#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 07, 2021; 2:06 GMT TreeBASE (cc) 1994-2008 Study reference: Blonder B.W., Baldwin B.G., Enquist B.J., & Robichaux R.H. 2015. Variation and macroevolution in leaf functional traits in the Hawaiian silversword alliance (Asteraceae). Journal of Ecology, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17478] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=38; TAXLABELS Anisocarpus_madioides_BGB488 Anisocarpus_scabridus_BGB676 Argyroxiphium_caliginis_BGB660 'Argyroxiphium grayanum East_Maui_Art_Medeiros_sn' 'Argyroxiphium grayanum West_Maui_BGB661' Argyroxiphium_kauense_BGB773 Argyroxiphium_sandwicense_subsp._macrocephalum_GDC1239 Argyroxiphium_sandwicense_subsp._sandwicense_BGB657 Carlquistia_muirii_BGB618 Dubautia_arborea_BGB527 Dubautia_ciliolata_subsp._ciliolata_BGB529 Dubautia_ciliolata_subsp._glutinosa_BGB659 Dubautia_herbstobatae_GDC1244 Dubautia_imbricata_BGB667 Dubautia_knudsenii_subsp._filiformis_GDC1234 Dubautia_knudsenii_subsp._knudsenii_GDC1047 Dubautia_knudsenii_subsp._nagatae_GDC1322 Dubautia_laevigata_BGB671 Dubautia_latifolia_BGB675 Dubautia_laxa_subsp._hirsuta_GDC833 Dubautia_laxa_subsp._laxa_BGB662 Dubautia_linearis_subsp._hillebrandii_BGB531 Dubautia_linearis_subsp._linearis_BGB516 Dubautia_menziesii_BGB522 Dubautia_microcephala_GDC1044 Dubautia_paleata_GDC1375 Dubautia_pauciflorula_BGB668 Dubautia_plantaginea_subsp._humilis_GDC1183 Dubautia_plantaginea_subsp._magnifolia_BGB776 Dubautia_plantaginea_subsp._plantaginea_GDC1180 Dubautia_platyphylla_BGB524 Dubautia_raillardioides_BGB670 Dubautia_reticulata_BGB664 Dubautia_scabra_subsp._leiophylla_BGB778 Dubautia_scabra_subsp._scabra_BGB530 Dubautia_sherffiana_BGB515 'Wilkesia gymnoxiphium C76_022' Wilkesia_hobdyi_GDC1150 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M31018] TITLE Silversword_alliance_ITS_sequence_matrix; LINK TAXA = Taxa1; DIMENSIONS NCHAR=647; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Anisocarpus_madioides_BGB488 TCGAATCCTGCATAGCAGAACAACCCGTGAACACGTACAACAACATGGCCTCATGAGGACCGATCAATTTTTGCTTCGCT-CGCGTGTGGCCACGTCGGCTTGTGTTTGTGATTTCCTCTGCGGTACT{CT}ATGGACATGGTGTCGGCACTACAACAA-CCCCCGGCACGGCATGTGCCAAGGAAAACCAAACTTAAGAAGGTCCGTGCAAGTGACCCCCAGTTTCTGGTGTGTTTCATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCG{AG}TGAAGAACGNNNNNNNNNNNNNNNCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTC{GT}CCCCCACCAGCCATCC---ATCGGATGTATTGGATGTGGGCGAAGATTGGTTTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCCCGTTGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGTACGTGTGTTTTGATTCTTGAAGTGGAAGACTCTTAAAATACCCCGGCGTGTTATCTCTTGATGG{AC}GCTTCGA Anisocarpus_scabridus_BGB676 TCGAATCCTGCATAGCAGAACGACCCGTGAACATGTACAACAACATGGCCTCATGAGGACTGATCATTTTTTGCTTCGGTCCGTGTGTGGCCACGTCGGCCTGTGTTTGTGATTTCCTTTGCGGTACTCATGGACATGGTGTTGGCACTACAACAAACCTCCGGCACGGCACGTGCCAAGGAAAACCAAACTTAAGAAGGTCCGTGCAAGTGACTCCCAGTTTCTGGTGTGTTTCATTGTTCGTGGCTTCTTTATAATCATAAA{CT}GACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACTAGCCATCC---ATCGGATGTGTTGGATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCCCGTCGAGATGGATGCACGAGTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCGTTTTGATTCTTGAAGCGGAAGACTCATAAAATACCCCGGCGTGTTGTCTTTTGATGGCGCTTCGA Argyroxiphium_caliginis_BGB660 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTCCTTGCGTCGCCATGTCGGCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCATGTAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTTTAATCATAAATGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCAGTTTGCGGTTGGCTTAAATACGAGTCTTGTCTAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGACGTGTTGTCTTTTGATGGCGCTTTGA 'Argyroxiphium grayanum East_Maui_Art_Medeiros_sn' TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTT{CT}GGTCCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCATGTAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTTTAATCATAAATGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGNNNNNNNNNNNNNTA{CT}TTGGTGTGAATTGCAGA{AT}TCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCAGTTTGCGGTTGGCTTAAATACGAGTCTTGTCTAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGACGTGTTGTCTTTTGATGGCGCTTTGA 'Argyroxiphium grayanum West_Maui_BGB661' TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTCCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCATGTAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTTTAATCATAAATGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGA{AC}GCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCAGTTTGCGGTTGGCTTAAATACGAGTCTTGTCTAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGACGTGTTGTCTTTTGATGGCGCTTTGA Argyroxiphium_kauense_BGB773 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTCCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCATGTAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTTTAATCATAAATGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCAGTTTGCGGTTGGCTTAAATACGAGTCTTGTCTAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGACGTGTTGTCTTTTGATGGCGCTTTGA Argyroxiphium_sandwicense_subsp._macrocephalum_GDC1239 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTCCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCATGTAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTTTAATCATAAATGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGNNNNAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCATCCATCCCTGAC{CT}GGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCAGTTTGCGGTTGGCTTAAATACGAGTCTTGTCTAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGACGTGTTGTCTTTTGATGGCGCTTTGA Argyroxiphium_sandwicense_subsp._sandwicense_BGB657 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTCCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCATGTAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTTTAATCATAAATGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCAGTTTGCGGTTGGCTTAAATACGAGTCTTGTCTAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGACGTGTTGTCTTTTGATGGCGCTTTGA Carlquistia_muirii_BGB618 TCGAATCCTGCATAGCAGAACGACCTGTGAACACGTAAAACAACATGGCCTTATAAGGATGGATCA-CTACTGATTCGCCCCTTGTGTGGCCACGTCAGCTTGTGTTTGTGATTTCCTTTGCGGGACTCATGGACATGATCCTGGCACAATAACAA-CCCCCGGCACGGCATGTGCCAAGGAAAACCAAACTTAAGAAGGCCTGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CACTGTTCGTGGCCTCTTTGTAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCATGTCGCCCCCACCAGCCATCCCTTAGCGGGTGTGTTGGATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCGTCTTGATTCTTGAAGTGGAAGACTCTTAAAATACCCCGGTGTGTTGTCTTTTGATGGCGCTTCGA Dubautia_arborea_BGB527 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGTCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTTGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTAAGGGCACGTCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTTGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGGCGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_ciliolata_subsp._ciliolata_BGB529 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGTCCTGTGTCTGTGAGCTCCTTGGAGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTTGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTAAGGGCACGTCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTTGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGGCATGTTGTCTTTTGATGGCGCTTTGA Dubautia_ciliolata_subsp._glutinosa_BGB659 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGTCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTTGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGNNNNNNNNNNNNNNNCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTAAGGGCACGTCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTTGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGGCATG{GT}TGTCTTTTGATGGCGCTTTGA Dubautia_herbstobatae_GDC1244 TTGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTTCTTTGGTTCTTGTGTGGCCATGTCGTCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAAC{AT}ACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTTGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGA{AT}TCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTAAGGGCACGCCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATTGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCTGGCGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_imbricata_BGB667 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCA{CT}TTGATTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGA{AC}GCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCGTCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-TGTGCCTTCCTACTCTTGAAGCAGAAGACTCTTAAAATACCCTGACGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_knudsenii_subsp._filiformis_GDC1234 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCACATGAGGACTGATCT-ATTTTGCTTCGGTTCTTGCGTGGTCATGTCGGCCTGTGTCTGTGAGCTCCTCGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGATTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGA{AC}GCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCGTCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-TGTGCCTTCCTACTCTTGAAGCAGAAGACTCTTAAAATACCCTGA{CT}GTGTTGTCTTTGGATGGTGCTTTGA Dubautia_knudsenii_subsp._knudsenii_GDC1047 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCACATGAGGACTGATC{AT}-ATTTTGCTTCGGTTCTTGCGTGGTCATGTCGGCCTGTGTCTGTGAGCTCCTCGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTG{AG}TTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCGTCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTAGACAGTCGTCTCGTGT-TGTGCCTTCCTACTCTTGAAGCAGAAGACTCTTAAAATACCCTGACGTGTTGTCTTTGGATGGTGCTTTGA Dubautia_knudsenii_subsp._nagatae_GDC1322 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCACATGAGGACTGATCT-ATTTTGCTTCGGTTCTTGCGTGGTCATGTCGGCCTGTGTCTGTGAGCTCCTCGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGATTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGA{AC}GCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCGTCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-TGTGCCTTCCTACTCTTGAAGCAGAAGACTCTTAAAATACCCTGACGTGTTGTCTTTGGATGGTGCTTTGA Dubautia_laevigata_BGB671 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACGTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTCGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGATTCCCAGTTTCTGGTGTGTT-CAATGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATTTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-TGTGCCTTCCTACTCTTGAAGCAGAAGACTCTTAAAATACCCTGACGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_latifolia_BGB675 TCGAATCCTGCACAGCAGAATGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTCCTTG{CT}GTGGCCATGTCGGCCTGTGTTTGTGAGCTCCTCGGTGGGACTCATGGACATGATGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTTCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTCCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTCGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGAC{AG}TGTTGTCTTTTGATGGCGCTTTGA Dubautia_laxa_subsp._hirsuta_GDC833 TCGAATCCTGCACAGCAGAACGACCCGTGAACA{CT}GTACAACAACCTGGCCACATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTCGGCGGGACTCATGGGCATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCA{CT}GTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGATTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCGTCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-TGTGCCTTCCTACTCTTGAAGCAGAAGACTCTTAAAATACCCTGACGTGTTGTCTTTGGATGGTGCTTTGA Dubautia_laxa_subsp._laxa_BGB662 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCACATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTCGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGATTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGCCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNNNNTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCGTCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-TGTGCCTTCCTACTCTTGAAGCAGAAGACTCTTAAAATACCCTGACGTGTTGTCTTTGGATGGTGCTTTGA Dubautia_linearis_subsp._hillebrandii_BGB531 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGTCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTTGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGC{AG}TCGATGAAGAACGNNNNNNNNNNNNNNNNTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTAAGGGCACGTCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTTGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGGCGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_linearis_subsp._linearis_BGB516 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGTCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTTGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGNAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTAAGGGCACGTCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTTGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGGCGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_menziesii_BGB522 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGTCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTTTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTTGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTAAGGGCACGTCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGGCGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_microcephala_GDC1044 TCGAATCCTGCACAGCAGAACGACCCGTGAACAAGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTCGGCGTGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGATTCCCAGTTT{CT}TGGTGTGTT-CATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGTGTCACGTCGCCCCCACCATCCATCCCTGACCAGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-TGTGCCTTCCTACTCTTGAAGCAGAAGACTCTTAAAATACCCTGACGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_paleata_GDC1375 TCGAATCCTGCACAGCAGAATGACCCGTGAACATGTACAACAACCTGGCCTCGTGAGGACTGATCA-GTTTTGCTTCGGTCCTTGCGTGGCCATGTCGGCATGTGTCTGTGAGCTCCTCGGTGGGACTCATGGACATGCTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCTCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCATCATCCATCCCTGACCGGATGTGTTG-ATGTGGACGGAAATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTCGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACGCAGTCGGCTCGTGT-TGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCTGACGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_pauciflorula_BGB668 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCACATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGGCCTGTGTATGTGAGCTCCTCGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGATTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGA{AC}GCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCGTCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-TGTGCCTTCCTACTCTTGAAGCATAAAACTCTTAAAATACCCTGACGTGTTGTCTTTGGATGGTGCTTTGA Dubautia_plantaginea_subsp._humilis_GDC1183 TCGAATCCTGCACAGCAGAACGACCCGTGAACAAGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTCGGCGTGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTG{AG}TTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCGTCACGTCGCCCCCACCATCCATCCCTGACCAGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-TGTGCCTTCCTACTCTTGAAGCAGAAGACTCTTAAAATACCCTGACGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_plantaginea_subsp._magnifolia_BGB776 TCGAATCCTGCACAGCAGAACGACCCGTGAACAAGTACAACAACCTGGCCTCATAAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTCGGCGTGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGATTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCGTCACGTCGCCCCCACCATCCATCCCTGACCAGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-TGTGCCTTCCTACTCTTGAAGCAGAAGACTCTTAAAATACCCTGACGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_plantaginea_subsp._plantaginea_GDC1180 TCGAATCCTGCACAGCAGAACGACCCGTGAACAAGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGGCCTGTGTCTGTGAGCTCCTCGGCGTGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGATTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCGTCACGTCGCCCCCACCATCCATCCCTGACCAGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-TGTGCCTTCCTACTCTTGAAGCAGAAGACTCTTAAAATACCCTGACGCGTTGTCTTTTGA{CT}GGCGCTTTGA Dubautia_platyphylla_BGB524 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGTCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTTTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTTGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTAAGGGCACGTCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGGCGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_raillardioides_BGB670 TCGAATCCTGCACAGCAGAATGACCCGTGAACACGTACAACAACCTGGCCTCGTGAGGACTGATCA-ATTTTGCTTCGGTCCTTGCGTGGCCATGTCGGCATGTGTCTGTGAGCTCCTCGGTGGGACT{CT}ATGGACATGCTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCTCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGACGGAAATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTCGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACGCAGTCGGCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCTGACGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_reticulata_BGB664 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGTCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTTTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTTGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTAAGGGCACGTCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGGCGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_scabra_subsp._leiophylla_BGB778 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGTCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CACTCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTTGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGC{AG}TCGATGAAGAACGNAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTAAGGGCACGTCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTTGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGG{AC}GTGTTGTCTTTTGATGGCGCTTTGA Dubautia_scabra_subsp._scabra_BGB530 TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTTCTTGCGTGGCCATGTCGTCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTTGCTTCTTTATAATC{AG}TAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTAAGGGCACGTCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATGGACGCACGACTTGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCCGGCGTGTTGTCTTTTGATGGCGCTTTGA Dubautia_sherffiana_BGB515 TTGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTTCTTTGGTTCTTGTGTGGCCATGTCGTCCTGTGTCTGTGAGCTCCTTGGCGGGACTCATGGACATGTTGTCGGCACAAC{AT}ACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGT{AG}TT-CATTGTTCGTTGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTAAGGGCACGCCTGCCTGGGCGTCATGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATGTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTTGTCGAGATTGACGCACGACTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGACTCTTAAAATACCCTGGCGTGTTGTCTTTTGATGGCGCTTTGA 'Wilkesia gymnoxiphium C76_022' TCGAATCCTGCACAGCAGAATGACCCGTGAACATGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTCCTTGCGTGGCCATGTCGGCC--TGTCTGTGAGCTCCTTGGTGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTTTAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCTTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATTTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTCGTCGAGATGGACGCACGATTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGA--CTTAAAATACCCCGACGTGTTGTCTTTTGATGGCGCTTTGA Wilkesia_hobdyi_GDC1150 TCGAATCCTGCACAGCAGAATGACCCGTGAACATGTACAACAACCTGGCCTCATGAGGACTGATCA-ATTTTGCTTCGGTCCTTGCGTGGCCATGTCGGCC--TGTCTGTGAGCTCCTTGGTGGGACTCATGGACATGTTGTCGGCACAACAACAA-CCCCCGGCACGGCACGTGCCAAGGAAAACCAAACTTTAGAAGGTCCGTGCAATTGACTCCCAGTTTCTGGTGTGTT-CATTGTTCGTGGCTTCTTTTTAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGNNNNNNNNNNNNNTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCTTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCATCCATCCCTGACCGGATTTGTTG-ATGTGGGCGGAGATTGGTCTCCCGTGTCCATGATGCGGTTGGCCTAAATACGAGTCTCGTCGAGATGGACGCACGATTAGTGGTGGTTGATTACACAGTCGTCTCGTGT-CGTGCCTTCCTATTCTTGAAGCAGAAGA--CTTAAAATACCCCGACGTGTTGTCTTTTGATGGCGCTTTGA ; END; BEGIN SETS; CHARSET its (CHARACTERS = Silversword_alliance_ITS_sequence_matrix) = 1-260 425-647; CHARSET 5_8S (CHARACTERS = Silversword_alliance_ITS_sequence_matrix) = 261-424; END; BEGIN TREES; TITLE Maximum_clade_credibility_for_Hawaiian_silversword_alliance_ITS; LINK TAXA = Taxa1; TRANSLATE 1 Anisocarpus_scabridus_BGB676, 2 Anisocarpus_madioides_BGB488, 3 Carlquistia_muirii_BGB618, 4 'Wilkesia gymnoxiphium C76_022', 5 Wilkesia_hobdyi_GDC1150, 6 Argyroxiphium_caliginis_BGB660, 7 Argyroxiphium_sandwicense_subsp._sandwicense_BGB657, 8 Argyroxiphium_sandwicense_subsp._macrocephalum_GDC1239, 9 'Argyroxiphium grayanum West_Maui_BGB661', 10 'Argyroxiphium grayanum East_Maui_Art_Medeiros_sn', 11 Argyroxiphium_kauense_BGB773, 12 Dubautia_menziesii_BGB522, 13 Dubautia_arborea_BGB527, 14 Dubautia_raillardioides_BGB670, 15 Dubautia_paleata_GDC1375, 16 Dubautia_plantaginea_subsp._plantaginea_GDC1180, 17 Dubautia_plantaginea_subsp._humilis_GDC1183, 18 Dubautia_plantaginea_subsp._magnifolia_BGB776, 19 Dubautia_ciliolata_subsp._ciliolata_BGB529, 20 Dubautia_laxa_subsp._laxa_BGB662, 21 Dubautia_laxa_subsp._hirsuta_GDC833, 22 Dubautia_reticulata_BGB664, 23 Dubautia_pauciflorula_BGB668, 24 Dubautia_laevigata_BGB671, 25 Dubautia_latifolia_BGB675, 26 Dubautia_herbstobatae_GDC1244, 27 Dubautia_microcephala_GDC1044, 28 Dubautia_knudsenii_subsp._knudsenii_GDC1047, 29 Dubautia_knudsenii_subsp._nagatae_GDC1322, 30 Dubautia_knudsenii_subsp._filiformis_GDC1234, 31 Dubautia_scabra_subsp._scabra_BGB530, 32 Dubautia_sherffiana_BGB515, 33 Dubautia_platyphylla_BGB524, 34 Dubautia_linearis_subsp._hillebrandii_BGB531, 35 Dubautia_linearis_subsp._linearis_BGB516, 36 Dubautia_ciliolata_subsp._glutinosa_BGB659, 37 Dubautia_imbricata_BGB667, 38 Dubautia_scabra_subsp._leiophylla_BGB778; TREE Fig._2 = [&R] (((2:0.011154890405491998,1:0.011154890405491998):0.007533866753758795,3:0.018688757159250797):0.010679194029014252,((((33:0.0014252917370605484,(12:4.413412761502464E-4,22:4.413412761502464E-4):9.83950460910302E-4):0.004117629960077416,((((34:4.897598589319943E-4,35:4.897598589319978E-4):0.0010668693460853512,(31:4.794489229175726E-4,13:4.7944892291756566E-4):0.0010771802820997798):0.0010852433520744473,(36:8.72811307447395E-4,19:8.72811307447395E-4):0.0017690612496444012):9.08239930438549E-4,38:0.003550112487530349):0.001992809209607616):0.0025335526233330845,(26:4.7401119202143075E-4,32:4.7401119202143075E-4):0.007602463128449695):0.0110057840287454,((((5:5.746202122294992E-4,4:5.746202122294992E-4):0.009923429899008102,((15:0.0024659101408210024,14:0.0024659101408210024):0.006090454569954955,25:0.008556364710776155):0.0019416854004614455):0.003927430767497003,(24:0.008776215953736854,((37:0.005523403498959098,(((17:0.0010355211780741988,27:0.0010355211780741988):6.876060983631027E-4,16:0.0017231272764373015):8.615322124247999E-4,18:0.0025846594888621014):0.0029387440100969962):0.0014997876845137675,(((21:0.0019184843929110403,20:0.0019184843929110403):9.771038080078603E-4,23:0.0028955882009189006):0.0010227261065815499,(28:0.0012816024361443478,(29:3.9764415894839866E-4,30:3.9764415894839866E-4):8.839582771959491E-4):0.0026367118713561026):0.0031048768759724147):0.0017530247702638845):0.0056492649249976525):0.0021592105336327924,(6:0.0026837046895912993,(((9:3.9409795559141106E-4,7:3.9409795559141106E-4):8.512296224777883E-4,(10:4.1655902362237873E-4,11:4.165590236223796E-4):8.287685544468206E-4):4.1982720396909444E-4,8:0.0016651547820382938):0.001018549907553002):0.013900986722776298):0.002497566936849053):0.010285692839048202); END;