#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:29 GMT TreeBASE (cc) 1994-2008 Study reference: Rong C., Ma Y., Wang S., Liu Y., Wang L., Ma K., Dou S., Yang Y., & Xu F. 2016. Penicillium chroogomphum, a new species in Penicillium section Ramosa isolated from fruiting bodies of Chroogomphus rutilus in China. Mycoscience, 57(1): 79-84. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17299] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=14; TAXLABELS Penicillium_jamesonlandense_CBS_102888 Penicillium_kojigenum_CBS_345_61 Penicillium_lanosum_CBS_106_11 Penicillium_lenticrescens_CBS_138215 Penicillium_raistrickii_CBS_261_33 Penicillium_ribeum_CBS_127809 Penicillium_sajarovii_CBS_277_83 Penicillium_scabrosum_CBS_683_89 Penicillium_simile_CBS_129191 Penicillium_soppii_CBS_226_28 Penicillium_sp_JZB2120005 Penicillium_sp_JZB2120023 Penicillium_swiecickii_CBS_119391 Penicillium_virgatum_CBS_114838 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=18; TAXLABELS Penicillium_brevicompactum_NRRL_2011 Penicillium_jamesonlandense_CBS_102888 Penicillium_kojigenum_CBS_345_61 Penicillium_lanosum_CBS_106_11 Penicillium_lenticrescens_CBS_138215 Penicillium_madriti_NRRL_3452 Penicillium_mexicanum_DTO_270F1 Penicillium_olsonii_CBS_232_60 Penicillium_raistrickii_CBS_261_33 Penicillium_ribeum_CBS_127809 Penicillium_sajarovii_CBS_277_83 Penicillium_scabrosum_CBS_683_89 Penicillium_simile_CBS_129191 Penicillium_soppii_CBS_226_28 Penicillium_sp_JZB2120005 Penicillium_sp_JZB2120023 Penicillium_swiecickii_CBS_119391 Penicillium_virgatum_CBS_114838 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M36889] TITLE Penicillium_14x1547; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1547; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Penicillium_jamesonlandense_CBS_102888 ???????????CCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-TTATGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATCTC-GAACTCTGTCTGAAGATTGTAGTCTGAGTAAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCCCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAAATTTTTATCCA????????????????????????????????????????TTTTTTTTTCGGTGTTGGGCATCAATTGA-CAAATTGCTAACTGGTTTAAAGGCAAACTATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT--TCAATGTGATAGGATTCCAGGTGAATCAGGCCTCTGATATATTCCTAGGTACAATGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACCTTGAGTGCAATGACCTTGCTTTTTTACAACGTGCGTTGTCTAACCTTCTTTCTTCGACCGCCCAGGCTAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGGCC--GGAACAACTGTTCTCCCTTTTTGTAAGTGACCCCACATA----------------CCGATTGAAGTA-TCTCAATACTGACCG--GCGATTTATCGCA---AAACAGGACAAGGATGGCGATGGTGAGTG--ATCGCGCCCGGCAGCT---------------------------------CAGTTGAGCTCGCA---AGTCGAATCAAAAGCCATTCAACAATCTCCTAACATGCATTCCCCTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCCGAACTGCAGGACATGATCAACGAGGTTGACGCCGACAACAATGGCACCATCGACTTCCCCGGTATTTGCC--ACCACT--------------------------CCCTAGAGCGAAAT---ACAGCC--ATTGACACGTAC---TAGAATTCTTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCCGCCGCTGAGCTCCGCCACGT Penicillium_kojigenum_CBS_345_61 AAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTATGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATCTC-GAACTCTGTCTGAAGATTGTAGTCTGAGTAAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAATTTTTTTTTCGGTGTTGGGCATCAATTGA-CCAATTGCTAACTGGCTTAAAGGCAAACTATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT--TCAATGTTATGGGATTCCAGGTGAATCAGGCCTCTGATATCTTCCTAGGTACAATGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACCCTGG---------------TTTCTTCCAACGTGCGTTGTCTAACCTTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTTT????????????????????????????TTCTCCCTTTTTGTAAGTGACCCCACATA----------------CCGATTGAAGTA-TCTCAATACTGACCG--GCGATTTATCGCA---AAACAGGACAAGGATGGCGATGGTGAGTG--ATCGCGCCCGACAGCT---------------------------------CAGTCGAGCTCGCA---AGTCGAATCAAAAGCCATTTAACAATCCCCTAACATGCATT-CCCTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCCGAACTGCAGGACATGATCAACGAGGTTGACGCCGACAACAATGGCACCATCGACTTCCCCGGTATTTGCC--ACCACT--------------------------CTCCAGAGCGAAAC---ACAGCT--ATTGACACGTAC---TAGAATTCTTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAAGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCCGCCGCTGAGCTCCGCCACGT Penicillium_lanosum_CBS_106_11 ???????????CCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTATGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATCTC-GAACTCTGTCTGAAGATTGTAGTCTGAGTAAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAATTTTTATCCA????????????????????????????????????????TTTTTTTTTCGGTGTTGGGCATCAATTGA-CCAATTGCTAACTGGCTTAAAGGCAAACTATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT--TCAATGTTATGGGATTCCAGGTGAATCAGGCCTCTGATATCTTCCTAGGTACAATGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACCCTGG---------------TTTCTTCCAACGTGCGTTGTCTAACCTTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAATCCGGTGCCGGTAACAACTG????????????GTAAGTGACCCCACATA----------------CCGATTGAAGTA-TCTCAATACTGACCG--GCGATTTATCGCA---AAACAGGACAAGGATGGCGATGGTGAGTG--ATCGCGCCCGACAGCT---------------------------------CAGTCGAGCTCGCA---AGTCGAATCAAAAGCCATTTAACAATCCCCTAACATGCATT-CCCTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCCGAACTGCAGGACATGATCAACGAGGTTGACGCCGACAACAATGGCACCATCGACTTCCCCGGTATTTGCC--ACCACT--------------------------CTCCAGAGCGAAAC---ACAGCT--ATTGACACGTAC---TAGAATTCTTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAAGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCCGCCGCTGAGCTCCGCCACGT Penicillium_lenticrescens_CBS_138215 AAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTTGGCGGGCCCGCC-TCACGGCCGCCGGGGGGCTTTTGCCCCCGGGCCCGTGCCCG-CCGAAGACACCTA-GAACTCTGTCTGAAGATTGTCGTCTGAGTATAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAATTTTT-TCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAATTTTCCCTGCCGTGTTGGGAATCAATTGAGCAGCTTGCTAACTGGTTTACAGGCAGACCATCTCCGGTGAGCACGGTCTCGATGGTGATGGACAGTAAGTTCTCCATGTGAT-GGACTCAAGATGATTCGGGCCTCTGATCTCTCGTTAGGTACAATGGTACTTCCGACCTCCAGCTTGAGCGTATGAACGTTTACTTCAACCATGTGAGTACAATGCTTACAA---------------TGTCTTCCAACGTGTATCGTCTAACCTTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTCGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCACCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGTGCTGGTAACAACTGTTCTCCCTCTTTGTAAGTGATCCCACATA----------------CCAGCTGAACGATTCCAAATACTGAACA--GTGATCTATCGGA---AAACAGGACAAGGATGGTGATGGTGAGTG--AACGCGCTCGATAGCC---------------------------------CAGTTGAGTTCGCA---ACTCGAATTA------GCCCACAATT---CTAACATGTAA--TTCCAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATCGACTTCCCTGGTATGGCCC---CCACCTCTTATCAGCCCCCCTCCCA--CCTCCCTCAAAA---------ACGGCC--ATTGACAAACGA---TAGAATTCTTGACCATGATGGCCCGCAAGATGAAGGACACTGATTCCGAGGAGGAGATCCGCGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGCTTCATCTCCGCCGCTGAGCTGCGCCACG? Penicillium_raistrickii_CBS_261_33 ?????????????GAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTCAGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATCTC-GAACTCTGTCTGAAGATTGTAGTCTGAGTATAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAATTTTTATCCAGGTTGACCTCGGATCAG???????????????????????TTTTTTTTTCGGTGTTGGGTATCAATTGA-CAAATTGCTAACTGGTTTATAGGCAAACCATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT--TCAATGAGATGGGATTCCAGTTGAATCAGACCTCTGATATCTACCTAGGTACAACGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTAGAATTGCTTTGA---------------TTTCTAA-ATCGTGCGTTGTCTAACCTTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAATACGTCCCCCGTGCTGTCCTCGTCGATTTGGAGCCCGGTACCATGGACGCCGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGTCCCGACAACTTCGTCT????????????????????????????TTCTCCCTTTTCGTAAGTGACCCCGCATA----------------CCGATTGAAG----GCAATCACTGACCG--GCGATTTTTGGC----AAACAGGATAAGGATGGCGATGGTGAGTG--ATCACGCT-----------------------------------------CAGCTGAGCTCGCA---AGTCGAAATTTAACGGGGCAACAAATCCTCTAACATGCAAC-CCCTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAATCCCTCCGAGTCCGAATTGCAAGATATGATCAACGAAGTTGACGCCGATAACAACGGCACCATCGACTTCCCCGGTATTTACC--ACTTCC------------------------TTGCCCAGAGCGAAGA---ACAGCTAGATTGACAAGTAC---TAGAATTCTTGACCATGATGGCCCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCCGCCGCCGAGCTGCGCCACGT Penicillium_ribeum_CBS_127809 ???????????CCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTATGGCCGCCGGGGGGCATCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATCTC-GAACTCTGTCTGAAGATTGTAGTCTGAGTCAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAATTTTTATCCA????????????????????????????????????????TTTTTTTTTCGGTGTTGGGCATCAATTGA-CAAATTGCTAACTGGTTTAAAGGCAAACCATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT--TCAATGTGATGAGATTCTAGGTGAATCAGGCCTCTGATATCTTACTAGGTACAACGGTACCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGGCCATGG---------------CTTCTACCAACTTGCGTCGTCTAACCTTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGTGCCGGTAACAACTGTTCTCCCTCTTTGTAAGTGAACCCACATA----------------CCGATTGAAGCA-TCTCAATACTGACCG--GCGATTTATCGCA---ACACAGGACAAGGATGGCGATGGTTAGTG--ATCGCGCCCGACAGCT---------------------------------CAGTTGAGCTCGCA---AGTCGAATCAAAAGCCGTTCAACAAATTCCTAACATGCATTCTCCTAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCTGAGTCTGAACTGCAGGACATGATCAACGAGGTTGACGCCGATAACAACGGCACCATCGATTTCCCCGGTAATTGCC--ACCACT----------------------------CCCGAGCGAAAT---ACAGCT--ATTGATACGTAT---TAGAATTCTTGACTATGATGGCTCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCTGCCGCTGAGCTGCGCCACGT Penicillium_sajarovii_CBS_277_83 AAGGATCATTACTGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTAAGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATCTC-GAACTCTGTCTGAAGATTGTAGTCTGAGTATAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAATTTTTATCCAG????????????????????????????????????????????????????GTTGGGTATCAATTGA-CAAATTGCTAACTGGTTTATAGGCAAACCATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT--TCAATGAGATAAGATTCCAGTTGAATCAGACCTCTGATATCTTCCTAGGTACAACGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTAGAATTGCTTTGA---------------TTTTTAA-ATCGTGCGTTGTCTAACCTTCTTTCTTTGACCGCTCAGGCTAGCGGTGACAAATACGTCCCCCGTGCTGTCCTCGTCGATTTGGAGCCCGGTACCATGGATGCCGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGTCCCGACAACTTCGTCT????????????????????????????TTCTCCCTGTTTGTGAGTGCTCCTGGACGCGTCCATTGACAATCTCCGATCGGAAAA-ACATTAGACTGACCAGTGCGGGTTTCCGCGTGTGAATAGGACAAGGATGGCGATGGTGCGTGCAGCCTTATTCGATAGCTCGAACGTGCAATTCTAAGGAGCAGTTCTGGAGCCATTTGAACCCGCG---AATATTCTCAAAACAGAATCATTGA----CTTAGTTTCGAT-GTCTAGGCCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACCATCGACTTCCCCGGTATGCACTGAACTGCTCGGCAATGGATGTCGCTCTTTTCTCTATTTAACCCAGACT--AACTGCT---TTCCCGTGCACCTGCAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGATACCGACTCAGAGGAGGAGATCCGGGAGGCGTTCAAGGTGTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGCCACGT Penicillium_scabrosum_CBS_683_89 ???????????CCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTATGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGTGCCCG-CCGAAGACACCTA-GAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGCCCCCCGATCCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAACTTTTTTCCA????????????????????????????????????????TTTTTTTCCCGGTATCGGGCATCAATTGA-CAAATTGCTAACTGGTTTAAAGGCAGACTATCTCCGGCGAGCACGGTCTCGATGGCGATGGACAGTAAGT--TCAACCTGATGGGATGCT-GGTGAATCAGACCTCTGATATCTTCCTAGGTACAACGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTTTACTTCAACCATGTGAGTACAATGATTATGA---------------TTTCTTTTTACGTGCGTTGTCTAACCTTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAGTATGTCCCCCGTGCTGTCCTCGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGATAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTG????????????GTAAGTGACCCCACATA----------------CCGATTGAAGTA-TCTCAATACTGACCG--GTGATTTTCC------ACACAGGACAAGGATGGCGATGGTGAGTG--ATCGCGCCT----------------------------------------CAGTCGAGCTCATT-TTGCCCGATTC--------------------CTAACATGCA-----CTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCCCTGGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGACATGATCAACGAGGTTGACGCCGATAACAACGGCACCATCGACTTCCCCGGTATTTGCC--ACCACC-------------------------TCCCCAGAGCGAAAT---ACAGCT--GTTGACACGTAC---TAGAATTCTTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGCGAAGCATTCAAGGTGTTCGATCGCGATAACAACGGCTTCATCTCCGCCGCTGAGCTGCGCCACGT Penicillium_simile_CBS_129191 ??????????????????????CCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTAAGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATCTC-GAACTCTGTCTGAAGATTGTAGTCTGAGTATAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAAATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA??????????GGTGTTGGGTATCAATTGA-CAAATTGCTAACTGGTTAATAGGCAAACCATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT--TCAATATGATAGGATTCCAGTTGAATCAGACCTCTGATATCTTCCTAGGTACAACGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGGCCTGGT---------------TTCCTTA-ACCGTGCGTCGTCTAACCTTCTTTCTTTGACCGCTCAGGCTAGCGGTGACAAATACGTCCCCCGTGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGTCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGTTCTCCCTTTTCGTAAGTGACCCCACATA----------------CCGATTGAAT----TCACTCACTGACCG--GCGATTTGTGGC----AAACAGGATAAGGATGGCGATGGTGAGTG--ATCGCGC------GCT---------------------------------CAGCTGAGCTCGCA---AGTCGAAAATCAAGCGGGCAACAAATCCCCTAACATGTAAT-CCCTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCCGAATTGCAGGATATGATCAACGAGGTTGACGCCGATAACAACGGCACCATCGACTTCCCTGGTATTTGCC--ACTCCCCTGAGTGAA---------------------AGAGTGAAAG---ATAGCTAGATTGACACGTCC---TAGAATTCTTGACCATGATGGCCCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCCGCCGCCGAGCTGCGTCACGT Penicillium_soppii_CBS_226_28 AAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTTGGCGGGCCCGCC-TCACGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGTGCCCG-CCGAAGACACCTTAGAACTCTGTCTGAAGATTGTAGTCTGAGTAAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAATTTTT-TCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAATTTTTTTTTTCGTGTTGGGGATCAATTGA-CAACCTGCTAACTGGTTTACAGGCAGACCATCTCTGGTGAACACGGTCTCGATGGTGATGGACAGTAAGTTCTCAACGTGAT-GGATTCCA{AG}ATGATTCAGGCCTCTGATCTCTCGTTAGGTACAATGGTACCTCCGACCTCCAGCTTGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGATTACAA---------------TATACTCCAGCGTGCATCGTCTAACCTTCTTTCTTTGACCGCTCAGGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTCGTC{AG}ATTTGGAGCCCGGTACCATGGACGCCGTCCGCACCGGTCCCTTCGGCAAGCTCTTCCGCCCC{AG}ACAACTTCGTCTTCGGTCAATCCGGTGCC????????????????????????????????????????------------------------------TCAA-CACTAACCA--GCGATCTATCGCA---AAACAGGACAAGGATGGTGATGGTGAGTG--ATCGCGCTCGTCAGCT---------------------------------CAGTCGAGTTCGCA---ACTCGAATTG------GCCCGAAAAT---CTAACATGTCAT--CCCAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGACAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATCGACTTCCCCGGTATGCCCC--CCCCCCCGTTATCAGCCC---------CCTCCCCCCAAAAA--------CCTGCC--ATTGACAAGCGA---TAGAATTCTTGACCATGATGGCCCGCAAGATGAAGGATACTGATTCCGAGGAGGAGATCCGCGAAGCGTTCAAGG???????????????????????????????????????????????????? Penicillium_sp_JZB2120005 ????GACATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTTGGCGGGCCCGCC-TCACGGCCGCCGGGGGGCTTCTGCCCTCGGGCCCGTGCCCGCCCAAAGACCTCTT-GAACTCTGTCTGAAGATTGTCGTCTGAGTG-AGATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCCCCGCTCCCGGGGGACGGGTCCGAAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCCGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAACTTCT-TCCAGG-TGACCTCGAT????????????????????????????????????????????????????TTGA-CAGTTTGCTAACTGGTTTACAGGCAGACCATCTCTGGTGAGCACGGTCTCGATGGTGATGGACAGTAAGTTCTCGATGTGAT-GGATTCAAGATGATTCAGGCCTCTGATTTCTCATTAGGTACAATGGTACCTCCGACCTCCAGCTTGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGATTACAT---------------TATCTTCCAACGTATATCGTCTAACCTTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTCGTTGACTTGGAGCCTGGTACCATGGACGCTGTCCGTACCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGTGCTGGTAACAACTG??????????????????GATCCCACATA----------------GCAGCTGAACGG-TCTAAATACTGATC---------TATCGGA---AAACAGGACAAGGATGGTGATGGTGAGTG--ATCGCGCTTCACAGCT---------------------------------CAGTCGAGTTCGCA---ACTCGAATTA------GCCCAAAAAT---CTAACCTAA----TTCCAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAATCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATCGACTTCCCCGGTATGGCCC--CCCACCCCTTATCAGCCCCCCTCACATCCCCCCCCCAAA----------ACGGCA--ATTGACAAGCGA---TAGAATTCTTGACCATGATGGCCCGCAAGATGAAGGACACCGATTCCGAGGAGGAGATTCGCGAAGCGTTCAAAGTGTTCGATCGCGACAACAACGGCTTCATATCCGCCGCCGAGCTGCGCCACGT Penicillium_sp_JZB2120023 ????GACATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTTGGCGGGCCCGCC-TCACGGCCGCCGGGGGGCTTCTGCCCTCGGGCCCGTGCCCGCCCAAAGACCTCTT-GAACTCTGTCTGAAGATTGTCGTCTGAGTG-AGATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCCCCGCTCCCGGGGGACGGGTCCGAAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCCGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAACTTCT-TCCAGG-TGACCTCGAT????????????????????????????????????????????????????TTGA-CAGTTTGCTAACTGGTTTACAGGCAGACCATCTCTGGTGAGCACGGTCTCGATGGTGATGGACAGTAAGTTCTCGATGTGAT-GGATTCAAGATGATTCAGGCCTCTGATTTCTCATTAGGTACAATGGTACCTCCGACCTCCAGCTTGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGATTACAT---------------TATCTTCCAACGTATATCGTCTAACCTTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTCGTTGACTTGGAGCCTGGTACCATGGACGCTGTCCGTACCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGTGCTGGTAACAACTG??????????????????GATCCCACATA----------------GCAGCTGAACGG-TCTAAATACTGATC---------TATCGGA---AAACAGGACAAGGATGGTGATGGTGAGTG--ATCGCGCTTCACAGCT---------------------------------CAGTCGAGTTCGCA---ACTCGAATTA------GCCCAAAAAT---CTAACCTAA----TTCCAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAATCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATCGACTTCCCCGGTATGGCCC--CCCACCCCTTATCAGCCCCCCTCACATCCCCCCCCCAAA----------ACGGCA--ATTGACAAGCGA---TAGAATTCTTGACCATGATGGCCCGCAAGATGAAGGACACCGATTCCGAGGAGGAGATTCGCGAAGCGTTCAAAGTGTTCGATCGCGACAACAACGGCTTCATATCCGCCGCCGAGCTGCGCCACGT Penicillium_swiecickii_CBS_119391 AAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTATGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATCTC-GAACTCTGTCTGAAGATTGTAGTCTGAGTAAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCCCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAATTTTTTTTTCGGTGTTGGGCATCAATTGA-CAAATTGCTAACTGGTTTAAAGGCAAACCATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT--TCAATGTGATAGGATTCCAGGTGAATCAGGCCTCTGACATCTTCCTAGGTACAATGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACCTTGC---------------TTTCTTACAACGTGCGTTGTCTAACCTTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCT????????????????????????????TTCTCCCTTTTTGTAAGTGACCCCACATA----------------TCGATTGAAGTA-TCTAAATACTGACCG--GCGATTTATCGCA---AAACAGGACAAGGATGGCGATGGTGAGTG--ATCGCGCCCGACAGCT---------------------------------CAGTCGAGCTCGCA---AGTCGAATCAAAAGCCATTCAACAATCTCCTAACATGCATTCCCCTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCCGAATTGCAGGACATGATCAACGAGGTTGACGCCGACAACAATGGCACCATCGACTTCCCCGGTATTTGCC--ACCACT--------------------------CCCTAGAGCGAAAT---ACAGCC--ATTGACACGTAC---TAGAATTCTTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCCGCCGCTGAGCTCCGCCACGT Penicillium_virgatum_CBS_114838 AAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCATGTTTATTGTACCTTGTTGCTTCGGCGGGCCCGCCTTTGTGGCCGCCGGGGG--CTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACACCTA-GAACTCTGTCTGAAGATTGCAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGCTCCCGGAGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACC-AAACTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA??TTTTTTTTCGTGTTGGGTATCAATTGA-CATCTTGCTAACTAATTTAAAGGCAAACTATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT--ATAATGTGTTAGGATTCCAGGTGAATCAGGTCTCTGATATCTTGCTAGGTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCAGGTGAGTACAATGGCTGTGA---------------TATCTTTAAATGTGCGTTGTCTAACCTTCTTTCTTTGACCGCTCAGGCTAGCAATGACAAGTACGTTCCCCGTGCCGTTCTGGTCGACTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCGTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCT????????????????????????????TTCTCCCTATTCGTAAGTAACACCAAATA----------------CCGATTGAAGAA-TGTCAACACTGACCG--GCGATTTATCGCG---AACCAGGACAAGGATGGCGATGGTGAGTG--ATCGCGCCCGACAACT---------------------------------CAGCTGAGCTCGCACCCAGTTATATGGAAAGCCATTCAAA----TCCTAACATGCAATTTCCCAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATCGACTTCCCCGGTATTTGCC--ACCATT---------------------------CTCAGAGCGAAACAAAACGGCT--ATTGACAAGCGA---TAGAATTCCTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGTGATAACAACGGTTTCATCTCCGCCGCTGAGCTGCG?????? ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M36890] TITLE Penicillium_18x1575; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1575; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Penicillium_brevicompactum_NRRL_2011 ????????????CGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGAGCCTGCC-TTTTGGCTGCCGGGGGACGTCTGTCCCCGGGTCCGCGCTCG-CCGAAGACACCTTAGAACTCTGTCTGAAGATTGTAGTCTGAGATTAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCC--TTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACCCGCTTTGTAGGACTGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCC-AGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAATTTTCCCGCTATGGCTGGGTATCAATTGA-CAATTT--GCTAACTGGCTCAAAGGCAAACTATCTCCGGCGAGCACGGTCTCGATGGCGATGGACAGTAAGTGGACGACTGTGTTCGAATTA-----CGCGTGTATTGGGTCTGAGATCTTGTTAGGTACAATGGCACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGATGTGA---------------AGAACTCTGGTTGTGCATTTTCTCACC---TCATATTCTTGACCGCCCAGGCTAGTGGTGACAAGTACGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGTGCTGGTAACAACTGTTCTCCCTGTTTGTGAGTAACCCCACGTG----------------TCAGATAAGTGACGGGA----------GCGCTGACCGGCGGTTTT-----TCGTGAAATAGGACAAGGATGGCGATGGTGAGTGAT---CGCG---------------GATCTAACC----TCCAGA-----------------GCGCAATGAAATCCTAATGCAC-CT------------------CCCCAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCCCTGGGCCAGAACCCCTCCGAGTCTGAACTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCCGGTACTTGC------------------------CTCTA-CCCCCCACGA---------------GATCTCAGAG---ACGGCT----ATTGAC-AAACGATCAGAATTCCTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAGGAGGAAATCCGCGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGCTTCATTTCCGCCGCTGAGCTGCGTCACGT Penicillium_jamesonlandense_CBS_102888 ???????????CCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-TTATGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATC-TCGAACTCTGTCTGAAGATTGTAGTCTGAGTAAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCCCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAAATTTTTATCCA????????????????????????????????????????TTTTTTTTTCGGTGTTGGGCATCAATTGA-CAAATT--GCTAACTGGTTTAAAGGCAAACTATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT---TCAATGTGATAGGATTCCA---GGTGAATCAGGCCTCTGATATATTCCTAGGTACAATGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACCTTGAGTGCAATGACCTTGCTTTTTTACAACGTGCGTTGTCTAACC---TTCTTTCTTCGACCGCCCAGGCTAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGGCC--GGAACAACTGTTCTCCCTTTTTGTAAGTGACCCCACATA----------------CCGATTGAAGTATCTCA----------ATACTGACCGGCGATTTA-----TCGCAAAACAGGACAAGGATGGCGATGGTGAGTGAT---CGCGCCCGGCAGCTCAGTTGAGCTCGCA----AGTCGAATCAAAAG-------CCATTCAACAATCTCCTAACATGCATTC-----------------CCCTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCCGAACTGCAGGACATGATCAACGAGGTTGACGCCGACAACAATGGCACCATCGACTTCCCCGGTATTTGC------------------------CACCA-CTCCCT-------------------AGAGCGAAAT---ACAGCC----ATTGAC-ACGTAC-TAGAATTCTTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCCGCCGCTGAGCTCCGCCACGT Penicillium_kojigenum_CBS_345_61 AAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTATGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATC-TCGAACTCTGTCTGAAGATTGTAGTCTGAGTAAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAATTTTTATCC-AGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAATTTTTTTTTCGGTGTTGGGCATCAATTGA-CCAATT--GCTAACTGGCTTAAAGGCAAACTATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT---TCAATGTTATGGGATTCCA---GGTGAATCAGGCCTCTGATATCTTCCTAGGTACAATGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACCCTG---------------GTTTCTTCCAACGTGCGTTGTCTAACC---TTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTTT????????????????????????????TTCTCCCTTTTTGTAAGTGACCCCACATA----------------CCGATTGAAGTATCTCA----------ATACTGACCGGCGATTTA-----TCGCAAAACAGGACAAGGATGGCGATGGTGAGTGAT---CGCGCCCGACAGCTCAGTCGAGCTCGCA----AGTCGAATCAAAAG-------CCATTTAACAATCCCCTAACATGCATT------------------CCCTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCCGAACTGCAGGACATGATCAACGAGGTTGACGCCGACAACAATGGCACCATCGACTTCCCCGGTATTTGC------------------------CACCA-CTCTCC-------------------AGAGCGAAAC---ACAGCT----ATTGAC-ACGTAC-TAGAATTCTTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAAGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCCGCCGCTGAGCTCCGCCACGT Penicillium_lanosum_CBS_106_11 ???????????CCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTATGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATC-TCGAACTCTGTCTGAAGATTGTAGTCTGAGTAAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAATTTTTATCC-A????????????????????????????????????????TTTTTTTTTCGGTGTTGGGCATCAATTGA-CCAATT--GCTAACTGGCTTAAAGGCAAACTATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT---TCAATGTTATGGGATTCCA---GGTGAATCAGGCCTCTGATATCTTCCTAGGTACAATGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACCCTG---------------GTTTCTTCCAACGTGCGTTGTCTAACC---TTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAATCCGGTGCCGGTAACAACTG????????????GTAAGTGACCCCACATA----------------CCGATTGAAGTATCTCA----------ATACTGACCGGCGATTTA-----TCGCAAAACAGGACAAGGATGGCGATGGTGAGTGAT---CGCGCCCGACAGCTCAGTCGAGCTCGCA----AGTCGAATCAAAAG-------CCATTTAACAATCCCCTAACATGCATT------------------CCCTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCCGAACTGCAGGACATGATCAACGAGGTTGACGCCGACAACAATGGCACCATCGACTTCCCCGGTATTTGC------------------------CACCA-CTCTCC-------------------AGAGCGAAAC---ACAGCT----ATTGAC-ACGTAC-TAGAATTCTTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAAGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCCGCCGCTGAGCTCCGCCACGT Penicillium_lenticrescens_CBS_138215 AAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTTGGCGGGCCCGCC-TCACGGCCGCCGGGGGGCTTTTGCCCCCGGGCCCGTGCCCG-CCGAAGACACC-TAGAACTCTGTCTGAAGATTGTCGTCTGAGTATAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAATTTTTT-CC-AGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAATTTTCCCTGCCGTGTTGGGAATCAATTGAGCAGCTT--GCTAACTGGTTTACAGGCAGACCATCTCCGGTGAGCACGGTCTCGATGGTGATGGACAGTAAGTTC-TCCATGTGAT-GGACTCAA---GATGATTCGGGCCTCTGATCTCTCGTTAGGTACAATGGTACTTCCGACCTCCAGCTTGAGCGTATGAACGTTTACTTCAACCATGTGAGTACAATGCTTACA---------------ATGTCTTCCAACGTGTATCGTCTAACC---TTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTCGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCACCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGTGCTGGTAACAACTGTTCTCCCTCTTTGTAAGTGATCCCACATA----------------CCAGCTGAACGATTCCAA---------ATACTGAACAGTGATCTA-----TCGGAAAACAGGACAAGGATGGTGATGGTGAGTGAA---CGCGCTCGATAGCCCAGTTGAGTTCGCA----ACTCGAA----------------TTAGCCCACAATTCTAACATGTAAT-------------------TCCAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATCGACTTCCCTGGTATGGCC------------------------CCCA--CCTCTTATCAGCCCCCCTCCCA-CCTCCCTCAAAA---ACGGCC----ATTGAC-AAACGA-TAGAATTCTTGACCATGATGGCCCGCAAGATGAAGGACACTGATTCCGAGGAGGAGATCCGCGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGCTTCATCTCCGCCGCTGAGCTGCGCCACG? Penicillium_madriti_NRRL_3452 AAGGATCATTACTGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTGTACCTTGTTGCTTCGGCGGGCCCGCCTTTACGGCCGCCGGGGGGCTCACGCTCCCGGGCCCGCGCCCG-CCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGGAATTATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCCCCAATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAACTTTTATCC-AGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAATGAATCTTTTCGTGTTGGGCATCAATTGA-CAAATC--ACTAACTAATCTACAGGCAAACCATCTCTGGCGAGCATGGTCTCGATGGTGATGGACGGTAAGT---GCAATGTTATGGAATCGACACGGGTGGATAAGGCGTCTGATATCTTGCTAGGTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTGTACTTCAACCAGGTGAGTACAATGGTTTGAC--------------AGGTTTCTGCTTGTGCAGCATCTAATT---AGACCTC-TTGACTGCCCAGGCCAGCAGTGACAAGTACGTTCCCCGTGCCGTTCTCGTCGATTTGGAGCCCGGCACCATGGACGCCGTCCGCTCCGGTCCTTTCGGCAAGCTCTTCCGCCCCGATAACTTCGTCT????????????????????????????TTCTCCCTGTTTGTGAGTTCCTCCGCCTG----------------CAGATTGAAGTCTTGGAAATAAGAAACATGCTGACTGGGAGTTTGTTTCGTTGTGCAATAGGACAAGGATGGCGATGGTGAGCAGCCAGAGTGCCCGATAGCTCATTCGAGTCGTGCAC--GATTGAA--------------CACCGGCGACCGATACTAACGATCAATC-----------------CAATAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTGGGTCAGAACCCCTCCGAGTCTGAGTTGCAGGACATGATCAACGAGGTTGATGCCGACAACAACGGCACCATTGACTTCCCCGGTACTGTG------------------------CCATAATCCAATGA----------------CCCAACATGAG---ACTGCT----TCTGAC-TTATGG-TAGAATTTCTTACCATGATGGCTCGCAAGATGAAGGATACGGATTCCGAGGAGGAGATCCGTGAGGCGTTCAAGGTGTTCGATCGCGACAACAACGGATTCATCTCCGCCGCCGAGCTGCGCCACGT Penicillium_mexicanum_DTO_270F1 AAGGATCATTACTGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTGTACCTTGTTGCTTCGGCGGGCCCGCCTTTATGGCCGCCGGGGGGCTTACGCTCCCGGGCCCGCGCCCG-CCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGGAATTGTAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCACATTTTTT-CC-AGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA?????TTTTTCTTGTTGGGCATCAATTGA-CGATTT--ACTAACCGGGTTACAGGCAAACTATCTCTGGCGAGCACGGTCTCGATGGTGATGGACAGTAAGT---TCAATGTGATGGGTTTTGAAATGGTGGATCAGGCAATTGATGTCTTGTCAGATACAATGGCACTTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGGTATAG---------------GTCCAATTCATCGAGCATCATCTAATCGGGTCTTTTTCTTGATAATCTAGGCCAGCGGCGATAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGCACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGATAACTTCGTCTTCGGTCAGTCTGGCGCCGGTAACAACTGTTCTCCCTGTTTGTGAGTAACTCTGCAGG----------------CAGATTAAAAAAGTACAAGTCGAAAATATGCTGACTGGGAGGTTGTT---TTGCGAAACAGGACAAGGATGGCGATGGTGAGTG-----CGATCCGGACAGCTCAGTCAAGCCCACCACAGTGTTGTCTGTCATGAAATTT-CGCCTTCAAAAGATTCTAACATAAAATC-------------CCACCAACAGGACAAATCACCACCAAGGAACTTGGCACCGTCATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGATATGATCAACGAAGTTGATGCCGACAACAATGGCACCATTGACTTCCCCGGTAATTTA------------------------CCTTACCTCCCTGA---------------TCCAAACGGGCG---ACAATT----ATTGACGATCCGG-CAGAGTTCCTCACCATGATGGCTCGTAAGATGAAGGACACTGATTCCGAGGAGGAGATCCGCGAGGCGTTCAAGGTATTCGATCGCGACAACAACGGATTCATCTCCGCCGCCGAGCTGCGCCACG? Penicillium_olsonii_CBS_232_60 ??????????ACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGAGCCTGCC-TTCGGGCTGCCGGGGGGCATCTGCCCCCGGGTCCGCGCTCG-CCGGAGACACC-TTGAACTCTGTCTGAAGATTGTAGTCTGAGACAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCC-TTCTGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGACTGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCC-AGG??????????????????????????????????????TTTCTCCCGCCATTTCGGGCATCAATTTG-ACATCTTGGCTAACTGACTCAAAGGCAAACCATCTCTGGCGAGCACGGTCTCGATGGCGATGGACAGTAAGT---TGCCATTGTTTCGACTGCA---GGTGGATCTGGTCTCTAAGATGTTGCTAGGTACAATGGAACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGTGAGTACGCCATATCCT---------------TGATGTCTCCGTGTGCGTTATCTCACC---TTATGTCTTTGACCTCCCAGGCTAGTGGCGAAAAATATGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCGGCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGTTCTCCCTGTTTGTGAGTAACCCCACGTG----------------CTGACGGGGAGATTGGA----------ATGCTGACCGACGATGTT-----TCGTGAAATAGGACAAGGATGGCGATGGTGAGTGAT---CGCC---------------GAGCTCGAG----TCCCAA-----------------GCGCAATAAGTTCCTAATATTTATT------------------TTCCAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCGCTGGGTCAGAACCCCTCCGAGTCCGAGCTGCAGGATATGATCAACGAGGTTGATGCCGACAACAACGGCACCATCGACTTCCCCGGTACTTGC------------------------CTTCT-CCCTACGA-----------------GACACCCTAT---ACGGCT----ATTGAC-CAGCGCTTAGAATTCCTGACCATGATGGCCCGCAAGATGAAGGATACCGACTCCGAGGAGGAGATCCGTGAGGCATTCAAGGTGTTCGATCGCGATAACAACGGCTTTATCTCCGCTGCCGAGCTCCGTCACGT Penicillium_raistrickii_CBS_261_33 ?????????????GAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTCAGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATC-TCGAACTCTGTCTGAAGATTGTAGTCTGAGTATAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAATTTTTATCC-AGGTTGACCTCGGATCAG???????????????????????TTTTTTTTTCGGTGTTGGGTATCAATTGA-CAAATT--GCTAACTGGTTTATAGGCAAACCATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT---TCAATGAGATGGGATTCCA---GTTGAATCAGACCTCTGATATCTACCTAGGTACAACGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTAGAATTGCTTTG----------------ATTTCTAAATCGTGCGTTGTCTAACC---TTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAATACGTCCCCCGTGCTGTCCTCGTCGATTTGGAGCCCGGTACCATGGACGCCGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGTCCCGACAACTTCGTCT????????????????????????????TTCTCCCTTTTCGTAAGTGACCCCGCATA----------------CCGATTGAAG---GCAA----------TCACTGACCGGCGATTTT-----TGGC-AAACAGGATAAGGATGGCGATGGTGAGTGAT---CAC--------GCTCAGCTGAGCTCGCA----AGTCGAAATTTAAC-------GGGGCAACAAATCCTCTAACATGCAAC------------------CCCTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAATCCCTCCGAGTCCGAATTGCAAGATATGATCAACGAAGTTGACGCCGATAACAACGGCACCATCGACTTCCCCGGTATTTAC------------------------CACTT-CCTTGCCC-----------------AGAGCGAAGA---ACAGCTAG--ATTGAC-AAGTAC-TAGAATTCTTGACCATGATGGCCCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCCGCCGCCGAGCTGCGCCACGT Penicillium_ribeum_CBS_127809 ???????????CCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTATGGCCGCCGGGGGGCATCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATC-TCGAACTCTGTCTGAAGATTGTAGTCTGAGTCAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAATTTTTATCC-A????????????????????????????????????????TTTTTTTTTCGGTGTTGGGCATCAATTGA-CAAATT--GCTAACTGGTTTAAAGGCAAACCATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT---TCAATGTGATGAGATTCTA---GGTGAATCAGGCCTCTGATATCTTACTAGGTACAACGGTACCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGGCCATG---------------GCTTCTACCAACTTGCGTCGTCTAACC---TTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGTGCCGGTAACAACTGTTCTCCCTCTTTGTAAGTGAACCCACATA----------------CCGATTGAAGCATCTCA----------ATACTGACCGGCGATTTA-----TCGCAACACAGGACAAGGATGGCGATGGTTAGTGAT---CGCGCCCGACAGCTCAGTTGAGCTCGCA----AGTCGAATCAAAAG-------CCGTTCAACAAATTCCTAACATGCATTC-----------------TCCTAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCTGAGTCTGAACTGCAGGACATGATCAACGAGGTTGACGCCGATAACAACGGCACCATCGATTTCCCCGGTAATTGC------------------------CACCA-CTCCC---------------------GAGCGAAAT---ACAGCT----ATTGAT-ACGTAT-TAGAATTCTTGACTATGATGGCTCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCTGCCGCTGAGCTGCGCCACGT Penicillium_sajarovii_CBS_277_83 AAGGATCATTACTGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTAAGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATC-TCGAACTCTGTCTGAAGATTGTAGTCTGAGTATAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAATTTTTATCC-AG????????????????????????????????????????????????????GTTGGGTATCAATTGA-CAAATT--GCTAACTGGTTTATAGGCAAACCATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT---TCAATGAGATAAGATTCCA---GTTGAATCAGACCTCTGATATCTTCCTAGGTACAACGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTAGAATTGCTTTG----------------ATTTTTAAATCGTGCGTTGTCTAACC---TTCTTTCTTTGACCGCTCAGGCTAGCGGTGACAAATACGTCCCCCGTGCTGTCCTCGTCGATTTGGAGCCCGGTACCATGGATGCCGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGTCCCGACAACTTCGTCT????????????????????????????TTCTCCCTGTTTGTGAGTGCTCCTGGACGCGTCCATTGACAATCTCCGATCGGAAAAACATT----------AGACTGACCAGTGCGGGTTTCCGCGTGTGAATAGGACAAGGATGGCGATGGTGCGTGCAG-CCTTATTCGATAGCTCGAACGTGCAATTCTAAGGAGCAGTTCTGGAGCCATTTGAACCCGCGAATATTCTCAAAACAGAATCATTGACTTAGTTTCGATGTCTAGGCCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACCATCGACTTCCCCGGTATGCACTGAACTGCTCGGCAATGGATGTCGCTCTT-TTCTCTAT-----------------TTAACCCAGA---CTAACTGCTTTCCCGTGCACCTG-CAGAGTTCCTCACCATGATGGCCCGCAAGATGAAGGATACCGACTCAGAGGAGGAGATCCGGGAGGCGTTCAAGGTGTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGCCACGT Penicillium_scabrosum_CBS_683_89 ???????????CCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTATGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGTGCCCG-CCGAAGACACC-TAGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGCCCCCCGATCCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAACTTTTTTCC-A????????????????????????????????????????TTTTTTTCCCGGTATCGGGCATCAATTGA-CAAATT--GCTAACTGGTTTAAAGGCAGACTATCTCCGGCGAGCACGGTCTCGATGGCGATGGACAGTAAGT---TCAACCTGATGGGATGCT----GGTGAATCAGACCTCTGATATCTTCCTAGGTACAACGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTTTACTTCAACCATGTGAGTACAATGATTATG---------------ATTTCTTTTTACGTGCGTTGTCTAACC---TTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAGTATGTCCCCCGTGCTGTCCTCGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGATAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTG????????????GTAAGTGACCCCACATA----------------CCGATTGAAGTATCTCA----------ATACTGACCGGTGATTTT-----CCAC---ACAGGACAAGGATGGCGATGGTGAGTGAT---CGCGC-------CTCAGTCGAGCTCATT-----------------------------TTGCCCGATTCCTAACATGCA----------------------CTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCCCTGGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGACATGATCAACGAGGTTGACGCCGATAACAACGGCACCATCGACTTCCCCGGTATTTGC------------------------CACCA-CCTCCC------------------CAGAGCGAAAT---ACAGCT----GTTGAC-ACGTAC-TAGAATTCTTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGCGAAGCATTCAAGGTGTTCGATCGCGATAACAACGGCTTCATCTCCGCCGCTGAGCTGCGCCACGT Penicillium_simile_CBS_129191 ??????????????????????CCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTAAGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATC-TCGAACTCTGTCTGAAGATTGTAGTCTGAGTATAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAAATTTTTTCC-AGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA??????????GGTGTTGGGTATCAATTGA-CAAATT--GCTAACTGGTTAATAGGCAAACCATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT---TCAATATGATAGGATTCCA---GTTGAATCAGACCTCTGATATCTTCCTAGGTACAACGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGGCCTGG----------------TTTCCTTAACCGTGCGTCGTCTAACC---TTCTTTCTTTGACCGCTCAGGCTAGCGGTGACAAATACGTCCCCCGTGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGTCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGTTCTCCCTTTTCGTAAGTGACCCCACATA----------------CCGATTGAAT---TCAC----------TCACTGACCGGCGATTTG-----TGGC-AAACAGGATAAGGATGGCGATGGTGAGTGAT---CGCGC------GCTCAGCTGAGCTCGCA----AGTCGAAAATCAAG-------CGGGCAACAAATCCCCTAACATGTAAT------------------CCCTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCCGAATTGCAGGATATGATCAACGAGGTTGACGCCGATAACAACGGCACCATCGACTTCCCTGGTATTTGC------------------------CACTC-CCCTGAGTGAA--------------AGAGTGAAAG---ATAGCTAG--ATTGAC-ACGTCC-TAGAATTCTTGACCATGATGGCCCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCCGCCGCCGAGCTGCGTCACGT Penicillium_soppii_CBS_226_28 AAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTTGGCGGGCCCGCC-TCACGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGTGCCCG-CCGAAGACACCTTAGAACTCTGTCTGAAGATTGTAGTCTGAGTAAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAATTTTTT-CC-AGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAATTTTTTTTTTCGTGTTGGGGATCAATTGA-CAACCT--GCTAACTGGTTTACAGGCAGACCATCTCTGGTGAACACGGTCTCGATGGTGATGGACAGTAAGTTC-TCAACGTGAT-GGATTCCA---{AG}ATGATTCAGGCCTCTGATCTCTCGTTAGGTACAATGGTACCTCCGACCTCCAGCTTGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGATTACA---------------ATATACTCCAGCGTGCATCGTCTAACC---TTCTTTCTTTGACCGCTCAGGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTCGTC{AG}ATTTGGAGCCCGGTACCATGGACGCCGTCCGCACCGGTCCCTTCGGCAAGCTCTTCCGCCCC{AG}ACAACTTCGTCTTCGGTCAATCCGGTGCC????????????????????????????????????????----------------??????????????TCA----------ACACTAACCAGCGATCTA-----TCGCAAAACAGGACAAGGATGGTGATGGTGAGTGAT---CGCGCTCGTCAGCTCAGTCGAGTTCGCA----ACTCGAA----------------TTGGCCCGAAAATCTAACATGTCAT-------------------CCCAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGACAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATCGACTTCCCCGGTATGCCC------------------------CCCCC-CCCGTTATCAGCCCCC-------TCCCCCCAAAAA---CCTGCC----ATTGAC-AAGCGA-TAGAATTCTTGACCATGATGGCCCGCAAGATGAAGGATACTGATTCCGAGGAGGAGATCCGCGAAGCGTTCAAGG???????????????????????????????????????????????????? Penicillium_sp_JZB2120005 ????GACATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTTGGCGGGCCCGCC-TCACGGCCGCCGGGGGGCTTCTGCCCTCGGGCCCGTGCCCGCCCAAAGACCTC-TTGAACTCTGTCTGAAGATTGTCGTCTGAGTG-AGATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCCCCGCTCCCGGGGGACGGGTCCGAAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCCGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAACTTCTTCC---AGGTGACCTCGAT????????????????????????????????????????????????????TTGA-CAGTTT--GCTAACTGGTTTACAGGCAGACCATCTCTGGTGAGCACGGTCTCGATGGTGATGGACAGTAAGTTC-TCGATGTGAT-GGATTCAA---GATGATTCAGGCCTCTGATTTCTCATTAGGTACAATGGTACCTCCGACCTCCAGCTTGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGATTACA---------------TTATCTTCCAACGTATATCGTCTAACC---TTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTCGTTGACTTGGAGCCTGGTACCATGGACGCTGTCCGTACCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGTGCTGGTAACAACTG??????????????????GATCCCACATA----------------GCAGCTGAACGGT-----------------CTAAATACTGATCTA-----TCGGAAAACAGGACAAGGATGGTGATGGTGAGTGAT---CGCGCTTCACAGCTCAGTCGAGTTCGCA----ACTCGAA----------------TTAGCCCAAAAATCTAAC--CTAAT-------------------TCCAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAATCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATCGACTTCCCCGGTATGGCC------------------------CCCCA-CCCCTTATCAGCCCCCCTCACATCCCCCCCCCAAA---ACGGCA----ATTGAC-AAGCGA-TAGAATTCTTGACCATGATGGCCCGCAAGATGAAGGACACCGATTCCGAGGAGGAGATTCGCGAAGCGTTCAAAGTGTTCGATCGCGACAACAACGGCTTCATATCCGCCGCCGAGCTGCGCCACGT Penicillium_sp_JZB2120023 ????GACATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTTGGCGGGCCCGCC-TCACGGCCGCCGGGGGGCTTCTGCCCTCGGGCCCGTGCCCGCCCAAAGACCTC-TTGAACTCTGTCTGAAGATTGTCGTCTGAGTG-AGATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCCCCGCTCCCGGGGGACGGGTCCGAAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCCGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAACTTCTTCC---AGGTGACCTCGAT????????????????????????????????????????????????????TTGA-CAGTTT--GCTAACTGGTTTACAGGCAGACCATCTCTGGTGAGCACGGTCTCGATGGTGATGGACAGTAAGTTC-TCGATGTGAT-GGATTCAA---GATGATTCAGGCCTCTGATTTCTCATTAGGTACAATGGTACCTCCGACCTCCAGCTTGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGATTACA---------------TTATCTTCCAACGTATATCGTCTAACC---TTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTCGTTGACTTGGAGCCTGGTACCATGGACGCTGTCCGTACCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGTGCTGGTAACAACTG??????????????????GATCCCACATA----------------GCAGCTGAACGGT-----------------CTAAATACTGATCTA-----TCGGAAAACAGGACAAGGATGGTGATGGTGAGTGAT---CGCGCTTCACAGCTCAGTCGAGTTCGCA----ACTCGAA----------------TTAGCCCAAAAATCTAAC--CTAAT-------------------TCCAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAATCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATCGACTTCCCCGGTATGGCC------------------------CCCCA-CCCCTTATCAGCCCCCCTCACATCCCCCCCCCAAA---ACGGCA----ATTGAC-AAGCGA-TAGAATTCTTGACCATGATGGCCCGCAAGATGAAGGACACCGATTCCGAGGAGGAGATTCGCGAAGCGTTCAAAGTGTTCGATCGCGACAACAACGGCTTCATATCCGCCGCCGAGCTGCGCCACGT Penicillium_swiecickii_CBS_119391 AAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTCGGCGGGCCCGCC-GTATGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACATC-TCGAACTCTGTCTGAAGATTGTAGTCTGAGTAAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCCCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAATTTTTATCC-AGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAATTTTTTTTTCGGTGTTGGGCATCAATTGA-CAAATT--GCTAACTGGTTTAAAGGCAAACCATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT---TCAATGTGATAGGATTCCA---GGTGAATCAGGCCTCTGACATCTTCCTAGGTACAATGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACCTTG---------------CTTTCTTACAACGTGCGTTGTCTAACC---TTCTTTCTTTGACCGCCCAGGCTAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCT????????????????????????????TTCTCCCTTTTTGTAAGTGACCCCACATA----------------TCGATTGAAGTATCTAA----------ATACTGACCGGCGATTTA-----TCGCAAAACAGGACAAGGATGGCGATGGTGAGTGAT---CGCGCCCGACAGCTCAGTCGAGCTCGCA----AGTCGAATCAAAAG-------CCATTCAACAATCTCCTAACATGCATTC-----------------CCCTAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCCGAATTGCAGGACATGATCAACGAGGTTGACGCCGACAACAATGGCACCATCGACTTCCCCGGTATTTGC------------------------CACCA-CTCCCT-------------------AGAGCGAAAT---ACAGCC----ATTGAC-ACGTAC-TAGAATTCTTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGCGACAACAACGGTTTCATCTCCGCCGCTGAGCTCCGCCACGT Penicillium_virgatum_CBS_114838 AAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCATGTTTATTGTACCTTGTTGCTTCGGCGGGCCCGCCTTTGTGGCCGCCGGGGG--CTCTGCCCCCGGGCCCGCGCCCG-CCGAAGACACC-TAGAACTCTGTCTGAAGATTGCAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGCTCCCGGAGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAACTTTTATCC-AGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA??TTTTTTTTCGTGTTGGGTATCAATTGA-CATCTT--GCTAACTAATTTAAAGGCAAACTATCTCCGGTGAGCACGGTCTCGATGGCGATGGACAGTAAGT---ATAATGTGTTAGGATTCCA---GGTGAATCAGGTCTCTGATATCTTGCTAGGTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCAGGTGAGTACAATGGCTGTG---------------ATATCTTTAAATGTGCGTTGTCTAACC---TTCTTTCTTTGACCGCTCAGGCTAGCAATGACAAGTACGTTCCCCGTGCCGTTCTGGTCGACTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCGTTCGGCAAGCTCTTCCGCCCCGACAACTTCGTCT????????????????????????????TTCTCCCTATTCGTAAGTAACACCAAATA----------------CCGATTGAAGAATGTCA----------ACACTGACCGGCGATTTA-----TCGCGAACCAGGACAAGGATGGCGATGGTGAGTGAT---CGCGCCCGACAACTCAGCTGAGCTCGCACC-CAGTTATATGGAAAG-----------CCATTCAAATCCTAACATGCAATT-----------------TCCCAGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATCGACTTCCCCGGTATTTGC------------------------CACCA-TTCTC--------------------AGAGCGAAACAAAACGGCT----ATTGAC-AAGCGA-TAGAATTCCTGACCATGATGGCTCGCAAGATGAAGGATACCGATTCCGAGGAGGAGATCCGTGAAGCGTTCAAGGTGTTCGATCGTGATAACAACGGTTTCATCTCCGCCGCTGAGCTGCG?????? ; END; BEGIN TREES; TITLE Penicillium_18x1575; LINK TAXA = Taxa2; TRANSLATE 1 Penicillium_brevicompactum_NRRL_2011, 2 Penicillium_jamesonlandense_CBS_102888, 3 Penicillium_kojigenum_CBS_345_61, 4 Penicillium_lanosum_CBS_106_11, 5 Penicillium_lenticrescens_CBS_138215, 6 Penicillium_madriti_NRRL_3452, 7 Penicillium_mexicanum_DTO_270F1, 8 Penicillium_olsonii_CBS_232_60, 9 Penicillium_raistrickii_CBS_261_33, 10 Penicillium_ribeum_CBS_127809, 11 Penicillium_sajarovii_CBS_277_83, 12 Penicillium_scabrosum_CBS_683_89, 13 Penicillium_simile_CBS_129191, 14 Penicillium_soppii_CBS_226_28, 15 Penicillium_sp_JZB2120005, 16 Penicillium_sp_JZB2120023, 17 Penicillium_swiecickii_CBS_119391, 18 Penicillium_virgatum_CBS_114838; TREE 'PAUP_2' = [&R] ((6:0.11369,7:0.086285):0.0401615,((1:0.077873,8:0.114731):0.071936,(18:0.045088,((14:0.018148,(5:0.020828,(15:1.0E-8,16:1.0E-8):0.042516):0.016704):0.06187,((12:0.044599,(11:0.159577,(9:0.021769,13:0.021327):0.011899):0.02872):0.007715,(10:0.025482,((2:0.009383,17:0.003592):0.006003,(3:1.0E-8,4:1.0E-8):0.009096):0.00404):0.005941):0.020872):0.007887):0.014827):0.0401615); END; BEGIN TREES; TITLE Penicillium_14x1547; LINK TAXA = Taxa1; TRANSLATE 1 Penicillium_jamesonlandense_CBS_102888, 2 Penicillium_kojigenum_CBS_345_61, 3 Penicillium_lanosum_CBS_106_11, 4 Penicillium_lenticrescens_CBS_138215, 5 Penicillium_raistrickii_CBS_261_33, 6 Penicillium_ribeum_CBS_127809, 7 Penicillium_sajarovii_CBS_277_83, 8 Penicillium_scabrosum_CBS_683_89, 9 Penicillium_simile_CBS_129191, 10 Penicillium_soppii_CBS_226_28, 11 Penicillium_sp_JZB2120005, 12 Penicillium_sp_JZB2120023, 13 Penicillium_swiecickii_CBS_119391, 14 Penicillium_virgatum_CBS_114838; TREE 'PAUP_2' = [&R] (7:0.0597095,((5:0.017422,9:0.023909):0.01715,(8:0.044938,((6:0.027807,((1:0.005643,13:0.004668):0.005849,(2:1.0E-8,3:1.0E-8):0.009481):0.002901):0.003241,(14:0.050521,(10:0.020452,(4:0.020718,(11:1.0E-8,12:1.0E-8):0.037496):0.013459):0.056091):0.015507):0.008683):0.02187):0.0597095); END;