#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 4:55 GMT TreeBASE (cc) 1994-2008 Study reference: Orihara T., Ohmae M., & Yamamoto K. 2016. First report of Chamonixia caespitosa (Boletaceae, Boletales) from Japan and its phylogeographic significance. Mycoscience, 57(1): 58-63. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17320] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=20; TAXLABELS 'Chamonixia caespitosa GERMANY, Bavaria 92/83 DQ534565' 'Chamonixia caespitosa JPN, Nagano KPM-NC 18070 KP222907' 'Chamonixia caespitosa JPN, Nagano KPM-NC 18071 KP222908' 'Chamonixia caespitosa POLAND KRA F-2013-38 KT001255' 'Chamonixia caespitosa POLAND KRA F-2013-60 KT001258' 'Chamonixia caespitosa POLAND KRA F-2014-110 KT001259' 'Chamonixia caespitosa POLAND KRA F-2014-113 KT001257' Chamonixia_caespitosa_SWEDEN__UDB001774 Chamonixia_caespitosa_USA__HQ647124 Chamonixia_caespitosa_USA__OSC_117034__EU846243 Chamonixia_caespitosa_USA__OSC_117036__EU834198 'Chamonixia caespitosa USA OSC 117571 (isolate p071i) EU669208' Chamonixia_caespitosa_USA__OSC_118291__EU834197 'Chamonixia caespitosa USA Trappe 10517 (isolate p693i) EU669385' Chamonixia_caespitosa_USA__Trappe_12656__EU846310 Chamonixia_caespitosa_USA__Trappe_12768__EU852804 'Uncultured ECM of Lithocarpus densiflorus USA, CA DQ273368' 'Uncultured ECM of Tsuga heterophylla, NA FJ152518' 'Uncultured ECM of Tsuga heterophylla, NA FJ152519' 'Uncultured ECM, CANADA, BC EU597022 ' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=44; TAXLABELS 'Chamonixia caespitosa GERMANY, Bavaria 92/83 DQ534565' 'Chamonixia caespitosa JPN, Nagano KPM-NC 18070 KP222907' 'Chamonixia caespitosa JPN, Nagano KPM-NC 18071 KP222908' 'Chamonixia caespitosa POLAND KRA F-2013-38 KT001255' 'Chamonixia caespitosa POLAND KRA F-2013-60 KT001258' 'Chamonixia caespitosa POLAND KRA F-2014-110 KT001259' 'Chamonixia caespitosa POLAND KRA F-2014-113 KT001257' Chamonixia_caespitosa_SWEDEN__UDB001774 Chamonixia_caespitosa_USA__HQ647124 Chamonixia_caespitosa_USA__OSC_117034__EU846243 Chamonixia_caespitosa_USA__OSC_117036__EU834198 'Chamonixia caespitosa USA OSC 117571 (isolate p071i) EU669208' Chamonixia_caespitosa_USA__OSC_118291__EU834197 'Chamonixia caespitosa USA Trappe 10517 (isolate p693i) EU669385' Chamonixia_caespitosa_USA__Trappe_12656__EU846310 Chamonixia_caespitosa_USA__Trappe_12768__EU852804 'Leccinellum aff. griseum JPN, Hyogo KC552008' Leccinellum_carpini_NETHERLANDS__AF454588L Leccinellum_crocipodium_NETHERLANDS__AF454590 'Leccinellum quercophilum USA, IL KC691207' 'Leccinum aff. duriusculum JPN, Tottori KC552013' 'Leccinum scabrum UK, Scotland KC552012' Leccinum_talamancae_COSTA_RICA__AY544779 'Leccinum vulpinum UK, Scotland KC552013' Octaviania_asterosperma_SPA_JN257998 'Octaviania celatifilia JPN, Nara JN257997' 'Octaviania cyanescens USA, OR KC552006' 'Octaviania etchuensis JPN, Toyama JQ619182' 'Octaviania japonimontana JPN, Akita JQ619174' 'Octaviania kobayasii JPN, Kyoto JQ619171' 'Octaviania mortae JPN, Kyoto JN257995 ' 'Octaviania nonae JPN, Amami-oshima Isl. JN257985' 'Octaviania tasmanica AUS, TAS OSC 132097 KP222909' Retiboletus_aff._griseus_CHINA__JQ928613_ 'Rossbeevera eucyanea JPN, Tottori KC551981' 'Rossbeevera griseovelutina JPN, Hyogo HQ693876' 'Rossbeevera pachydermis NZ, North Isl. KJ001089' 'Rossbeevera vittatispora AUS, VIC KC551977' 'Rossbeevera westraliensis AUS, WA KC551980' 'Rossbeevera yunnanensis CHINA, Yunnan KC551990' 'Uncultured ECM of Lithocarpus densiflorus USA, CA DQ273368' 'Uncultured ECM of Tsuga heterophylla, NA FJ152518' 'Uncultured ECM of Tsuga heterophylla, NA FJ152519' 'Uncultured ECM, CANADA, BC EU597022 ' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M32176] TITLE 'Chamonixia caespitosa ITS small dataset (2)'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=516; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Chamonixia caespitosa GERMANY, Bavaria 92/83 DQ534565' GA-CATTATTGAATACACAA-GACTGTCGCTGGCTAGG-TCATTCTTAGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAGA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACC--TACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-ATAG-CTTTGATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTT-AATT--GAAT-TTGAATTTGAA-TTC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa JPN, Nagano KPM-NC 18070 KP222907' GATCATTATTGAATACACAA-GACTGTCGCTGGCTAGG-TCATTCTTAGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AATGAAA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-ATAG-CTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTT-AATT--GAAT-TTGAATTTGAA-TTC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa JPN, Nagano KPM-NC 18071 KP222908' GATCATTATTGAATACACAA-GACTGTCGCTGGCTAGG-TCATTCTTAGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AATGAAA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-ATAG-CTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTT-AATT--GAAT-TTGAATTTGAA-TTC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa POLAND KRA F-2013-38 KT001255' GATCATTATTGAATACACAAGGACTGTCGCTGGCTAGGTTCATTCTTAGCATGTGCACGTCTACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAAGAGGATTCTATGTCCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCATAGTCTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA-GTAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAATGAAGCTTGCTTT-AATTTTGAAT-TTGAATTTGAAATTCTATTACCATTTTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa POLAND KRA F-2013-60 KT001258' GATCATTATTGAATACACAAGGACTGTCGCTGGCTAGGTTCATTCTTAGCATGTGCACGTCTACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAAGAGGATTCTATGTCCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCATAGTCTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA-GTAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAATGAAGCTTGCTTT-AATTTTGAAT-TTGAATTTGAAATTCTATTACCATTTTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa POLAND KRA F-2014-110 KT001259' GATCATTATTGAATACACAAGGACTGTCGCTGGCTAGGTTCATTCTTAGCATGTGCACGTCTACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAAGAGGATTCTATGTCCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCATAGTCTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA-GTAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAATGAAGCTTGCTTT-AATTTTGAAT-TTGAATTTGAAATTCTATTACCATTTTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa POLAND KRA F-2014-113 KT001257' GATCATTATTGAATACACAAGGACTGTCGCTGGCTAGGTTCATTCTTAGCATGTGCACGTCTACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAAGAGGATTCTATGTCCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCATAGTCTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA-GTAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAATGAAGCTTGCTTT-AATTTTGAAT-TTGAATTTGAAATTCTATTACCATTTTGACCTCAAATCAGGTAGGACTACCCGCT Chamonixia_caespitosa_SWEDEN__UDB001774 GATCATTATTGAATACACA-GGACTGTCGCTGGCTAGGTTCATTCTTAGCATGTGCACGTCTACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAAGAGGATTCTATGTCCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCATAGTCTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA-GTAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAATGAAGCTTGCTTT-AATTTTGAAT-TTGAATTTGAAATTCTATTACCATTTTGACCTCAAATCAGGTAGGACTACCCGCT Chamonixia_caespitosa_USA__HQ647124 GATCATTATTGAATACACAA-GACTGTCGCTGGCTAGG-TCATTCTTAGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AATGAAA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-ATAG-CTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTT-AATT--GAAT-TTGAATT???????????????????????????????????????????????? Chamonixia_caespitosa_USA__OSC_117034__EU846243 GATCATTATTGAATACACAATGACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTACTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTA-AATT----------AATC------TC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT Chamonixia_caespitosa_USA__OSC_117036__EU834198 GATCATTATTGAATACACAATGACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTACTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTA-AATT----------AATC------TC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa USA OSC 117571 (isolate p071i) EU669208' GATCATTATTGAATACACAATGACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTACTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTA-AATT----------AATC------TC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT Chamonixia_caespitosa_USA__OSC_118291__EU834197 GATCATTATTGAATACACAA-GACTGTCGCTGGCTAGG-TCATTCTTAGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-ATAG-CTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTT-AATT--GAAT-TTGAATTTGAA-TTC-ATTACCA--TT???????????????????????????? 'Chamonixia caespitosa USA Trappe 10517 (isolate p693i) EU669385' GATCATTATTGAATACACAATGACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTACTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTA-AATT----------AATC------TC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT Chamonixia_caespitosa_USA__Trappe_12656__EU846310 ???????????????????????????????????????????????AGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-ATAG-CTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTT-AATT--GAAT-TTGAATTTGAA-TTC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT Chamonixia_caespitosa_USA__Trappe_12768__EU852804 GATCATTATTGAATACACAATGACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTACTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTA-AATT----------AATC------TC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Uncultured ECM of Lithocarpus densiflorus USA, CA DQ273368' GATCATTAATGAAGAC--AAAGACTGTTGCTGGCTAGG-TGATTCT-AGCACGTGCACGTC-ACTTTTCACACCTGTGCACCTATTGTAGATCGCA------A-GA-TCTATGT-CATATCAATTGTATGTCTATAGAATGT--CAAGTACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC---AA-----GATTATTGGCTTGGACTTGGGATTTGCTGGCTAGTCAGCTTTCCTTAAATGCATTAGCAAATCGATC--GACGGCACGGCCTCTGATGATCGTTGGAAGCGTTAT-GGAAAGTTTGCTTATAATT--GGGTTGTGGGCTGGAA-GTT-ATT------TTGACCTCAAATCAGGTAGGACTACCCGCT 'Uncultured ECM of Tsuga heterophylla, NA FJ152518' GATCATTATTGAATACACAATGACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTACTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTA-AATT----------AATC------TC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Uncultured ECM of Tsuga heterophylla, NA FJ152519' GATCATTATTGAATACACAA-GACTGTCGCTGGCTAGG-TCATTCTTAGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-ATAG-CTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-GAAGCTTGCTTT-AATT--GAAT-TTGAATTTGAA-TTC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Uncultured ECM, CANADA, BC EU597022 ' ??????????????????????ACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTG------------AT--AACGAAA-AGGA-TCTATGT-CTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTT??AAG-GTCATAA-GAAGCTTGCTTA-AATT----------AATC------TC-ATTACC?--TTGACCTCAAATCAGG?AG??????????? ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M32175] TITLE 'Chamonixia caespitosa ITS large dataset (2)'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=523; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Chamonixia caespitosa GERMANY, Bavaria 92/83 DQ534565' GA-CATTATTGAATACACAA-GACTGTCGCTGGCTAGG-TCATTCTTAGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAGA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACC--TACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-ATAG-CTTTGATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTT--AATT--GAAT-TTGAATTTGAA-TTC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa JPN, Nagano KPM-NC 18070 KP222907' GATCATTATTGAATACACAA-GACTGTCGCTGGCTAGG-TCATTCTTAGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AATGAAA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-ATAG-CTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTT--AATT--GAAT-TTGAATTTGAA-TTC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa JPN, Nagano KPM-NC 18071 KP222908' GATCATTATTGAATACACAA-GACTGTCGCTGGCTAGG-TCATTCTTAGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AATGAAA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-ATAG-CTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTT--AATT--GAAT-TTGAATTTGAA-TTC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa POLAND KRA F-2013-38 KT001255' GATCATTATTGAATACACAAGGACTGTCGCTGGCTAGGTTCATTCTTAGCATGTGCACGTCTACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAAGAGGATTCTATGTCCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCATAGTCTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA-GTAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAAT------GAAGCTTGCTTT--AATTTTGAAT-TTGAATTTGAAATTCTATTACCATTTTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa POLAND KRA F-2013-60 KT001258' GATCATTATTGAATACACAAGGACTGTCGCTGGCTAGGTTCATTCTTAGCATGTGCACGTCTACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAAGAGGATTCTATGTCCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCATAGTCTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA-GTAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAAT------GAAGCTTGCTTT--AATTTTGAAT-TTGAATTTGAAATTCTATTACCATTTTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa POLAND KRA F-2014-110 KT001259' GATCATTATTGAATACACAAGGACTGTCGCTGGCTAGGTTCATTCTTAGCATGTGCACGTCTACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAAGAGGATTCTATGTCCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCATAGTCTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA-GTAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAAT------GAAGCTTGCTTT--AATTTTGAAT-TTGAATTTGAAATTCTATTACCATTTTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa POLAND KRA F-2014-113 KT001257' GATCATTATTGAATACACAAGGACTGTCGCTGGCTAGGTTCATTCTTAGCATGTGCACGTCTACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAAGAGGATTCTATGTCCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCATAGTCTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA-GTAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAAT------GAAGCTTGCTTT--AATTTTGAAT-TTGAATTTGAAATTCTATTACCATTTTGACCTCAAATCAGGTAGGACTACCCGCT Chamonixia_caespitosa_SWEDEN__UDB001774 GATCATTATTGAATACACA-GGACTGTCGCTGGCTAGGTTCATTCTTAGCATGTGCACGTCTACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAAGAGGATTCTATGTCCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCATAGTCTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA-GTAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAAT------GAAGCTTGCTTT--AATTTTGAAT-TTGAATTTGAAATTCTATTACCATTTTGACCTCAAATCAGGTAGGACTACCCGCT Chamonixia_caespitosa_USA__HQ647124 GATCATTATTGAATACACAA-GACTGTCGCTGGCTAGG-TCATTCTTAGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AATGAAA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-ATAG-CTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTT--AATT--GAAT-TTGAATT???????????????????????????????????????????????? Chamonixia_caespitosa_USA__OSC_117034__EU846243 GATCATTATTGAATACACAATGACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTACTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTA--AATT----------AATC------TC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT Chamonixia_caespitosa_USA__OSC_117036__EU834198 GATCATTATTGAATACACAATGACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTACTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTA--AATT----------AATC------TC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Chamonixia caespitosa USA OSC 117571 (isolate p071i) EU669208' GATCATTATTGAATACACAATGACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTACTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTA--AATT----------AATC------TC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT Chamonixia_caespitosa_USA__OSC_118291__EU834197 GATCATTATTGAATACACAA-GACTGTCGCTGGCTAGG-TCATTCTTAGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-ATAG-CTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTT--AATT--GAAT-TTGAATTTGAA-TTC-ATTACCA--TT???????????????????????????? 'Chamonixia caespitosa USA Trappe 10517 (isolate p693i) EU669385' GATCATTATTGAATACACAATGACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTACTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTA--AATT----------AATC------TC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT Chamonixia_caespitosa_USA__Trappe_12656__EU846310 ???????????????????????????????????????????????AGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-ATAG-CTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTT--AATT--GAAT-TTGAATTTGAA-TTC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT Chamonixia_caespitosa_USA__Trappe_12768__EU852804 GATCATTATTGAATACACAATGACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTACTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTA--AATT----------AATC------TC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Leccinellum aff. griseum JPN, Hyogo KC552008' GATCATTATCGAACAA-ATA-GATTGTCGCTGGCTAGG-TGATTCT-AGCATGTGCACATCT--CTACCACACCTGTGAACCTATTGTAGATCGAA------A-GA-TCTATGT-CA-ACA-ATCGTATGTCTATAGAATGT--A-ACTACAACTTTCAGCAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-CAAG-CTTTGATTATTGGCTTGGACTTGGGAATTGCTGGCTAGTCAGCTGTCCTTAAATGCATTAGTGAGT--------ACGGCACGGCCTCTGATGATCGTTGGAAGCGT-------------AA--TTGCTTAT-AA-T--AC-TGGGAAA--------TG-AAA-CCC--TTGACCTCAAATCAGGTAGGACTACCCGCT Leccinellum_carpini_NETHERLANDS__AF454588L GATCATTATCGAACAAC----GATTGTCGCTGGCTAGG-TGATTCT-AGCATGTGCACATCT--CTACCACACCTGTGAACCTATTGTAGATCGAG------A-GA-TCTATGTCCA-ACACATCGTATGTCCATAGAATGT--A-ATTACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-G-AG-CTTTGATTATTGGCTTGGACTTGGGAATTGCTGGCTAGTCGGCTGTCCTTAAAAGCATTAGCGAGT-AA-----ACGGCACGGCCTCTGATGATCGTTGGAAGCGT-------------AA--TTGCTTAT-AATT--AC-TGGGAAA--------GG-AAA-CCA???????????????????????????????? Leccinellum_crocipodium_NETHERLANDS__AF454590 GATCATTATCGAACA---TG-GATTGTCGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-A-CAACCACACCTGTGCACCTATTGTAGATCGAG------A-GA-TCTATGTCCA-ACATATCGTATGTC--TAGAATGT------TACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATCATCAAC-CTAG-CTTTCATTATTGGCTTGGACTTGGGATTTGCTGGCT--TCAGCTGTCCTTAAATGCATTAGCAAGTGTTTCT--ACAGCACGGCCTTTGACGATCGTTGGAAGTGT---AGG----------CTTGCTTC-AAA----ATCT-GG-AA--------TG-TCTA-----TTGACCTCAAATCAGGTAGGACTACCCGCT 'Leccinellum quercophilum USA, IL KC691207' GATCATTAAAG-ATAG--AATGGTTGTCGCTGGCTAG--TAACTCT-AGCATGTGCACGCC-A-CATTCACACCCGTGCACCCATTGTAGATCGCA------A-GA-TCTATGT-CACATC?ATCGTATGTCTACAGAATGT--A-ATTACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCA?CTTGCGCCCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC--?AA-CTTTGATTATTGGCTTGGACTTGGGATTTGCTGGCTGGTCAGCTGTTCTTAAATGCATTAGCAAGTGTTTCT--ACAGCACGGCCTTTGATGATCGTTGGAAGTGT-A--GG----------CTTGCTTCTAAA----ACGT-GG-AA--------TG-TCTA-----TT???????????????????????????? 'Leccinum aff. duriusculum JPN, Tottori KC552013' GATCATTAACGAATGA-----GGCTGTCGCTGGCTAGG-TGATTCT-AGCATGTGCACGTCTTTTAA-CACACTTGTGAACCTATTGTAGATCGAGCGAAA-AAGA-TCTATGT-TACACCAATCGTATGTCC--AGAA----AA-C-TACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATCGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTTTATCATCAAC-TTAG-CTTTGATTATGGGCTTGGACTTGGGAATTGCTGGCTAGTCGGCTGTCCTTAAATGTATTAGCGAGTGTTTCT--ACAGCACGGCCTTTGATGATCGTTGGAAGTGT---AG-------GT--CTGGCTTCT-AATT--GA-T-GC----------GTA---TCGGA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Leccinum scabrum UK, Scotland KC552012' GATCATTAATGAATGA-----GGCTGTCGCTGGCTAGG-TCATTCT-AGCATGTGCACGTCTTTTAA-CACACTTGTGAACCCATTGTAGATCGAGCGAAA-AAGA-TCTATGT-TACACCAATCGTATGTCC--AGAA----AATATTACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATCGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTTTATCATCAAC-TTAG-CTTTGATTATGGGCTTGGACTTGGGAATTGCTGGCTAGTCGGCTGTCCTTAAATGCATTAGCGAGTGTTTCT--ACAGCACGGCCTCTGATGATCGTTGGAAGTGT---AG-------GT--CTGGCTT{CT}T-AATT--GA-T-GC----------GTA--TTCGAA--TTGACCTCAAATCAGGTAGGACTACCCGCT Leccinum_talamancae_COSTA_RICA__AY544779 GATCATTACCAAAGAA-ATA-GATTGTTGCTGGCTAGA-TTAT-CT-AGCATGTGCACATC---ATAACACACTTGTGAACCTATTGTAGATCGCA------A-GA-TCTATGTT----C-TATTGTATGGCTATAGAATGT--T-ACTACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-CTAG-CTTTGATTATTGGCTTGGACTTGGGATTTGCTGGCTAGTCAGCTTTCCTTAAATGCATTAGCAAGTGAA-----ACAGCACGGCCTCTGATGATCGTTGGAAGTGTTA-AAA------GAAGCTTGCTT---AGTG--GA-T----AA--------GG-----CAA--TTGACCTCA????????????????????? 'Leccinum vulpinum UK, Scotland KC552013' ?????TTATTGAATGA-----GGCTGTCGCTGGCTAGG-TGATTCT-AGCATGTGCACGTCTTTTAA-CACACTTGTGAACCCATTGTAGATCGAGCGAAA-AAGA-TCTATGT-TACACCAATCGTATGTCC--AGAA----AATATTACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATCGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTTTATCATCAAC-TTAG-CTTTGATTATGGGCTTGGACTTGGGAATTGCTGGCTAGTCGGCTGTCCTTAAATGCATTAGCGAGTGTTTCT--ACAGCACGGCCTCTGATGAT{CT}GTTGGAAGTGT---AG-------GT--CTGGCTT{CT}T-AAA---GA-T-GC----------GTA---TCAAA--TTGACCTCAAATCAGGTAGGACTACCCGCT Octaviania_asterosperma_SPA_JN257998 GATCATTATAGAACCA-----GATTGTCGCTGGCTAGG-TGATTCT-AGCATGTGCACGTCTA--AATCACACCTGTGCACCTATTGTAGATTTTA------T-GA-TCTATGT-CACACAAATTGTATGGCATTAGAATGT-ATTTTTACAACTTTCAGCAATGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTCGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTTTATTATCAAC--TA-------ATT-TAGGCTTGGACTTGGGATTTGCTGGCTAGTCAGCTATCCTTGAATGTATTAGCAAGTGAATCTTGACGGCACGGCCTCTGATGATCGTTGGAAGCGTTATAGG-------AAGCTTGCTTCT-AAA-----GT----ATT-GG----TC-ACTAC----TTGACCTCAAATCAGGTAGGACTACCCGCT 'Octaviania celatifilia JPN, Nara JN257997' GATCATTAAGG-A-AAA----GA-------TGG---------------GCATGTGCACATCTACCATCCACACCTGTGCACCTATTGTAGATCTAG------TGGA-TCTATGTTTACACTCATTGTATGGCC-TAGAAT---A----TACAACTTTCAGCAATGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCAAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC----------GG---TAGGATTGGACTTGGGATTTGCTGGCTAGTCAGCTATCCTTAAATGCATTAGTGAG-CAATCTTGACGGCACGGCCTGTTCTGAACGTTGGAAGCGTCATAGG-------AAGCTTGCTTAT-AAC------T-----------------AC-------TTGACCTCAAATCAGGTAGGACTACCCGCT 'Octaviania cyanescens USA, OR KC552006' GATCATTATCGCACGA--AAGGATTGTCGCTGGCTAGG-TGATTCT-AGCACGTGCACGTCTATCTTCCACACCTGTGCACCAATTGTAGATC-AACGAAA-ACGA-TCTATGT-CACACCAAATGTATGTCTTTAGAATGT-ATTATTACAACTTTCAGCAATGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC--TAG-CTT--ATTATAGGCTTGGACTTGGGATTTGCTGGCTAGTCAGCTATCCTTAAATGCATTAGCGAGTGAATCTTGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAGG-------AAACTTGCTTCT-AATA--CAGT---------------C-ACTA-----TTGACCTCAAATCAGGTAGGACTACCCGCT 'Octaviania etchuensis JPN, Toyama JQ619182' GATCATTAACGAAC----AA-GATTGTCGCTGGCTAGG-TAATTCT-AGCATGTGCACATC----ATTCACACCTGTGCACCTATTGTAGATCGAA------A-GA-TCTATGT-TACACTAAATGTATGTCC--AGAATGTTA--ATTACAACTTTCAGCAATGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC----G-----AACCATCGGATTGGAGTTGGG-TTTGCTGGCTAGTCGGCTTTCCTTAAATACATTAGCGAGTGAATCTTGACAGCACGGCCTCTGATGATCGTTGGAAGTGTCATAGG-------AAGCTTGCTTATTAACA--CAATGGG-AA-------GTC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Octaviania japonimontana JPN, Akita JQ619174' GATCATTA-CGAAC----AA-GATTGTCGCTGGCTAG--TAACTCT-AGCACGTGCACATCTT-TAATCACACCTGTGCACCTATTGTAGATCGAA------A-GA-TCTATGT-TACACTAAATGTATGTCC-TA{CG}AATGT-AATATTACAACTTTCAGCAATGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC----G-----GAGC-TCGGATTGGAATTGGG-TTTGCTGGCTAGTCAGCTTTCCTTAAAAGCATTAGTGAGTGGATCTTGATAGCACGGCTTCTGATGATCGTTGGAAGTGTCATAGG-------AAGCTTGCTTT--AACG--GGGT-G--AATGGGAA-GTC-ATTAGCA--TTGACCTCAAATCAGGTA???????????? 'Octaviania kobayasii JPN, Kyoto JQ619171' GATCATTAACGAAC----AA-GATTGTCGCTGGCTATG-TAATTGT-AGCACGTGCACATCCA--AA--ACACCTGTGAACCTATTGTAGATCGAA------A-GA-TCTACGT-TATACTAATTGTATGTCA-TAGAATGTTATCATTACAACTTTCAGCAATGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC--AAG-----AA---TCGGATTGGAGTTGGG-TTTGCTGGCTAGTCGGCTCTCCTTAAAAGTATTAGCAAGTCGATCTTGACGGGGCGGCTTCTGATCATCGTCAGAAGCGTCATAGG-------AAGCTTGCTTT-GAATG----ATGGT-ATT-G-AA-G-------GCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Octaviania mortae JPN, Kyoto JN257995 ' GATCATTATTGAATAAAAAA-GATTGTTGCTGGCTAGG-TGATTCT-AGCATGTGCACATCTACCATCCACACCTGTGCACCTATTGTAGATCTAG------TGGA-TCTATGT-TACACTAATTGTATGTCC-TAGAATG--TTTT-TACAACTTTCAGCAATGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCAAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC--TAG-T---GATT-TAGGATTGGACTTGGGATTTGCTGGCTAGTCAGCTATCCTTAAATGCATTAGTGAGTGAATCTTGACAGCACGGCCTGTTTTGATCGTTGGAAGTGTCATAGG-------AAGCTTGCTTAT-AAC-----GT----AT--------TG-AC-------TTGACCTCAAATCAGGTAGGATTACCCGCT 'Octaviania nonae JPN, Amami-oshima Isl. JN257985' GATCATTATTGAA-AA--AA-GATTGTTGCTGGCT-------TT-T-AGCATGTGCACATCTACC{AC}TCCACACCTGTGCATCTATTGTAGATCTAG------TGGA-TCTATGT-TACACTAATTGTATGTCC-TAGTATAA-AA--TTACAACTTTCAGCAATGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCCTTGGTATTCCAAGGAGTATGCCTGTTTGAGTGTCATTTAATTATCAAC-----------ATTTTAGGATTGGACTTGGGATTTGCTGGCTAGTCAGCTATCCTTAAATGCAT--GTA--------TTGACGGCACGGCCTGTTCTGATCGTTGGAAGCGTC------------AA-TTT--TTATTAAC------T----AT--------TG-AC-------TTGACCTCAAATCAGGTAGGACTACCCGCT 'Octaviania tasmanica AUS, TAS OSC 132097 KP222909' GATCATTATCGCACGA--AATGGCTGTCGCTGGCTAGG-TGATTCT-AGCACGTGCACGTCTATCTTCCACACCTGTGCACCTATTGTAGATTTTA------TGG--TCTATGT-CACACTAAATGTATGTCCTTTGAATGT-ATTT-TACAACTTTCAGCAATGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTGATTATCAAC--TAG-CTT-GA--ATAGGCTTGGACTTGGGATTTGCTGGCTAGTCAGCTATCCTTAAATGTATTAGCGAGTGAATCTTGACGGCACGGCCTCTGATGATCGTTGG-AGCGTCATAGG-------AAGCTTGCTTTG-AAGA--CAGT-GTCA---------TT-AAT------TTGACCTCAAATCAGGTAGGACTACCCGCT Retiboletus_aff._griseus_CHINA__JQ928613_ ????????????????????????????????????????????????????????????????????CAC-CCTGTGCACC-GT-GTAGGT----CGAAA-AGGA-TCTATGTTCACACCCATCGTATGTCTATAGAATGTGAT-ATTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATCGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCAAGGAGCATGCCTGTTTGAGTGTCATCGAGTTCTCAAG--TGA--TT-AATTATTGACTTGGACTTGGGAGTTGCTGGCT-TTCAGCTCTCCTGAAATGCATCA-T-A-TTAGTTT-GACAGCACGGCCTCCGACGATCGTTGG-AGTGT---AG----------GCTT-CTTG--AA-----------------------------------TGACCTCAAATC????????????????? 'Rossbeevera eucyanea JPN, Tottori KC551981' GATCATTATTGAA-ACACAG-GATTGTTGCTGGCTAG--TAATTCT-AGCATGTGCACGTCTT-CAA-CACACTTGTGAACCTATTGTAGATCGCA------A-GA-TCTATGT-CACATATATCGTATGTCTACAGAATGA-TT-ATTACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-TTAG-CTTTGATTATTGGATTGGACTTGGGAATTGCTGGCCAGTCAGCTGTCCTTAAATATAGTAGCAAGTGA-TTT-TACGGCACGGCCTTTGATGATCGTTGGAAACGT-TT-AAATGTTAGTAGTTTGCTTTT-AATT--AAGT-GG-A-TTT-AT-GTG-AAAA--G--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Rossbeevera griseovelutina JPN, Hyogo HQ693876' GATCATTATCGAAAGAATAG-GATTGTTGCTGGCTAGG-TCATTCT-AGTACGTGCACATCCA-CAA-CACACTTGTGAACCTATTGTAGATCGCA------A-GA-TCTATGTACACATATATCGTATGTCTACAGAATGT--T-ACTACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-CTGG-CTTTGATTATTGGATTGGACTTGGGAATTGCTGGCCGGTCGGCTGTCCTTAAATGCAGTAGCAAGTGA-TTT-TATGGCACGGCCTTTGATGATCGTTGGAAGCAT-TT-AAAAGCTAGTAGTTTGCTTTTATAT-----GT-GG-A-TTT-CT-ATC-AG-ACCA--TTGACCTCAAATCAGGTAGGA????????? 'Rossbeevera pachydermis NZ, North Isl. KJ001089' GATCATTATTGAA-ACACAG-GATTGTTGCTGGCTAG--TCATTCT-AGCACGTGCACATCTTCCAC-CACACTTGTGAACTTACTGTAGATCGCA------A-GA-TCTATGTACACATATATCGTATGTCTACAGAATGT--T-ACTACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-TTAG-CTTTGATTATTGGATTGGAGTTGGGAATTGCTGGTCGATCAGCTGTCCTTAAATGCAGTAGCAAGTGA-TTT-TACGGCACGGCCTTTGATGATCGTTGGAAGCGT-TT-AAAAGCTAGTAGTTTGCTTT--AATT--AAGT-G--AATTT-CT-ATG-AGAA--A--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Rossbeevera vittatispora AUS, VIC KC551977' GATCATTATTGAA-ACACTG-GATTGTTGCTGGCTAG--TCATTCT-AGCACGTGCACATCTTCCAC-CACACTTGTGAACTTATTGTAGATCGCA------A-GA-TCTATGTACACATATATCGTATGTCTACAGAATGT--T-ACTACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-TTAG-CTTTGATTAT{GT}GGATTGGAGTTGGGAATTGCTGGTCGATCAGCTGTCCTTAAATGCAGTAGCAAGTGA-TTT-TACGGCACGGCCTTTGATGATCGTTGGAAGCGT-TT-AAAAGCTAGTAGTTTGCTTT--AATT--AAGT-G--AATTT-CT-ATG-AGAA--A--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Rossbeevera westraliensis AUS, WA KC551980' ?????????????????????????????CTGGCTAG--TCATTCT-AGCACGTGCACATCTTCCAC-CACACTTGTGAACTTATTGTAGATCGCA------A-GA-TCTATGTACACATATATTGTATGTCTACAGAATGT--T-ACTACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-TTAG-CTTTGATTATTGGATTGGAGTTGGGAATTGCTGGTCGATCAGCTGTCCTTAAATGCAGTAGCAAGTGA-TTT-TACGGCACGGCCTTTGATGATCGTTGGAAGCGT-TT-AAAAGCTAGTAGTTTGCTTTT-AATT--AAGT-G--AATTT-CT-ATG-AGAA--A--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Rossbeevera yunnanensis CHINA, Yunnan KC551990' ???CATTATTGAATGAA-TA-GATTGTCGCTGGCTTT----ATT----GCA-GTGCACATCTT--A--CACACTTGTGAACCTATTGTAGATCGCG------A-GA-TCTATGTCCACATATATTGTATGTCTATAGAATGT-AA-A-TACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-TTAG-CTTTGATTATTGGATTGGATTTGGGAATTGCTGGCC-GTCAGCTGTCCTTAAAAGCATTAGCAAGTGA--TT--ATGGCACGGCCTCTAATGATCGTTGGAAGCGT-AT------------GTTTGCTTTTGTATT--A-GT----AAT-------------ACCC--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Uncultured ECM of Lithocarpus densiflorus USA, CA DQ273368' GATCATTAATGAAGAC--AAAGACTGTTGCTGGCTAGG-TGATTCT-AGCACGTGCACGTC-ACTTTTCACACCTGTGCACCTATTGTAGATCGCA------A-GA-TCTATGT-CATATCAATTGTATGTCTATAGAATGT--CAAGTACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC---AA-----GATTATTGGCTTGGACTTGGGATTTGCTGGCTAGTCAGCTTTCCTTAAATGCATTAGCAAATCGATC--GACGGCACGGCCTCTGATGATCGTTGGAAGCGTTAT-GG------AAAGTTTGCTTAT-AATT--GGGTTGTGGGCTGGAA-GTT-ATT------TTGACCTCAAATCAGGTAGGACTACCCGCT 'Uncultured ECM of Tsuga heterophylla, NA FJ152518' GATCATTATTGAATACACAATGACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTACTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTA--AATT----------AATC------TC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Uncultured ECM of Tsuga heterophylla, NA FJ152519' GATCATTATTGAATACACAA-GACTGTCGCTGGCTAGG-TCATTCTTAGCATGTGCACGTCCACTTTCCACACTTGTGCACCAATTGTAGAT--AACGAAA-AGGA-TCTATGTTCTCATCTAATGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-ATAG-CTTT-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTTGGAAGCGTCATAA-------GAAGCTTGCTTT--AATT--GAAT-TTGAATTTGAA-TTC-ATTACCA--TTGACCTCAAATCAGGTAGGACTACCCGCT 'Uncultured ECM, CANADA, BC EU597022 ' ??????????????????????ACTGTTGCTGGCTAGG-TCATTCT-AGCATGTGCACGTC-ACTCTCCACACCTGTG------------AT--AACGAAA-AGGA-TCTATGT-CTCATCTATTGTATGTCCTTAGAATGTAACAAATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTATCAAC-AAAG-CTTC-ATTGTTGGCTTGGACTTGGGATTTGCTGGCCAGTCAGCTGTCCTTAAAAGCATTAGCAAGTGAA--TAGACGGCACGGCCTCTGATGATCGTT??AAG-GTCATAA-------GAAGCTTGCTTA--AATT----------AATC------TC-ATTACC?--TTGACCTCAAATCAGG?AG??????????? ; END; BEGIN TREES; TITLE 'Chamonixia caespitosa Fig. 1 - Bayesian consensus'; LINK TAXA = Taxa2; TRANSLATE 1 'Rossbeevera yunnanensis CHINA, Yunnan KC551990', 2 'Rossbeevera vittatispora AUS, VIC KC551977', 3 'Rossbeevera westraliensis AUS, WA KC551980', 4 'Rossbeevera pachydermis NZ, North Isl. KJ001089', 5 'Rossbeevera griseovelutina JPN, Hyogo HQ693876', 6 'Rossbeevera eucyanea JPN, Tottori KC551981', 7 Leccinum_talamancae_COSTA_RICA__AY544779, 8 'Leccinellum aff. griseum JPN, Hyogo KC552008', 9 Leccinellum_carpini_NETHERLANDS__AF454588L, 10 'Leccinellum quercophilum USA, IL KC691207', 11 Leccinellum_crocipodium_NETHERLANDS__AF454590, 12 'Octaviania nonae JPN, Amami-oshima Isl. JN257985', 13 'Octaviania mortae JPN, Kyoto JN257995 ', 14 'Octaviania celatifilia JPN, Nara JN257997', 15 'Octaviania tasmanica AUS, TAS OSC 132097 KP222909', 16 'Octaviania cyanescens USA, OR KC552006', 17 Octaviania_asterosperma_SPA_JN257998, 18 'Octaviania kobayasii JPN, Kyoto JQ619171', 19 'Octaviania japonimontana JPN, Akita JQ619174', 20 'Octaviania etchuensis JPN, Toyama JQ619182', 21 'Uncultured ECM of Lithocarpus densiflorus USA, CA DQ273368', 22 Chamonixia_caespitosa_USA__HQ647124, 23 'Chamonixia caespitosa JPN, Nagano KPM-NC 18070 KP222907', 24 'Chamonixia caespitosa JPN, Nagano KPM-NC 18071 KP222908', 25 'Uncultured ECM of Tsuga heterophylla, NA FJ152519', 26 Chamonixia_caespitosa_USA__OSC_118291__EU834197, 27 Chamonixia_caespitosa_USA__Trappe_12656__EU846310, 28 'Chamonixia caespitosa GERMANY, Bavaria 92/83 DQ534565', 29 'Chamonixia caespitosa POLAND KRA F-2013-38 KT001255', 30 'Chamonixia caespitosa POLAND KRA F-2014-113 KT001257', 31 'Chamonixia caespitosa POLAND KRA F-2013-60 KT001258', 32 'Chamonixia caespitosa POLAND KRA F-2014-110 KT001259', 33 Chamonixia_caespitosa_SWEDEN__UDB001774, 34 Chamonixia_caespitosa_USA__OSC_117036__EU834198, 35 Chamonixia_caespitosa_USA__Trappe_12768__EU852804, 36 'Chamonixia caespitosa USA Trappe 10517 (isolate p693i) EU669385', 37 'Chamonixia caespitosa USA OSC 117571 (isolate p071i) EU669208', 38 Chamonixia_caespitosa_USA__OSC_117034__EU846243, 39 'Uncultured ECM of Tsuga heterophylla, NA FJ152518', 40 'Uncultured ECM, CANADA, BC EU597022 ', 41 'Leccinum aff. duriusculum JPN, Tottori KC552013', 42 'Leccinum scabrum UK, Scotland KC552012', 43 'Leccinum vulpinum UK, Scotland KC552013', 44 Retiboletus_aff._griseus_CHINA__JQ928613_; TREE Fig._1 = [&R] (44:0.2377,(((((((12:0.04137,13:0.02336):0.0,14:0.03685)1.00:0.08508,(15:0.05123,17:0.08122)0.81:0.0194)0.78:0.02087,16:0.02688):0.0,((18:0.12087,19:0.04001)1.00:0.04142,20:0.01978)1.00:0.07764)0.99:0.0445,(21:0.11548,((((((((22:0.00224,23:0.00203):0.0,24:0.00203)0.96:0.00488,25:0.00207):0.0,26:0.00204):0.0,27:0.00244):0.0,((((29:0.0019,30:0.00191):0.0,31:0.00195):0.0,32:0.00193):0.0,33:0.00193)0.77:0.00815)0.61:0.00586,28:0.01136)0.82:0.02194,((((((34:0.00216,35:0.00217):0.0,36:0.0022):0.0,37:0.00216):0.0,38:0.00217):0.0,39:0.00219):0.0,40:0.0026)0.92:0.02449)1.00:0.08709)0.85:0.04616)0.70:0.03211,((((1:0.06042,((((2:0.00438,3:0.00601):0.0,4:0.0055)1.00:0.02216,5:0.06207)0.91:0.02247,6:0.04162)1.00:0.07222)1.00:0.05813,7:0.1128)0.65:0.02919,(8:0.01885,9:0.02996)0.52:0.01457)0.93:0.04048,((10:0.09007,((41:0.02165,42:0.00607):0.0,43:0.01176)1.00:0.141)0.60:0.02366,11:0.03868)0.95:0.04113)0.51:0.02716):0.0316); END; BEGIN TREES; TITLE 'Chamonixia caespitosa Fig. 2 - MLT based on the infrageneric dataset'; LINK TAXA = Taxa1; TRANSLATE 1 'Uncultured ECM of Lithocarpus densiflorus USA, CA DQ273368', 2 Chamonixia_caespitosa_USA__HQ647124, 3 'Chamonixia caespitosa JPN, Nagano KPM-NC 18070 KP222907', 4 'Chamonixia caespitosa JPN, Nagano KPM-NC 18071 KP222908', 5 'Uncultured ECM of Tsuga heterophylla, NA FJ152519', 6 Chamonixia_caespitosa_USA__OSC_118291__EU834197, 7 Chamonixia_caespitosa_USA__Trappe_12656__EU846310, 8 'Chamonixia caespitosa GERMANY, Bavaria 92/83 DQ534565', 9 'Chamonixia caespitosa POLAND KRA F-2013-38 KT001255', 10 'Chamonixia caespitosa POLAND KRA F-2014-113 KT001257', 11 'Chamonixia caespitosa POLAND KRA F-2013-60 KT001258', 12 'Chamonixia caespitosa POLAND KRA F-2014-110 KT001259', 13 Chamonixia_caespitosa_SWEDEN__UDB001774, 14 Chamonixia_caespitosa_USA__OSC_117036__EU834198, 15 Chamonixia_caespitosa_USA__Trappe_12768__EU852804, 16 'Chamonixia caespitosa USA Trappe 10517 (isolate p693i) EU669385', 17 'Chamonixia caespitosa USA OSC 117571 (isolate p071i) EU669208', 18 Chamonixia_caespitosa_USA__OSC_117034__EU846243, 19 'Uncultured ECM of Tsuga heterophylla, NA FJ152518', 20 'Uncultured ECM, CANADA, BC EU597022 '; TREE Fig._2 = [&R] (((20:1.20459326510094E-6,(17:1.20459326510094E-6,(16:1.20459326510094E-6,((14:1.20459326510094E-6,19:1.20459326510094E-6)5:1.20459326510094E-6,(18:1.20459326510094E-6,15:1.20459326510094E-6)6:1.20459326510094E-6)5:1.20459326510094E-6)8:1.20459326510094E-6)34:1.20459326510094E-6)98:1.20459326510094E-6,((((((13:1.20459326510094E-6,((12:1.20459326510094E-6,11:1.20459326510094E-6)14:1.20459326510094E-6,(9:1.20459326510094E-6,10:1.20459326510094E-6)10:1.20459326510094E-6)30:1.20459326510094E-6)100:0.023687084256695863,(2:1.20459326510094E-6,(3:1.20459326510094E-6,4:1.20459326510094E-6)47:1.20459326510094E-6)94:0.010847895448901721)20:1.20459326510094E-6,6:1.20459326510094E-6)11:1.20459326510094E-6,5:1.20459326510094E-6)17:1.20459326510094E-6,7:1.20459326510094E-6)96:0.011016386251779553,8:0.035325291120561424)93:0.13393674532727484):0.43873383240129404,1:0.43873383240129404); END;