#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 19:45 GMT TreeBASE (cc) 1994-2008 Study reference: Tang S. 2017. Podosphaera paracurvispora (Erysiphaceae, Ascomycota), a new powdery mildew species on Pyrus from China. Mycoscience, 58(2): 116-120. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17446] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=13; TAXLABELS Cystotheca_lanestris_AB022353 Cystotheca_wrightii_AB022355 Podospaera_paracurvispora_KP972565 Podosphaera_aphanis_AB525933 Podosphaera_clandestina_AB525931 Podosphaera_clandestina_AB525932 Podosphaera_longiseta_AB022423 Podosphaera_pannosa_AB022347 Podosphaera_pannosa_AB525937 Podosphaera_spiraeae_AB022384 Podosphaera_tridactyla_tridactyla_AB022393 Podosphaera_xanthii_AB462784 Podosphaera_xanthii_AB462785 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=22; TAXLABELS Cystotheca_lanestris_AB000933 Cystotheca_wrightii_AB000932 'Podospaera paracurvispora Ex_Pyrus_ussuriensi_KP757181' Podosphaera_aphanis_AB525933 Podosphaera_aphanis_aphanis_AB026136 Podosphaera_clandestina_AB525930 Podosphaera_clandestina_AB525931 Podosphaera_curvispora_AB525928 Podosphaera_ferruginea_ferruginea_AB026152 Podosphaera_ferruginea_ferruginea_AB027232 Podosphaera_leucotricha_AB027231 Podosphaera_leucotricha_EU148597 Podosphaera_leucotricha_HM579838 Podosphaera_longiseta_AB000945 Podosphaera_pannosa_AB525937 Podosphaera_pannosa_AB525939 Podosphaera_pannosa_KM001669 Podosphaera_spiraeae_AB022385 Podosphaera_spiraeae_AB525940 Podosphaera_spiraeae_KF500426 Podosphaera_tridactyla_tridactyla_AB000943 Podosphaera_xanthii_AB040340 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M51257] TITLE Podosphaera_28S; LINK TAXA = Taxa1; DIMENSIONS NCHAR=670; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Cystotheca_lanestris_AB022353 TGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGAGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTATGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCCCTTGTCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCTGGGGTTCTCCCCGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGAGGAATGTAGCTGTCTCTCGGGGCAGTGTTATAGCCTCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCGGATGTCTT Cystotheca_wrightii_AB022355 TGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTCGGGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGCGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCCCTTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGTCGGGGTTCTCCCCGGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGTGAGGGGAATGTAGCTGTCTCTCGGGGCAGTGTTATAGCCCCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTTAGGGTGCATCATCGACCGATCCGGATGTCTT Podospaera_paracurvispora_KP972565 TGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGGTCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGCGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTCGGGGTTCTCCCTGAGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGACTGGTGGAATGTAGCTGCCT-TC-GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAAGGGTGCATCATCGACCGATCCTGATGTCTT Podosphaera_aphanis_AB525933 TGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCCCGCGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCTCCCTGGGGTACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCCGGTGGAATGTGGCTGCCT-TC-GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCTT Podosphaera_clandestina_AB525931 TGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTCAGGGTTCTCCCTGGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGACTGGTGGAATGTGGCTGCCC-TC-GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCTT Podosphaera_clandestina_AB525932 ??????????????????????????ATCTGGCTCCTTTGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTCAGGGTTCTCCCTGGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGACTGGTGGAATGTGGCTGCCC-TC-GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCTT Podosphaera_longiseta_AB022423 TGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCC-TC-GGGCAGTGTTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTGAGGGTGCATCATCGACCGATCCTGATGTCTT Podosphaera_pannosa_AB022347 TGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGCGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCTCCCTGGGGTACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCT-TC-GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCTT Podosphaera_pannosa_AB525937 TGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGCGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCTCCCTGGGGTACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCT-TC-GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCTT Podosphaera_spiraeae_AB022384 TGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCTCCCTGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCT-TC-GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCTT Podosphaera_tridactyla_tridactyla_AB022393 TGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGGAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCC-TC-GGGCAGTGTTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTGAGGGTGCATCATCGACCGATCCTGATGTCTT Podosphaera_xanthii_AB462784 TGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCT-TT-GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCTT Podosphaera_xanthii_AB462785 TGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCT-TT-GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCTT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M51256] TITLE Podosphaera_ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=490; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cystotheca_lanestris_AB000933 CTGAGCGTGAGGCCACGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTATCT--TCTCATGTTGCTTTGGCGGGCCGGGCCGCGTGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAAAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTGAGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGAGTGGTGACGGGACCTGCCAGAATACCCATCTTAACA-GG Cystotheca_wrightii_AB000932 CTGAGCGTGAGGCCACGCTGGGCGCCTGGCGCCAGGCGTGGCTGACCCTCCACCCGTGTCTATCT--TCTCATGTTGCTTTGGCGGGCCGGGCCCTGTGCCCTCCCGGCGCCTGCTGGGACGCGCCCGCCAGAGCCACCCTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTGGCTTGGTCTTGGAGCGCGCCCCGCGGGGCGGCTCTTAAATGCAGTGGCGGTGCCGTCGGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAAGCCTCATCATACTA-GG 'Podospaera paracurvispora Ex_Pyrus_ussuriensi_KP757181' CTGAGCGTGAGGCCACGCAGGAGACTTC-TCCTGCG--CGGTCGACCCTCCACCCGTGTGAACTA---TTTTTGTTGCTTTGGCAGGCCGGGCTC---GACCTACCGGCTTCGGCTGGGGAGCGCCTGCCAGAGAAGCCCCAACTCGTGTAGTCAGTGCAGTCTGAGTCTAAATT-AATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-ATTCGGCGTCCCCTAAATAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGCATCTCGCGACAGAGCCATGATGGGACCTGCCAGAATACC---CTTCTTTTGG Podosphaera_aphanis_AB525933 CTGAGCGCGAAGCCACGCAGGACGCTTG-TCCTGCG--CGGCTGACCCTCCACCCGTGTGAACTG---ATTTTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTTAGTGCAGTCTGAGAA-AAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTATCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACCTATTTTTTTGG Podosphaera_aphanis_aphanis_AB026136 CTGAGCGCGAAGCCACGCAGGACGCTTG-TCCCGCG--CGGCTGACCCTCCACCCGTGTGAACTG---ATTTTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTTCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTTAGTGCAGTCTGAGAA-AAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTATCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACCTATTTTTT-GG Podosphaera_clandestina_AB525930 CTGAGCGCGAGGCCACGCAGGACACTTG-TCCTGCG--CGGTTGACCCTCCACCCGTGTGAACTG---ATTTTGTTGCTTTGGCGGGCCGGGCTC---GACCCACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTTAGTGCAGTCTGAGAAAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGTGCGCCA-GCTCGGCGTCCCCTAAACGTAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTATCTCGCGACAGAGTTGCACTGAGACCTGCCAGAACCCCCCTTTTTTTATGG Podosphaera_clandestina_AB525931 CTGAGCGCGAGGCCACGCAGGACACTTG-TCCTGCG--CGGTTGACCCTCCACCCGTGTGAACTG---ATTTTGTTGCTTTGGCGGGCCGGGCTC---GACCCACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTTAGTGCAGTCTGAGAAAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGTGCGCCA-GCTCGGCGTCCCCTAAACGTAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTATCTCGCGACAGAGTTGCACTGAGACCTGCCAGAACCCCCCTTTTTTTATGG Podosphaera_curvispora_AB525928 CTGAGCGTGAGGCTACGCAGGACACTTG-TTCTGCG--TGGCCGACCCTCCACCCGTGTGAACTA---TTTGTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGTAGTCAGTGTAGTCTGAGTCTAAATT-AATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCA{AG}AATTTAGTGAATCATCAAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCA-GTTTGGCGTCCCCTAAATACAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCATGTATCTCGCGACAGAGCCACGACGGCGCTTGCCAGAACCCC---ATTCTCTTGG Podosphaera_ferruginea_ferruginea_AB026152 CTGAGCGTGAAGCCACGTAGGGCGCTTG-TCCTGCG--CGGCTGACCCTCCACCCGTGTGAACTG---ATTTTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTTAGTGCAGTCTGAGAA-ACATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTATCTCGCGACAGAGTGGCAATGGGACCTGCCAAAACCCACATATTTTTT-GG Podosphaera_ferruginea_ferruginea_AB027232 CTGAGCGTGAAGCCACGCAGGGCGCCTG-TCCTGCG--CGGCTGACCCTCCACCCGTGTGAACTG---ATTATGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCATGTAGTTAGTGCAGTCTGAGAA-AAACTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GTTCGGCGTCCCCTAAACACAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTATCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACATATTTTTT-GG Podosphaera_leucotricha_AB027231 CTGAGCGTGAGGCCACGCAGGACACTCG-TTCTGCG--CGGCTGACCCTCCACCCGTGTGAACTA---TTTGTGTTGCTTTGGCGGGCCGGGTTC---GACCTACCGGCTCCGGCTGGGGAGCGCCCGCCAGAGAAGCCCCAACTCGTGTAGTTAGTGCAGTCTGAGTCTAAATT-AATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTAGCTTGGTCTTGGGGTGCGCCA-GTGTGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACATATCTCGCGACAGAGCCACCACGGCACCTGCCAGAATCCC---TTTTTCATGG Podosphaera_leucotricha_EU148597 CTGAGCGTGAGGCCACGCAGGACACTCG-TTCTGCG--CGGCTGACCCTCCACCCGTGTGAACTA---TTTGTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGCGCCCGCCAGAGAAGCCCCAACTCGTGTAGTTAGTGCAGTCTGAGTCTAAATT-AATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTAGCTTGGTCTTGGGGTGCGCCA-GTGTGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACATATCTCGCGACAGAGCCACCACGGCACCTGCCAGAATCCC---TTTTTCATGG Podosphaera_leucotricha_HM579838 CTGAGCGTGAGGCCACGCAGGACACTCG-TTCTGCG--CGGCTGACCCTCCACCCGTGTGAACTA---TTTGTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGCGCCCGCCAGAGAAGCCCCAACTCGTGTAGTTAGTGCAGTCTGAGTCTAAATT-AATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTAGCTTGGTCTTGGGGTGCGCCA-GTGTGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACATATCTCGCGACAGAGCCACCACGGCACCTGCCAGAATCCC---TTTTTCATGG Podosphaera_longiseta_AB000945 CCGAGCGCGAGGCCACGCGGGGCGCCTG-TCCTGCGT-TGGCTGACCCTCCACCCGTGTGAACTATATCTATTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTCAGTGTGGTCTGAGTGAATGTGGAATTAA--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTTGCTTGGTCTTGGGGCTCGCCG-GCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATGTATCTCGCGACAGAGCGGCGACGGGACCTGCCAGAAGCCTC-AATTTTCT-AG Podosphaera_pannosa_AB525937 CTGAGCGCGAAGCCACGCAGGACGCTTG-TCCTGCG--CGGCTGACCCTCCACCCGTGTGAACTG---ATTTTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTTAGTGCAGTCTGAGAA-AAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTATCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACCTATTTTTTTGG Podosphaera_pannosa_AB525939 CTGAGCGCGAAGCCACGCAGGACGCTTG-TCCTGCG--CGGCTGACCCTCCACCCGTGTGAACTG---AATTTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTTAGTGCAGTCTGAGAA-AAACTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTATCTCGCGACAGAGTGGCGACGGGACCTGCCAAAACCCACCTATTTTTTTGG Podosphaera_pannosa_KM001669 CTGAGCGCGAAGCCACGCAGGACGCTTG-TCCTGCG--CGGCTGACCCTCCACCCGTGTGAACTG---AATTTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTTAGTGCAGTCTGAGAA-AAACTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTATCTCGCGACAGAGTGGCGACGGGACCTGCCAAAACCCACCTATTTTTTTGG Podosphaera_spiraeae_AB022385 CTGAGCGTGAAGCCACGCAGGGCGCCTG-TCCTGCG--CGGCTGACCCTCCACCCGTGTGAACTG---ATTATGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCATGTAGTTAGTGCAGTCTGAGAA-AAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GTTCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTATCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACATATTTTTT-GG Podosphaera_spiraeae_AB525940 CTGAGCGTGAAGCCACGTAGGGCGCTTG-TCCTGCG--CGGCTGACCCTCCACCCGTGTGAACTG---ATTTTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTTAGTGCAGTCTGAGAA-ACATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCCCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTATCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACATATTTTTT-GG Podosphaera_spiraeae_KF500426 CTGAGCGTGAAGCCACGTAGGGCGCTTG-TCCTGCG--CGGCTGACCCTCCACCCGTGTGAACTG---ATTTTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTTAGTGCAGTCTGAGAA-ACATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCCCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTATCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACATATTTTTT-GG Podosphaera_tridactyla_tridactyla_AB000943 CCGAGCGCGAGGCCACGCAGGGCGCCTG-TCCTGTGT-TGGCTGACCCTCCACCCGTGTGAATTATATCTATTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTCAGTGTTGTCTGAGTGAATGTGGAATTAA--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCG-GCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATGTATCTCGCGACAGAGCGGCGACGGGACCTGCCAGAACCCCCCAATTTTCT-TG Podosphaera_xanthii_AB040340 CTGAGCGCGAGGCCCCGCAGCGCGCACG-CGCTGCGG-CGGTTGACCCTCCACCCGTGTGAACTC--TTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTGAGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC---AGTCTTT-GG ; END; BEGIN TREES; TITLE Podosphaera_ITS; LINK TAXA = Taxa2; TRANSLATE 1 Podosphaera_tridactyla_tridactyla_AB000943, 2 Podosphaera_longiseta_AB000945, 3 Podosphaera_spiraeae_AB022385, 4 Podosphaera_aphanis_aphanis_AB026136, 5 Podosphaera_ferruginea_ferruginea_AB026152, 6 Podosphaera_leucotricha_AB027231, 7 Podosphaera_ferruginea_ferruginea_AB027232, 8 Podosphaera_xanthii_AB040340, 9 Podosphaera_curvispora_AB525928, 10 Podosphaera_clandestina_AB525930, 11 Podosphaera_clandestina_AB525931, 12 Podosphaera_aphanis_AB525933, 13 Podosphaera_pannosa_AB525937, 14 Podosphaera_pannosa_AB525939, 15 Podosphaera_spiraeae_AB525940, 16 Podosphaera_leucotricha_EU148597, 17 Podosphaera_leucotricha_HM579838, 18 Podosphaera_spiraeae_KF500426, 19 Podosphaera_pannosa_KM001669, 20 'Podospaera paracurvispora Ex_Pyrus_ussuriensi_KP757181', 21 Cystotheca_lanestris_AB000933, 22 Cystotheca_wrightii_AB000932; TREE Fig._2 = [&R] ((((1,2),8),(((((3,7),(5,(15,18))),(4,12,13,(14,19))),(10,11)),(((6,16,17),9),20))),(21,22)); END; BEGIN TREES; TITLE Podosphaera_28S; LINK TAXA = Taxa1; TRANSLATE 1 Podosphaera_pannosa_AB022347, 2 Podosphaera_spiraeae_AB022384, 3 Podosphaera_tridactyla_tridactyla_AB022393, 4 Podosphaera_longiseta_AB022423, 5 Podosphaera_xanthii_AB462784, 6 Podosphaera_xanthii_AB462785, 7 Podosphaera_clandestina_AB525931, 8 Podosphaera_clandestina_AB525932, 9 Podosphaera_aphanis_AB525933, 10 Podosphaera_pannosa_AB525937, 11 Podospaera_paracurvispora_KP972565, 12 Cystotheca_wrightii_AB022355, 13 Cystotheca_lanestris_AB022353; TREE Fig._3 = [&R] (((((1,(9,10)),2),((7,8),11)),((3,4),(5,6))),(12,13)); END;