#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 5:14 GMT TreeBASE (cc) 1994-2008 Study reference: Tsuji M. 2015. Ethanol productivity of cryophilic basidiomycetous yeast Mrakia spp. correlates with ethanol tolerance. Mycoscience, 57(1): 42–50. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17701] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=47; TAXLABELS Mrakia_sp._8912T Mrakia_sp._ABS1 Mrakia_sp._ABS2 'Mrakia sp. ABS2-1' 'Mrakia sp. ABU1-2' 'Mrakia sp. ABU2-2' Mrakia_sp._AGK3 Mrakia_sp._AGS2 Mrakia_sp._AGU1 Mrakia_sp._AGU2 Mrakia_sp._AKS2 Mrakia_sp._ARI5 Mrakia_sp._AS2.1971 'Mrakia sp. BSU1-1' 'Mrakia sp. BSU1-2' Mrakia_sp._CBS_8909 Mrakia_sp._CBS_8919 Mrakia_sp._CBS_8921 Mrakia_sp._CBS5266 Mrakia_sp._CBS5270 Mrakia_sp._CBS5272 Mrakia_sp._CBS5688 Mrakia_sp._CBS5917 Mrakia_sp._CBS8910 Mrakia_sp._CBS8922 Mrakia_sp._DBVPG4782 Mrakia_sp._DBVPG4995 Mrakia_sp._DBVPG5218 Mrakia_sp._EBS1 Mrakia_sp._EBS2 Mrakia_sp._EBU2 Mrakia_sp._HTK1 Mrakia_sp._MGH2 Mrakia_sp._NRI4 Mrakia_sp._NSA1 Mrakia_sp._SIS1 'Mrakia sp. SK-4' Mrakia_sp._SMS2 'Mrakia sp. TKG1-1' 'Mrakia sp. TKG1-2' 'Mrakia sp. TKU2-1' 'Mrakia sp. TKU2-2' Mrakia_sp._YSAR11 Mrakia_sp._YSAR12 Mrakia_sp._YSAR9 Mrakiella_sp._DBVPG4994 Mrakiella_sp._DBVPG5180 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M37484] TITLE Mrakia_spp._ITS_and_D1D2_domain_sequence; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1288; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Mrakia_sp._8912T TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-TCAAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAGCTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTCTCACGAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAAGAAAGT-TCT-AGATCCGCTTCTAATTCTTAGATAAAGCTTGCTTTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAA-------GCATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATTAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACG---- Mrakia_sp._ABS1 -----------------GGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGAAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTTGTTCTCACGAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAAGAAAGT-TCT-AGATCCGCTTCTAATTCTTAGATAAAGCTTGCTTTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAC--TTAAGCATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCG---------------- Mrakia_sp._ABS2 --------------TGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--TTAAAAGA-CGCAAGT-CTGCAAAGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTCACTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAGAGAAGTCTTTTAGATCCGCTTCTAATTCTTAGATCAAGCTTGCTTGACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATT-------------------------------------CCCCTAGTACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCACGTAGTCCGAAGTTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGC{AT}TTAAACGACCCGCTA------------- 'Mrakia sp. ABS2-1' -----------------GGAAGGATCACTAGTGATTAAATCGAGAGTGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--TTAAAAGA-CGCAAGT-CTGCAAAGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTCACTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAGAGAAGTCTTTTAGATCCGCTTCTAATTCTTAGATCAAGCTTGCTTGACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- 'Mrakia sp. ABU1-2' -----------------GGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGAAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTTGTTCTCACGAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAAGAAAGT-TCT-AGATCCGCTTCTAATTCTTAGATAAAGCTTGCTTTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAACCATTAAGCATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCG---------------- 'Mrakia sp. ABU2-2' -----------------GGAAGGATCACTAGTGATTAAATCGAGAGTGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--TTAAAAGA-CGCAAGT-CTGCAAAGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTCACTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGAAAGTATGGCCGAGATAAGAGAAGTCTTTTAGATCCGCTTCTAATTCTTAGATCAAGCTTGCTTGACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAGACGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGA-GCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- Mrakia_sp._AGK3 --------------TGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGTTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAA-GCGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- Mrakia_sp._AGS2 --------------TGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACCTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGGAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTCCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- Mrakia_sp._AGU1 -----------------GGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACCTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGGAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCACGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGA-GCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTCCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- Mrakia_sp._AGU2 -----------------GGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACCTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGGAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAAGCGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTCCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- Mrakia_sp._AKS2 -----------------GGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACCTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGGAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAGACGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTCCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCG---------------- Mrakia_sp._ARI5 -----------------GGAAGGATCACTAGTGATTAAATCGAGAGTGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--TTAAAAGA-CGCAAGT-CTGCAAAGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTCACTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAGAGAAGTCTTTTAGATCCGCTTCTAATTCTTAGATCAAGCTTGCTTGACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGA-GCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- Mrakia_sp._AS2.1971 ------------------------------GTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGAAAGT-CTGAAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTAATAA--GGTTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGAAAGTATGGCCGAGATAAATAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAA----------A---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGACCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGG------------------------------ 'Mrakia sp. BSU1-1' ----AAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGGAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGA-GCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTCCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- 'Mrakia sp. BSU1-2' -----------------GGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGGAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTCCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- Mrakia_sp._CBS_8909 TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGTTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAA-GCGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACG---- Mrakia_sp._CBS_8919 TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGAAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTCTCACGAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAAGAAAGT-TTT-AGATCCGCTTCTAATTCTTAGATAAAGCTTGCTTTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAA-------GCATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACG---- Mrakia_sp._CBS_8921 TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTAATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGGAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTCCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACG---- Mrakia_sp._CBS5266 TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTTTATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTCCAACTTTTTTATTAA--GGTTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTTATTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGAAAGTATGGCCGAGATAAAGAAAGTTTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACG---- Mrakia_sp._CBS5270 TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTTTATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTCCAACTTTTTTATTAA--GGTTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTTATTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGAAAGTATGGCCGAGATAAAGAAAGTTTTTTAGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACG---- Mrakia_sp._CBS5272 TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGTGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--TTAAAAGA-CGCAAGT-CTGCAAAGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTCACTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGAAAGTATGGCCGAGATAAGAGAAGTCTTTTAGATCCGCTTCTAATTCTTAGATCAAGCTTGCTTGACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACG---- Mrakia_sp._CBS5688 TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTTTATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTCCAACTTTTTTATTAA--GGTTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTTATTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGAAAGTATGGCCGAGATAAAGAAAGTTTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACG---- Mrakia_sp._CBS5917 TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGTGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--TTAAAAGA-CGCAAGT-CTGCAAAGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTCACTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGAAAGTATGGCCGAGATAAGAGAAGTCTTTTAGATCCGCTTCTAATTCTTAGATCAAGCTTGCTTGACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACCGCGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACG---- Mrakia_sp._CBS8910 TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTTGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGTTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAA-GCGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACG---- Mrakia_sp._CBS8922 TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGTGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--TTAAAAGA-CGCAAGT-CTGCAAAGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTCACTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAGAGAAGTCTTTTAGATCCGCTTCTAATTCTTAGATCAAGCTTGCTTGACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACG---- Mrakia_sp._DBVPG4782 -----------------------------------------GAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGAAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTCTCACGAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAAGAAAGT-TCT-AGATCCGCTTCTAATTCTTAGATAAAGCTTGCTTTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAA-------GCATATCAATAAG-CGGAGGAAAAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTG----------- Mrakia_sp._DBVPG4995 ------------------------------------------AGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--TTAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTTTATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTTACTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAGGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATCAAGCTTGCTTGACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGA---------------------------------------------GGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTT-ATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACC Mrakia_sp._DBVPG5218 ---------------------------------------TCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTTTATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTTACTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAGGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATCAAGCTTGCTTGACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAG----------------------------TACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACC Mrakia_sp._EBS1 -----------------GGAAGGATCACTAGTGATTAAATCGAGAGTGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--TTAAAAGA-CGCAAGT-CTGCAAAGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTCACTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAGAGAAGTCTTTTAGATCCGCTTCTAATTCTTAGATCAAGCTTGCTTGACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCG---------------- Mrakia_sp._EBS2 -----------------GGAAGGATCACTAGTGATTAAATCGAGAGTGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--TTAAAAGA-CGCAAGT-CTGCAAAGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTCACTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAGAGAAGTCTTTTAGATCCGCTTCTAATTCTTAGATCAAGCTTGCTTGACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCG---------------- Mrakia_sp._EBU2 -----------------GGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGGAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTCCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCG---------------- Mrakia_sp._HTK1 -----------------GGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGTTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAA-GCGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCG---------------- Mrakia_sp._MGH2 --------------TGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--TTAAAAGA-CGCAAGTGCTGCAAAGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGAGCGCTGCTGGTTTTCACTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGAAAGTATGGCCGAGATAAGAGAAGTCTTTTAGATCCGCTTCTAATTCTTAGATCAAGCTTGCTTGACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------A----------------------------------------------GTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGAG--CCGAA-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- Mrakia_sp._NRI4 --------------TGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGGAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTCCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- Mrakia_sp._NSA1 ----AGGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACCTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGGAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGA-GCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTCCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- Mrakia_sp._SIS1 --------------TGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGTTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAA-GCGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- 'Mrakia sp. SK-4' --------------TGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACCTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGGAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTA--------------------------------------------------------------------------------------------------------CTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTCCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATAACTTTAAACGACCCG---------------- Mrakia_sp._SMS2 -----------------GGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGTTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAA-GCGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCG---------------- 'Mrakia sp. TKG1-1' --------------TGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGTTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAA-GCGGAGGAAA----GAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGA-GCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- 'Mrakia sp. TKG1-2' --------------TGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGTTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGCG-----CATATCAATAA-GCGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCT-AGGATGCTG--------------------------------------- 'Mrakia sp. TKU2-1' -----------------GGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGTTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAAGCGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCG---------------- 'Mrakia sp. TKU2-2' -----------------GGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGTTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAGACGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGA-GCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- Mrakia_sp._YSAR11 ----------AACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGAAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTAAAGGCTTGGACTTGAGCGCTGCTGGTTCTCACGAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAAGAAAGT-TCT-AGATCCGCTTCTAATTCTTAGATAAAGCTTGCTTTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAA-------GCATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGA-CGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATG------------------------------- Mrakia_sp._YSAR12 ----------AACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGAAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTAAAGGCTTGGACTTGAGCGCTGCTGGTTCTCACGAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATATGAAAGTATGGCCGAGATAAAGAAAGT-TCT-AGATCCGCTTCTAATTCTTAGATAAAGCTTGCTTTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAA-------GCATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCC----------------- Mrakia_sp._YSAR9 --------TGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--ATAAAAGA-CGCAAGT-CTGCAATGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCTTCAACTTTTTTATTAA--GGCTGAAGGCTTGGACTTGGGCGCTGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCAAGTATGGCCGAGATAAAGGAAGTCTTT-AGATCCGCTTCTAATTCTTAGATAGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCGGCCTCAGGTCGTCCGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCTCCGGATGTGTTATAGCCCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCCTCGGGTACATACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGG--- Mrakiella_sp._DBVPG4994 ---------------------------------------TCGAGAGCGTCTT-ATTGACCTCTCACCCTTCACATCCACATACACCCTGTGAATCGTTTGGCTTTTCATTAATAGAGCGCAAGC-TCGACAAGTGAAAAGTCATCATTTATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCACCCTTCAACTTTCTTAATAGT-GGTTGGAGGCGTGGACTTGAGCGCTGCTGGTTTTTATTAACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATCTTAACGGATGGCCGAGATAAAGAAAGTCTTT-AGATCCGCTTCTAATTCTTAGCCTTACGCAAGTAAGCTAAACCCA-TTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGAAA---AGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTTGCAGCCTCAGGTTGTACGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTCTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTGGCAGGCCAGCATCAGTTTTGATCTGTGGAAAAGGTTGGAGAGAATGTGGCATCTTCGGATGTGTTATAGCTCTTCTTCGAATACATAGAGCGGGACTGAGGAACGCAGCGTGCCTTTTATTAGGTTGGCCTTCGGGTACATACACGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACC Mrakiella_sp._DBVPG5180 -----------------------------------------GAGAGTGTCTTCATTGACCTCTCACCCTTCACATCCACATACACC-TGTGCACCGTTTGGCTCTT--TTAAAAGA-CGTAAGT-CTGCAAAGAGAGTCATCAATTTT-ATACATACCCCAGTCTTATGAATGTAACAGTTTTAATAAACAAAATAAAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACTCCCAACTTTCTTAATAGTCGGTTGGGAGCTTGGACTTGAGCGTTGCTGGTCTTTATTGACCGGCTCGCTTGAAATGAATTAGCAGATCCTTTTTGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATCTTAACGGATGGCCGAGATAAAGAAAGTCTTT-AGATCCGCTTCTAATTATTAGATAGAGCTTGCTCTACTAAACCCC-TTTTATGATCTGGCCTCAAATCAGGTAGGACTACC-CGCTGAACTTAAGC-------ATATCAATAAG-CGGAGGA---------------------------------GGCGAGTGA-GCGGGATGAGCTCAAATTTAAAATCTTGCAGCCTCAGGTTGTACGAG-TTGTAGTCTAGAGAATCGTTTTCCGCGTTGGCCTGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGATTACCAATGCTTTGTGATGCGATCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCATGCTTTCCGAGACTCAGCCGATTCTGTCGGTGTACTTCTCGGTTTGCAGGCCAGCATCAGTTTCGATCTGTGGAAAAGGTTGGAGGGAACGTGGCATCCTCGGATGTGTTATAGCCCTTCTTCGAATACACAGAGCGGGACTGAGGAACGCAGCGCGCCTTTTATTAGGTTGGCCTTCGGGTACATTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACC ; END; BEGIN TREES; TITLE Mrakia_spp._ITS_and_D1D2_domain_sequence; LINK TAXA = Taxa1; TRANSLATE 1 Mrakia_sp._8912T, 2 Mrakia_sp._ABS1, 3 Mrakia_sp._ABS2, 4 'Mrakia sp. ABS2-1', 5 'Mrakia sp. ABU1-2', 6 'Mrakia sp. ABU2-2', 7 Mrakia_sp._AGK3, 8 Mrakia_sp._AGS2, 9 Mrakia_sp._AGU1, 10 Mrakia_sp._AGU2, 11 Mrakia_sp._AKS2, 12 Mrakia_sp._ARI5, 13 Mrakia_sp._AS2.1971, 14 'Mrakia sp. BSU1-1', 15 'Mrakia sp. BSU1-2', 16 Mrakia_sp._CBS_8909, 17 Mrakia_sp._CBS_8919, 18 Mrakia_sp._CBS_8921, 19 Mrakia_sp._CBS5266, 20 Mrakia_sp._CBS5270, 21 Mrakia_sp._CBS5272, 22 Mrakia_sp._CBS5688, 23 Mrakia_sp._CBS5917, 24 Mrakia_sp._CBS8910, 25 Mrakia_sp._CBS8922, 26 Mrakia_sp._DBVPG4782, 27 Mrakia_sp._DBVPG4995, 28 Mrakia_sp._DBVPG5218, 29 Mrakia_sp._EBS1, 30 Mrakia_sp._EBS2, 31 Mrakia_sp._EBU2, 32 Mrakia_sp._HTK1, 33 Mrakia_sp._MGH2, 34 Mrakia_sp._NRI4, 35 Mrakia_sp._NSA1, 36 Mrakia_sp._SIS1, 37 'Mrakia sp. SK-4', 38 Mrakia_sp._SMS2, 39 'Mrakia sp. TKG1-1', 40 'Mrakia sp. TKG1-2', 41 'Mrakia sp. TKU2-1', 42 'Mrakia sp. TKU2-2', 43 Mrakia_sp._YSAR11, 44 Mrakia_sp._YSAR12, 45 Mrakia_sp._YSAR9, 46 Mrakiella_sp._DBVPG4994, 47 Mrakiella_sp._DBVPG5180; TREE 'PAUP_1' = [&R] (46:0.0223745,(47:0.015954,((22:1.0E-8,(19:1.0E-8,20:1.0E-8):1.0E-8):8.99E-4,(((17:1.0E-8,(1:0.003267,((43:1.0E-8,44:1.0E-8):8.32E-4,(26:1.0E-8,(2:1.0E-8,5:1.0E-8):0.00104):0.0):0.0):9.93E-4):0.003679,((27:1.0E-8,28:0.001551):0.002253,((3:0.008016,33:0.00194):0.003145,((23:1.0E-8,(6:1.0E-8,21:1.0E-8):1.0E-8):7.97E-4,(25:1.0E-8,(30:1.0E-8,(29:1.0E-8,(4:1.0E-8,12:1.0E-8):1.0E-8):1.0E-8):1.0E-8):0.0):7.81E-4):0.002911):0.003329):0.003025,(13:0.005136,((42:1.0E-8,(16:1.0E-8,(24:8.04E-4,(7:1.0E-8,(36:1.0E-8,(32:1.0E-8,(38:1.0E-8,(39:1.0E-8,(40:1.0E-8,41:1.0E-8):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.001681):8.34E-4,(((10:2.49146E-5,37:0.001822):0.001629,(8:1.0E-8,(9:8.31E-4,(11:1.0E-8,35:1.0E-8):0.0):0.0):0.0):0.001625,(18:0.001612,(45:1.0E-8,(34:1.0E-8,(15:1.0E-8,(14:1.0E-8,31:1.0E-8):0.0):0.0):0.0):0.0):1.0E-8):0.002411):0.001):0.003434):0.00225):0.015164):0.0223745); END;