#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 11, 2021; 22:55 GMT TreeBASE (cc) 1994-2008 Study reference: Fehlberg S., & Ranker T. 2007. Phylogeny and biogeography of Encelia (Asteraceae) in the Sonoran and Peninsular Deserts Based on Multiple DNA Sequences. Systematic Botany, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1722] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=34; TAXLABELS Bahiopsis_sp Encelia_actonii_1 Encelia_actonii_2 Encelia_asperifolia_1 Encelia_californica Encelia_canescens Encelia_conspersa Encelia_densifolia Encelia_farinosa_var_farinosa Encelia_farinosa_var_phenicodonta Encelia_farinosa_var_radians Encelia_frutescens_2 Encelia_frutescens_subsp_glandulosa Encelia_halimifolia_1 Encelia_halimifolia_2 Encelia_hispida Encelia_palmeri_1 Encelia_palmeri_3 Encelia_ravenii Encelia_resinifera_1 Encelia_resinifera_2 Encelia_ventorum_1 Encelia_virginensis_2 Encelia_x_laciniata_1 Encelia_x_laciniata_2 Enceliopsis_argophylla Enceliopsis_covillei Enceliopsis_nudicaulis_1 Enceliopsis_nudicaulis_2 Enceliopsis_nutans_1 Flourensia_stenophylla Geraea_canescens_1 Geraea_viscida Simsia_calva ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=29; TAXLABELS Encelia_actonii_1 Encelia_asperifolia_1 Encelia_asperifolia_2 Encelia_californica Encelia_canescens Encelia_conspersa Encelia_densifolia Encelia_farinosa_var_farinosa Encelia_farinosa_var_phenicodonta Encelia_farinosa_var_radians Encelia_frutescens_1 Encelia_frutescens_subsp_glandulosa Encelia_halimifolia_2 Encelia_hispida Encelia_palmeri_1 Encelia_palmeri_3 Encelia_ravenii Encelia_resinifera_2 Encelia_ventorum_1 Encelia_ventorum_2 Encelia_virginensis_1 Encelia_x_laciniata_2 Enceliopsis_argophylla Enceliopsis_covillei Enceliopsis_nudicaulis_1 Enceliopsis_nudicaulis_2 Enceliopsis_nutans_2 Geraea_canescens_1 Geraea_viscida ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1703] TITLE 'Fig 2 psbA-trnH and trnS-trnfM'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1613; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Encelia_actonii_1 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATTATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTGATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAA-----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_asperifolia_1 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATTATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTGATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAAA-CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAA-----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_asperifolia_2 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATTATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGTAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTGATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAA---CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAA-----TA----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_californica TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATGATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCATATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAA-----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_canescens TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATGATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCATATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAAA----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_conspersa TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATGATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCATATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAAA----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_densifolia TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATGATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCATATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAAA----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_farinosa_var_farinosa TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATGATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCATATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAAA----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_farinosa_var_phenicodonta TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATTATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTGATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAA---CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAA-----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_farinosa_var_radians TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATGATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGAGAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATTTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCATATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAAA----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTAATATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_frutescens_1 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATTATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTGATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCCTTTGTAAAATAAAAAAAA-CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAAA----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_frutescens_subsp_glandulosa TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATTCTCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTGATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAA-----TC----------------AAAAATTAGATTATTAGATT-GA-TAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAA-----TTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_halimifolia_2 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATGATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCATATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAAA----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_hispida TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATGATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCATATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAAA----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_palmeri_1 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATGATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CTGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCATATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAAA----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_palmeri_3 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATGATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAAAGGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGCTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCATATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAAA----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_ravenii TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATTATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTGATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAAA-CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAA-----TC----------------AAAAATTAGATTATTAGATT-GATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_resinifera_2 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTGATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATTATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAAGCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTGATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAAA-CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTTAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAA-----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_ventorum_1 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATTATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGTAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTGATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAA---CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAA-----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_ventorum_2 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATGATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGCTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAA--CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCATATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAAA----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_virginensis_1 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATTATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTGATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAAAA-CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAA-----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Encelia_x_laciniata_2 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTTTCCATTAACATAAAAAA-GCATATTATTTATTGATTATTTTTATTT-----AATAAATTGATTATTTTTATTTAATAAAT-----CAAAGTAATAAATAAGCAAAATTATCATTTTTATCTATTTTCGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAAACCTATAATATAAATGAATACAAAGATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATAAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAAA-GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTGATTTTATTCCTCCGAATGGAACATGGCCATATGAGTGGATACCGCCACTATCAAGGATCTCGGGTGTGATGGTCAATCTATC----CCGATATATGGATAGATATATGATCCAGTATGCCCATTTGTAAAATAAAAAA---CCAAATTCCATTCTCCCCCGACTCCATGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAAA-----TC----------------AAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAGTCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTATTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCGTCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCTTACCTCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Enceliopsis_argophylla TTGGCTACATCCGCCCCTCTACTATTATCCAGTATTACTATATTTTT-CCATTAACATAAAAAAAGCATATTATTTATTTCTTATTTTTATTT-----AA----------------------TTAAT-----CAAAGTAATAAATAAGCAAAATTCTCATTTTTATCTATTTTAGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAA--------TATAGAAACCTA-TAATATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATCAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAA--GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATAGAACATGGCCATATGAGTGGATACCGCCACTATCAAAGATCTCGGGTGTGATGGTCAATCTATCTATCCCGATATATGGATAGATATATGATCCAGCATGCCCTTTTGTAAAATAAAAAA---CCAAATTCCATTCTCCCCCGACTCCACGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAATGAAAATTTAGATTATTAGATTAGAAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAATCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACACATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTTTTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCATCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCCTACCCCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Enceliopsis_covillei TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTT-CCATTAACATAAAAAAAGCATATTATTTATTTCTTATTTTTATTT-----AA----------------------TTAAT-----CAAAGTAATAAATAAGCAAAATTCTCATTTTTATCTATTTTAGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAA--------TATAGAAACCTA-TAATATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATCAAAA-----TGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAA--GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATAGAACATGGCCATATGAGTGGATACCGCCACTATCAAAGATCTCGGGTGTGATGGTCAATCTATCTATCCCGATATATGGATAGATATATGATCCAGCATGCCCTTTTGTAAAATAAAAAA---CCAAATTCCATTCTCCCCCGACTCCACGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAATGAAAATTTAGATTATTAGATTAGAAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAATCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACACATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTTTTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCATCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCCTACCCCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Enceliopsis_nudicaulis_1 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTT-CCATTAACATAAAAAAAGCATATTATTTATTTCTTATTTTTATTT-----AA----------------------TTAAT-----CAAAGTAATAAATAAGCAAAATTCTCATTTTTATCTATTTTAGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAA--------TATAGAAACCTA-TAATATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATCAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAA--GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATAGAACATGGCCATATGAGTGGATACCGCCACTATCAAAGATCTCGGGTGTGATGGTCAATCTATCTATCCCGATATATGGATAGATATATGATCCAGCATGCCCTTTTGTAAAATAAAAAA---CCAAATTCCATTCTCCCCCGACTCCACGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAATGAAAATTTAGATTATTAGATTAGAAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAATCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACACATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTTTTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCATCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCCTACCCCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Enceliopsis_nudicaulis_2 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTT-CCATTAAAATAAAAAAAGCATATTATTTATTTCTTATTTTTATTT-----AA----------------------TTAAT-----CAAAGTAATAAATAAGCAAAATTCTCATTTTTATCTATTTTAGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAA--------TATAGAAACCTA-TAATATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATCAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAA--GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATAGAACATGGCCATATGAGTGGATACCGCCACTATCAAAGATCTCGGGTGTGATGGTCAATCTATCTATCCCGATATATGGATAGATATATGATCCAGCATGCCCTTTTGTAAAATAAAAAA---CCAAATTCCATTCTCCCCCGACTCCACGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAATGAAAATTTAGATTATTAGATTAGAAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAATCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACACATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTTTTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCATCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCCTACCCCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Enceliopsis_nutans_2 TTGTCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTT-CCATTAACATAAAAAAAGCATATTATTTATTTCTTATTTTTATTT-----AA----------------------TTAAT-----CAAAGTAATAAATAAGCAAAATTCTCATTTTTATCTATTTTAGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAA--------TATAGAAACCTA-TAATATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATCAAAA--TTTTG--ATTTTTAAAGAAACTATGTAAGACAAAT--TACTAAATAAAAAAA--GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATAGAACATGGCCATATGAGTGGATACCGCCACTATCAAAGATCTCGGGTGTGATGGTCAATCTATCTATCCCGATATATGGATAGATATATGATCCAGCATGCCCTTTTGTAAAATAAAAAA---CCAAATTCCATTCTCCCCCGACTCCACGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAATGAAAATTTAGATTATTAGATTAGAAAAATTAGATTATT-----AGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAATCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTTTTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCATCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCCTACCCCAAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Geraea_canescens_1 TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTT-CCATTAACATAAAAAA-GCATATTATTTATTTCTTATTT-----------AATAAATC--TTATTTTTATTTAATTAATTTAATCAAAGTAATAAATAAGCAAAATTCTCATTTTTATCTATTTTAGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAA--------TATAGAAACCTAATAATATAAATGAATACAAAGAAAAAACACGCAAATCGAACCAAACTATCAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAA--GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCTATTGCTCCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATAGAACATGGCCATATGAGTGGATACCGCCACTATCAAAGATCTCGGGTGTGATGGTCAATCTATCTATCCCGATATATGGATAGATATATGATCCAGCATGCCCTTTTGTAAAATAAAAAA---CCAAATTCCATTCTCCCCCGACTCCACGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATTAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCACATTCAATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAATGAAAATTTAGATTATTAGATTAGAAAAATTAGATTATTAGATTAGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAATCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTTTTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCATCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTTTACCCCTACCCCCAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA Geraea_viscida TTGGCTACATCCGCCCCTCTACTATTATCTAGTATTACTATATTTTT-CCATTAACATAAAAAA-GCATATTATTGATTTCTTATTTTTATTT-----AA----------------------TTAAT-----CAAAGTAATAAATAAGCAAAATTCTCATTTTTATCTATTTTAGATTGAAATTGAATTGTAAATAAAACTTCATAAAAGATTGGGAAAAGTATATGATATAGAA--------TATAGAAACCTA-TAATATAAATGAATACAAAGAAAAAACACACAAATCGAACCAAACTATCAAAAGTACTTGTTATTTTTAAAGAAACTATGTAAGGCAAATAGTACTAAATAAAAAAA--GGAGCAATAACGCCCTCTTGATAAAACAAGAGGGAAGCT------CCTTTTTTAGTTCAAAAACTCCTATACAATCAGACCAAAGTCTTATCCATTTGAACCACTCAGCCATCTCTCCGAAAGACAATTTTATTTTATTCCTCCGAATAGAACATGGCCATATGAGTGGATACCGCCACTATCAAAGATCTCGGGTGTGATGGTCAATCTATCTATCCCGATATATGGATAGATATATGATCCAGCATGCCCTTTTGTAAAATAAAAAA---CCAAATTCCATTCTCCCCCGACTCCACGTACGAATAAAGTGGTAAAGGGGTAGTAATATAATAAATCATATAGAATCAATGGATTCGTGGTAAAATCCCTGTATGATGTATTTTAGTACAATTTTTGGCTGATATAGGGATCAAATGGTATAGTTCATTTGTTGGTAGCTTGGAGGATAAAAAGCATGACTCTTGCTTTCCAATTGGCTGTTTTTGCATTAATTGCTACTTCATCAATCTTATTGATTAGCGTACCCGTTGTATTTGCTTCTCCTGATGGTTGGTCAAGTAACAAAAATGTTGTATTTTCAGGTACATCATTATGGATTGGATTAGTCTTTCTGGTGGGTATCCTTAATTCTCTCATCTCTTGAACCTATTGTCCTAGATCCAAAACCGAAATGGCCCTCTGAATTATTCTTGGTTGTGAGACACATTCACATTCA------ATATAAGTCCCCAAAATCAAAATAAATAGAAGAAAAAAATGAAAATTTAGATTATTAGATTAGAAAAATTAGATTATT-----AGATTAGAAGGGGGGCCAAACTTCTTGTTCTTGAAAAAAATGAATATTTAATTCAAATTAAGAAAAAATTTGGGCTCAATCTGAAGAGAATCTCCGGCCCAGCACTGCACAAATATGCTCCAGACATATATATCATATATGTGTGGACATATTGTGTATTATAGACATATTGTGTATCAAGAACGAAACAAAAAGCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCCAAAATCAAAATGAAGTCATTTTTTTAATATCTAAAATTCTAAATTAAAATGCTAAAGGATTTGGTATAGTTAGTCATCATAGTGTAGTGATTCTATCCTTCCCCTCTTTGCCTTCTACCCCTACCCCCAAAGAAAAAGTGTTAACTAATTACTAGTTACCAGAGTAAAACATACA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1704] TITLE Fig_1_ITS_and_ETS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1300; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bahiopsis_sp ACTTGGGGTCGCGATCGAAGCATCGTCATAAGACAACGCGTCGGGGTACTTTAAGAGCGTCTATACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCGTGAGGAGACTCCTATTTAGGCCAACCACGCCATAGGCACGGGAGACCAATCTCCGCCCCAGCACAAGACATCCCTGGAAAGG-ATGGTTGGTGGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAACCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGTTTTACAAAGAAGCCACGTCCAACGCGCACACCGCGAACGGGGCGCAATAGCACGGGCCCTTTAAGTTTGGTTTTCCTTGGCACGTCTCGTGCCGGGGTTTTGTTATTGCGTCAACATGACATCCATGATGCCCCAAAGATATGGCGCAAGCATGAACGCACGTCGACAAG-GCCTCACAAGGCTCGAAACAATTGCTTC-----GGTCCCAGCAAGGCCGGATGTGTTAACTTGTTCACGGGTCGTTCTGCTGTGCAGGGTTCGACAATGATCCTTCCGCAGGTTCA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Encelia_actonii_1 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAAAGCAAAAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACACACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCAAGTACTACGCGCACACCGCAAACGGGGCACGATAGCACGGGCCCTTTAAGTTTAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCCCCACATGTGTGGGGGAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTCCCCCGCAAGGCCAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCTCTTTCTGCTTTTGGTTGCCTGCCTGGCCTGTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTTCAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCCCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAGATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_actonii_2 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAAAGCAAAAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACAGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACGCGCACACCGCAAACGGGGCACGATAGCACGGGCCCTTTAAGTTTAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCCCCACATGTGTGGGGGAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTCCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATC?CTTTCTGCTTTTGGTTGCCTGCCTGGCCTGTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTTCAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCCCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_asperifolia_1 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-TAGAGCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACACGCACACCGCAAACGGGGCGGGATAGCACGAGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCGCCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCTTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTC{AG}TGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_californica ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAG{CT}CGTGCGTCCCTCCTGAGGAGA{CT}TCCTATTTAGGCCAACC{AG}CACCATAGGCACGGGAGACCATTCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCG{AG}ATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACGCGCACACCGCAAACGGGGCG{GT}GATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCAC{AG}TGTCGTGCCGGGGGTTTGTTAGTGTGTC{AG}AC--GACATCCATGCTGCCCCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGTGGGTTTCGTGTGTTGCCTACCTACTTCAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGATGAATGTCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_canescens ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCACCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGACCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACGCGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCGCCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCTTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTTGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCATGTGTTGCCTACCTACTCTAGGGTATTGTCCTGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAA{CT}GCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCATCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_conspersa ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCACCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACC{AG}CACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCA{AG}CCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCAC{AG}TACTACGCGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCGCCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCA{CT}GAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTCTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCAACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCATCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_densifolia ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACGCGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCGCCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTCTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGTCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_farinosa_var_farinosa ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCATATGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAATACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACGCGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCACCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_farinosa_var_phenicodonta ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACAGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACGCGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCGCCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGTTTT-----GTTCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATC?CTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCA{CT}CAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCTGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_farinosa_var_radians ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCATATGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAATACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACGCGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCACCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATC?CTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACC{AT}CATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_frutescens_2 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAATGCGAAAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAACCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACACGCACACCGCAAACGGGGCACGATAGCACGGGCCCTTTAAGTTTAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCCCCACATGTGTGGGGGAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTCCCCCGCAAGGCCAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCTCTTTCTGCTTTTGGTTGCCTGCCTGGCCTGTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTTCAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCCCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGGGCTTTTCCTCTTAAGATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_frutescens_subsp_glandulosa ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAAAGCAAAAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTGCTACGCGCACACCGCAAACGGGGCACGATAGCACGGGCCCTTTAAGTTTAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCCCCACATGTGTGGGGGAAACATGAACATACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTCCCCCGCAAGGCCAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCTCTTTCTGCTTTTGGTTGCCTGCCTGGCCTGTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCTGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTTCAGGGTATTGTCCCGA{GT}CGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCCCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAGATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_halimifolia_1 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACGCACGACA{CT}GAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTAC{AG}CGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCGCCACATGTGTGGGGCAGACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCAACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCTGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCATCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_halimifolia_2 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCACCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCACACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAACCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACATACTACGCGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCGCCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCAACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTC{AG}TGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCATCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_hispida ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCACCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGACCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCATTTTAGGTTTACAAAGAGGTCACGTACTACGCGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCGCCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTTGCTTTGTTCCCCACAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCTTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTTGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCCGATTGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAACGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_palmeri_1 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACGCACGACATGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACACGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCGCCACATGTGTGGGGCAGACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCAACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCATCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_palmeri_3 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCACCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACATACTAC{AG}CGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTG{AT}GTCAAC--GACATCCATGCTGCGCCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTC{AG}ACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGC{AG}TATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCTCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTAGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_ravenii ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-TAGAGCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCAACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACGCGCACACCGCAAACGGGGCGTGATAGCACGGCGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GATATCCATGCTGCCCCACATGTGTGGGGGAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCCAGCTGTTTTCACTTGTTCAC{AT}GGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTTCAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTAT{AT}GTGGGCATGGGGTCT{CT}TGGATCCTTGTTTTGCCCTCGTGTAGCGT{GT}TGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAAT{AT}GGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCT{AT}AGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_resinifera_1 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAAAGCAAAAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACACACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACGCGCACACCGCAAACGGGGCACGATAGCACGGGCCCTTTAAGTTTAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCCCCACATGTGTGGGGGAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTCCCCCGCAAGGCCAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCTCTTTCTGCTTTTGGTTGCCTGCCTGGCCTGTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGTGGGTTTCGTGTGTTGCCTACCTACTTCAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCCCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAGATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGTCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_resinifera_2 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAAAGCAAAAGGGTGTTC-AAGAGCATCTGCACTCAAGAAAGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCATAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTTCGCGCACACCGCAAACGGGGCACGATAGCACGGGCCCTTTAAGTTTAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCTCCACATGTGTGAGGGAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTCCCCCGCAAGGCCAGCTGTTTTTACTTATTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCTCTTTCTGCTTTTGGTTGCCTGCCTGGCCTGTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTTCAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCTTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCCCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAGATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGATGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_ventorum_1 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACGCGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCACCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGTTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_virginensis_2 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAAAGCAAAAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACGCGCACACCGCAAACGGGGCACGATAGCACGGGCCCTTTAAGTTTAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCCCCACATGTGTGGGGGAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTCCCCCGCAAGGCCAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCTCTTTCTGCTTTTGGTTGCCTGCCTGGCCTGTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGTGGGTTTCGTGTGTTGCCTACCTACTTCAGGGTATTGTCCCGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACC{AG}CATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCCCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAGATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGTCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_x_laciniata_1 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-TAGAGCATATGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCATAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACACGCACACCGCAAACGGGGCGGGATAGCACGGGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGC{AG}CCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTTGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCTGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Encelia_x_laciniata_2 ACCTGGGGTCGCGATCGAAGCATCATCGCAAGACAACGCGACAGGGTGTTC-AAGAGCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCGCACCGTAGGCACGGGAGACCAATCTCCGCCCCGACCCAAGACATCCCCGAAA-GTGATGGTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACTACACGCACACCGCAAACGGGGCGGGATAGCACGAGGCCTTTAAGTTGAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCGCCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGATCATAACAAAAGCTTT-----GTTCCCCGCAAGGCTAGCTGTTTCTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCCTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTATTCAGATGTTTGCTTTGGCGTATACTGCCAATGCAGGTTGCGGGTTTCGTGTGTTGCCTACCTACTCTAGGGTATTGTCCTGATCGATCGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCCGTCTCTTTGCACCACATCATTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTATTGTGGGCATGGGGTCTCTGGATCCTTGTTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGACTTCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAATCACTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Enceliopsis_argophylla ACCTGGGGTCGCGATCGAAGCGTCATCGCAAGACAACACCACAGGGTACTT-AAGATGATCTGCACTCAAGAATGAACACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCATGAGGAGACTCCTATTTAGGCCAACCACACCATAGGCACGGGAGACCAATCTCCGCCCCAGCCCACAACATCCCTAAAA-GTGATGTTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACGACACGCACACCGTAAACGGGGCGCGATAGCACAGGCCCTTTAAGTTTAGTTTTCCTTGGCACTTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GGCATCCAAGCTGCCCCACATGTGCGGGGCAAACATGAACACACGTCAACAA-TGCCTCACGAGGCTCAAAACAAAAGCTTT-----GAGCCCCGCAAGGCCAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCTTGCCTGGCCTCTTGGCGTAAGGTGGGTGGTCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTACGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCTACCCGGCTTACCTTTTCAGATGTTTGCTTTGGCTTCGACTGCCAATGCAGAATGTGGGTTTCATGTGTTGCCTACCTACGTCATGGTATTGTCCCGACGAATTGAAGTTGCTTTCGTCTTGTGTCATTCAAATGGCATCAGATGAACATTGAAGCTGTCTCTTTGCACCACATCGTTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATTGGTTGGTATCTTGGATACGGAACCTGATGTGGGCATGGGGTCTCTGGATCCTTGTTCTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGTCTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGCATTCATTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Enceliopsis_covillei ACCTGGGGTCGCGATCGATGCGTCATCGCAAGACAACACCACAGGGTATCT-AAGATGATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCATGAGGAGACTCCTATTTAGGCCAACCACACCATAGGCACGGGAGACCAATCTCCGCCCCAGCCCACAACATCCCCAAAA-GTGATGTTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACGACACGCACACCGTAAACGGGGCGCGATAGCAGAGGCCCTTTAAGTTTAGTTTTCCTTGGCACTTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCCCCACATGTGCGGGGCGAACATGAACACACGTCAACAA-TGCCTCACGAGGCCCAAAACAAAAGCTTT-----GAGCCCCGCAAGGCCAGCTGTTTTTACTTGTTCACGGGTC{AG}TTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCTTGCCTGGCCTCTTGGCGTAAGGTGGGTGGTCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTACGGGTGGTTGGCTCTTTGCTTGTGCAACAACGGCTACCCGGCTTACCTTTTCAGATGTTTGCTTTGGCTTCGACTGCCAATGCAGAATGTGGGTTTCTTGTGTTGCCTACCTACGTCATGGTATTGTCTCGATGGATTGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCTGTCTCTTTGCACCACATCGTTAATGCTTGTGTTGATGTTGTGGCTCATTGAGCATTGGTTGGTATCTTGGATACGGAACCTGATGTGGGCATGGGGTCTCTGGATCCTTGTTCTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGTCTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGCATTCATTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Enceliopsis_nudicaulis_1 ACCTGGGGTCGCGATCGATGCGTCATCGCAAGACAACACCACAGGGTATCT-AAGATGATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCATGAGGAGACTCCTATTTAGGCCAACCACACCATAGGCACGGGAGACCAATCTCCGCCCCAGCCCACAACATCCCCAAAA-GTGATGTTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACGACACGCACACCGTAAACGGGGCGCGATAGCAGAGGCCCTTTAAGTTTAGTTTTCCTTGGCACTTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCATGCTGCCCCACATGTGCGGGGCGAACATGAACACACGTCAACAA-TGCCTCACGAGGCCCAAAACAAAAGCTTT-----GAGCCCCGCAAGGCCAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCTTGCCTGGCCTCTTGGCGTAAGGTGGGTGGTCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTACGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCTACCCGGCTTACCTTTTCAGATGTTTGCTTTGGCTTCGACTGCCAATGCAGAATGTGGGTTTCTTGTGTTGCCTACCTACGTCATGGTATTGTCTCGATGGATTGAAGTTGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCTGTCTCTTTGCACCACATCGTTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATTGGTTGGTATCTTGGATACGGAACCTGATGTGGGCATGGGGTCTCTGGATCCTTGTTCTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGTCTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGCATTCATTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Enceliopsis_nudicaulis_2 ACCTGGGGTCGCGATCGAAGCGTCATCGCAAGACAACACCACAGGGTATTT-AAGATGATCTGCACTCAAGAATGAACACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCATGAGGAGACTCCTATTTAGGCCAACCACACCATAGGCACGGGAGACCAATCTCCGCCCCAGCCCACAACATCCCCAAAA-GTGATGTTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACGTACGACACGCACACCGTAAACGGGGCGCGATAGCACAGGCCCTTTAAGTTTAGTTTTCCTTGGCACTTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCAAGCTGCCCCACATGTGCGGGGCAAACATGAACACACGTCAACAA-TGCCTCACGAGGCTCAAAACAAAAGCTTT-----GAGCCCCGCAAGGCCAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCTTGCCTGGCCTCTTGGCGTAAGGTGGGTGGTCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTACGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCTACCCGGCTTACCTTTTCAGATGTTTGCTTTGGCTTCGACTGCCAATGCAGAATGTGGGTTTCATGTGTTGCCTACCTACGTCATGGTATTGTCCCGATGGATTGAAGTTGCTTTCGTCTTGTGTCATTCACCTGGCATCAGATGAACATTGAAGCTGTCTCTTTGCACCACATCGTTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCATTGGTTGGTATCTTGGATACGGAACCTGATGTGGGCATGGGGTCTCTGGATCCTTGTTCTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGTCTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGCATTCATTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Enceliopsis_nutans_1 ACCTGGGGTCGCGATCGAAGCGTCATCGCAAGACAACACCACAGGGTATCA-AAGATCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCATGAGGAGACTCCTATTTAGGCCAACCACACCATAGGCACGGGAGACCAATCTCCGCCCCGACCCACAACATCCCCAAAA-GTGATGTTTGGGAGGGGCGACATGATGCGTGACGCCCAGGCAGACGTGCCCTCAACCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTACAAAGAGGTCACATACGACGCACACACCGAAAACGGGGCGCGACTGCACATGCCCTTTAAGTTTAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--AATATCCATGCTACCCCACATGCGTGGGGCAAACATGAACACACGTCAACGA-CGCCTCACAAGGCTCAAAACAAAAGCTTT-----GAGCCCAGTGCGGCCAGCTGTTTTTACTTGTTCACGGGTTGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATTGCTTTCTGCTTTTGGTTGCTTGCCTGGCCT{CG}TTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGAATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTACGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCTGGCTTACCTTTTCAGATGTTTGCTTTGGCTACGACTGCCAATGCAGAATGCGGGTTTCATGTGTTGCCTACCTACGTCATGGTATTGTCCTGATCGATTGAAGTCGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCTGTCTCTTTGCACCACATCGTTAATGCTTGCGTTGATGTTGTGGCTCATTGAGCCTCGGCTGGTATCTTGGATACGGAACCTGATGTGGGCATGGGATCTCCGGATCCTTGTTCTGCCCTCGTGTAGCGTGTGTGCTTTTCCTCTTAAAATGTTTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGCA-TCATTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTATCGTCAAAGAGGAGTGCTACCTGGTTGATCCTGCC Flourensia_stenophylla ACCTGGGGTTGCCATCGATGCATCATCGCAAGATAACACGACAGGGTATTT-AGAAGCATCTGCACTCAAGAATGAAAACGCACGCACGAGACG-ACTGTCTTATCAACCACCACTAGCCGTGCGTCCTTCCTGACGAGACTCCTATTTAGGCCAACCACACCATAGGCACGGAAGACCAATCTCCGCTCCGACCCAAGACATCCCTGAAAAGGGATGTTTGGTGGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTGCGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAAGTTTACAAAGAGGTCACGTACGACGCGCACACCGCAAACGGGGCGCGATAGCACGAGCCCTTTAAGTTTAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAACCTGACATCCATGATGCCCCACATACATGGGGCAAACATGAACACACGTCAACGGGTGCCTCACGAGGCTCAAAACAAAAGCTTC-----GTTCCCCGTGAGGCCAGTTGTTTTTACTTGTTCACAGGTCGTTCTGCTGTGCAGGATTCGACAATGATCCTTCCGCAGGTTCA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Geraea_canescens_1 ACCTGGGGTCGCGATCGAAGCATCGTCGCAAGACAACGCCACAGGGTATTT-AAGAGCATCTGCACTCAAGAATGAAAACGCACGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCCTGAGGAGACTCCTATTTAGGCCAACCACACCGTAGGCACGGGAGACCAATCTCCGCCC-GACCCACAGCATCCCCGAAA-GTGATGTTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGAATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAAGTTTACAAAGAGGCCACGTACGACGCGCACACCGAAAGCGGGGCGCGAAAGCACATGCCCTTTAAGTTTAGTTTTCCTTGGCACGTGTCGTGCCGGGGGTTTGTTAGTGTGTCAAC--GACATCCGTGCTGCCCCACATGTGCAGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGCTCAAAACAAAGGCTCT-----GAGCCCCGCTAGGCGAGCTGTTTTTACTTGTTCACGGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCCTTTTGCTTTTGGTTGCTTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGGATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTATGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTTCTCAGATCTTTGCTTTGGCTTCGACCGCCAATGCAGAATGCGGGTTTCGTGTGTTGCCTACCTACGTCATGGTATTGTCCCGATCGATTGAAGTCGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGAAGCTGTCTCTTTGCACCACATCGTTAACGCTTGCGTTGATGTTGTGGCTCATTGAGCATCAGCTGGTATCTTGGATACGGAACCTGATGTGGGCATGGGGTCTATGGATCCCTATTCTGCCCTCGTGTAGCGTTTGCACTTTTCCTCTTAAAATGTTTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGCA-TCGTTGAAGAGGAATGTTGTGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGTAT-GTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Geraea_viscida ACCTGGGGTCGCGATCGAAGCATCGTCACAAGACAACGCCACAGGGTATTT-AAGAGCATCTGCACTCAAGAGTGAAAACGCATGACACGAGACGACTGTCTTATCAACCACCACTAGCCGTGCGTCCCTCATGAAGAGACTCCTATTTAGGCCAACCACACCATAGGCACGGGAGACCAATCTCCGCCCCGACCCACAACATCCCCGAAA-GTGAAGTTTGGGAGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAGCCGGATGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGTTG-CCGAGAGTCGTTTTAGGTTTAGAAAGAGGTCACGTACGACGCGCACACCGCAAACGGGGCGCGAACGCACAGGCCCTTTAAGTTTAGTTTTCCTTGGCACGTGTCGTGCCGGGGGGTTGTTAGTGTGTCAAC--GACATCCATGCTGCCCCACATGTGTGGGGCAAACATGAACACACGTCAACGA-TGCCTCACGAGGCTCAAAACAAAAGCTTT-----AAGCCCCGCTAGGCTAGCTGTTTTTACTTGTTCACAGGTCGTTCTGCTGTGCAGGTTTCGACAATGATCCTTCCGCAGGTTCATCGCTTTCTGCTTTTGGTTGCTTGCCTGGCCTCTTGGCGTAAGGTGGGTGGCCTCTTGCCGGGTGGTCTTCGGGGATGTCGACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGTTACGGGTGGTTGGCTCTTTGCTTGTGCAACAACTGCCACCCGGCTTACCTTTTCAGATCTTTGCTTTGGCTTCAACTGCCAATGCAGAATGCGGGTTTCGTGTGTTGCCTACCTACGCAATGGTATTGTCCCGATCGATTGAAGTCGCTTTCGTCTTGTGTCATTCACATGGCATCAGATGAACATTGGAGCTGTCTCTTTGCACCACATCGTTCGTCCATGTGCTAATGTTGTGGCTCATTGAGCATCGGTTGGTATCCTGGATACGGAACCTAATGTGGGCATGGGGTCTCTGGATCCTTATTTTGCCCTCGTGTAGCGTTTGCGCTTTTCCTCTTAAAATGTTTGCCTAGCCCGAATTGGCTCGTACCACCGGGTGGGCA-TCATTAAAGAGGAATGCCGCGCTTCTCTTAGAATGACTGCCTAGCCCGAATTGGCTCGTACCATCGGGTGGGTATCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCC Simsia_calva ACCTGGGGTCGCGATCGAAGCATCGTCAAAAGACAACACATCAGGTTATTT-AAGAGCATCTACACTCAAGAAAGTAAACGCACAACACGAGACGACGGTCTTATCAACCACCACTAGCCGTGCGTCCCTCATGAGGAGACTCCTATTTAGGCCAACCACGCCATGGGCACAGGAGACCAATCTCCGCCCCAACACAAAACAGCCCTAGAAAGG-ATGCCTGGTGGGGGCGACGTGATGCGTGACGCCCAGGCAGACGTGCCCTCAACCAGAAGGCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTGGCTACGTTCTTCATCGATGCGTGAGCCGAGATATCCGGTGGCCGAGAGTCGTTTTAAGTTTACAAAGAAGCCACGTCCGACACGCACACCGAAAACGGGGCGCACCTGAACAGGCCCTTTAATTTTTGTTTTCCTTGGCACGTCTCGTGCCGGGGGTTTGTTATTTCGTCGACATGACATCCATGATGCACCAAATGTATGGGGCATCCATGAACGCACGTCGACAAG-GCCTCACGAGTCCCGAAACAAATGCTTC-----GGACCAAGCAAGGCCAGATGTGTTAACTTGTTCACGGGTCGTTCTGCTGTGCAGGGTTCGACAATGATCCTTCCGCAGGTTCA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ; END; BEGIN TREES; TITLE Tb8178; LINK TAXA = Taxa1; TRANSLATE 1 Simsia_calva, 2 Bahiopsis_sp, 3 Flourensia_stenophylla, 4 Geraea_canescens_1, 5 Geraea_viscida, 6 Enceliopsis_nutans_1, 7 Enceliopsis_nudicaulis_2, 8 Enceliopsis_nudicaulis_1, 9 Enceliopsis_covillei, 10 Enceliopsis_argophylla, 11 Encelia_farinosa_var_phenicodonta, 12 Encelia_farinosa_var_radians, 13 Encelia_farinosa_var_farinosa, 14 Encelia_virginensis_2, 15 Encelia_ventorum_1, 16 Encelia_resinifera_1, 17 Encelia_resinifera_2, 18 Encelia_ravenii, 19 Encelia_palmeri_3, 20 Encelia_palmeri_1, 21 Encelia_x_laciniata_1, 22 Encelia_x_laciniata_2, 23 Encelia_halimifolia_1, 24 Encelia_halimifolia_2, 25 Encelia_frutescens_subsp_glandulosa, 26 Encelia_frutescens_2, 27 Encelia_densifolia, 28 Encelia_conspersa, 29 Encelia_hispida, 30 Encelia_canescens, 31 Encelia_californica, 32 Encelia_asperifolia_1, 33 Encelia_actonii_2, 34 Encelia_actonii_1; TREE Fig._1 = [&R] ((((((34,33,25,17,(16,14)),26),((((((32,22),(23,20)),((30,29),((28,24),19)),27,11),(15,(21,(13,12)))),31),18))Encelia,((((10,7),(9,8)),6)Enceliopsis,(5,4)Geraea)),3),(2,1)); END; BEGIN TREES; TITLE Tb8179; LINK TAXA = Taxa2; TRANSLATE 1 Geraea_canescens_1, 2 Geraea_viscida, 3 Enceliopsis_nutans_2, 4 Enceliopsis_nudicaulis_2, 5 Enceliopsis_nudicaulis_1, 6 Enceliopsis_covillei, 7 Enceliopsis_argophylla, 8 Encelia_farinosa_var_phenicodonta, 9 Encelia_farinosa_var_radians, 10 Encelia_farinosa_var_farinosa, 11 Encelia_virginensis_1, 12 Encelia_ventorum_1, 13 Encelia_ventorum_2, 14 Encelia_resinifera_2, 15 Encelia_ravenii, 16 Encelia_palmeri_3, 17 Encelia_palmeri_1, 18 Encelia_x_laciniata_2, 19 Encelia_halimifolia_2, 20 Encelia_frutescens_subsp_glandulosa, 21 Encelia_frutescens_1, 22 Encelia_densifolia, 23 Encelia_conspersa, 24 Encelia_hispida, 25 Encelia_canescens, 26 Encelia_californica, 27 Encelia_asperifolia_1, 28 Encelia_asperifolia_2, 29 Encelia_actonii_1; TREE Fig._2 = [&R] (((29,(28,12),27,(26,25,24,23,22,19,17,(16,13),10,9),21,18,15,14,11,8),20)Encelia,((7,6,5,4),3,(2,1)Geraea)); END;