#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 16:38 GMT TreeBASE (cc) 1994-2008 Study reference: Siahaan S.A., Hidayat I., Kramadibrata K., Meeboon J., & Takamatsu S. 2015. Phyllactinia poinsettiae sp. nov.: a new species of powdery mildew on poinsettia from Indonesia. Mycoscience, 56(6): 580-583. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17332] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=39; TAXLABELS Ovulariopsis_poinsettiae_ex_Euphorbia_MUMH5670 Ovulariopsis_poinsettiae_ex_Euphorbia_MUMH5689 Ovulariopsis_poinsettiae_ex_Euphorbia_MUMH5709 Phyllactinia_actinidiae_ex_Actinidia_MUMH139 Phyllactinia_actinidiae_ex_Actinidia_MUMH428 Phyllactinia_actinidiae_ex_Actinidia_MUMH497 Phyllactinia_ailanthi_ex_Ailanthus_MUMH143 Phyllactinia_alngii_ex_Alangium_MUMH88 Phyllactinia_alni_ex_Alnus_MUMH522 Phyllactinia_betulae_ex_Betula_MUMH503 Phyllactinia_betulae_ex_Betula_MUMH506 Phyllactinia_enkianthi_ex_Lyonia_MUMH391 Phyllactinia_enkianthi_ex_Lyonia_MUMH479 Phyllactinia_enkianthi_ex_Lyonia_MUMH527 Phyllactinia_enkianthi_ex_Menziesia_MUMH500 Phyllactinia_enkianthi_ex_Rhododendron_MUMH473 Phyllactinia_enkianthi_ex_Rhododendron_MUMH508 Phyllactinia_enkianthi_ex_Rhododendron_SMK17204 Phyllactinia_hamamelidis_ex_Hamamelis_MUMH38 Phyllactinia_hamamelidis_ex_Hamamelis_MUMH425 Phyllactinia_hamamelidis_ex_Hamamelis_MUMH45 Phyllactinia_juglandis_ex_Juglans_TUAMH2072 Phyllactinia_juglandis_ex_Platycarya_HMAS41384 Phyllactinia_juglandis_ex_Pterocarya_TUAMH3507 Phyllactinia_kakicola_ex_Diospyros_MUMH19 Phyllactinia_kakicola_ex_Diospyros_MUMH251 Phyllactinia_linderae_ex_Litsea_TUAMH2927 Phyllactinia_linderae_ex_Pseudosassafras_HMAS40347 Phyllactinia_magnoliae_ex_Magnolia_MUMH58 Phyllactinia_magnoliae_ex_Magnolia_MUMH59 Phyllactinia_magnoliae_ex_Magnolia_MUMH859 Phyllactinia_roboris_ex_Castanea_MUMH591 Phyllactinia_salmonii_ex_Paulownia_MUMH55 Phyllactinia_salmonii_ex_Paulownia_MUMH582 Phyllactinia_sapii_ex_Sapium_MUMH53 Phyllactinia_sp_ex_Picrasma_MUMH893 Phyllactinia_toonae_ex_Cedrela_HMAS41428 Phyllactiniaalni_ex_Alnus_MUMH157 Phyllactiniaalni_ex_Alnus_MUMH449 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M30603] TITLE 'Phyllactinia poinsettiae ITS+28S'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1259; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ovulariopsis_poinsettiae_ex_Euphorbia_MUMH5670 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTCAAATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCGCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC--AAAAACAAGACCCACGGCGTCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCGCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTCTAAGGGGG Ovulariopsis_poinsettiae_ex_Euphorbia_MUMH5689 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTCAAATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCGCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC--AAAAACAAGACCCACGGCGTCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCGCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTCTAAGGGGG Ovulariopsis_poinsettiae_ex_Euphorbia_MUMH5709 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTCAAATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCGCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC--AAAAACAAGACCCACGGCGTCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCGCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTCTAAGGGGG Phyllactinia_actinidiae_ex_Actinidia_MUMH139 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AAAGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGTGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_actinidiae_ex_Actinidia_MUMH428 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-AAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_actinidiae_ex_Actinidia_MUMH497 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AAAGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGTGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_ailanthi_ex_Ailanthus_MUMH143 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCTGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATCTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGAG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTCTTGGCTTGGTCTTGGGGCTCGCCCGCAGCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGCGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTC-TTGCGCGACGTGACTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGCGTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACTGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactinia_alngii_ex_Alangium_MUMH88 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGCAGGTGAGAACCCTTTAAGGGGG Phyllactinia_alni_ex_Alnus_MUMH522 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATATGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGT--CAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGGTCTCTCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGTATCGACGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactinia_betulae_ex_Betula_MUMH503 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCTGCTGG-CCGTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGCGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGCCTTTGCGCGGCGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactinia_betulae_ex_Betula_MUMH506 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCTGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGGAAAATAAAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGCGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGCCTTTGCGCGACGTGTCTCTTCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTATCGTCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactinia_enkianthi_ex_Lyonia_MUMH391 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTCGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTGTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_enkianthi_ex_Lyonia_MUMH479 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTCGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTGTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_enkianthi_ex_Lyonia_MUMH527 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTCGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTGTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_enkianthi_ex_Menziesia_MUMH500 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATATGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-AAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC--AAAA--AAGACCCACGGCGTCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCGCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_enkianthi_ex_Rhododendron_MUMH473 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATATGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-AAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCGCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_enkianthi_ex_Rhododendron_MUMH508 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATATGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-AAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCGCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_enkianthi_ex_Rhododendron_SMK17204 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGTCTC-TCTCAATGG---------------------------------------------------------------------------------TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCGCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_hamamelidis_ex_Hamamelis_MUMH38 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCCGGGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGCCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_hamamelidis_ex_Hamamelis_MUMH425 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCCGGGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGCCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_hamamelidis_ex_Hamamelis_MUMH45 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCCGGGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGCCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_juglandis_ex_Juglans_TUAMH2072 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGT---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATATGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGAG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCAGCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGCGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTC-TTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGCGTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACTGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactinia_juglandis_ex_Platycarya_HMAS41384 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGT-------AAAACCTGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTATTTTGGAACAA-CGCGTGTTATTTGGTGTAGTCTGAGT-CCCATGTGAA-AAAT-AAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCAACTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGCGGCCACTGGATCCAGCCAAAAAAACAAGACCCACGGCGTC-TTGCGCGACGTGGTCTCTCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCTATAAGCGGA--------------------------TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGCGTCGTCGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_juglandis_ex_Pterocarya_TUAMH3507 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCTGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATATGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGT-ACAATGTGAG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGTTC-TGGCTTGGTCTTGGGGCTCGCCCGCACCCGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGCGG-CACTGGATCCAGCC---AAA--ATGACCCACGGCGTC-TTGCGCGACGTGGCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGTATCGACGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGGGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactinia_kakicola_ex_Diospyros_MUMH19 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCGTTGCGCGTCGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCATCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCGTTAAGGGGG Phyllactinia_kakicola_ex_Diospyros_MUMH251 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCATCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_linderae_ex_Litsea_TUAMH2927 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCTGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTGA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAATAAAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGCGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGCCTTTGCGCGACGTGTCTCTTCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGCGTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACTGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactinia_linderae_ex_Pseudosassafras_HMAS40347 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCTGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAATAAAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGCGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGCCTTTGCGCGACGTGTCTCTTCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA---------------------TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTATCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactinia_magnoliae_ex_Magnolia_MUMH58 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCCGGGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACTCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACTCACGGCGCCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGTATCGACGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactinia_magnoliae_ex_Magnolia_MUMH59 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCCGGGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACTCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACTCACGGCGCCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_magnoliae_ex_Magnolia_MUMH859 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCCGGGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACTCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACTCACGGCGCCTTTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_roboris_ex_Castanea_MUMH591 ACCCGTGTCGATGTTTATCTGCTGTTGCTTTGGCAGGCC-GGGGCCGCCATGCGGACCTGCCGGCCTCTATGGCTGGAGCGTGCCTGCCAGAGA-----------AATCTG-------ACAA-CTCGTGTGA-TTGGTGAAGTCTGAGCAATGAAGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCTGCTC-CGGCTTGGTCTTGGGGCTCGCCCGCGCAAGCGTGGCGACCCTTAAACACAGTGGCGGTACCGGTGGTGCTCTCCGCGTAGTCACGTTTCTCGCGACAGGGCGG-CACTGGATCCAGCC----AG--AAGATAGCCGGCGTCTTTGTGCGTCGTCACTT-ACTCTATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGCGTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTTGGAACGTGGCTCTTTTCGGAGAGTGTTATAGCCTGCAACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_salmonii_ex_Paulownia_MUMH55 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAAAGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCTAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGACTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_salmonii_ex_Paulownia_MUMH582 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAAAGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGACTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_sapii_ex_Sapium_MUMH53 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGAGCCTGCCAGAGAATGTA-TTTC-AATATGTTTTGGAACAACCTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCGTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCAGCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGCGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTC-TTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGCGTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactinia_sp_ex_Picrasma_MUMH893 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGGCCCCTTGGGCTGGAGCGTGTCTGCCAGAGAAAGTATTTTC-AATGTGTTTTGGAACAA-CTCGTGTTA-TTGGTGGAGTCTGAGC-ACAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CGCTGGATCCAGCC---AAG--AAGACCCACGGCGTCTTTGCGCGACGTGTC---TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTCTCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTAAGGGGG Phyllactinia_toonae_ex_Cedrela_HMAS41428 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCTGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATATGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGC-ACAATGTGAG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCAGCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGCGG-CACTGGATCCAGCC---AAA--ACGACCCACGGCGTC-TTGCGCGACGTGTCTC-TCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGTATCGACGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactiniaalni_ex_Alnus_MUMH157 ACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATATGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGT--CAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGGTCTCTCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGTATCGACGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactiniaalni_ex_Alnus_MUMH449 ACCCGTGTCGATTTTATTCTCCTGTTGCTTTGGCAGGCC-GGGGC---------AACCCGCTGG-CCCTTGGGCTGGAGCGTGCCTGCCAGAGAATGTATTTTC-AATATGTTTTGGAACAA-CTCGTGTTA-TTGGTGAAGTCTGAGT--CAATGTGGG-AAAT-TAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCGCTC-TGGCTTGGTCTTGGGGCTCGCCCGCATCTGCGCGGCGTCCCTTAAACCCAGTGGCGGAACCGGTGGTGCTCTCCGCGTAGTCACG-TTCTCGCGACAGGGTGG-CACTGGATCCAGCC---AAA--AAGACCCACGGCGTCTTTGCGCGACGTGGTCTCTCTCAATGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGTATCGACGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGT--TCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'Phyllactinia poinsettiae ITS+28S') = N: 1-1259; CODONPOSSET CodonPositions (CHARACTERS = 'Phyllactinia poinsettiae ITS+28S') = N: 1-1259; END; BEGIN TREES; TITLE 'Phyllactinia poinsettiae ITS+28S'; LINK TAXA = Taxa1; TRANSLATE 1 Ovulariopsis_poinsettiae_ex_Euphorbia_MUMH5670, 2 Ovulariopsis_poinsettiae_ex_Euphorbia_MUMH5689, 3 Ovulariopsis_poinsettiae_ex_Euphorbia_MUMH5709, 4 Phyllactinia_kakicola_ex_Diospyros_MUMH251, 5 Phyllactinia_kakicola_ex_Diospyros_MUMH19, 6 Phyllactinia_alngii_ex_Alangium_MUMH88, 7 Phyllactinia_enkianthi_ex_Rhododendron_SMK17204, 8 Phyllactinia_actinidiae_ex_Actinidia_MUMH497, 9 Phyllactinia_enkianthi_ex_Menziesia_MUMH500, 10 Phyllactinia_enkianthi_ex_Rhododendron_MUMH508, 11 Phyllactinia_enkianthi_ex_Rhododendron_MUMH473, 12 Phyllactinia_salmonii_ex_Paulownia_MUMH582, 13 Phyllactinia_salmonii_ex_Paulownia_MUMH55, 14 Phyllactinia_sp_ex_Picrasma_MUMH893, 15 Phyllactinia_actinidiae_ex_Actinidia_MUMH139, 16 Phyllactinia_actinidiae_ex_Actinidia_MUMH428, 17 Phyllactinia_enkianthi_ex_Lyonia_MUMH527, 18 Phyllactinia_enkianthi_ex_Lyonia_MUMH479, 19 Phyllactinia_enkianthi_ex_Lyonia_MUMH391, 20 Phyllactinia_magnoliae_ex_Magnolia_MUMH59, 21 Phyllactinia_hamamelidis_ex_Hamamelis_MUMH425, 22 Phyllactinia_hamamelidis_ex_Hamamelis_MUMH45, 23 Phyllactinia_hamamelidis_ex_Hamamelis_MUMH38, 24 Phyllactinia_magnoliae_ex_Magnolia_MUMH58, 25 Phyllactinia_toonae_ex_Cedrela_HMAS41428, 26 Phyllactinia_alni_ex_Alnus_MUMH522, 27 Phyllactiniaalni_ex_Alnus_MUMH157, 28 Phyllactiniaalni_ex_Alnus_MUMH449, 29 Phyllactinia_ailanthi_ex_Ailanthus_MUMH143, 30 Phyllactinia_betulae_ex_Betula_MUMH506, 31 Phyllactinia_sapii_ex_Sapium_MUMH53, 32 Phyllactinia_juglandis_ex_Juglans_TUAMH2072, 33 Phyllactinia_linderae_ex_Pseudosassafras_HMAS40347, 34 Phyllactinia_linderae_ex_Litsea_TUAMH2927, 35 Phyllactinia_betulae_ex_Betula_MUMH503, 36 Phyllactinia_magnoliae_ex_Magnolia_MUMH859, 37 Phyllactinia_juglandis_ex_Pterocarya_TUAMH3507, 38 Phyllactinia_juglandis_ex_Platycarya_HMAS41384, 39 Phyllactinia_roboris_ex_Castanea_MUMH591; TREE Fig._2 = [&R] ((((((((((((((1,(2,3)),((4,6),5)),(7,(9,(10,11)))),16),((8,15),(17,(18,19)))),((12,13),14)),(21,(22,23))),(20,36)),(24,((25,37),((26,27),28)))),((30,33),35)),((29,32),31)),34),38),39); END;