):0.00974609600000001,(71:7.963539000000186E-4,(72:7.913237999999656E-4,73:7.82194799999969E-4):0.0018890510000000305):0.003510601000000002):0.008782632999999984,((46:0.0018854930000000159,47:7.887960999999888E-4,48:7.885286000000047E-4,49:0.0017381389999999997,50:9.49544400000002E-4):0.01168306999999999,((10:7.497843000000004E-4,(4:7.60520099999995E-4,5:7.568320000000128E-4,6:7.630705999999987E-4):0.0029536000000000007,(7:7.814528999999792E-4,(8:7.593473999999989E-4,9:7.469362000000201E-4):0.0018198809999999954):0.0018328529999999954):0.011736810000000014,((74:0.0018415380000000037,75:0.0018749060000000095,76:0.0018987629999999978,78:7.638112000000197E-4):0.0027790209999999926,(77:0.0018401120000000049,79:7.645638999999871E-4,(80:0.006859405999999985,81:0.0017963599999999968,82:7.778609000000103E-4):0.010888399999999993):0.0030722029999999956):0.0029234450000000245):0.004201914999999973):0.004058998000000008):0.018044909999999997,((62:0.0018691589999999814,63:7.787082999999861E-4,((64:0.0012408359999999952,65:7.916949999999812E-4):0.004651055000000015,(66:7.900164999999904E-4,67:7.681616999999918E-4,68:8.443304000000096E-4):0.0056513950000000035):0.0055908349999999885):0.011483230000000011,((120:0.008330302999999983,121:0.007185280999999988,122:0.0018417379999999817,123:0.0029389969999999987,(26:0.001607554000000011,27:7.632979000000151E-4,115:7.484373000000155E-4,116:0.0014189770000000157,117:7.444299000000099E-4,118:7.453160000000236E-4,119:7.583017000000192E-4,(124:0.0018675880000000034,125:0.0040321249999999975):0.00292173200000001,(35:0.0018700160000000021,89:0.0018318030000000207,106:0.0018500970000000228):0.0018127569999999982,(127:0.0010399190000000003,(126:0.002615616000000015,128:0.004138427):0.0018094939999999948):0.02851646000000002):0.0017876419999999782):0.005213837999999998,(29:0.008142552999999997,((1:7.839600000000002E-4,2:7.859865000000021E-4,3:7.806584000000227E-4):0.0028751699999999825,(19:7.916125999999912E-4,20:7.80529799999985E-4,23:0.003065486000000006,43:7.646047000000045E-4,87:7.951964999999839E-4,(85:0.0018231489999999961,(21:7.86657199999985E-4,22:7.574621999999753E-4,(25:7.966309000000116E-4,(24:0.009804072999999996,28:0.001839665000000018):0.003982659999999999):0.0017614839999999798):0.001989653000000008):0.002401557999999998,((36:7.62949900000004E-4,39:0.001274878000000007):0.0030398259999999955,(51:0.0030890919999999877,(30:0.001825629000000023,91:0.0018151380000000217):0.0028783709999999907):0.0017788589999999938,(42:7.780950999999869E-4,44:7.530206999999955E-4,45:0.0018506909999999877):0.0029706359999999987):0.0035904409999999998,((13:8.030830999999905E-4,16:0.0030596619999999908):0.0018709209999999976,(18:0.0029266639999999955,(14:0.002978091000000016,15:0.0027238619999999936,33:7.688583000000082E-4):0.004002568999999984,(17:0.0017914719999999884,31:7.770494999999877E-4,34:0.0018167249999999913,38:0.0018512760000000128,41:0.0017937339999999913,83:0.0029345209999999955,86:7.722971000000134E-4,88:0.0011337630000000098,90:0.0014922350000000084,105:0.005744126999999988,107:0.0018077079999999912,(37:0.0018462829999999764,40:0.0018035489999999876):0.004018227000000013,(110:7.590409000000076E-4,111:0.001809278999999997):0.0018464049999999954,(11:7.781334000000195E-4,12:7.769663000000149E-4,32:7.808142000000073E-4):0.0028386659999999897,(84:0.003455511999999994,(108:7.464543000000046E-4,109:7.492983999999869E-4):0.002963836999999997):0.0018083060000000095):0.001782832000000012):0.0017286669999999893):0.003612789000000005):0.0017805850000000012):0.002307484999999998):0.003917377999999999):0.00615294999999999):0.019068790000000002):0.01261422000000001):0.0649192); END; BEGIN TREES; TITLE Armillaria_from_China_TEF1a; LINK TAXA = Taxa1; TRANSLATE 1 Armillaria_sp._CBS_C_CMW31123, 2 Armillaria_sp._CBS_C_CMW31124, 3 Armillaria_sp._CBS_F_CMW31127, 4 Armillaria_sp._CBS_F_CMW31128, 5 Armillaria_sp._CBS_F_CMW31129, 6 Armillaria_sp._CBS_F_CMW31130, 7 Armillaria_sp._CBS_G_CMW31132, 8 Armillaria_sp._CBS_G_CMW31133, 9 Armillaria_sp._CBS_G_CMW31134, 10 Armillaria_sp._CBS_H_CMW31136, 11 Armillaria_sp._CBS_H_CMW31138, 12 Armillaria_sp._CBS_H_CMW31139, 13 Armillaria_sp._CBS_J_CMW31140, 14 Armillaria_sp._CBS_J_CMW31142, 15 Armillaria_sp._CBS_L_CMW31144, 16 Armillaria_sp._CBS_L_CMW31145, 17 Armillaria_sp._CBS_N_CMW31146, 18 Armillaria_sp._CBS_N_CMW31148, 19 Armillaria_sp._CBS_O_CMW31150, 20 Armillaria_sp._CBS_O_CMW31151, 21 Armillaria_altimontana_JF313117_USA, 22 Armillaria_altimontana_JF313118_USA, 23 Armillaria_altimontana_JF313120_USA, 24 Armillaria_borealis_CMW31072_China, 25 Armillaria_borealis_CMW31075_Belarus, 26 Armillaria_borealis_CMW31077_China, 27 Armillaria_borealis_HQ285901_Finland, 28 Armillaria_borealis_JN657494_Finland, 29 Armillaria_borealis_JN657495_Germany, 30 Armillaria_borealis_JN657496_Switzerland, 31 Armillaria_calvescens_CMW31078_USA, 32 Armillaria_calvescens_CMW31079_USA, 33 Armillaria_calvescens_CMW31080_USA, 34 Armillaria_calvescens_JF313129_USA, 35 Armillaria_calvescens_JF313130_USA, 36 Armillaria_calvescens_JF313138_Canada, 37 Armillaria_cepistipes_AB510790_Japan, 38 Armillaria_cepistipes_AB510793_Japan, 39 Armillaria_cepistipes_CMW31082_Finland, 40 Armillaria_cepistipes_CMW31083_Italy, 41 Armillaria_cepistipes_EU251395_CzechRep, 42 Armillaria_cepistipes_JF313115_USA, 43 Armillaria_cepistipes_JF313116_Canada, 44 Armillaria_cepistipes_JF746917_UK, 45 Armillaria_cepistipes_JN657474_Ukraine, 46 Armillaria_cepistipes_KJ414319_Finland, 47 Armillaria_cepistipes_KJ414320_Finland, 48 Armillaria_cepistipes_KJ414321_Italy, 49 Armillaria_gallica_AB510760_Japan, 50 Armillaria_gallica_AB510761_Japan, 51 Armillaria_gallica_CMW31086_Russia, 52 Armillaria_gallica_CMW31087_China, 53 Armillaria_gallica_CMW31088_China, 54 Armillaria_gallica_CMW31090_Italy, 55 Armillaria_gallica_CMW31091_Italy, 56 Armillaria_gallica_CMW31093_China, 57 Armillaria_gallica_JF313123_Canada, 58 Armillaria_gallica_JF313125_USA, 59 Armillaria_gallica_JF313126_USA, 60 Armillaria_gallica_JF746920_France, 61 Armillaria_gallica_JN657480_France, 62 Armillaria_gallica_JN657482_Ukraine, 63 Armillaria_gallica_JN657485_Ukraine, 64 Armillaria_gallica_KJ200952_Germany, 65 Armillaria_gallica_KJ200955_Iran, 66 Armillaria_gemina_CMW31094_USA, 67 Armillaria_gemina_CMW31095_USA, 68 Armillaria_gemina_JF313133_USA, 69 Armillaria_gemina_JF313135_USA, 70 Armillaria_gemina_JF313136_USA, 71 Armillaria_mellea_AB510801_Japan, 72 Armillaria_mellea_AB510802_Japan, 73 Armillaria_mellea_CMW31161_China, 74 Armillaria_mellea_CMW31171_USA, 75 Armillaria_mellea_CMW31172_China, 76 Armillaria_mellea_JF313127_USA, 77 Armillaria_mellea_JF313128_USA, 78 Armillaria_mellea_JF313137_USA, 79 Armillaria_mellea_JN657491_France, 80 Armillaria_mellea_JN657493_Ukraine, 81 Armillaria_nabsnona_AB510764_Japan, 82 Armillaria_nabsnona_AB510766_Japan, 83 Armillaria_nabsnona_CMW31100_Canada, 84 Armillaria_nabsnona_CMW31101_USA, 85 Armillaria_nabsnona_JF313119_USA, 86 Armillaria_nabsnona_JF313122_Canada, 87 Armillaria_nabsnona_JF313124_USA, 88 Armillaria_ostoyae_AB510781_Japan, 89 Armillaria_ostoyae_AB510782_Japan, 90 Armillaria_ostoyae_CMW31102_China, 91 Armillaria_ostoyae_CMW31103_China, 92 Armillaria_ostoyae_CMW31104_China, 93 Armillaria_ostoyae_CMW31107_Finland, 94 Armillaria_ostoyae_CMW31110_China, 95 Armillaria_ostoyae_EU251400_CzechRep, 96 Armillaria_ostoyae_HQ285903_France, 97 Armillaria_ostoyae_JF313139_USA, 98 Armillaria_ostoyae_JF313140_USA, 99 Armillaria_ostoyae_JF313141_USA, 100 Armillaria_ostoyae_JN657486_France, 101 Armillaria_ostoyae_JN657489_Ukraine, 102 Armillaria_sinapina_AB510774_Japan, 103 Armillaria_sinapina_AB510776_Japan, 104 Armillaria_sinapina_CMW31112_China, 105 Armillaria_sinapina_CMW31113_China, 106 Armillaria_sinapina_CMW31115_China, 107 Armillaria_sinapina_JF313114_Canada, 108 Armillaria_sinapina_JF313131_USA, 109 Armillaria_sinapina_JF313132_USA, 110 Armillaria_tabescens_AB510804_Japan, 111 Armillaria_tabescens_AB510805_Japan, 112 Armillaria_tabescens_CMW31118_China, 113 Armillaria_tabescens_CMW31119_Italy, 114 Armillaria_tabescens_CMW31120_Italy, 115 Armillaria_tabescens_HQ285906_Ukraine, 116 Armillaria_tabescens_HQ285907_Ukraine, 117 Armillaria_tabescens_HQ285908_Ukraine, 118 Armillaria_tabescens_JF313111_USA, 119 Armillaria_tabescens_JF313112_USA, 120 Armillaria_tabescens_JF313113_USA, 121 Armillaria_tabescens_JF746929_France, 122 Armillaria_tabescens_JF746930, 123 Armillaria_sp_CMW31153, 124 Armillaria_sp._NAG_E_AB510768_Japan, 125 Armillaria_sp._NAG_E_AB510769_Japan, 126 Armillaria_sp._NAG_E_AB510771_Japan; TREE Fig._2 = [&R] (((((24:8.34790900000007E-4,26:8.353906000000133E-4):0.0020061289999999954,25:8.107688000000002E-4,29:8.055767000000047E-4,27:7.927137000000029E-4):0.009252134999999995,(((((31:8.352282999999974E-4,32:8.224358000000001E-4,33:8.313241999999971E-4):0.0038325759999999903,36:0.004172544999999993,35:8.276160000000032E-4,34:8.33915699999993E-4):0.005935770000000007,53:0.012197470000000002,57:0.003238403000000001,(59:0.0013503400000000054,58:0.002086244000000008):0.0062213349999999945):0.004120036999999993,((((1:0.0020232170000000008,(2:8.167071000000012E-4,52:8.378761000000026E-4):0.0019708490000000037):0.004230192000000001,10:0.001663233,(11:8.268830000000005E-4,12:8.278971999999968E-4):0.0019732339999999973,13:0.0032106819999999994,14:0.004405171999999999):0.002093712999999997,(19:8.292121999999985E-4,20:7.982839000000019E-4):0.006627135999999999):0.0020501690000000045,((15:8.18894700000003E-4,16:8.120215000000028E-4):0.003330653000000003,(17:0.0019667249999999956,18:8.371374999999945E-4):0.004171545999999998):0.007200154000000007):0.009429485999999987,((51:8.129787000000013E-4,(54:8.09435800000001E-4,61:7.999289999999978E-4):0.001933490000000003,(64:8.926558000000029E-4,63:7.898315999999989E-4,60:0.0021597039999999984,62:0.002738828999999998):0.0019295289999999993):0.003016658999999998,(55:8.463308999999974E-4,65:8.833697999999987E-4):0.004593856):0.01017715999999999,56:0.011166989999999988,((83:8.254477000000024E-4,84:0.0016823290000000032,85:8.096408999999985E-4,86:7.980782000000033E-4,87:8.208710000000008E-4):0.007067066999999996,(81:9.051833999999953E-4,82:0.0021548980000000023):0.004710588000000002):0.005713683999999997,(23:8.078540999999981E-4,22:8.058800000000019E-4,21:0.001900080999999998):0.012722219999999992,((43:7.996222999999969E-4,42:8.077074000000031E-4):0.009540818000000006,49:0.0041035420000000156):0.003621263999999985,50:0.010817959999999988,(126:0.003692304999999993,(124:9.018576E-4,125:8.927199999999996E-4):0.002176389000000001):0.019728239999999994):0.005265831999999998,(((112:0.002792160000000002,111:9.094578999999936E-4,110:0.0035159429999999936):0.0045043720000000065,(113:0.0020160760000000055,114:0.002030517999999995,115:7.996106999999947E-4,117:7.850880999999976E-4,121:9.094322000000044E-4,122:9.153249000000002E-4):0.0030538239999999967,116:0.0019067460000000008):0.009741639999999996,(120:8.240471999999971E-4,119:8.230193000000052E-4,118:8.130657000000041E-4):0.009952853999999997):0.061916339999999986):0.005077365):0.003247465000000005,((((((66:8.115192999999937E-4,70:8.0621639999999E-4,68:8.027709999999938E-4):0.004437717999999993,(67:0.0019577590000000034,69:8.150279000000149E-4):0.004214970999999984):0.003033375000000005,((99:0.0014859809999999973,97:0.001886783000000003):0.0018710269999999973,98:9.998667999999988E-4):0.0074273589999999945):0.007252681000000011,(28:0.003146758999999999,30:8.869997999999962E-4):0.007965447000000014):0.003274502999999984,((90:8.448819000000107E-4,91:8.446031000000076E-4):0.0019691939999999936,92:0.0023269910000000005,((93:8.340706000000142E-4,94:8.289389000000064E-4,96:7.866408000000158E-4,100:7.833770000000018E-4):0.0018913139999999912,95:8.677358999999996E-4,101:8.112099999999928E-4):0.003079577,89:8.975286999999971E-4,88:8.936739000000027E-4):0.00795175799999999):0.006270549000000014,(((104:0.0020075749999999976,105:0.001985318,106:0.002335069000000009):0.004205553000000001,107:8.170623000000043E-4,109:0.0038865029999999995,108:0.0017045210000000005,102:0.002189399999999994,103:0.002189840999999998):0.012962979999999999,(((39:8.25028699999994E-4,40:8.070196000000002E-4,46:8.759423000000016E-4):0.001985387000000005,41:8.503437000000058E-4,44:8.778736000000092E-4,47:0.0015069700000000102,48:9.065498000000033E-4,45:7.960352000000032E-4):0.002464916999999997,(((3:8.085976000000022E-4,4:8.112388000000026E-4):0.007955449000000003,(6:0.004524699999999993,(38:0.002181407999999996,37:0.0021741150000000042):0.0036692170000000024):0.001955383000000005):0.0020364589999999905,(123:0.0018977389999999955,5:0.0049570050000000004):0.004457022000000005):0.0033528949999999946):0.008630263999999999):0.006087663999999993):0.005551515000000007):0.01200836,(((7:8.447436999999974E-4,8:8.400959000000041E-4,9:0.001662266999999995,75:8.293349000000061E-4,73:8.260196000000053E-4):0.0025964289999999973,(72:0.0027673090000000025,71:9.307094000000002E-4):0.002229582000000001):0.007879461000000004,(74:0.0029499650000000058,((78:0.001935503000000005,76:8.165185000000019E-4):0.0032570819999999945,77:8.185348000000064E-4):0.004380073000000005):0.008400751000000005,(79:7.818456999999987E-4,80:7.849154000000025E-4):0.008789668000000007):0.02401671999999999); END;