#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 18:53 GMT TreeBASE (cc) 1994-2008 Study reference: Sotome K., Matozaki T., Aimi T., & Boonlue S. 2015. Polyporus thailandensis, a new species of group Polyporellus in Polyporus (Polyporales, Agaricomycota) from Northeastern Thailand. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17512] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=13; TAXLABELS Ganoderma_lucidum Lentinus_polychrous Lentinus_squarrosulus Lentinus_tigrinus Perenniporia_tephropora Polyporus_arcularius Polyporus_brumalis Polyporus_ciliatus Polyporus_longiporus_DAOM229479 Polyporus_longiporus_WD2579 'Polyporus thailandensis MSUT_6734' 'Polyporus thailandensis MSUT_6735' Polyporus_tricholoma ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M31098] TITLE Polyporus__LSU_and_ITS_dataset; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1130; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=- GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ganoderma_lucidum GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGAACTCAGCCTTGCTTTTGCTTGGTGCACTTTCCGGATGACGGGTCAGCATCGATTTTGACCGTCGGAAAAGGGCTGGAGTAATGTGGCACCTCC--GGGTGTGTTATAGACTCTGGTCGCATACGACGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGCA-GGGGTTCGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACGC-----------TCTTTACCGGGCTTG-CGGAG---CATATCTGTGCCTGCGTTT-ATCACAAACTCTAT-AAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGC-TTTT------GTGGT--TTGTAGGCTTGGACTTGGA-GGC--TTGTCGGCCG------TTATC--GGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCC-TTGCGGAT-CGGCTCTCGGTGTGATAA-TGTCTACGCCGCGACCG-TGAAGCGTT----T--GGCGAGCTTCTAACC Lentinus_polychrous GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCCGGAACTCAGCCTTCCTCTTGGTTGGTGCACTTTCTGGTAGACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTGGAGAAATGTGGCACCTTT--TGGTGTGTTATAGTCTTCAGTCGCATACGGCGGTTGGGATCGAGGACCGCAGCGCGCCGCAAGGCA-GGGGTTCGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCGAAAGCGAG-AGGGCCCCTTGCGGGGTCAGTCTCGTCGTAGT--AGTGACTGGGCCCACGTCC-ACTATAAACTCTTA-AAAGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACGGG-TTCTTAACCGGACTT--GCTTAGGCTTGGACTTGGA-GGCT-TTGTCGGCTTGCTT--ATGTC-GAGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCCTTTGCGGAT-CGGCTCACGGTGTGATAATTGTCTACGCCGCGACCGTTGAAGCGTTTTAAT--GGCCAGCTTCTAATC Lentinus_squarrosulus GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCCGGAACTCAGCCTTCCTTTTGGTTGGTGCACTTTCTGGTAGACGGGCCAGCATCGATTTTGACCGTAGGATAAGGGCTGGAGAAATGTGGCACCTTC--GGGTGTGTTATAGTCTTCAGTCGCATACTACGGTTGGGATCGAGGACCGCAGCGCGCCGCAAGGCA-GGGGTTCGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCGAAAGCGAGAAAAGGGCCTTCACGGGCTTTTTCTTGCCTAGT--TGTTACTGGGCCTACGTTTCACTACAAACACTTATAAAGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACGGG-TTCTTAACGGGACTT--GCTTAGGCTTGGACTTGGA-GGTTCTTGTCGGCTTGCTTCAATGTC-AAGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTGTGCGGAT-CGGCTCACGGTGTGATAATTGTCTACGCCGCGACCGTTGAAGCGTTTTATA--GGCCAGCTTCTAGTC Lentinus_tigrinus GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCCGGAACTCAGCCTTCCTTTTGGTTGGTGCACTTTCCGGTAGACGGGCCAGCATCGATTTCGACCGTCGGATAAGGGCTGGGGAAATGTGGCACCTTC--GGGTGTGTTATAGTCCTCAGTCGCATACGGCGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGCA-GGGGTTCGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCAAGGGC-------------------GTTTCTTACGCCGGAGT--TGTGACTGGGCCTACGTTT-ACTACAAACTCTTA-CAAGTATCAGAATGTGTATTGCGATGTAACGCATCTCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACGGG-TTCTTAACGGGACTT--GCTTAGGCTTGGACTTGGA-GGCTCTTGTCGGCTTGCTT--TCGTC-AAGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCT-TTGCGGATCCGGCTCACGGTGTGATAATTGTCTACGCCGCGACCGTTGAAGCGTTTTAATGGGACTAGCTTCTAACC Perenniporia_tephropora GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCTTTTGCTTGGTGCACTTTCCGGATGACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGGGTAATGTGGCACCTTC--GGGTGTGTTATAGACCTTAGTCGCATACGGCGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGCA-GGGGTTCGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGA--TGGCGTAGTGAGC-----------CTTT--ACGGGCTTG-TGAAA----GCATCTGTGCCTGCGTTT-ATTATAAACTCTTA-TAAGTAACAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCATCAACCTATAAAC-CTTT-----GTGGGT--TTGTAGGCTTGGATTTGGA-GGC--TTGTCGGCC--------TAAC--AGTCGGCTCCTCTTAAATGCATTAGCTTGATTCC-TTGCGGAT-CGGCTCTCGGTGTGATAATTGTCTACGCCGCGACCG-TGAAGCGTT----T--GGCGAGCTTCTAATC Polyporus_arcularius GTTGTAGCCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTCCGGAACTCAGCCTTCCTTTTGGTTGGTGCACTTTCCGGTAGACGGGCCAGCATCGATTTCGACCGTCGGAAAAGGGCTGGGGAAATGTGGCACCTTTCGGGGTGTGTTATAGTCCTCAGTCGCATACGTCGGTTGGGATCGAGGATCGCAGCGCGCCGCAAGGCA-GGGGTTCGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCGAAGCGAGG-----------GTTTAATCGCTCTCG-CCGAGT--TGTTACTGGGCCTACGTTT-ATCACAAACTCTTA-AAAGTATCAGAATGT-AAACGCG-TCTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACAAG-TTCTTAACGGGGCTT--GCTTAGGCTTGGACTTGGA-GGC--TTGTCGGCTC------TTAGC--AGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCC-TTGCGGAT-CGGCTCACGGTGTGATAATTATCTGCGCCGCGACCGTTGAAGCG-TTTAAT--GGCCAGCTTCTAATC Polyporus_brumalis GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCCGGAACTCAGCCTTCCTTTTGGTTGGTGCACTTTCCGGTAGACGGGCCAGCATCGATTTCGACCGTCGGATAAGGGCTGGGGAAATGTGGCACCTTTCGGGGTGTGTTATAGTCCTCAGTCGCATACGTCGGTTGGGATCGAGGATCGCAGCGCGCCGCAAGGCA-GGGGTTCGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCGAAGCGGGG-----------GCTTAATCGCCTTCG-CCGAGT--TGTTACTGGGCCTACGTTT-ACCACAAACACTTT-AAAGTAACAGAATGT-AATCGCG-TCTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACAAG-TTCTTAACCGGACTT--GCTTAGGCTTGGACTTGGA-GGC--TTGTCGGCTC------TTAGC--AGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCC-TTGCGGAT-CGGCTCACGGTGTGATAATTGTCTACGCCGCGACCGTTGAAGCGTTTTAAT--GGCCAGCTTCTAATC Polyporus_ciliatus GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTCCGGAACTCAGCCTTCCTCTTGGTTGGTGCACTTTCCGGTTGACGGGCCAGCATCAATTTCGACCGTCGGATAAGGGCTGGAGAAATGTGGCACCTTTCGGGGTGTGTTATAGTCTTCAGTCGCATGCGTCGGTTGGGATTGAGGATCGCAGCGCGCCGCAAGGCAGGGGGTTAGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCGAAGCGAGG-----------GCTTAATCGCTCTCG-CCGAGT--TGTTACTGGGCCTACGTTC-ACCACAAACACTTA-TAAGTAACAGAATGTTTATCGCG-TGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCCAACAAGTTTCTTAACGGGACTT--GCTGAGGCTTGGACTTGGA-GGC--TTGTCGGCTC------TCAGCAGAGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCCTTTGCGGAT-CGGCTCACGGTGTGATAATTGTCTACGCCGCGACCGTTGAAGCGTTTTAAT--GGCCAGCTTCTAATC Polyporus_longiporus_DAOM229479 GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTCCGGAACTCAGCCTTCCTCTTGGTTGGTGCACTTTCCGGTTGACGGGCCAGCATCAATTTCGACCGTCGGATAAGGGCTGGAGAAATGTGGCACCTTTCGGGGTGTGTTATAGTCTTCAGTCGCATGCGTCGGTTGGGATTGAGGATCGCAGCGCGCCGCAAGGCAGGGGGTTAGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCGAAGCGAGG-----------GCTTAATCGCTCTCG-CCGAGT--TGTTACTGGGCCTACGTTC-ACCACAAACACTTA-TAAGTAACAGAATGTTTATCGCG-TGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCCAACAAGTTTCTTAACGGGACTT--GCTGAGGCTTGGACTTGGA-GGC--TTGTCGGCTC------TTAGCAGAGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCCTTTGCGGAT-CGGCTCACGGTGTGATAATTGTCTACGCCGCGACCGTTGAAGCGTTTTAAT--GGCCAGCTTCTAATC Polyporus_longiporus_WD2579 GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTCCGGAACTCAGCCTTCCTTTTGGTTGGTGCACTTTCCGGTTGACGGGCCAGCATCAATTTCGACCGTCGGAAAAGGGCTGGGGAAATGTGGCACCTTTCGGGGTGTGTTATAGTCCTCAGTCGCATACGTCGGTCGGGATTGAGGATCGCAGCGCGCCGCAAGGCAGGGGGTTAGCCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTAGGCTTCAGGAGCTTCGAAGCGAGG-----------G{ACT}TTAATCGCTCTCG-CCGAG{ACT}TGTGTGA{CG}TGGGCCTACGTTT-ACCACAAACTCTTA-TAAGTAACAGAATGTTAATCGCG-TGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGG{ACT}ATTCCGAGGAGCATGCCTG{ACT}TTGAG{ACT}G{ACT}CATGAAATTCTCAACCCAACAAG-{ACT}TCTTAACGGGACTTTGCTTGTGGCTTGGACTTGGA-GGA--TTG{ACT}CGGCTCA-----TTAGC--AGTCGGCTCCTCTCAAATGCATTAACTTGGTTCC-TTGCGGAT-CGGCTCACGGTG{ACT}GATAATTGTCTACGCCGCGACCGTTGAAGCG-TTTAAT--GGCCAGCTTCTAATC 'Polyporus thailandensis MSUT_6734' GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCCGGAACTCAGCCTTCCTTTTGGTTGGTGCACTTTCCGGTAGACGGGCCAGCATCGATTTCGACCGTTGGAAAAGGGCTGGAGAAATGTGGCACCTTC--GGGTGTGTTATAGTCTCCAGTCGCATACAGCGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGCA-GGGCTTCGGCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCTCGGGCTGT-----------CATTAGT---------CTGGGT--TGTAACTGGGCCTACGTTT-ATCACAAACTCTTGTAAAGTATCAGAATGTGTATTGCGATATAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACAAG-TTTGTAAC-GAGCTT--GCTTAGGCTTGGACTTGGA-GGC--TTGTCGGCTGT-----TTACC--AGTCGACTCCTCTCAAATG{CT}ATTAGCTTGGTTCC-TTGCGAAT-CGGCTCACGGTGTGATAATTGTCTACGCCGCGACCG-TGAAGCG-TTTATT--GGCCAGCTTCTAATC 'Polyporus thailandensis MSUT_6735' GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCCGGAACTCAGCCTTCCTTTTGGTTGGTGCACTTTCCGGTAGACGGGCCAGCATCGATTTCGACCGTTGGAAAAGGGCTGGAGAAATGTGGCACCTTC--GGGTGTGTTATAGTCTCCAGTCGCATACAGCGGTTGGGATCGAGGAACGCAGCGCGCCGCAAGGCA-GGGCTTCGGCCACTTTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCTCGGGCTGT-----------CATTAGT---------CTGGGT--TGTAACTGGGCCTACGTTT-ATCACAAACTCTTGTAAAGTATCAGAATGTGTATTGCGATATAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACAAG-TTTGTAAC-GAGCTT--GCTTAGGCTTGGACTTGGAGGGC--TTGTCGGCTGT-----TTACC--AGTCGACTCCTCTCAAATGCATTAGCTTGGTTCC-TTGCGAAT-CGGCTCACGGTGTGATAATTGTCTACGCCGCGACCG-TGAAGCG-TTTATT--GGCCAGCTTCTAATC Polyporus_tricholoma GTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCCGGAACTCAGCCTTCCTTTTGGTTGGTGCACTTTCCGGTAGACGGGCCAGCATCGATTTCGACCGTTGGATAAGGGCTGAAGAAATGTGGCACCTTC--GGGTGTGTTATAGTCTTCAGTCGCATACAGCGGTTGGGATCGAGGAACGCAGCGCGCCGTAAGGCA-GGGCTTAGGCCACTATCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAG-----TCATCCACTCTACACCTGTGCACTTACTGTAGGTTTCAGGAGCTTCACGGGCTTT-----------CATTAGT---------CCGGGT--TGTAACTGGGCTTACGTTT-ACTACAAACTCTTATAAAGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTAACAAG-TTTGTAAC-GAGCTT--GCTTAGGCTTGGACTTGGA-GGC--TTGCCGGCTGT-----TTACC-CAGTCGACTCCTCTCAAATGCATTAGCTTGGTTCC-TTGCGAAT-CGGCTCACGGTGTGATAGTTGTCTACGCCGCGACCG-TGAAGCG-TTTATT--GGCCAGCTTCTAATC ; END; BEGIN TREES; TITLE 'Polyporus ML; LSU and ITS'; LINK TAXA = Taxa1; TRANSLATE 1 Lentinus_squarrosulus, 2 Lentinus_polychrous, 3 Lentinus_tigrinus, 4 Polyporus_tricholoma, 5 'Polyporus thailandensis MSUT_6734', 6 'Polyporus thailandensis MSUT_6735', 7 Polyporus_arcularius, 8 Polyporus_brumalis, 9 Polyporus_ciliatus, 10 Polyporus_longiporus_DAOM229479, 11 Polyporus_longiporus_WD2579, 12 Perenniporia_tephropora, 13 Ganoderma_lucidum; TREE Fig._1 = [&U] ((((3,(1,2)),(4,(5,6))),((7,8),(9,(10)))),(12,13)); END; BEGIN TREES; TITLE 'Polyporus MP; LSU and ITS'; LINK TAXA = Taxa1; TRANSLATE 1 Lentinus_squarrosulus, 2 Lentinus_polychrous, 3 Lentinus_tigrinus, 4 Polyporus_tricholoma, 5 'Polyporus thailandensis MSUT_6734', 6 'Polyporus thailandensis MSUT_6735', 7 Polyporus_arcularius, 8 Polyporus_brumalis, 9 Polyporus_ciliatus, 10 Polyporus_longiporus_DAOM229479, 11 Polyporus_longiporus_WD2579, 12 Perenniporia_tephropora, 13 Ganoderma_lucidum; TREE MP_tree = [&U] ((((3,(1,2)),(4,(5,6))),(7,(8,(9,(10))))),(12,13)); END;