#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 19:32 GMT TreeBASE (cc) 1994-2008 Study reference: Ritz C., Martins L., Mecklenburg R., Goremykin V., & Hellwig F. 2007. The molecular phylogeny of Rebutia (Cactaceae) and its allies demonstrates the influence of paleogeography on the evolution of South American mountain cacti. American Journal of Botany, 94(8): 1321-1332. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1773] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=87; TAXLABELS Arrojadoa_rhodantha_CA38 Arrojadoa_rhodantha_CA83 Austrocactus_philippii Browningia_candelaris Browningia_hertlingiana Cereus_hildemannianus Cintia_knizei_CA01 Cintia_knizei_CA13 Cipocereus_minensis Cleistocactus_strausii Coleocephalocereus_fluminensis Coleocephalocereus_goebelianus Copiapoa_laui Denmoza_rhodacantha Discocactus_zehntneri_subsp._boomianus Echinopsis_ancistrophora_subsp._arachnacantha Echinopsis_atacamensis_subsp._pasacana Echinopsis_cinnabarina Echinopsis_huotii Echinopsis_mamillosa Echinopsis_mirabilis Echinopsis_pentlandii Echinopsis_schickendantzii Echinopsis_tiegeliana Eriosyce_napina Espostoa_guentheri Espostoa_lanata Espostoa_ritteri Espostoopsis_dybowskii Gymnocalycium_andreae_subsp._carolinense Gymnocalycium_anisitsii_subsp._anisitsii Gymnocalycium_bruchii Gymnocalycium_carminanthum Gymnocalycium_leptanthum Gymnocalycium_paraguayense Gymnocalycium_pflanzii_subsp._argentinense Gymnocalycium_pflanzii_subsp._pflanzii Gymnocalycium_rauschii Gymnocalycium_schickendantzii Haageocereus_pacalaensis Matucana_aurantiaca Melocactus_oreas Micranthocereus_auriazureus Neoraimondia_arequipensis_subsp._roseiflora Neoraimondia_herzogiana Neowerdermannia_vorwerkii Oreocereus_celsianus Oroya_peruviana Parodia_magnifica Parodia_microsperma Rauhocereus_riosaniensis Rebutia_deminuta Rebutia_einsteinii Rebutia_fiebrigii Rebutia_minuscula Rebutia_padcayensis Rebutia_pseudodeminuta Rebutia_pygmaea_CA08 Rebutia_pygmaea_CA93 Rebutia_steinmannii Samaipaticereus_corroanus Stetsonia_coryne Sulcorebutia_arenacea Sulcorebutia_canigueralii_CA103 Sulcorebutia_canigueralii_CA104 Sulcorebutia_canigueralii_CA27 Sulcorebutia_cardenasiana Sulcorebutia_crispata_CA09 Sulcorebutia_crispata_CA106 Sulcorebutia_mentosa Sulcorebutia_purpurea Sulcorebutia_spec._CA101 Sulcorebutia_spec._CA99 Sulcorebutia_steinbachii_CA107 Sulcorebutia_steinbachii_CA28 Sulcorebutia_steinbachii_CA29 Sulcorebutia_tarijensis Uebelmannia_pectinifera_subsp._flavispina Weingartia_buiningiana Weingartia_cintiensis Weingartia_fidaiana Weingartia_neocumingii_subsp._pulquinensis Weingartia_neocumingii_var._hediniana Weingartia_neocumingii_var._longigibba Weingartia_neocumingii_var._neocumingii Weingartia_westii Yavia_cryptocarpa ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1828] TITLE 'Kak11jan-01'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2412; FORMAT DATATYPE=DNA SYMBOLS= "A C G T 0 1" MISSING=- GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arrojadoa_rhodantha_CA38 -----------------------------------------TAAT-AAA-CCTAAGGCCAGCTA-------ATCCAATAAG-------------------------------------------C---TTAGCCGCTCCAATTTTTT--------------------TCGCGTAC-----------CATGCCAACA----------TGAACTACAAA-----T-CCCATA-------------------------AAAT-ACTTAT----------------------------------------TAATGTATTCGATTCC-ATTTAAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-AAA-ATTTCACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------A----TA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAGACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTCA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCATTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCC----------------TCCCTTATCCCAAA-A-------TCATATACGTAA---------------------------------TGAGTCATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACT--------C-TTTTCAATTGCAA----------A-AGTTCTCA-------TATT-----CAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAA----------TGTAGATACAATCGGGATCCAAATCAA-----------------C---CAATA-----------------------------------------------------------------------TTAA-TTCATATT-ATAT-ATTTT-------------CTATTTCTAT----------------TCTTATTATATAATATTAATTTTTATTTATATAATAAGAATAGAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAG------AAAAACTAGAAATAGGATAGAAATAATGAAATA------A-TAAGGAGAAAAATCTAAGTTAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATTA---------TTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACACACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Arrojadoa_rhodantha_CA83 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AA-GCT-----TAT{CG}T{CG}ACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATTTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTGACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGT{AC}CTCA-------TATT-----AAAATGAG-AGATGAT------GCCCCAA-----GGGAATG---------------------------------------ATCAA-----------------C---{CG}AATA-----------------------------------------------------------------------TTAA-TT{CG}ATATT-ATAT-ATATT-------------CTATTTCTAT----------------TCTTGTTATATAATATTGATTTTTATTTATATAATAAGAATAGAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAG------AAAAACTAGAAATAGGATAGAAATAATGAAATA------A-TAAGGAGAAAAATCTAAGTTAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTGCATAAATAGATGAATAGAAAAGCGAA{CG}AATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATTA---------TTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGTTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCATTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Austrocactus_philippii ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCC{AT}AACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------GACGGTGGTTATGTTCCTTATTTTTTTTTTGTTTTC-----CCA--TTTCAAAACAGGCT-----AAAGGCTCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATATGTACAAAATGAATATCTTTGAGCAAGGAATAATTATTTGAGTGATTCACAATCAAAC-----TACTCATTACACCGTACTAAAACTCAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCT---------------------ATGAGTGGATCAT------GCCCCACGAAGGGGGAATGCCAAAATAGATATGTTATGTAGATACAATCGGGATCAAAATC{ACG}CAAT------A--TTGAACTTGAAATA-------------------------------------------------------------TAAATTATAT----------------------------A--AAT-ATATA------------------------------------------------------------------------------------------------ATAAATATTTCAATTCAATATTTT------------ATTATAATTAAT------AAAAAATAGAAATAGGATAGAAATAATGAAATCTGAAATA-TAAGGAGAAAAATCTAAGTAAAGTATCCAAAAAAAACTTGTGTTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAAAAAAAGTTATACCA----C----ACCTC-------ATTCTATC---TTTTTTTTATTTAATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT------TAAAACCCGCTTCCCTCTTTACTAAAATATCATAAATAGTTTCCCTAGGTTGAGGGCCTTTTTCACGAAAATCGAGAAGAGCAGGAACATTCCTCTTTAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAATAAAATCGATAAGAGCAGGAACATTTAAATAA-GT{GT}TGATTCTTTATTGGATCATAAAAACCCACTTTCCCCAGA--TCTCTTCCCTCTCTTCGGG---------- Browningia_candelaris -----AAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CATA---------------------TTTAACATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTTCACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------ATAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATAT--------------------------C----C---C---------------------C---------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------C-------------------TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCC-TTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAA-GGATCAGTTATGTAGATACAA-CGGGATCCAAATCACAAA-TAAAAAAAT-GAACTTGCAATA-----------------------------------------------------------------------TTAA-TAAATAT--ATAT-ATATT------------TATATTTAGATAATTATAATAGAATAT-------ATATAATATTAATTAATATTTATATAATTAGAATAGAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAT------AAAAACTAGAAATAGGATAAAAATAATGAAATCTGAAATA-TAAGGAGAAAAATCTAAGTTAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCT{ACG}CATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAA{CG}CCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTCTGATTCTTTATTGGATCATGAAAACCCACTTTCCGC-GA--TCTCTTCCCTCTCTTCGGGACCGA-CA-T Browningia_hertlingiana AAAATAAAATAAATGTCCGATAGCATAGC-CATTGATCGATTAATTAAA-CCTAAGACCATA----------------------------------------------------AGGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTCCACTTTTTATTCCATTTTTACATA---------------------GGAAACATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTTCACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AA-----------------------C-------------------------------------------------------------------AACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC---------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCAA-----GGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAACTTGCAATA-----------------------------------------------------------------------TTAA-TTAATAT--ATAT-ATATT------------TATATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAATCTGAAATA-TAAGGAGAAAAATCTAAGTTAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Cereus_hildemannianus AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATAAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTCTACTTTCT--------A--ACATCG--------------------TTT-A-ATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAA----------TTTCACTTTTCAAACAAA-TAAAA-T------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACCT{GT}GCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A----------CGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTAT{GT}CCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTT{CT}TATTTCATTAATTA---------TTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGT{GT}GGTTGAGCGCCTTTTTCAAGAAAATATAGAAT{GT}GCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Cintia_knizei_CA01 -----AAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AC------C--CTA-------ATTAAATTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTTCATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGAGTCA-ATTTAAA-CTG--------A-------TATCAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAAT--TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGAA--------------------CGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGA{AG}ATTGGAAACTTAAAA{AG}ACAAACAAGGGTTGGGTTGCAC{CG}A{GT}ATATATAAAGCT-----TATTTCACTCCCTAAC----C---C---CCTTTTTTTATTAA-CAGCTTTGG----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA-TTTTTTTTTAAA---AAAAACAA--TTTCAAAAA-------------------C---CGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAA-A-------CTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA--AAAAAAATTGAACTTGCAATA-----------------------------------------------------------------------TTAA-TTAATATATA---------------------T{AC}TATTTAT------------------------------------------------ATAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCT-------------------------- Cintia_knizei_CA13 ---------TAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AC------C--CTA-------ATAAAATTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------T-GC-TAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTTCATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGAGTCA-ATTTAAA-CTG--------A-------TATCAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGAA--------------------CGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAA{AG}ACAAACAAGGGTTGGGTTGCAC{CG}A{GT}ATATATAAAGCT-----TATTTCACTCCCTAAC----C---C---CCTTTTTTTATTAACCAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA-TTTTTTTTTAAA----AAAACAA--TTTCAAAAA-------------------C---CGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAA-A-------CTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCTGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA--AAAAAAATTGAACTTGCAATA-----------------------------------------------------------------------TTAA-TTAATATATA---------------------TATATTTAT------------------------------------------------ATAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Cipocereus_minensis AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAA---------------------------------------------------------------------CGCATTAGCCAATCCAATTTTTT--------------------TCGCGTAC-----------CAT-CAAACA----------TGAACTACAAA-----TTCACATA-------------------------AAAT-ACTTATATATGA--------------------------------TTTTACATATTCGAGTCA-ATCATAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-TAA-ATTTCACTTTTCAAACAAAATCAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------A----TA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAGACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CA{CG}CTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATCTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGT{CG}ATATACGTAA---------------------------------TGAGT{CG}ATTCACAATCAACCTATAATA----------C---CTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCAA----------A-AGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAA---------CTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCAA-----------------C---CAATA-----------------------------------------------------------------------TT----T-ATA-A-ATAT--------AT-ATAATTATATATTTAT---------------------------------------------------------AT--AAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAATA------A-TAAGGAGAAAAATCTAAGTTAAGTTTCCAAAAAAAACTTGTATTGGATTGGCACTACA-------------TAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTA---------TTAA--------C----TTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Cleistocactus_strausii -----AAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATTCAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACT-TTTATTA---TTT-T-ATTAAACGTATAA-----------CATCA--------------------TTTCACATATTCGATGCA-ACTTAAA-CTC--------A-------GAGAAAGTCCACTTAAA---------TTTCACTTTGAAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTATA------TATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATAT--------------------------C----C---C-------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------------------------------------------------------------------C--ACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTAGAATACTCATTACACCGTACTAAAACAAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCC-TTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----CAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Coleocephalocereus_fluminensis ---------------------AGCATAGCAGATTGATCGATTAATTAAA-CCTATGA-------------------------------------------------------------------C---TTAGCCATTCCAATTTTTT--------------------TCGCGTAC-----------CAT-AAAACA----------TAAACTACAAA-----ATC----------------------------T-ATTA--C---TAA-----------TAGCA--------------------TTTTACATATTCGATTCA-ATTAAAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-TAA-ATTTCACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------A----TA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCA---------GGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAA--------------ATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCAA----------A-AGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCAA-----------------C---CAATA-----------------------------------------------------------------------TTTA-TAAATAT--ATAT-A------------ATTAT------------------------------------------------ATATTTATATAATTAGAATAGAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAATA------A-TAAGGAGAAAAATCTAAGTTAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTA---------TTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Coleocephalocereus_goebelianus AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGA-------------------------------------------------------------------C---TTAGCCATTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CAAACA----------CGAACTACAAA-----CTC----------------------------T-ATTA------TAG-----------TAGCA--------------------TTTTACATATTCGATTCA-ATTAAAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-TAA-ATTTCACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------A----TA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCA---------GGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC{GT}ATTTATAT-----T-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAA--------------ATACGTAA---------------------------------TGAGT-ATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCAA----------A-AGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGGTTAAAAGGATAAGTTATGTAGACTACATCGGGATC-AAATCAA-----------------C---CAATA-----------------------------------------------------------------------TTTA-TCTATAT--ATAT-{AG}-----------------------------------------------ATTATATAA-A------------TATATAATTAGAATAGAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAT------AAAAACTACAAATAGGATAGAAATAATCAAATA------A-TAA{CG}{CG}A{CG}AAAAATCTAACTTAAGTATCCAAAAAAAAC--------GATTGGGACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTA---------TGAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCGGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATGA-GTTTGATTCTTTATTGGATCATAAAAACC-ACTTTCCGCAGA--TCTCTTCCCTCTCT{CT}CGGGACCGAACA-T Copiapoa_laui AAAATAAAATAAATGTCCGATAG-----AAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATTAAATAAGACATTAATTAAATAAGACATA------------AGGAGTTAG-A-------CCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTCCACTTTT-----------------------------------------GACTTATTCGATTCA-ATTTCAA-CTG--------CAGTGAATTCTCAAGTTAACTCAAA---------CTTCACTAAAA{AG}{AG}{AG}CAAA-AAA-A-{AC}ATCCA-------------------------------------------------------------------------------------------------------------AATGG{AG}TGAA{AT}CAAAAATCTTGAGACAAGTCTTTTCATTTGT-CTATCATTATAGACAATCCTTTCGATATTATCCACGAAAATCGGACCCTAAACTATATT-------CCAAATA-TTTCAATTGG{AG}TTTAT-GA-TTCAT{AT}ATTTCTATCGC{GT}CTGGAACT-------AAGTTCA------TTATTT{AG}GA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACCTAGC{CT}TAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTCA--TTTTTTTTGTTTTC-----------------ACAGGCT-----AAAGGCTCCCGGATGGAAATGCTTTTCCCTTATCCCAAACAGTCCTTGTGATATACGTACAAAATGAATATCTTTGAGCAAGGAATAATCATTTGAGTGATTGACCATCAAAC-----TACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATAC-TTTCCGTCCCTTTTCAATTACACCATAGACCCCCGAGTGCTCA-------TATT-----AAAATGAGTAGATGAT------GCGCCACGAAGGGGGAATGCCAAAATAGATATGTTATGTAGATACAATCGGGATCAAAAACACAAA-TTCCAAT-TTGAACTTGAAATA------------------------------------------AAAAAATTGAATTGCAATATTAATTATAT--------------------------ATA--AATTATATATTGAG------------------------------------------------ATAATTAGAATAGAAAATATATAA-A--AA--AATG---AAATGAA--------ATTTCATTATTTA------------ATAATAATTAAT------AAAAAATAGAAATAGAATAGAAATAATGAAATCTGAAATA-TAAGGAGAAAAATAGAAGTTAAGTATCCAAAAAAAACTTGTGTTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAAAAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC--TTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTTAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GT{GT}TGATTCTTTATTGGATCATAAAAACCCAATTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Denmoza_rhodacantha AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTACACTTATAG-----------CATCA--------------------TTTAACATATTCGATGCA-ACTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTTCACTTTGCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCTCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCC-TTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Discocactus_zehntneri_subsp._boomianus -----AAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATA----------------------------------------------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CAATCA----------TCAAA-ACAAA-----TTCACATA-------------------------AAAC-ACGTATAA-----------TCGCA--------------------TTTTACATATTCGATTCA-ATAAAAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-TAA-ATTTCACTTTTCAAACAAA-TCCAA-TATCTA-------------------------------------------------------------------------------------------------------------A------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------A----TA-TTTCAATTGAATTTA------------------------------------------------------------------------------------------------------------------------------------------------GGACTATACATATA-----TATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATAT--------------------------C----C---C---------------------C---------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------C------------CCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTAGAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCC-TTTTCCATTGCAA----------A-AGTTCTCA-------TATG-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAA---------GTTATGTAGATACAATCGGGATCCAAATCAA-----------------C---CAATA-----------------------------------------------------------------------TTCA-TAAATAT--ATAT-A------------ATTATATA----------------------------------AATAT--------------ATAATTAGAATATAAAATATC---------------------------------ATTTCATTATTTC------------ATAATCATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAATA------A-TAAGGAGAAAAATCTAAGTTAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTTATTAATTA---------TGAATTAACGTCA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_ancistrophora_subsp._arachnacantha -----AAAATAAATGTCCGATAGC-TAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATTAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTCT--ATTA-------T-ATTACACTTATAA-----------CAGCA--------------------TTTAACATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-ATA-ATTTCACTTTTCAAACAAA-GAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTTTTTATCTA-TATTATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAGAAGGGGGTAAGAGATTGGAAACTTAAAAGACAAAGAAGGGTTGGGTTGCACGA{GT}ATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTGG----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACGAAAAGAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--TCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCC-TTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATGAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_atacamensis_subsp._pasacana AAAATAAAATAAATGTCCGATAGCATAGCA-ATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACGCCAATTTTTTT-------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTACACTTTTAA-----------{CG}ATCT--------------------TTTAACATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTTCACTTTTCAA-C-------------C--TGATATTATTAATTAATGCTAATTTACTTTTTTTTATTCTATAAAAGTATAGCAAAAACTTGTTAATTTGTCAAGTTCTGTTTTCAGTTTAGATATAGATATAATTTCTAATGGATGAATCAAAAAT{CG}{GT}TGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTTTTTATA------TATATT--------------------------------------------------------ATATTT{CG}-TA{CG}{CG}-------C---------------TAT{CG}T-GCTGTCAAGAGTGAATTTC-GAA------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTAGAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAAT----C-ATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_cinnabarina -----AAAATAAATGTCCGATAGC-TAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATTAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------T------------------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTCT--ATTA-------T-ATTACACTTATAA-----------CAGCA--------------------TTTAACATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-TTA-ATTTCAA------AACAAA-GAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTTTTTATCTA-TATTATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAAC{GT}TAAAA{AG}ACAAACAAGGGTTGGGTTGCAC{CG}ATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATA-----------------TATACGTAA---------------------------------TGAGTGATTCACAATCAACCTAGAATACTCATTACACCGTACTAAAACGAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--TCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCC-TTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATGAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_huotii ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTGG----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTAGAATACTCATTACACCGTACTAAAACGAAAAGAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTCTACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATG-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_mamillosa A{AT}AATAAAATAAATGTCC--TAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTATTGAATTGGATTCATTTGGATCGCGTAC-----------CAA-AAAACATTAAATTGAATGAACTCCAAA-----TTCCCATCTGTTCACTA--------------T-CTTAAACGTATAA-----------CATCA--------------------TTGAACATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-ATA-ATTTCACTTTTCAAACAAA-GAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCAATGGAACT-------AAGTTCA------TTATTTATA------TATATTT--------C{GT}AGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAA{AG}ACAAACAAGGGTTGGGT{GT}GCACC--------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAA---- Echinopsis_mirabilis AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTCATAAGGCATTC-ATAAGGCAT----------------A------------AGGAGTTAG-CGA-TTA--C-CTCCCATTTGGA--------------------TCGCGTACAGGTACCCTCCCAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCATTA--------------G-ATTCTACTTATAG-----------CATCC--------------------TTTCACATATTCGATGCA-AGTTCAA-CTG--------A-------TCTCAAGTCCACTTCACTTT-TAA-ATTTCACTTTTC---C--A-TAAAA-TAT--------------------------------------------------------------------------------------------------------------------GATGAAGCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTCAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCTAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACAATATATAT----------------CACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCG-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGT{CG}ATATACGTAA---------------------------------TGAGT{CG}ATTCACAATCAACCTAGAATACTCATTACACCGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCCAGATAAGACTCTT-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATG-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATGGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTG-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_pentlandii -----AAAATAAATGTCCGATAGC-TAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------T------------------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTCT--ATTA-------T-ATTACACTTATAA-----------CAGCA--------------------TTTAACATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-TTA-ATTTCAA------AACAAA-GAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTTTTTATCTA-TATTATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAAC{GT}{GT}AAAA{AG}ACAAACAAGGGTTGGGTTGTAC{GT}A{GT}ATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATA-----------------TATACGTAA---------------------------------TGAGTGATTCACAATCAACCTAGAATACTCATTACACCGTACTAAAACGAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--TCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCC-TTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATGAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_schickendantzii ---------TAAATGTCCG--AGCAAAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTATTTA--------------T-AATACACTTTTAA-----------CAACA--------------------TTTCGCATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTCCACTTAACTTT-ATA-ATTTCACTTTTCAAGCGGA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAG{AG}ATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACGATATT-------CC{AG}{AG}{AG}-{AG}-TTTCAATTGAGTTTAT-GA-TTCATTATTTC-ATCGCACTGGAACT-------AAGTTCA------TTATTTATA------{GT}AT{AG}TGT--------{CG}G{AG}GCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCA{AG}AAGGGGGTAAGAGATTGGAAACTTAAAAGACAAACAAGGGTTGGG---------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTAGAATACTCATTACACCGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-- Echinopsis_tiegeliana ----TAAAATAAATGTCCGATAGC-TAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTCT--ATTA-------T-ATTACACTTATAA-----------CAGCA--------------------TTTAAGATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-ATA-ATTTCAA------A{AG}CA{AG}A-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAA{AG}AATGTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTGA{AG}ATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTTTTTATCTA-TATTATATTT--------G{GT}AGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGG{AC}AACTTAAAA{AG}ACAAACAAGGGTTGGGTTG{GT}AAGATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATA-----------------TATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACGAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--TCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT{AC}AGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATGAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Eriosyce_napina ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTACTCTCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGCCT-----AAAGGCTCCCGGACGGAAATGCTTTTCCCTTATCCCAAACAGTCCTTGTGATATACGTACAAAATGAATATCTTTGAGCCAGGAATAATCATTTGAGTGATTCACAATCAAAC-----TACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTAGACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATG{CT}{AC}GATAGAATCGGGATCAAAATCCCAAA-TTCAAA-------CTTGCAATATTTTTATTGCAATTCAATATTGATTTTATTATATCTATTTTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACTCAAAATAGGATGGAAA---------C-GAAATACTAAGGCGAAAAATCTAAGTTTAGTATCCAAAACAAA-----GTTGGATTGGCACTAAATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTTAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GT-TGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Espostoa_guentheri AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATGAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAAC---------------CTCCAAA-----TTCTCATCTGTTCACTA----------------ATTCAACGTATAA-----------CATCA--------------------TTTCACATATTCGATGCA-ACTTAAA-CTG--------A-------TATCAAGTTCACTTAAA---------TTTCACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC---------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACGAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATG-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCAAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTC-CTCTCTTCGGGACCGAACA-- Espostoa_lanata AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCA---C--------T--------------------TCGA----------------AT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTCT--ATTACATTTTAT-ATTACACTTTTAA-----------CATC{AT}--------------------TTTAACATATTCGATTCA-ATTTCAA-CTG--------A-------TATCAAGTTCACTTAAA---------TTTCACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATAGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTGAGA------TATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTGAAAAAACAAACAAGGGTTGGGTTGCACCATATATAT--------------------------C----C---C-------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------------------------------------------------------------------C--ACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACGAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCC-TTTTA-------C-ATAGACCCCCGAGT{AC}CTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Espostoa_ritteri AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCA---C--------T--------------------TCGA----------------AT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTCT--ATTACATTTTAT-ATTACACTTATAA-----------CATCA--------------------TTTAACATATTCGATTCA-ATTTCAA-CTG--------A-------TATCAAGTTCACTTAAA---------TTTCACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATAGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTGAGA------TATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTGAAAAAACAAACAAGGGTTGGGTTGCAC---------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTAGAATACTCATTACACCGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTA-------C-ATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-- Espostoopsis_dybowskii -AAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATAAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTACAAA-----TTCACATA-------------------------AAAT-ACTTATAA-----------TTGCA--------------------TTTTACATATTCGATTCA-ATTAAAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-TAA-ATTTCACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------A----TA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCA{CG}{CG}ATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCAA----------A-AGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGC----------------TGTAGATACAATCGGGATCCAAATCAA-----------------C---CAATA-----------------------------------------------------------------------TTAA-TTAATAT--ATATTA-A--A-ATT--AATAATATATT-A-A-A---AT--TA--ATA--------ATATA-TATTAATTAATATTTATATAATTAGAATAGAAAATATC----------------------------ATTTCATTTCATTATTTA------------ATAATAATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAATA------A-TAAGGAGAAAAATCTAAGTTAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTA---------TTAATTAACGTCA-----------------AAAA{AC}CCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGTTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Gymnocalycium_andreae_subsp._carolinense ----------AAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACA---------------------------------------------------------------G-CGA-TTAGCCACTCCAATTTTGT--------------------TA-A---------------CAT-CCAACA----------TGAACTCCAAA-----TTCAA--C----CACTA--------------TCATTATAA----AT-----------CAACA--------------------TTTT-CATATTCGATTTC-GATTCCA-CTC--------A-------CCTCATGTCCACTTGACTTT-TTA-ATTTA-CTTTTGAAAA-----------------------------------------------------------------------------------------------------------------------------------CAAATCCAATATCTTGAGAA-----------------------------------------------------------------------------------------------AATGGAATTTAT-GA-TTCATTCTTTCTCTCGCAATGGAACT-------CAGTTCA------TGATAGAGA------TCTATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCACTGTCAAGAGTGAATTTA-----------AGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTGAAAAAACAAACAAGGGTTGGGTTGCAC---------AA---------TATTTCACTCCCTAAA----C-----------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTA----C-TTTTCAATTGCAA--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGATGCCCCAGCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-GAAAGAAATGGAACTATCCATA-----------------------------------------------------------------------TTCA-TTAATATGGA---------------------TCTATTTAG--------------------------------------------------------AATAGAAAATAT----------------------------------------------AGAATATTAATGAATATGGATTCAT------AAAAACTAGAAATAGGATAGAAATCA------------------------AAATCGAAGTGAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATCGATGAATCGAAAAGCGAAGAAGAAAAGAAA-GTTCTACCCAAGCCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATTA---------TTCATTAACGTGA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATCA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCT-TTCGGG{AT}CCGAACA-T Gymnocalycium_anisitsii_subsp._anisitsii AAATCAAAGTAAATTTCCAAGAG{AG}ATGGTAGA--GATCGATTAATT-----------CA---------------------------------------------------------------G-CGA-TTAGCCACTCC----------------------------T-TCCAAC-------------T-TC-ACA----------TGA-C-CCATA-----TTCAC-TCAATTCA-------------------------------T------------------------------------TTTAGCATATTCGATTCACAATTGTC-CAATTGAAATGA-------GTTTAAGTCCACTTGAA---------TTCCTCTATTGAAAA-----------------------------------------------------------------------------------------------------------------------------------AAAAAC-GAAAACTTGAGAA-----------------------------------------------------------------------------------------------AATGGAATTTAG-GA-TTCATTATTTCTATCGCGATGGAACT-------GAGT-------------------------ATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCACTGTCAAGAGTGAATTTA-----------AGGTCTTTCGACTTCAAAAGGGGGTAAGATATTGGAAACTTAAAA-ACAAACAA-----------------------AAATCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATGAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AAA-----------------------TTTT-TTTTC-----CCA--TTTCAAAACAGGCT-----AAAGGCCCCA------AA-----TTTCCCTTATCCCCAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTAGAATCCTCATTACACCGTACTAAAACTTAAAGAAACTTA--------------CTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTA----C-TTTGCAATTGCAA--------CCCGAGTTCTCA-------TATT-----CAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATCAGTTATGTAGATACAATCGGGATCCAAATCACAAA-GAAAAAAATGGAACTCGAAATA-----------------------------------------------------------------------TTCAATTAATATTTC---------------------TATATTTAG--------------------------------------------------------AATCGAAAATAT----------------------------------------------AGAATATTAATGAATATTTATTCAT------AAAAACTATCAATAGGATAGAAAGAA------------------------AAATCTAAGTGAAGTAGA-------AACTTGTATTGGATTGGCACTACATAATCAATCTACATAAATCGATGAATCGAAAAGA-----AGAAAAGAAA-GTTCTACCCAAGCA------CTC-------ATTCTATCTTTTTTTTTTGATTTCATTCATTA---------TTCATTAACGTTA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATAGAGAATAGCAGGAACATTTAAATAAAGTTTGATTCTTGATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Gymnocalycium_bruchii -------------------ATAGCATAGCAGATTGA{GT}-GATTAATTAA{AG}-CCTAAGACA---------------------------------------------------------------G-CGA-TTAGCCACTCCAATTTTGT--------------------TA-A---------------CAT-CCAACA----------TGAACTCCAAA-----TTCAA--C----CACTA--------------TCATTATAA----AT-----------CAACA--------------------TTTT-CATATTCGATTTC-GATTCCA-CTT--------A-------CCTTATGTCCACTTAACTTT-TTA-ATTTA-CTTTTGA{AG}AA-----------------------------------------------------------------------------------------------------------------------------------CAAATCCAATATC{GT}{GT}GAGAA-----------------------------------------------------------------------------------------------{AG}ATGGAATTTAT-GA-TTCATTCTTTCTCTCGCAATGGAACT-------CAGTTCCTGATTCTGATAGAGA------TCTATTT--------C{GT}AGCCA-----------------------------------------------------------C---------------TATCTCACTGTCAAGAGTGAATTTA-----------AGGTCTTTCGACTTCA{AG}{AG}AGGGGGTAAGAGATTGGAAAC-GAAAA{AG}ACAAACAAGGGTTGGGTTGG{AG}CGGGA-A-AGA----------TATTTAACTCCCTAAA----C-------------------------C---------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTA----C-TTTTCAATTGCAA--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-GAAAGAAATGGAACTATCAATA-----------------------------------------------------------------------TTCA-TTAATATGGA---------------------TCTATTTAG--------------------------------------------------------AATAGAAAATAT----------------------------------------------AGAATATTAATGAATATTGATTCAT------AAAAACTAGAAATAGGATAGAAATCA------------------------AAATCGAACTGAAGTATCCAAAAAAAACTTGTA{GT}TGGATTG-CACTACATAATAAATCTACATAAATCGATGAATCGAAAAGCGAAGAAGAAAAGAAA-GTTCTACCCAAGCCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATTA---------TTCATTAACGTGA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-{CG}TTTGATTCTTTATTGGATCATAAAAACCCACTTTCC-CAGA--TCTCTTCCCTCTCTTC--GACC-AACA-T Gymnocalycium_carminanthum -------------TGTCCGATAGCATAGCAGATTGATCGATTAATTAAACCCTAAGACA---------------------------------------------------------------G-CGA-TTAGCCACTCCAATTTTTT--------------------TA-A---------------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACT-T-AATTA-------TAATTACACTTTTAT------------------------------------TTTAGCATATTCGATTCA-ATTTGTC-CAA--------A-------GTTCAAGTTCACTTGAA---------TTTA-CTTTTGAAAA-----------------------------------------------------------------------------------------------------------------------------------AAAATCCAATATCTTGAGAA-----------------------------------------------------------------------------------------------AATTGAATTTAT-GA-TTCATTATTTCTCTCGCAATGGAACTTGGAACTCAGTTCA------TGATAGAGA------TCTATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCACTGTCAAGAGTGAATTTA-----------AGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC-------------CT-----TATTTCACTCCCTAAA----C-----------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTA----C-TTTTCAATTGCAA--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-GAAAAAAATGGAACTATCAATA-----------------------------------------------------------------------TTCA-TTAATATGGA---------------------TCTATTTAG--------------------------------------------------------AATAGAAAATAT----------------------------------------------AGAATATTAATGAATATTGATTCAT------AAAAACTAGAAATAGGATAGAAATAA------------------------AAATCTAAGTGAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAAGAAAAGAAA-GTTCTACCCAAGCA------CTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATTA---------TTCATTAACGTTA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCT{CT}CGGGACCGAACA-T Gymnocalycium_leptanthum ---------GAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACA---------------------------------------------------------------G-CGA-TTAGCCACTCCAATTTTGT--------------------TA-A---------------CAT-CCAACA----------TGAACTCCAAA-----TTCAA--C----CACTA--------------TCATTATAA----AT-----------CAACA--------------------TTTT-CATATTCGATTTC-GATTCCA-CTC--------A-------CCTCATGTCCACTTGACTTT-TTA-ATTTA-CTTTTGAAAA-----------------------------------------------------------------------------------------------------------------------------------CAAATCCAATATCTTGAGAA-----------------------------------------------------------------------------------------------AATGGAATTTAT-GA-TTCATTCTTTCTCTCGCAATGGAACT-------CAGTTCA------TGATAGAGA------TCTATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCACTGTCAAGAGTGAATTTA-----------AGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTGAAAAAACAAACAAGGGTTGGGTTGCAC---ATATAGA----------TATTTCACTCCCTAAA----C-----------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTA----C-TTTTCAATTGCAA--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-GAAAGAAATGGAACTATCCATA-----------------------------------------------------------------------TTCA-TTAATATGGA---------------------TCTATTTAG--------------------------------------------------------AATAGAAAATAT----------------------------------------------AGAATATTAATGAATATGGATTCAT------AAAAACTAGAAATAGGATAGAAATCA------------------------AAATCGAAGTGAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATCGATGAATCGAAAAGCGAAGAAGAAAAGAAA-GTTCTACCCAAGCCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATTA---------TTCATTAACGTGA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATCA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Gymnocalycium_paraguayense ----------AAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACA---------------------------------------------------------------G-CGA-TTAGCCACTCCAATTTTTT--------------------TA-A---------------CAT-CCAACA----------TGAACTCCAAA-----TTCAA--C----CACTA--------------TCATTATAA----AT-----------GACCA--------------------TTTT-CATATTCGATTTC-GATTCCA-CTT--------A-------CCTCAGGTTCACTTGACTTT-TTA-ATTTA-CTTTTGAAAA-----------------------------------------------------------------------------------------------------------------------------------CAAATCCAATATCTTGAGAA-----------------------------------------------------------------------------------------------AATGGAATTTAT-GA-TTCATTCTTTCTCTCGCAATGGAACT-------CAGTTCA------TGATAGAGA------TCTATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCACTGTCAAGAGTGAATTTA-----------AGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC---------AAAGCT-----TATTTCACTCCCTAAA----C-----------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTA----C-TTTTCCATTGCAA--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAA----------TATGTAGATACAATCGGGATCCAAATCACAAA-GAAAGAAATGGAACTATCAATA-----------------------------------------------------------------------TTCA-TGAATATGGA---------------------TCTATTTAG--------------------------------------------------------AATAGAAAATAT----------------------------------------------AGAATATTCATGAATATTGATTCAT------AAAAACTAGAAATAGGATAGAAATCA------------------------AAATCGAAGTGAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATCAATCTACATAAATAGATGAATAGAAAAGCGAAGAAGAAAAGAAA-GTTCTACCCAAGCCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATTA---------TTCATTAACGTGA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCT-CGGGACCGAACA-T Gymnocalycium_pflanzii_subsp._argentinense -----AAAATAAATTTCCAAGAG-{AC}T-GTGGATTGATCGATTAAT-----------------------------------------------------------------------------G-CGCCTTAGCCACTCC----------------------------TA-A-----------------T-CCAAC-----------TGAACTTCAAA-----TT------------------------------------------------------------TGAATTCTATTCGAATTCATTTTAGCATATTCGATTCC-ATTGAAA-CTG--------A-------GATCAGGTTCACTTGAA---------TTTCTCTTTTGAAAA-----------------------------------------------------------------------------------------------------------------------------------AAAATCCAATATCTTGAGAA-----------------------------------------------------------------------------------------------AATTGAATTTAT-GA-TTCATGATTTCTATCGCAATGGAACT-------CAGTTCA------TGATAGAGA------TCTATTT--------CGAGCCA-----------------------------------------------------------C---------------TATCTCACTGTCAAGAGTGAATTTA-----------AGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAAC{GT}{GT}AAAA{AG}ACAAACAAGGGTTGGGTTGCACC{CG}GAACGATAAAGCT-----TATTTCACTCCC---C----CTTAC--TCCTTTTTTGATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AAA-----------------------TTTT-TTTTC-----CCA--TTTCAAAACAGGCT-----AAAGGCCCCA------AA-----TTTCCCTTATCCCAAACAGTCCTTGTGATGTACGTAA---------------------------------TGAGTGATTCACAATCAACCTAGAATCCTCATTACACA-----------TAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTAGACTTTTA----C-TTTGCAATTGCAA--------CCCGAGTTCTCA-------TATT-----CAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-GAAAAAAATGGAACTCGAAATA-----------------------------------------------------------------------TTCA-TTAATATTTC---------------------TATATTTAG--------------------------------------------------------AATCGAAAATAT----------------------------------------------AGAATATTAATGAATATTTATT-------------ACT--AAATAGGATAGAAAGAA------------------------AAATCGAAGTTCAGTATA-------CAATTGTATTGGATTGGCACTACATAATCAATCTACATAAATCGATGAATAGAAAAGA-----ATAAAAGAAA-GTTTTACCCAAGCA------CTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATTA---------TTCATTAACGTGA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTGATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Gymnocalycium_pflanzii_subsp._pflanzii CAAAGAAAAGAAATTTCCAAGAGCAT-GTGGATTGATCGATTAAT-----------------------------------------------------------------------------GACGCCTTAGCCACTCC----------------------------TA-A-----------------T-CCAAC-----------TGAACTTCAAA-----TT------------------------------------------------------------TGAATTCTATTCGAATTCATTTTAGCATATTCGATTCC-ATTGAAA-CTG--------A-------GATCAGGTTCACTTGAA---------TTTCTCTTTTGAAAA-----------------------------------------------------------------------------------------------------------------------------------AAAATCCAATATCTTGAGAA-----------------------------------------------------------------------------------------------AATTGAATTTAT-GA-TTCATGATTTCTATCGCAATGGAACT-------CAGTTCA------TGATAGAGA------TCTATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCACTGTCAAGAGTGAATTTA-----------AGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC---------AAAGCT-----TATTTCACTCC----C----CTTAC--TCCTTTTTTGATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AAA-----------------------TTTT-TTTTC-----CCA--TTTCAAAACAGGCT-----AAAGGCCCCA------AA-----TTTCCCTTATCCCAAACAGTCCTTGTGATGTACGTAA---------------------------------TGAGTGATTGACAATCAACCTAGAATCCTCATTACACA-----------TAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTA----C-TTTGCAATTGCAA--------CCCGAGTTCTCA-------TATT-----CAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATCACAAA-GAAAAAAATGGAACTCGAAATA-----------------------------------------------------------------------TTCA-TTAATATTTC---------------------TATATTTAG--------------------------------------------------------AATCGAAAATAT----------------------------------------------AGAATATTAATGAATATTTATT-------------ACT--AAATAGGATAGAAAGAA------------------------AAATCGAAGTTCAGTATA-------CAATTGTATTGGATTGGCACTACATAATCAATCTACATAAATCGATGAATAGAAAAGA-----ATAAAAGAAA-GTTTTACCCAAGCA------CTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATTA---------TTCATTAACGTGA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Gymnocalycium_rauschii ---------------------AG-ATAGCAGATTGATCGATTAATTAA{AG}-CCTAAGACA---------------------------------------------------------------G-CGA-TTAGCCACTCCAATTTTGT--------------------TA-A---------------CAT-CCAACA----------TGAACTCCAAA-----TTCAA--C----CACTA--------------TCATTATAA----AT-----------CAACA--------------------TTTT-CATATTCGATTTC-GATTCCA-CTT--------A-------CCTTATGTCCACTTAACTTT-TTA-ATTTA-CTTTTGAAAA-----------------------------------------------------------------------------------------------------------------------------------CAAATCCAATATCTTGAGAA-----------------------------------------------------------------------------------------------AATGGAATTTAT-GA-TTCATTCTTTCTCTCGCAATGGAACT-------CAGTTCCTGATTCTGATAGAGA------TCTATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCACTGTCAAGAGTGAATTTA-----------AGGTCTTTCGACTTCAAAAGGGGGTAAGA{AG}ATTGGAAACTGAAAA{AG}ACAAACAAGGGTTGGGTTG{CG}ACGG{GT}ATATAGA----------TATTTCACTCCCTAAA----C-----------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTA----C-TTTTCAATTGCAA--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT{AC}AGTTATGTAGATACAATCGGGATCCAAATCACAAA-GAAAGAAATGGAACTATCAATA-----------------------------------------------------------------------TTCA-TTAATATGGA---------------------TCTATTTAG--------------------------------------------------------AATAGAAAATAT----------------------------------------------AGAATATTAATGAATATTGATTCAT------AAAAACTAGAAATAGGATAGAAATCA------------------------AAATCGAAGTGAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATCGATGAATCGAAAAGCGAAGAAGAAAAGAAA-GTTCTACCCAAGCCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATTA---------TTCATTAACGTGA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTTCGTAGGTTGAGCGCCTTTTTCAAGA{ACG}AATATAGAATAGCAGGAACATTTAAAT---------------------------------------------------------------------------- Gymnocalycium_schickendantzii ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTT--TGAA----CTTT------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAA--------CCCGAGTTCTCA-------TATT-----CAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATCAGTTATGTAGATACAATCGGGATCCAAATCACAAA-GAAAGAAATGGAACTCGAAATA-----------------------------------------------------------------------TTCA-TTAATATTTC---------------------TATATTTAG--------------------------------------------------------AATCGAAAATAT----------------------------------------------AGAATATTAATGAATATTTATTCAT------AAAAACTATCAATAGGATAGAAAGAA------------------------AAATCTAAGTGAAGTAGA-------AACTTGTATTGGATTGGCACTACATAATCAATCTACATAAATCGATGAATCGAAAAGA-----ATAAAAGAAA-GTTCTACCCAAGCA------CTC-------ATTCTATCTTTTTTTTTTGATTTCATTCATTA---------TTCATTAACGTTA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATAGAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTGATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Haageocereus_pacalaensis AAA-TAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAA--CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCCATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTACACTTTTAA-----------CATCA--------------------TTTCACATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA--------TTTTCTCTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATAGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAA------TCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTATA------TATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--T{AT}TCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGT-CTATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----TAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Matucana_aurantiaca -----AAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCCATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTACACTTATAA-----------CATCA--------------------TTTCACATATTCGATGCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTTCACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATAGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTTA------TTATTTATA------TATATTT--------CTATCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAG----------TT{CG}ACTCCCTAACCTAGCTTAC--TC{GT}{AT}TTTTTTATT-A-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA-----TTTTTAATTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACG{CGT}A------TTTC----ATCA---------C-TGT-ATATACGTAA---------------------------------TGAGTGATTCACAATCAACC---AAT-C--ATTACACCGTACTAAAACGAAAATACACTAAGAGAC----TCC---TTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAA--CTTT{AC}-{AC}{AC}ATACTTTTCCGTCC-TTTTCAATTGA-A--------CCCGAGT-CTCA-------TATT--------ATGA{AC}TAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Melocactus_oreas AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATA----------------------------------------------------AGGAGTTAG-CGA-TTAGCCACTCCCATTTTTT--------------------TCGCGTAC-----------CAT-CAATCA----------TCAAA-ACAAA-----TTCACATA-------------------------AAAC-ACGTATAA-----------TCGCA--------------------TTTTACATATTCGATTCA-ATAAAAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-TCA-ATTTCACTTTTCAAACAAA-TCCAA-TAT-T---------------------------------------------------------------------------------------------------------------------CAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------A----TA-TTTCAATTGAATTTAG-GA-----------------------------------------------------------------------------------------------------------------------------------------------CTATACATATA-----TATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTGAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTAACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAG{AG}{GT}CCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGT-ATATACGTAA---------------------------------TTAGTGATTCACAATCAACCTAGAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT------------------------------CTTTTCCGTCCCTTTTCCATTGCAA----------A-AGTTCTCA-------TATG-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAA---------GTTATGTAGATACAATCGGGATCCAAATCAA-----------------C---CAATA-----------------------------------------------------------------------TTAA-TAAATAT--ATAT-A------------ATTATATA----------------------------------A------------------------ATAATATACAATATC---------------------------------ATTTCATTATTTC------------ATAATAATGAAT------AAAAACTAGAAATAGGATAGAAATAATGAAATA------A-TAAGGAGAAAAATCTAAGTTAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACAT-------CTACATAAATAGATGAATAGAAAAGCGAAGAATAAAAGAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATTA---------TTAATGAACGTCA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Micranthocereus_auriazureus -------------------------------------CGATTAAGTAGG-CCTAGGACCATCTA-------ATAAAATAAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTACAAA-----TTCACATA-------------------------AAAT-ACG-----------------------------------------TATAACATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-TAA-ATTTCACTTTTTAAACAAA-GAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------------CTA--TT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAA{AC}ACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAA-------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCAA----------A-AGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGCTAAGTTATGTAGATACAATCGGGATCCAAATCAA-----------------C---CAATA-----------------------------------------------------------------------TTAA-TTAATATT-ATAT-ATATTATATTATAATTATATATTT---------------------------ATATAATATTAATTAATATTTATA-------------------C---------------------------------ATTTCATTATTTA------------ATA-------AT------AAAAACTAGAAATA-----------ATGAAATA------A-TAAGGAGAAAAATCTAAGTTAAGTATCCAAAAAAAACTTGTATTGGATTG-CACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTA---------TTAATTAACGTCA-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGGCCGAACAGT Neoraimondia_arequipensis_subsp._roseiflora ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAA-------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCAA----------A-AGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATG-------GGATATGTTATGTAGATACAATCGGGATCAAAATCACTAA-TTCAAA--TTGAACTTGAAATA------------------------------------------TAAATATTGAATTGCAATATAAATTATAT--------------------------ATA--AATTATATATTTAG------------------------------------------------ATAATTAGAATAGAAAATATATA--------TAA--TTTATATATA---ATTTCATTTCATTATTTA-------AAT--AT-ATAATTAAT------AAAAAATAGAAATAGGATAGAAATAATGAAATCTGAAATA-TAAGGAGAAAAATCTAAGTTAAGTATCA-AAAAAAACTTGTGTTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAAAAAA-GTTATACCA----C----ACCTC-------ATTCTATC---TTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTTAAAATATCGTAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATAGAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTC---------------- Neoraimondia_herzogiana ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTCTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA-TTTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCTCCCGGACGGAAATGCTTTTCCCTTATCCAAAACAGTCCTTGTGATATACGTACAAAATGAATATCTTTGAGCAAGGAATAATCATTTGAGTGATTCACAATCAAAC-----TACTCATTACACCGTACTAGAACTTAAATACACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGTTACCTAGATAAGACTTTG-TTATACCTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------CATT-----AAAATGAGTAGATGAT------GCCCCGCGAA-GGGGAATGCCAAAATAGATATGTTATGTAGATACAATCGGGATCAAAATCACTAA-TTCAAA--TTGAACTTGAAATA------------------------------------------TAAATATTGAATTGCAATATAAATTATAT--------------------------ATA--AATTATATATTTAG------------------------------------------------ATAATTAGAATAGAAAATATATA--------TAA----TA-ATATA---ATTTCATTTCATTATTTA------------ATAATAATTAAT------AAAAAATAGAAATAGGATAGAAATAATGAAATCTGAAATA-TAAGGAGAAAAATCTAAGTTAAGTATCA-AAAAAAACTTGTGTTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAAAAAA-GTTATACCA----C----ACCTC-------ATTCTATC---TTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTTAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATAGAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGAGTTCTCTTCCCTCTCTTCGGGACCGA----- Neowerdermannia_vorwerkii AAAATAAAATAAAAGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATAAGACAT----------------A------------AGGAGTTAG-A-------CCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTCCACTT---------------TTGCA-------------------------CTTATTCAATTCA-ATTTCAA-CTG--------CAGTGAATTCTCAAGTTCACTCAAA---------CTTCACTTTTCAAACAAA--AAAA-AATC-A-------------------------------------------------------------------------------------------------------------AA----TCAATCCAGTATATTGAGT-A-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGCCCTCTTATTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-C-CATC{GT}{AG}GGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAGAAGGTGGTCAGA------------------------------------------------AACGCT-----TATTTCACTCCCTAACCTAGCTTTC--TCCTTTTTTTATTAA-CAGCTTTGG----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGATTATATTCCTTA--TTTTTT---TTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCTCCCGGACAGAAATGCTTTTCCCTTATCCCAAACAGTCCTTGTGATATACGTACAAAATTAATATCTTTGAGCAAGGAATAATTATTTGAGTGATTCACAATCAAAC-----TACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCTGTGCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCCATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAG---AT------GCCCCACGAAGGGGCAATG------------TGTTATGATTTAT{ACG}TTTTA----------CACAAA-CTCAAAA------C----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAAGATGGAAATAATGCAATCTGAAATA-TAAGGAGAAAAA-CTCAGTTTAGTA---------AACTTGTGTTGGATTGGCACTAAATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCGAGAACCTC-------TATTTATC-TTATTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAA-CCTCTGCCC------------------------------------------------------------------------------TCTTTAAAATATCATAAACGGGTTCCGTAG-TTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA--TTTGATT-TTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Oreocereus_celsianus AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCCATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTACACTTATAA-----------CATCA--------------------TTTCACATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTTCACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATAGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTATA------TATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCGTTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Oroya_peruviana -------------------ATAGC{CG}TAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCCATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTACACTTATAA-----------CATCA--------------------TTTCACATATTCGATGCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTTCACTTTTCAAACAAA-AAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATAGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTATCTATTATTATATTT--------CTATCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCG-CTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATAT--------------------------C----C---C-------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------------------------------------------------------------A------TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCC-TTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Parodia_magnifica ------------------GATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATAAGACAT----------------A------------AGGAGTTAG-A-------CCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTCCACTTTT-----------------------------------------GACTTATTCGATTCA-ATTTCAATCTG--------CAGTGAATTCTCAAGTTCACTCAAA---------CTTCACTTTTCAAACAAA-AAAACAAATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTCATTTGTTCTATCATTATAGACAATCCTTTCGATATTATCTACGAAAATCGTAACCTATACTATATA------ACCAAATA-TATCAATTGAATTTAT-GAAT{AT}CA{AT}TATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------AATAT{AT}G--------ATA---------------------------------------------------------------C-------------TATGTCT-GCC--------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCTCCCGGACGGAAATGCTTTTCCCTTATCCCAAACAGTCCTTGTGATATACGTACAAAATGAATATCTTTGAGCAAGGAATAATCATTTGAGTGATTCACAATCAAAC-----TACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAAGGAGTAGATGAT------GCGCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATAGAATCGGG------ATCACAAA-TTCAAA--TTGCTCTTG----------ATTTCAATTCA---------TTATTATATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAAAGAAAAA-TA-AAA---GATGTAAATAATGCAA-C----AGACTAAGGAGAAAAATCAAAGTTTAGTATCCAAAAAAAACTTGTGTTGGATTGGCACTAAATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTTAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTC{CT}CTCTCTTCGGGACC------- Parodia_microsperma ----------------------------------------------------------C--C---------ATAAAATAAGACAT----------------A------------AGGAGTTAG-A-------CCACTCCCATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------TAATTCAACTTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATATTG-ATATA-TGTATCT-------TATAGCCCTCTTCGTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTACGACTATATATATACAACATATCCCGCCGTGAAGAGTGAATTTCCAAATTA-TTTAGGTCTTTCGACTTCAAAATGTGGTAAGAAATTGAAAACTTGAAAAATAAACAAGGGTTGGGTTACACCATATATAT--------------------------C----C---C-------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A--------------------------------------------------------------------------------------------------------------------------------------------GTTCAA-----GTCCCTCTATCCCCCC------------------------------------------------------------------------------------------------------------------------------------------------------C-----------------AGAC-TTGTTTATACTTTTCCGTCC---{AT}-C--TT-CACCATAGACCCCCGAGTTCTCA-------TATTTGAAGGAAAGGAGTAGATGAT------GCGCCACGAAGGGGGAATG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Rauhocereus_riosaniensis ---------TAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATTAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTACACTTTTAA-----------CATCA--------------------TTTAACATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTACACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATAGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTGAGA------TATATTT--------CTAGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAGACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTTA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCCATTTCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT{AC}AGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATTAACGTCCAAAATTCTTTATTCTTTAAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_deminuta -----AAAATAAATGTCCG-TAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATAAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCCATTTTTT--------------------GCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTACACTTTTAA-----------TATCG--------------------TTGAACATATTCGAGTCA-ACTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTTCACTTTTCGAACA{AG}A-TA-------C-----------------------------------------------------------------------------------------------------------------TGGATGAATCAA{AG}{AG}ATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGA{AG}TTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTC--TTTTATCCCTTTCCTGATGGAATTCCGCATATTTTTCACATCTAGGACTATAC{AT}A-T-CGA{CG}ATATCTCGCCGTCAAGAGTGAAT-TCCGA-TGA-ATTAGGTCTT-CGACTTC----------------------------------------------------------------------------------------C----C---C---------------------C---------------------------------------------A---------------------------------------------------------------------------------------------------------CTTATAT{AT}GA-ATAGAATAGAATAACCCGATTGAAGCGTAACGATCAATTGAAACGCCCAAAACAACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----A----------AACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCA------TATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTAAAAGAAACTTAGAGACAAAGTCATTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTT-TTATACTTTTA----C-TTTGCAATTGA-A--------A-CGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATA-------------------C--------------------------------------------------------------------------------TCA-TGAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_einsteinii AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATA----------------------------------------------------AGGAGTTAG-CGA-TTAG{CG}CACTCCCATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAA-------------C--TTCACTA--------------T-ATTACACTTTTAA-----------CATCA--------------------TT-AACATATTCGAGTCA-ACGTCAA-CTG--------A-------TCTCAAGTTCACTTCAA---------TTTCACTTTTCAAACAAA-TA-------C-----------------------------------------------------------------------------------------------------------------TGGAGGAATCAAT--TCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCCAATA-TTTCAATTGAATTGAT-GA-TTCAGGATTTCGAGCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT---------TAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACAGCTAGGACTATATATA-A-AA-ATATTTCGC-GTCAAGAGTGAA--------------------------------------------------------------------------------------------AA-----------TTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTT------------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGT-----------------------------------------------------------------------------------------CC--AACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTCAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATCAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------A-CGAGTTCTCA-------TATG-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATGGAACTTGCAATA-----------------------------------------------------------------------TTAA-TTAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATCGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTCGAACTTCTTTTAATTCACGTCCCAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCT{AT}CGGGACCGAACA-T Rebutia_fiebrigii -----------------------------AGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATAAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCCATTTTTT--------------------GCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTACACTTTTAC----ATGTTAATATCC--------------------TTCAACATGTGC-ACGCA-ACGTCAA-CTG--------A-------T-TCAAGTTCACTTAAA--------ATTTCACTTTTCGA{AG}CA{AG}A-TGA------C-----------------------------------------------------------------------------------------------------------------TGGATGAATCAC---TGTTGAG{AC}CGCGTCTTTTA-----------------------------------------------------C--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C----C---C---------------------C---------------------------------------------A---------------------------------------------------------------------------------------------------------CTTATATAGA-ATAGAATAGAATAACCCGATTGAAGCGTAACGATCAATTGAAACGCCCAAAACAACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----A----------AACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCA------TATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTAAAAGAAACTTAGAGACAAAGTCATTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTT-TTATACTTTTA----C-TTTGCAATTGA-A--------A-CGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT{AC}AGTTATGTAGATACAATCGGGATCCAAATA-------------------C--------------------------------------------------------------------------------TCA-TGAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_minuscula AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCGAAGACCATCGA-------ATAAAATTAGACAT----------------A------------AGGAATTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAAA---------------------------TTCACATCTGTTCACTA--------------T-ATTCCACTAATAA-----------CATA---------------------TTTAACGTATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTTCACTTTTCAAACAAA-TAAAA-T-------------------------------------------------------------------------------------------------------------------------------------------C-----------------------------------------------------------------TAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------ATAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATC{GT}AGGACTATAC--------------TCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTTGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACGA{GT}ATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------T---------ACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCCAGATAAGACTTTG-TTATACTTTTA----C-TTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT{AC}AGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAAT----C------TA-----------------------------------------------------------------------TTAA-TAAATAT--ATAT-AT-T---------------TATTTAG------------------------------------------------ATAATTATAATAGAAAATATATAATATTAATTAATATTTATATAAAAATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAA{CT}ATTTAAATAA-GTGTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGG-CCGAACA-T Rebutia_padcayensis -----------------------CATAACAGATT---C-ATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAAA---------------------------TTCACATCTGTTCACTA--------------T-ATTCCACTAATAA-----------CATA---------------------TTTAACGTATTCGATTCA-A--------------------------------------TTCAA---------TTTCACTTTTCAA{AG}C{AG}{AG}A-T-------------------------------------------------------------------------------------------------------------------------------------------------C---------------------------------------------------------------------CTATATT-------CCA{AG}{AG}T{AG}-TTTCAGTTGAGTTTAT-GA-{AT}TCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------AGGGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCGTATTTT-CACATCTAGGAC-AT{AG}CA---------TATCTCGCCGTCAAGAGTGA-TTTCCGGGT-A-TTTAGGTCTTTCGACTTCAG--GGGGG-AAGGGGTTGGAGGCTTCAAGGGGCG-CGAGGGTTGGG---------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC---------------------C---------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------TCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------T---------ACAATCAACCTATAATACTCATTACACCGTACTCAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCCAGATAAGACTTTG-TTATACTTTTA----C-TTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----CAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATG------------------------------GGGATC-------------------------C--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCAGAAACGGTTTCCGTAG-TTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_pseudodeminuta --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C----C---C---------------------C--------------------------------------------------------------------------------------------------------------------------------AAA--------------------CTTATATAGA-ATAGAATAGAATAACCCGATTGAAGCGTAACGATCAATTGAAACGCCCAAAACAACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC------------------CAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCA------TATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTAAAAGAAACTTAGAGACAAAGTCATTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTT-TTATACTTTTA----C-TTTGCAATTGA-A--------A-CGAGT{GT}CTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATA-------------------C--------------------------------------------------------------------------------TCA-TGAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_pygmaea_CA08 --------------------TA{AT}CATAGCAGATTGATCG{ACG}{ACT}TAATTAAAACCTAAGACCATA----------------------------------------------------AGGAGTTAG-CGA-TTAGCCACTCCCATTTTTT--------------------TCGCGTAC-----------CAT-{CG}CAAA---------------------------TTCCCATCTGTTCACTA--------------T-ATTACACTTGTAA-----------CATCG--------------------TTTCACATATTCGAGTCA-ACTTAAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTTCACTTTTCAAAC{AG}{AG}A-{GT}A-------C-----------------------------------------------------------------------------------------------------------------TGGATGAATCAA{AG}{AG}ATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAAGA-TTTCAATTGA{AG}TTTAT-GA-TTCATTCTTTCTATCGCACTGGAAC{GT}-------{AG}{AG}GTTCA------TTATTTAGA------TATATTT--------CT{AG}GCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACA---------TATCTCGCCGTCAAGAGTGAATGGCCGAATTA-TTTAGGTCT{CT}TCGACTTC----------AAGAGATTGG{AG}AACGTAAAGGGCAAAC{AG}AGGGTTGGGTGG{CG}GCGGGG------AAGCT-----TATTTCACTCC----C----C---C---------------------C-----GCTGTCCATGGATCAAATTCTTTCTTTGGATTGGCTTCACCTTTATTTTCTACAGCTCCTTTGCGTGTGCTCGGGGTAGAAGTTTTGTATAAATGTATGGTCATGCTATTAAGTATTTTGATGAAAGTTTCTTTTCTTCTTTTTCTCTTATAATGAGATAGAATAGAATAACCCGATTGAAGCGTAACGATCAATTGAAACGCCCAAAA-AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCCAAA----C-TGTGATATACGTAA---------------------------------TGAGTGATTCTCAATCAACCTATAATACTCATTACACCGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATCAGACTTTG-TTATACTTTTCCGTCC-TTTTCAATTGA-A--------A-CGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATA-------------------C--------------------------------------------------------------------------------TCA-TTAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTCGAACTTCTTTTAATTAAA---C------CTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_pygmaea_CA93 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C----C---C---------------------C---------------------------------------------CTTTATTTTCTACAGCTCCTTTGCGTGTGCTCGGGGTAGAAGTTTTGTATAAATGTATGGTCATGCTATTAA----TTTGATTAAAGTTTCTTTTCTTCTTTTTCTCTGATAATGAGATAGAATAGAATAACCCGATTGAAGCGTAACGATCAATTGAAACGCCCAAAACAACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAAA----C-TGTGATATACGTAA---------------------------------TGAGTGATTGAGAATCAACCTATAATACTCATTACACCGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATCAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------A-CGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT-------------------------CTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATA-------------------C--------------------------------------------------------------------------------TCA-TTAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTCGAACTTCTTTTAATTAAA---C------CTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_steinmannii ----------------------------------GATCGATTAATTAAA-CCTAAGACCATA----------------------------------------------------AGGAGTTAG-CGA-TTAGCCACTCCCATTTTTT--------------------TCGCGTAC-----------CAT-CCAAA---------------------------TTCCCATCTGTTCACTA--------------T-ATTACACTTGTAA-----------CATCG--------------------TTTCACATATTCGAGTCA-ACTTAAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTTCACTTTTCAAACAAA-TA-------C-----------------------------------------------------------------------------------------------------------------TGGATGAGTCAAAAATCTTGAGAC{AG}AGTCTTTTA-----------------------------------------------------CCTAAAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C----C---C---------------------C-------------------------------------GATT{AT}CACCTTTATTTTC{AT}ACAGCTCCTTTGCGTGTGCTCGGGGTAGAAGTTTTGTATAAATGTATGGTCATGCTATTAAGTATTTTGATGAAAGTTTCTTTTCTTCTTTTTCTCTTATAATGAGATAGAATAGAATAACCCGATTGAAGCGTAACGATCAATTGAAACGCCCAAAACAACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCCAAA----C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATCAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------A-CGAGTTCTCA-------TATT-----AAAA-------------------------------------CTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATA-------------------C--------------------------------------------------------------------------------TCA-TTAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTCGAACTTCTTTTAATTAAA---C------CTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Samaipaticereus_corroanus AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATTAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCAAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTACACTTTTAA-----------CATCA--------------------TTTAA{CG}ATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA--------TTTTCTCTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCCAAAATCGTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACGATATT-------CCAAATA-TTTCAATTGAGTTTAT-GA-TTCATTATTTCGATCGCACTGGAAC{GT}-------AAGTTCA------TTATTTAGA------TATATTT--------CGAGCCA-----------------------------------------------------------C---------------TATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAGAAGGGGG{AT}AAGA{AT}ATTGGAAACGGAAAAG{AT}CAAACAAGGGTTGGGTTG------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAATTTTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCA---------C-TGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--TCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---CTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GT{GT}TGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Stetsonia_coryne AAAATAAAATAAATGTCCGATAGTATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATAAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTA--CGTATAA-----------CATCA--------------------TTTTACATATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTAAA---------TTTCACTTTTCAAACAAA-TAAAA-TATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATA-----------------------------------------------------------------------------C--ATCATATA----ATATCTCGCTGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------A-CGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAACTTG--C--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTA---------TTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCCCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Sulcorebutia_arenacea AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AC------C--CTA-------ATAAAATTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTTAAA-CTG--------A-------TCTCAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGATACAAGTCTTTTA-----------------------------------------------------CCTAAACTATAA-CTATATTCCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATAT---ACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGG--------------------------------------------------------GCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTAAAAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTGCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA--AAAAAAATTGAACTTGCAATA-----------------------------------------------------------------------TT----------------------------------------TAT------------------------------------------------ATAATTAGAATATAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCT{CT}TTCGGGACCGAACA-T Sulcorebutia_canigueralii_CA103 AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AC------C-TCTA-------ATAAAATTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCTTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTTTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTGAAA-CTG--------A-------TCTCAAGTTCACTTTACTTT-TACAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGAA-----------------AATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC--------------T-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGT{GT}GATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCT{GT}GAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGC--TCTCTTCCCTCTCTTCGGGACCGAACA-- Sulcorebutia_canigueralii_CA104 AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AC------C-TCTA-------ATTAAATTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTA{AC}-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTGAAA-CTG--------A-------TCTCAAGTTCACTTTACTTT-TACAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATAT{AC}T--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATAC{AG}ACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGAA-----------------AATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC----------{CT}TGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAACTTGGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCT{GT}GAACCTC-------ATTCTATC-TTTTTTTTTGATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGC--TCTCTTCCCTCTCTTCGGGACCGAACA-- Sulcorebutia_canigueralii_CA27 -----AAAATAAATGTCCGATAGC-TAGCAGATTGATCGATTAATTAAA-AC------C-TCTA-------ATAAAATTAGAAAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCTTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTGAAA-CTG--------A-------TCTCAAGTTCACTTTACTTT-TACAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGAA-----------------AATTGGAAAATTAAAAAACAAACAAGGGTTGGGTTGCACGA{GT}ATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCC-TTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGC--TCTCTTCCCTCTCTTCGGGACCGAACA-- Sulcorebutia_cardenasiana AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AA------C--C---------------TTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTTCA-------------A------------AGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-GAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTC------------------GAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC-----------------------------------C--AGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAAGAAA-GTTATACCCAAGCCT{GT}GAACCTC-------ATTCTATC-TTTTTTTTTGATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-- Sulcorebutia_crispata_CA09 AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AA------C--C---------------TTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTGAAA-CTG--------A-------TCTCAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTC-CTTTTATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACCAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACCTAGA-----------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---TTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCCCAAA-TAAAAAAATGGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCCAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Sulcorebutia_crispata_CA106 AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AA------C--C---------------TTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTGAAA-CTG--------A-------TCTCAAGTTCACTTTACTTT-TTCAATTTCAC{AC}{AC}TTCTTTC{AT}{ACT}{ACT}-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GGGTCGGAGGGCTGGAGAC{AG}AGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATAT{AC}T--------{CG}TAGCCCTATTCTTTTC-CTTTTATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTAATTTAGGTCTTTCGA-T----------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACCTAGA-----------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---TTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCCCAAA-TAAAAAAATGGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCCAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCG------ Sulcorebutia_mentosa -----AAAATCAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AA------C--C---------------TTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-AGTTCAC-A----------A-------TTTCAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGAAATTGGAAACT--AAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATA--------------------------------TTT------C-TTTTCAATTGA-A--------CCCGAGTGCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCC--------------CTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATGG--C-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAAGAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Sulcorebutia_purpurea --------------------------------TTGATCGATTAATTAAA-CCTAAGACCATCTC-------ATCAAATTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATAATTTCAATTGAATTTATTGA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACA------ACATATCTCGCCGTCA-GAGTGAATTTCCGAATTA-TTTAGG-CTTTC----------GGGGGTAAGAAATTGGA-ACTTAAA--GCA-ACAAGGGT-------------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAAT---------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAA---------A----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTATACCCAAGCCTAGAACCTCATTCTATATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Sulcorebutia_spec._CA101 AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AC------C--CTA-------ATAAAATTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTTCATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTTCAA-CTG--------A-------TCTCAAGTTCACTTTACTTTTTAA-ATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATTCCAAATTCCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTAT---------ACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGA------------------------------------------------AAAGCTTCTTTTATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------AACGGTGGTTATGTTCCTTA-TTTTTTTTTTTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTAATATACGTAA---------------------------------TGAGT-ATT-ACAATCAACCTATAATACTCATTACCCCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGT{CGT}CTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATG---------------------------------------ATCACCAA---AAAAAATTGAACTTGCAATA-----------------------------------------------------------------------TTAA-T--ATAT--ATA-------------------TATATTTAT------------------------------------------------ATAATTAGAATATAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAATCTGAAATA-TAAGGAGACAAATCTAAGTTAAGTATCCAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTGTGATTCTTTATTGGATCATAAAAAC{GT}CAC----------------------------------------- Sulcorebutia_spec._CA99 AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AC------C-TCTA-------ATAAAATTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTGAAA-CTG--------A-------TCTCAAGTTCACTTTACTTT-TACAATTTCACTTTTCAAACAAA-TAAAA-T{GT}TA----------------------------------------------------------------------------------------------------------------------GAATC{GT}A{GT}{GT}{CGT}TCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------CTCCCTTTCCTGATGGCATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGAA------------------ATTGGA-ACTTAA----------------------------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTCATATACGTAA---------------------------------TGAGTCATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGC--{GT}CTCTTCCCTCTCT-CGGGACCGAACA-T Sulcorebutia_steinbachii_CA107 AAAATAAAATCAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AA------C--C---------------TTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-AGTTCAC-A----------A-------TTTCAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAA{AG}ACAAACAAGGGTTGGGTTGCAC---------AAAGCT-----TATTTCACTCCC{AT}AACCTAGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAAT-A-------ACCGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATA--------------------------------TTTTCCGTCCG---------------------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATGGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAAGAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATCTTTTTTTTTT-ATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-- Sulcorebutia_steinbachii_CA28 -----AAAATCAATGTCCGATAGCA-AGCAGATTGATCGATTAATTAAA-AA------C--C---------------TTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-AGTTCAC-A----------A-------TTTCAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-GACATCTAGGACTATACATATACAACATATATCGCCGTGAAGAGTGAATTTCCGAATTA-TTTAGGTGTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACGATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATA--------------------------------TTTTCCGTCA-----C----GA-A--------CCCGAGTGCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCCCCAAATAAAAAAATGGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAAGAAA-GTTATACCCAAGCCT{AG}GAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Sulcorebutia_steinbachii_CA29 AAAATAAAATCAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AA------C--C---------------TTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-AGTTCAC-A----------A-------TTTCAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATA--------------------------------TTTTCCGTCA-----C----GA-A--------CCCGAGTGCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATGGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAAGAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Sulcorebutia_tarijensis AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AC------C-TCTA-------ATAAAATTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TG--------C---CCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTGAAA-CTG--------A-------TATCAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-GAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTCTCTTTTATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATAT--AACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGAA-----------------AATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC---------AA{GT}GCT-----TATTTCACTCCCTAACCTA-C-----------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C------------------------G-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAGAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TCAAAAAATGGAACTTGCAATA-----------------------------------------------------------------------TTAA-TAAATAT--ATA-------------------TATATTTAT------------------------------------------------ATAATTATAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Uebelmannia_pectinifera_subsp._flavispina AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATAAGACAT----------------A------------AGGAGTTAG-CGA-TTAGCCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTCCACG-----------------------------------------TTTAACATATTCGATTCA-ATTTAAA-CTG--------A-------TCTCAAGTTCACTTAACTTT-TAA-ATTTCACTTTTCAAACAAA-GAAAA-TATCAA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAA----------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGCTTTG-----------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAA-C---------CCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACTAAGGGGGAATGCTAAAAGGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAACTTGCAATA-----------------------------------------------------------------------TTAA-TCAATAT--ATAT-ATAT-ATAT----ATT-TCTATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC---------------------------------ATTTCATTATTTT------------ATAATAATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAATCTTCAATA-T--------AAATCTAAGTTAAGTATCCAAAAAAAACTTGTGTTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTACGGGACCGAACA-T Weingartia_buiningiana ---ATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AC------C-TCTA-------ATCAAATTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGA---------------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTCTTCACTA--------------T-ATTCCACTTATAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTTCAA-CTG--------A-------TCTAAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TCTA----------------------------------------------------------------------------------------------------------------------GAATA-------------C---------------------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGCTGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGG------------------------------------------AAAGCT-----TATTTCACTCCCTAAC----C---C-------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCCTATTAACTATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTT{AC}CCTCTCT-CGGGACCGAACA-T Weingartia_cintiensis ------------------------ATAGCAGAT-------------------------C--C--------------ATTAGACAT----------------CGGA-GTT------AGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAG-----------GAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGAGTCA-ATTTAAA-CTG--------A-------TCTAAAGTTCACTTCACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTCTCTTTTATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGAA-----------------AATT{CG}{CG}AAA{CG}TTAAAAAA{CG}AAA-AA{CG}{CG}{CG}TT{CG}{CG}{CG}TT{CG}{CG}A{CG}-ATATATATAAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAACTCAAAAAATTGAACTTGCAATA-----------------------------------------------------------------------TTAA-TAAATATATA---------------------TATATTTAT------------------------------------------------ATAATTATAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCT{CG}TCTTCGGGACCGAACA-T Weingartia_fidaiana AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AC------C-TCTA-------ATAAAATTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTGAAA-CTG--------A-------TCTCAAGTTCACTTAACTTTATTCAATTTCACTTTTCAAA-AA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCGCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAAGTTAAAA-A{CG}AAACAAGGGTT-----------------------------TATTT{CG}ACTCCCTAACCTAGCTTAC--TC------TTATTAA-CAGC---------------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------------------------TA--TTTTTTTTGTTTTC------A-----------C--GCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGG-TAAGTTATGTAGATACAATCGGGATCCA{AC}ATCACAAA-AAAAAAAATTGAACTTGCAATA-----------------------------------------------------------------------TTAA-T--ATAT--ATAT-A----------------TATATTTAT------------------------------------------------ATAATTAGAATATAAAATATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AT----TC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTT-----------------------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTT-TTGGATCATAAAAACCC{AC}CTTTCCGCAGA--T-TCTTCCCTCT{CT}TTCGGGACCGAACA-T Weingartia_neocumingii_subsp._pulquinensis AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTCAA-AC------C-TCTC-------ATAAAATTAGACAT----------------CGGGAGGGGAGGG-GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCCACT-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTATAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTTCAA-CTG--------A-------TCTAAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACA------------------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATT{CG}ACAATCAACCTATAATAA-------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Weingartia_neocumingii_var._hediniana -----AAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AC------C-TCTA-------ATAAAATTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGA---------------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTATAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTTCAA-CTG--------A-------TCTAAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATA-------------C---------------------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATAC{AG}ACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC{CG}A{GT}ATATATAAAGCT-----TATTTCACTCCCTAAC----C---C-------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCC-TTTTCAATTGA-A--------CCCGAGTTCTCCTATTAACTATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGAT{AC}AGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Weingartia_neocumingii_var._longigibba AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AA------C--C---------------TTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGA---------------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTATAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTTCAA-CTG--------A-------TCTAAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC------------GCT-----TATTTCACTCCCTAAC----C---C-------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACACTCCTTGT{AT}ATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCCTATTAACTATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCT-CGGGACCGAACA-T Weingartia_neocumingii_var._neocumingii AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AA------C--C---------------TTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGA---------------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTATAG-----------CGTA---------------------TTTTACGTATTCGATTCA-ATTTCAA-CTG--------A-------TCTAAAGTTCACTTTACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATA-------------C---------------------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAA{CG}AAA{CG}AAGGGTTGGGTTGCA--ATATATATAAAGCT-----TATTTCACTCCCTAAC----C---C-------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGA-A--------CCCGAGTTCTCCTATTAACTATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAA-TAAAAAAATTGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGCGAAGAATAAAATAAA-GTTATACCCAAGCCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Weingartia_westii -----AAAATAAA{GT}GTCCGATAGCATAGCAGATTGATCGATTAATTAAA-AA------C--C---------------TTAGACAT----------------CGGGAGG-------GGAGTTAG-CGCATTAGCCATTA-----------------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAACACTCCTTTACATCTGTTCACTA--------------T-ATTCCACTTTTAG-----------CGTA---------------------TTTTACGTATTCGAGTCA-ATTTAAA-CTG--------A-------TCTAAAGTTCACTTAACTTT-TTCAATTTCACTTTTCAAACAAA-TAAAA-TATA----------------------------------------------------------------------------------------------------------------------GAATCAAAAATCTTGAGACAAGTCTTTTA-----------------------------------------------------CCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTT--------CTAGCCCTATTCTTTTCTCTTTTATCCCTTTCCTGATGGA-TTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGAA-----------------AATTGGAAACTTAAAAAAC-----------------------------AAAGCT-----TATTTCACTCCCTAACCTAGCTTAC--TCCTTTTTTTATTAA-CAGA---------------------------------------------A---------------------------------------------------------------------------------------------------------A------------------------------------------------------------------------------------------TTTGTTTTC-----CAA--TTTCAAAACAGGCT-----AAAGGCCCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTAA---------------------------------TGAGTGATTCACAATCAACCTATAATAA-------ACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCC-TTTTCAATTGA-A--------CCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCCCCACGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCACAAACTCAAAAAATTGAACTTGCAATA-----------------------------------------------------------------------TTAA-TAAATAT--ATA-------------------TATATTTAT------------------------------------------------ATAATTATAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGAGTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Yavia_cryptocarpa A-AATCAAATAAAAGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-CCTAAGACCATCTA-------ATAAAATAAGACAT----------------A------------AGGAGTTAG-A-------CCACTCCAATTTTTT--------------------TCGCGTAC-----------CAT-CCAACA----------TGAACTCCAAA-----TTCACATCTGTTCACTA--------------T-ATTCCACTTTT-----------------------------------------GACTTATTCGATTCA-ATTTCAA-CTG--------CAGTGAATTCTCAAGTTCACTCAAA---------CTTCACTTTTCAAACAAA-AAAACATATCCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAAATCTTGAGACA-----TTTCATTTGT-CTATCATTATAGACAATCCTTTCAATATTATCTACGAAAATCGAAACCTAAACTATATT-------CCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTCA------TTATTTAGA------TATATTGATTTATGTCTAGCCCTATTCTTTTA------ATCCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGACTATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCCGAATTA-TTTAGGTCTTTCGACTTCAAAAGGTGGTAAGAAATTGGAAACTTGAAAAACAAACAAGGGTTGGGTTGCACCATATAT----------------------------C----C---C-------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------A---------------------------------------------------------------------------------------------------------------------C--ACT-----AAAGGCTCCCGGACGGAA-----TTTCCCTTATCCCAAACAGTCCTTGTGATATACGTACAAAATGAATATCTTTGAGCAAGGAATAATTATTTGAGTGATTCACAATCAAAC-----TACTCATTACACCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTCGAAGACCAAAGAAATCT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCCGTCCCTTTTCAATTGCACCATAGACCCCCGAGTTCTCA-------TATT-----AAAATGAGTAGATGAT------GCGCCACGAAGGGGGAATGCTAAAAAGGATAA----------TCGAATCGGGATCAAAATCCCTAA-TTCAAA-------CTTGCAATATTTTTATTTCAATTCAATATTGATTTTATTATATCTATTTTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACTCAAAATAGGATGGAAATAATGCAATCTGAAATACTAAGGAGAAAAATCTCAGTTTAGTATCCAAAAAAAACTTGTGTTGGATTGGCACTAAATAATAAATCCACATAA-----------------------------------------------------------------TTCTATC-TTTTTTTTTTATTTCATTAATTCGAACTTCTTTTAATTAACGTCCAA-----TTT-------TAAAACCTTTGCCC------------------------------------------------------------------------------TCTTTAACATATCATAAACGGTTTCCGTAG-TTGAGCGCCTTTTTCAAGAAAATCTAGAATAGCAGGAACATTTAAATAA-ATTTGATTCTTTATTGGATCATAAAAACCCAGTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAGCA-T ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1829] TITLE Kak11jan; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2331; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=- GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arrojadoa_rhodantha_CA38 -----------------------------------------TAAT-AAA-TAAGGCAGTA-------ATCCAATAAG--------------------------------------------TTAGCGCTCAATTTTTT--------------------TGGTAC-----------CATGCCAAA----------TGAATACAA-----T-CCAT------------------------AAAT-ATTAT---------------------------------------TAATGTATTCGATTCC-ATTTAAA-TG---------------TCTCAAGTTCACTTAATTT-AA-ATTTATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-----------TA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAGACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTCA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCATTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCC---------------TCCCTTATCAAAA------TCATATACGTA---------------------------------TGAGTCATTCACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACT--------TTTTAATTGA----------AGTTCTC-------TATT-----CAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAA----------TGTAGATACAATCGGGATCCAAATA--------------------CAATA-----------------------------------------------------------------------TTAA-TTCATATT-ATAT-ATTTT-------------CTATTTCTAT----------------TCTTATTATATAATATTAATTTTTATTTATATAATAAGAATAGAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAG------AAAAACTAGAAATAGGATAGAAATAATGAAAT------A-TAAGGAGAAAAATCTAAGTTAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATT---------TTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACACACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Arrojadoa_rhodantha_CA83 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AA-GCT-----TAT{CG}T{CG}ACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATTTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTGACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGT{AC}CTC-------TATT-----AAAATGAG-AGATGAT------GCCCCA-----GGGAATG---------------------------------------ATA--------------------{CG}AATA-----------------------------------------------------------------------TTAA-TT{CG}ATATT-ATAT-ATATT-------------CTATTTCTAT----------------TCTTGTTATATAATATTGATTTTTATTTATATAATAAGAATAGAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAG------AAAAACTAGAAATAGGATAGAAATAATGAAAT------A-TAAGGAGAAAAATCTAAGTTAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTGCATAAATAGATGAATAGAAAAGGAA{CG}AATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATT---------TTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGTTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCATTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Austrocactus_philippii --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCC{AT}AACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGGTGGTTATGTTCCTTATTTTTTTTTTGTTTTC-----CA--TTTCAAAAAGGCT-----AAAGGCTCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATATGTAAAAATGAATATCTTTGAGCAAGGAATAATTATTTGAGTGATTCACAATCAA-----TATCATTACACGTACTAAAACTCAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCT--------------------ATGAGTGGATCAT------GCCCCAGAAGGGGGAATGCCAAAATAGATATGTTATGTAGATACAATCGGGATCAAAAT{ACG}AAT------A--TTGAATTGAAATA-------------------------------------------------------------TAAATTATAT----------------------------A--AAT-ATATA------------------------------------------------------------------------------------------------ATAAATATTTCAATTCAATATTTT------------ATTATAATTAAT------AAAAAATAGAAATAGGATAGAAATAATGAAATTGAAATA-TAAGGAGAAAAATCTAAGTAAAGTATAAAAAAAACTTGTGTTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAAAAAAAGTTATACC--------ACCTC-------ATTCTATC---TTTTTTTTATTTAATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT------TAAAACCCGCTTCCCTCTTTACTAAAATATCATAAATAGTTTCCCTAGGTTGAGGGCCTTTTTCACGAAAATCGAGAAGAGCAGGAACATTCCTCTTTAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAATAAAATCGATAAGAGCAGGAACATTTAAATAA-GT{GT}TGATTCTTTATTGGATCATAAAAACCCACTTTCCCCAGA--TCTCTTCCCTCTCTTCGGG---------- Browningia_candelaris -----AAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTCCATTTTAG-----------CAT---------------------TTTAACATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------ATAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTC-TTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAA-GGATCAGTTATGTAGATACAA-CGGGATCCAAATAAAA-TAAAAAAAT-GAATTGCAATA-----------------------------------------------------------------------TTAA-TAAATAT--ATAT-ATATT------------TATATTTAGATAATTATAATAGAATAT-------ATATAATATTAATTAATATTTATATAATTAGAATAGAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAT------AAAAACTAGAAATAGGATAAAAATAATGAAATTGAAATA-TAAGGAGAAAAATCTAAGTTAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCT{ACG}CATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAA{CG}CTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTCTGATTCTTTATTGGATCATGAAAACCCACTTTCCGC-GA--TCTCTTCCCTCTCTTCGGGACCGA-CA-T Browningia_hertlingiana AAAATAAAATAAATGTCCGATAGCATAGC-CATTGATCGATTAATTAAA-TAAGACAT---------------------------------------------------AGGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTCCATTTTTATTCCATTTTTACAT---------------------GGAAACATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AA----------------------------------------------------------------------------------------AACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC---------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCA-----GGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAATTGCAATA-----------------------------------------------------------------------TTAA-TTAATAT--ATAT-ATATT------------TATATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAATTGAAATA-TAAGGAGAAAAATCTAAGTTAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Cereus_hildemannianus AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATAAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTCTATTTCT--------A--ACATG--------------------TTT-A-ATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTTCAAAAAA-TAAA-T-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACT{GT}GTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG----------GAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTAT{GT}CCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTT{CT}TATTTCATTAATT---------TTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGT{GT}GGTTGAGCGCCTTTTTCAAGAAAATATAGAAT{GT}GCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Cintia_knizei_CA01 -----AAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA---------TA-------ATTAAATTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTTATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGAGTCA-ATTTAAA-TG---------------TATCAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAAT--TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGA--------------------CGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGA{AG}ATTGGAAACTTAAAA{AG}ACAAACAAGGGTTGGGTTGCAC{CG}A{GT}ATATATAAAGCT-----TATTTCACTCCCTAA----------CCTTTTTTTATTAA-CAGTTTGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA-TTTTTTTTTAAA---AAAAAAA--TTTCAAAA----------------------CGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAA-------TCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA--AAAAAAATTGAATTGCAATA-----------------------------------------------------------------------TTAA-TTAATATATA---------------------T{AC}TATTTAT------------------------------------------------ATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCT-------------------------- Cintia_knizei_CA13 ---------TAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA---------TA-------ATAAAATTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TG-TAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTTATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGAGTCA-ATTTAAA-TG---------------TATCAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGA--------------------CGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAA{AG}ACAAACAAGGGTTGGGTTGCAC{CG}A{GT}ATATATAAAGCT-----TATTTCACTCCCTAA----------CCTTTTTTTATTAACCAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA-TTTTTTTTTAAA----AAAAAA--TTTCAAAA----------------------CGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAA-------TCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTTGTCCTTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA--AAAAAAATTGAATTGCAATA-----------------------------------------------------------------------TTAA-TTAATATATA---------------------TATATTTAT------------------------------------------------ATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Cipocereus_minensis AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAA------------------------------------------------------------------GATTAGCAATCAATTTTTT--------------------TGGTAC-----------CAT-CAAAA----------TGAATACAA-----TTCAAT------------------------AAAT-ATTATATATGA-------------------------------TTTTACATATTCGAGTCA-ATCATAA-TG---------------TCTCAAGTTCACTTAATTT-TA-ATTTATTTTCAAAAAAATCAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-----------TA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAGACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CA{CG}TTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATCTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGT{CG}ATATACGTA---------------------------------TGAGT{CG}ATTCACAATCAATATAATA------------CTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGA----------AGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAA---------CTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATA--------------------CAATA-----------------------------------------------------------------------TT----T-ATA-A-ATAT--------AT-ATAATTATATATTTAT---------------------------------------------------------AT--AAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAAT------A-TAAGGAGAAAAATCTAAGTTAAGTTTAAAAAAAACTTGTATTGGATTGGCACTACA-------------TAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATT---------TTAA-----------TTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Cleistocactus_strausii -----AAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATTCAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACTTTTATTA---TTT-T-ATTAAAGTATAA-----------CATA--------------------TTTCACATATTCGATGCA-ACTTAAA-TC---------------GAGAAAGTCCACTTAA--------TTTATTTGAAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAT------TATATTT--------CTAGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATAGAATATCATTACACGTACTAAAACAAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTC-TTTTAATTGACATAGACCCGAGTTCTC-------TATT-----CAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Coleocephalocereus_fluminensis ---------------------AGCATAGCAGATTGATCGATTAATTAAA-TATGA------------------------------------------------------------------TTAGCATTCAATTTTTT--------------------TGGTAC-----------CAT-AAAAA----------TAAATACAA-----ATC-------------------------T-ATTA-----TAA-----------TAGA--------------------TTTTACATATTCGATTCA-ATTAAAA-TG---------------TCTCAAGTTCACTTAATTT-TA-ATTTATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-----------TA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCC---------GGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAA------------ATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGA----------AGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATA--------------------CAATA-----------------------------------------------------------------------TTTA-TAAATAT--ATAT-A------------ATTAT------------------------------------------------ATATTTATATAATTAGAATAGAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAAT------A-TAAGGAGAAAAATCTAAGTTAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATT---------TTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Coleocephalocereus_goebelianus AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGA------------------------------------------------------------------TTAGCATTCAATTTTTT--------------------TGGTAC-----------CAT-CAAAA----------CGAATACAA-----CTC-------------------------T-ATTA-----TAG-----------TAGA--------------------TTTTACATATTCGATTCA-ATTAAAA-TG---------------TCTCAAGTTCACTTAATTT-TA-ATTTATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-----------TA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCC---------GGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC{GT}ATTTATAT-----T-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAA------------ATACGTA---------------------------------TGAGT-ATTCACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGA----------AGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGGTTAAAAGGATAAGTTATGTAGACTACATCGGGATC-AAATA--------------------CAATA-----------------------------------------------------------------------TTTA-TCTATAT--ATAT-{AG}-----------------------------------------------ATTATATAA-A------------TATATAATTAGAATAGAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAT------AAAAACTACAAATAGGATAGAAATAATCAAAT------A-TAA{CG}{CG}A{CG}AAAAATCTAACTTAAGTATAAAAAAAAC--------GATTGGGACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATT---------TGAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCGGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATGA-GTTTGATTCTTTATTGGATCATAAAAACC-ACTTTCCGCAGA--TCTCTTCCCTCTCT{CT}CGGGACCGAACA-T Copiapoa_laui AAAATAAAATAAATGTCCGATAG-----AAGATTGATCGATTAATTAAA-TAAGACATTA-------ATTAAATAAGACATTAATTAAATAAGACAT------------AGGAGTTAG-------CACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTCCATTTT----------------------------------------GACTTATTCGATTCA-ATTTCAA-TG--------AGTGAATTCTCAAGTTAACTCAA--------CTTATAAAA{AG}{AG}{AG}AAA-AAA--{AC}ATCA-------------------------------------------------------------------------------------------------------------AATGG{AG}TGAA{AT}AAAAATCTTGAGAAAGTCTTTTATTTGT-CTATCATTATAGACAATCCTTTCGATATTATCCACGAAAATCGGACCCTAAACTATATT-------CAAATA-TTTCAATTGG{AG}TTTAT-GA-TTCAT{AT}ATTTCTATCGC{GT}CTGGAACT-------AAGTTC------TTATTT{AG}G------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACTAG{CT}TA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTCA--TTTTTTTTGTTTTC----------------AAGGCT-----AAAGGCTCCGGATGGAAATGCTTTTCCCTTATCAAAAGTCTTGTGATATACGTAAAAATGAATATCTTTGAGCAAGGAATAATCATTTGAGTGATTGACCATCAA-----TATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATAC-TTTCGTCCTTTTAATTAACATAGACCCGAGTGCTC-------TATT-----AAAATGAGTAGATGAT------GCGCCAGAAGGGGGAATGCCAAAATAGATATGTTATGTAGATACAATCGGGATCAAAAAAAAA-TTCCAAT-TTGAATTGAAATA------------------------------------------AAAAAATTGAATTGCAATATTAATTATAT--------------------------ATA--AATTATATATTGAG------------------------------------------------ATAATTAGAATAGAAAATATATAA-A--AA--AATG---AAATGAA--------ATTTCATTATTTA------------ATAATAATTAAT------AAAAAATAGAAATAGAATAGAAATAATGAAATTGAAATA-TAAGGAGAAAAATAGAAGTTAAGTATAAAAAAAACTTGTGTTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAAAAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC--TTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTTAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GT{GT}TGATTCTTTATTGGATCATAAAAACCCAATTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Denmoza_rhodacantha AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTACATTATAG-----------CATA--------------------TTTAACATATTCGATGCA-ACTTCAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTGCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCC------------------------------------------------------------------------TATCTCTCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTC-TTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Discocactus_zehntneri_subsp._boomianus -----AAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACAT---------------------------------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CAATA----------TCAA-ACAA-----TTCAAT------------------------AAAC-AGTATAA-----------TCGA--------------------TTTTACATATTCGATTCA-ATAAAAA-TG---------------TCTCAAGTTCACTTAATTT-TA-ATTTATTTTCAAAAAA-TCCA-TATTA-------------------------------------------------------------------------------------------------------------A------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-----------TA-TTTCAATTGAATTTA-------------------------------------------------------------------------------------------------------------------------------------------GGATATACATATA-----TATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATAGAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTC-TTTTCATTGA----------AGTTCTC-------TATG-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAA---------GTTATGTAGATACAATCGGGATCCAAATA--------------------CAATA-----------------------------------------------------------------------TTCA-TAAATAT--ATAT-A------------ATTATATA----------------------------------AATAT--------------ATAATTAGAATATAAAATATC---------------------------------ATTTCATTATTTC------------ATAATCATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAAT------A-TAAGGAGAAAAATCTAAGTTAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTTATTAATT---------TGAATTAAGTC-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_ancistrophora_subsp._arachnacantha -----AAAATAAATGTCCGATAGC-TAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATTAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACTT--ATTA-------T-ATTACATTATAA-----------CAGA--------------------TTTAACATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAATTT-AT-ATTTATTTTCAAAAAA-GAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTTTTTATTA-TATTATATTT--------CTAGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAGAAGGGGGTAAGAGATTGGAAACTTAAAAGACAAAGAAGGGTTGGGTTGCACGA{GT}ATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACGAAAAGAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--TCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTC-TTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATGAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_atacamensis_subsp._pasacana AAAATAAAATAAATGTCCGATAGCATAGCA-ATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACGCAATTTTTTT-------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTACATTTTAA-----------{CG}ATT--------------------TTTAACATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTTCAA---------------TGATATTATTAATTAATGCTAATTTACTTTTTTTTATTCTATAAAAGTATAGCAAAAACTTGTTAATTTGTCAAGTTCTGTTTTCAGTTTAGATATAGATATAATTTCTAATGGATGAATAAAAAT{CG}{GT}TGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTTTTTAT------TATATT-----------------------------------------------------ATATTT{CG}-TA{CG}{CG}----------------------TAT{CG}T-GCTGTCAAGAGTGAATTT-GAA-----------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATAGAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAAT----ATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_cinnabarina -----AAAATAAATGTCCGATAGC-TAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATTAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------T----------------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACTT--ATTA-------T-ATTACATTATAA-----------CAGA--------------------TTTAACATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAATTT-TT-ATTTA------AAAAA-GAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTTTTTATTA-TATTATATTT--------CTAGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAAC{GT}TAAAA{AG}ACAAACAAGGGTTGGGTTGCAC{CG}ATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT--------------TATACGTA---------------------------------TGAGTGATTCACAATCAATAGAATATCATTACACGTACTAAAACGAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--TCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTC-TTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATGAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_huotii --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATAGAATATCATTACACGTACTAAAACGAAAAGAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTCTACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATG-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_mamillosa A{AT}AATAAAATAAATGTCC--TAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTATTGAATTGGATTCATTTGGATGGTAC-----------CAA-AAAAATTAAATTGAATGAATCCAA-----TTCCATTGTTCACT--------------T-CTTAAAGTATAA-----------CATA--------------------TTGAACATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAATTT-AT-ATTTATTTTCAAAAAA-GAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCAATGGAACT-------AAGTTC------TTATTTAT------TATATTT--------C{GT}AGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAA{AG}ACAAACAAGGGTTGGGT{GT}GCACC--------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAA---- Echinopsis_mirabilis AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTCATAAGGCATTC-ATAAGGCAT----------------------------AGGAGTTAG-G-TTA---CTCCATTTGGA--------------------TGGTACAGGTACCCTCCCAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCATT--------------G-ATTCTATTATAG-----------CATC--------------------TTTCACATATTCGATGCA-AGTTCAA-TG---------------TCTCAAGTCCACTTCATTT-TA-ATTTATTTTC-----A-TAAA-TAT-------------------------------------------------------------------------------------------------------------------GATGAAGAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTCAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCTAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACAATATATAT----------------CACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCG-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGT{CG}ATATACGTA---------------------------------TGAGT{CG}ATTCACAATCAATAGAATATCATTACACGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCCAGATAAGACTCTT-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATG-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATGGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTG-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_pentlandii -----AAAATAAATGTCCGATAGC-TAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------T----------------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACTT--ATTA-------T-ATTACATTATAA-----------CAGA--------------------TTTAACATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAATTT-TT-ATTTA------AAAAA-GAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTTTTTATTA-TATTATATTT--------CTAGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAAC{GT}{GT}AAAA{AG}ACAAACAAGGGTTGGGTTGTAC{GT}A{GT}ATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT--------------TATACGTA---------------------------------TGAGTGATTCACAATCAATAGAATATCATTACACGTACTAAAACGAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--TCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTC-TTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATGAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Echinopsis_schickendantzii ---------TAAATGTCCG--AGCAAAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTATTT--------------T-AATACATTTTAA-----------CAAA--------------------TTTCGCATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTCCACTTAATTT-AT-ATTTATTTTCAAGGGA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAG{AG}ATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACGATATT-------C{AG}{AG}{AG}-{AG}-TTTCAATTGAGTTTAT-GA-TTCATTATTTC-ATCGCACTGGAACT-------AAGTTC------TTATTTAT------{GT}AT{AG}TGT--------{CG}G{AG}GCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCA{AG}AAGGGGGTAAGAGATTGGAAACTTAAAAGACAAACAAGGGTTGGG---------------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATAGAATATCATTACACGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-- Echinopsis_tiegeliana ----TAAAATAAATGTCCGATAGC-TAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACTT--ATTA-------T-ATTACATTATAA-----------CAGA--------------------TTTAAGATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAATTT-AT-ATTTA------A{AG}A{AG}A-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAA{AG}AATGTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTGA{AG}ATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTTTTTATTA-TATTATATTT--------G{GT}AGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGG{AC}AACTTAAAA{AG}ACAAACAAGGGTTGGGTTG{GT}AAGATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT--------------TATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACGAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--TCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT{AC}AGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATGAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Eriosyce_napina --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACTAGTTATCTCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGCCT-----AAAGGCTCCGGACGGAAATGCTTTTCCCTTATCAAAAGTCTTGTGATATACGTAAAAATGAATATCTTTGAGCCAGGAATAATCATTTGAGTGATTCACAATCAA-----TATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTAGACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATG{CT}{AC}GATAGAATCGGGATCAAAATCAAA-TTCAAA-------TTGCAATATTTTTATTGCAATTCAATATTGATTTTATTATATCTATTTTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACTCAAAATAGGATGGAAA----------GAAATACTAAGGCGAAAAATCTAAGTTTAGTATAAAACAAA-----GTTGGATTGGCACTAAATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTTAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GT-TGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Espostoa_guentheri AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATGAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAA---------------TCCAA-----TTCTATTGTTCACT----------------ATTCAAGTATAA-----------CATA--------------------TTTCACATATTCGATGCA-ACTTAAA-TG---------------TATCAAGTTCACTTAA--------TTTATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC---------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACGAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATG-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCAAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTC-CTCTCTTCGGGACCGAACA-- Espostoa_lanata AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGC-----------T--------------------TG----------------AT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACTT--ATTACATTTTAT-ATTACATTTTAA-----------CAT{AT}--------------------TTTAACATATTCGATTCA-ATTTCAA-TG---------------TATCAAGTTCACTTAA--------TTTATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATAGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTGAG------TATATTT--------CTAGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTGAAAAAACAAACAAGGGTTGGGTTGCACCATATATAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACGAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTC-TTTT-------ATAGACCCGAGT{AC}CTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Espostoa_ritteri AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGC-----------T--------------------TG----------------AT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACTT--ATTACATTTTAT-ATTACATTATAA-----------CATA--------------------TTTAACATATTCGATTCA-ATTTCAA-TG---------------TATCAAGTTCACTTAA--------TTTATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATAGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTGAG------TATATTT--------CTAGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTGAAAAAACAAACAAGGGTTGGGTTGCAC---------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATAGAATATCATTACACGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTT-------ATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-- Espostoopsis_dybowskii -AAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATAAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATACAA-----TTCAAT------------------------AAAT-ATTATAA-----------TTGA--------------------TTTTACATATTCGATTCA-ATTAAAA-TG---------------TCTCAAGTTCACTTAATTT-TA-ATTTATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-----------TA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCA{CG}{CG}ATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGA----------AGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGC----------------TGTAGATACAATCGGGATCCAAATA--------------------CAATA-----------------------------------------------------------------------TTAA-TTAATAT--ATATTA-A--A-ATT--AATAATATATT-A-A-A---AT--TA--ATA--------ATATA-TATTAATTAATATTTATATAATTAGAATAGAAAATATC----------------------------ATTTCATTTCATTATTTA------------ATAATAATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAAT------A-TAAGGAGAAAAATCTAAGTTAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATT---------TTAATTAAGTC-----------------AAAA{AC}CCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGTTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Gymnocalycium_andreae_subsp._carolinense ----------AAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGAC-------------------------------------------------------------G-G-TTAGCACTCAATTTTGT--------------------T----------------CAT-CCAAA----------TGAATCCAA-----TTCA------CACT--------------TCATTATA----AT-----------CAAA--------------------TTTT-CATATTCGATTTC-GATTCCA-TC---------------CCTCATGTCCACTTGATTT-TT-ATTT-TTTTGAAA---------------------------------------------------------------------------------------------------------------------------------CAAATCAATATCTTGAGA---------------------------------------------------------------------------------------------AATGGAATTTAT-GA-TTCATTCTTTCTCTCGCAATGGAACT-------CAGTTC------TGATAGAG------TCTATTT--------CTAGCC------------------------------------------------------------------------TATCTCACTGTCAAGAGTGAATTT-----------AGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTGAAAAAACAAACAAGGGTTGGGTTGCAC---------AA---------TATTTCACTCCCTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTT-----TTTTAATTGA--------CGAGTTCTC-------TATT-----AAAATGAGTAGATGATGCCCCAGCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-GAAAGAAATGGAATATCCATA-----------------------------------------------------------------------TTCA-TTAATATGGA---------------------TCTATTTAG--------------------------------------------------------AATAGAAAATAT----------------------------------------------AGAATATTAATGAATATGGATTCAT------AAAAACTAGAAATAGGATAGAAATCA-----------------------AAATCGAAGTGAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATCGATGAATCGAAAAGGAAGAAGAAAAGAAA-GTTCTACCAAGCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATT---------TTCATTAAGTG-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATCA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCT-TTCGGG{AT}CCGAACA-T Gymnocalycium_anisitsii_subsp._anisitsii AAATCAAAGTAAATTTCCAAGAG{AG}ATGGTAGA--GATCGATTAATT---------C-------------------------------------------------------------G-G-TTAGCACTC----------------------------TTCAAC-------------T-TC-AA----------TGA--CCAT-----TTCA-TAATTCA-----------------------------T-----------------------------------TTTAGCATATTCGATTCACAATTGTC-AATTGAAATG-------GTTTAAGTCCACTTGA--------TTCTTATTGAAA---------------------------------------------------------------------------------------------------------------------------------AAAAA-GAAAACTTGAGA---------------------------------------------------------------------------------------------AATGGAATTTAG-GA-TTCATTATTTCTATCGCGATGGAACT-------GAGT-----------------------ATATTT--------CTAGCC------------------------------------------------------------------------TATCTCACTGTCAAGAGTGAATTT-----------AGGTCTTTCGATTCAAAAGGGGGTAAGATATTGGAAACTTAAAA-ACAAACAA-----------------------AAATCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATGAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AA-----------------------TTTT-TTTTC-----CA--TTTCAAAAAGGCT-----AAAGGCCCC------AA-----TTTCCCTTATCCAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATAGAATCTCATTACACGTACTAAAACTTAAAGAAACTTA--------------CTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTT-----TTTGAATTGA--------CGAGTTCTC-------TATT-----CAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATCAGTTATGTAGATACAATCGGGATCCAAATAAAA-GAAAAAAATGGAATCGAAATA-----------------------------------------------------------------------TTCAATTAATATTTC---------------------TATATTTAG--------------------------------------------------------AATCGAAAATAT----------------------------------------------AGAATATTAATGAATATTTATTCAT------AAAAACTATCAATAGGATAGAAAGAA-----------------------AAATCTAAGTGAAGTAG------AACTTGTATTGGATTGGCACTACATAATCAATCTACATAAATCGATGAATCGAAAAG-----AGAAAAGAAA-GTTCTACCAAGC------CTC-------ATTCTATCTTTTTTTTTTGATTTCATTCATT---------TTCATTAAGTT-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATAGAGAATAGCAGGAACATTTAAATAAAGTTTGATTCTTGATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Gymnocalycium_bruchii -------------------ATAGCATAGCAGATTGA{GT}-GATTAATTAA{AG}-TAAGAC-------------------------------------------------------------G-G-TTAGCACTCAATTTTGT--------------------T----------------CAT-CCAAA----------TGAATCCAA-----TTCA------CACT--------------TCATTATA----AT-----------CAAA--------------------TTTT-CATATTCGATTTC-GATTCCA-TT---------------CCTTATGTCCACTTAATTT-TT-ATTT-TTTTGA{AG}A---------------------------------------------------------------------------------------------------------------------------------CAAATCAATATC{GT}{GT}GAGA---------------------------------------------------------------------------------------------{AG}ATGGAATTTAT-GA-TTCATTCTTTCTCTCGCAATGGAACT-------CAGTTCTGATTCTGATAGAG------TCTATTT--------C{GT}AGCC------------------------------------------------------------------------TATCTCACTGTCAAGAGTGAATTT-----------AGGTCTTTCGATTCA{AG}{AG}AGGGGGTAAGAGATTGGAAAC-GAAAA{AG}ACAAACAAGGGTTGGGTTGG{AG}CGGGA-A-AGA----------TATTTAACTCCCTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTT-----TTTTAATTGA--------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-GAAAGAAATGGAATATCAATA-----------------------------------------------------------------------TTCA-TTAATATGGA---------------------TCTATTTAG--------------------------------------------------------AATAGAAAATAT----------------------------------------------AGAATATTAATGAATATTGATTCAT------AAAAACTAGAAATAGGATAGAAATCA-----------------------AAATCGAACTGAAGTATAAAAAAAACTTGTA{GT}TGGATTG-CACTACATAATAAATCTACATAAATCGATGAATCGAAAAGGAAGAAGAAAAGAAA-GTTCTACCAAGCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATT---------TTCATTAAGTG-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-{CG}TTTGATTCTTTATTGGATCATAAAAACCCACTTTCC-CAGA--TCTCTTCCCTCTCTTC--GACC-AACA-T Gymnocalycium_carminanthum -------------TGTCCGATAGCATAGCAGATTGATCGATTAATTAAACTAAGAC-------------------------------------------------------------G-G-TTAGCACTCAATTTTTT--------------------T----------------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACTT-AATTA-------TAATTACATTTTAT-----------------------------------TTTAGCATATTCGATTCA-ATTTGTC-AA---------------GTTCAAGTTCACTTGA--------TTT-TTTTGAAA---------------------------------------------------------------------------------------------------------------------------------AAAATCAATATCTTGAGA---------------------------------------------------------------------------------------------AATTGAATTTAT-GA-TTCATTATTTCTCTCGCAATGGAACTTGGAACTCAGTTC------TGATAGAG------TCTATTT--------CTAGCC------------------------------------------------------------------------TATCTCACTGTCAAGAGTGAATTT-----------AGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC-------------CT-----TATTTCACTCCCTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTT-----TTTTAATTGA--------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-GAAAAAAATGGAATATCAATA-----------------------------------------------------------------------TTCA-TTAATATGGA---------------------TCTATTTAG--------------------------------------------------------AATAGAAAATAT----------------------------------------------AGAATATTAATGAATATTGATTCAT------AAAAACTAGAAATAGGATAGAAATAA-----------------------AAATCTAAGTGAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAAGAAAAGAAA-GTTCTACCAAGC------CTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATT----------TCATTAAGTT-----------------AAAAACCTCGCC--------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCT{CT}CGGGACCGAACA-T Gymnocalycium_leptanthum ---------GAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGAC-------------------------------------------------------------G-G-TTAGCACTCAATTTTGT--------------------T----------------CAT-CCAAA----------TGAATCCAA-----TTCA------CACT--------------TCATTATA----AT-----------CAAA--------------------TTTT-CATATTCGATTTC-GATTCCA-TC---------------CCTCATGTCCACTTGATTT-TT-ATTT-TTTTGAAA---------------------------------------------------------------------------------------------------------------------------------CAAATCAATATCTTGAGA---------------------------------------------------------------------------------------------AATGGAATTTAT-GA-TTCATTCTTTCTCTCGCAATGGAACT-------CAGTTC------TGATAGAG------TCTATTT--------CTAGCC------------------------------------------------------------------------TATCTCACTGTCAAGAGTGAATTT-----------AGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTGAAAAAACAAACAAGGGTTGGGTTGCAC---ATATAGA----------TATTTCACTCCCTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTT-----TTTTAATTGA--------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-GAAAGAAATGGAATATCCATA-----------------------------------------------------------------------TTCA-TTAATATGGA---------------------TCTATTTAG--------------------------------------------------------AATAGAAAATAT----------------------------------------------AGAATATTAATGAATATGGATTCAT------AAAAACTAGAAATAGGATAGAAATCA-----------------------AAATCGAAGTGAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATCGATGAATCGAAAAGGAAGAAGAAAAGAAA-GTTCTACCAAGCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATT---------TTCATTAAGTG-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATCA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Gymnocalycium_paraguayense ----------AAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGAC-------------------------------------------------------------G-G-TTAGCACTCAATTTTTT--------------------T----------------CAT-CCAAA----------TGAATCCAA-----TTCA------CACT--------------TCATTATA----AT-----------GACA--------------------TTTT-CATATTCGATTTC-GATTCCA-TT---------------CCTCAGGTTCACTTGATTT-TT-ATTT-TTTTGAAA---------------------------------------------------------------------------------------------------------------------------------CAAATCAATATCTTGAGA---------------------------------------------------------------------------------------------AATGGAATTTAT-GA-TTCATTCTTTCTCTCGCAATGGAACT-------CAGTTC------TGATAGAG------TCTATTT--------CTAGCC------------------------------------------------------------------------TATCTCACTGTCAAGAGTGAATTT-----------AGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC---------AAAGCT-----TATTTCACTCCCTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTT-----TTTTCATTGA--------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAA----------TATGTAGATACAATCGGGATCCAAATAAAA-GAAAGAAATGGAATATCAATA-----------------------------------------------------------------------TTCA-TGAATATGGA---------------------TCTATTTAG--------------------------------------------------------AATAGAAAATAT----------------------------------------------AGAATATTCATGAATATTGATTCAT------AAAAACTAGAAATAGGATAGAAATCA-----------------------AAATCGAAGTGAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATCAATCTACATAAATAGATGAATAGAAAAGGAAGAAGAAAAGAAA-GTTCTACCAAGCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATT---------TTCATTAAGTG-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTTCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCT-CGGGACCGAACA-T Gymnocalycium_pflanzii_subsp._argentinense -----AAAATAAATTTCCAAGAG-{AC}T-GTGGATTGATCGATTAAT------------------------------------------------------------------------G-GCTTAGCACTC----------------------------T------------------T-CCAA-----------TGAATTCAA-----TT-------------------------------------------------------TGAATTCTATTCGAATTCATTTTAGCATATTCGATTCC-ATTGAAA-TG---------------GATCAGGTTCACTTGA--------TTTTTTTTGAAA---------------------------------------------------------------------------------------------------------------------------------AAAATCAATATCTTGAGA---------------------------------------------------------------------------------------------AATTGAATTTAT-GA-TTCATGATTTCTATCGCAATGGAACT-------CAGTTC------TGATAGAG------TCTATTT--------CGAGCC------------------------------------------------------------------------TATCTCACTGTCAAGAGTGAATTT-----------AGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAAC{GT}{GT}AAAA{AG}ACAAACAAGGGTTGGGTTGCACC{CG}GAACGATAAAGCT-----TATTTCACTCCC-------TTA--TCCTTTTTTGATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AA-----------------------TTTT-TTTTC-----CA--TTTCAAAAAGGCT-----AAAGGCCCC------AA-----TTTCCCTTATCAAAAGTCTTGTGATGTACGTA---------------------------------TGAGTGATTCACAATCAATAGAATCTCATTACAC-----------TAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTAGACTTTT-----TTTGAATTGA--------CGAGTTCTC-------TATT-----CAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-GAAAAAAATGGAATCGAAATA-----------------------------------------------------------------------TTCA-TTAATATTTC---------------------TATATTTAG--------------------------------------------------------AATCGAAAATAT----------------------------------------------AGAATATTAATGAATATTTATT-------------ACT--AAATAGGATAGAAAGAA-----------------------AAATCGAAGTTCAGTAT------CAATTGTATTGGATTGGCACTACATAATCAATCTACATAAATCGATGAATAGAAAAG-----ATAAAAGAAA-GTTTTACCAAGC------CTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATT---------TTCATTAAGTG-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTGATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Gymnocalycium_pflanzii_subsp._pflanzii CAAAGAAAAGAAATTTCCAAGAGCAT-GTGGATTGATCGATTAAT------------------------------------------------------------------------GAGCTTAGCACTC----------------------------T------------------T-CCAA-----------TGAATTCAA-----TT-------------------------------------------------------TGAATTCTATTCGAATTCATTTTAGCATATTCGATTCC-ATTGAAA-TG---------------GATCAGGTTCACTTGA--------TTTTTTTTGAAA---------------------------------------------------------------------------------------------------------------------------------AAAATCAATATCTTGAGA---------------------------------------------------------------------------------------------AATTGAATTTAT-GA-TTCATGATTTCTATCGCAATGGAACT-------CAGTTC------TGATAGAG------TCTATTT--------CTAGCC------------------------------------------------------------------------TATCTCACTGTCAAGAGTGAATTT-----------AGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC---------AAAGCT-----TATTTCACTCC--------TTA--TCCTTTTTTGATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AA-----------------------TTTT-TTTTC-----CA--TTTCAAAAAGGCT-----AAAGGCCCC------AA-----TTTCCCTTATCAAAAGTCTTGTGATGTACGTA---------------------------------TGAGTGATTGACAATCAATAGAATCTCATTACAC-----------TAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTT-----TTTGAATTGA--------CGAGTTCTC-------TATT-----CAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATAAAA-GAAAAAAATGGAATCGAAATA-----------------------------------------------------------------------TTCA-TTAATATTTC---------------------TATATTTAG--------------------------------------------------------AATCGAAAATAT----------------------------------------------AGAATATTAATGAATATTTATT-------------ACT--AAATAGGATAGAAAGAA-----------------------AAATCGAAGTTCAGTAT------CAATTGTATTGGATTGGCACTACATAATCAATCTACATAAATCGATGAATAGAAAAG-----ATAAAAGAAA-GTTTTACCAAGC------CTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATT---------TTCATTAAGTG-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Gymnocalycium_rauschii ---------------------AG-ATAGCAGATTGATCGATTAATTAA{AG}-TAAGAC-------------------------------------------------------------G-G-TTAGCACTCAATTTTGT--------------------T----------------CAT-CCAAA----------TGAATCCAA-----TTCA------CACT--------------TCATTATA----AT-----------CAAA--------------------TTTT-CATATTCGATTTC-GATTCCA-TT---------------CCTTATGTCCACTTAATTT-TT-ATTT-TTTTGAAA---------------------------------------------------------------------------------------------------------------------------------CAAATCAATATCTTGAGA---------------------------------------------------------------------------------------------AATGGAATTTAT-GA-TTCATTCTTTCTCTCGCAATGGAACT-------CAGTTCTGATTCTGATAGAG------TCTATTT--------CTAGCC------------------------------------------------------------------------TATCTCACTGTCAAGAGTGAATTT-----------AGGTCTTTCGATTCAAAAGGGGGTAAGA{AG}ATTGGAAACTGAAAA{AG}ACAAACAAGGGTTGGGTTG{CG}ACGG{GT}ATATAGA----------TATTTCACTCCCTAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTT-----TTTTAATTGA--------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT{AC}AGTTATGTAGATACAATCGGGATCCAAATAAAA-GAAAGAAATGGAATATCAATA-----------------------------------------------------------------------TTCA-TTAATATGGA---------------------TCTATTTAG--------------------------------------------------------AATAGAAAATAT----------------------------------------------AGAATATTAATGAATATTGATTCAT------AAAAACTAGAAATAGGATAGAAATCA-----------------------AAATCGAAGTGAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATCGATGAATCGAAAAGGAAGAAGAAAAGAAA-GTTCTACCAAGCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATT---------TTCATTAAGTG-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTTCGTAGGTTGAGCGCCTTTTTCAAGA{ACG}AATATAGAATAGCAGGAACATTTAAAT---------------------------------------------------------------------------- Gymnocalycium_schickendantzii --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTT--TGAA----TTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A--------CGAGTTCTC-------TATT-----CAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATCAGTTATGTAGATACAATCGGGATCCAAATAAAA-GAAAGAAATGGAATCGAAATA-----------------------------------------------------------------------TTCA-TTAATATTTC---------------------TATATTTAG--------------------------------------------------------AATCGAAAATAT----------------------------------------------AGAATATTAATGAATATTTATTCAT------AAAAACTATCAATAGGATAGAAAGAA-----------------------AAATCTAAGTGAAGTAG------AACTTGTATTGGATTGGCACTACATAATCAATCTACATAAATCGATGAATCGAAAAG-----ATAAAAGAAA-GTTCTACCAAGC------CTC-------ATTCTATCTTTTTTTTTTGATTTCATTCATT---------TTCATTAAGTT-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACAGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATAGAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTGATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Haageocereus_pacalaensis AAA-TAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAA--TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCCATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTACATTTTAA-----------CATA--------------------TTTCACATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAA-------TTTTTTTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATAGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAA------TCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAT------TATATTT--------CTAGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--T{AT}TCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGT-CTATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATT-----TAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Matucana_aurantiaca -----AAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCCATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTACATTATAA-----------CATA--------------------TTTCACATATTCGATGCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATAGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTT------TTATTTAT------TATATTT--------CTATCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAG----------TT{CG}ACTCCCTAACTAGTTA--TC{GT}{AT}TTTTTTATT-A-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA-----TTTTTAATTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACG{CGT}A------TTTC----AT---------TGT-ATATACGTA---------------------------------TGAGTGATTCACAATCAA---AAT---ATTACACGTACTAAAACGAAAATACACTAAGAGAC----TCC---TTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAA--CTTT{AC}-{AC}{AC}ATACTTTTCGTC-TTTTAATTG---------CGAGT-CTC-------TATT--------ATGA{AC}TAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Melocactus_oreas AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACAT---------------------------------------------------AGGAGTTAG-G-TTAGCACTCCATTTTTT--------------------TGGTAC-----------CAT-CAATA----------TCAA-ACAA-----TTCAAT------------------------AAAC-AGTATAA-----------TCGA--------------------TTTTACATATTCGATTCA-ATAAAAA-TG---------------TCTCAAGTTCACTTAATTT-TC-ATTTATTTTCAAAAAA-TCCA-TATT---------------------------------------------------------------------------------------------------------------------CAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-----------TA-TTTCAATTGAATTTAG-GA------------------------------------------------------------------------------------------------------------------------------------------TATACATATA-----TATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTGAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTAACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAG{AG}{GT}CCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGT-ATATACGTA---------------------------------TTAGTGATTCACAATCAATAGAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT------------------------------CTTTTCGTCCTTTTCATTGA----------AGTTCTC-------TATG-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAA---------GTTATGTAGATACAATCGGGATCCAAATA--------------------CAATA-----------------------------------------------------------------------TTAA-TAAATAT--ATAT-A------------ATTATATA----------------------------------A------------------------ATAATATACAATATC---------------------------------ATTTCATTATTTC------------ATAATAATGAAT------AAAAACTAGAAATAGGATAGAAATAATGAAAT------A-TAAGGAGAAAAATCTAAGTTAAGTATAAAAAAAACTTGTATTGGATTGGCACTACAT-------CTACATAAATAGATGAATAGAAAAGGAAGAATAAAAGAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATCTTTTTTTTTTTATTTCATTCATT---------TTAATGAAGTC-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Micranthocereus_auriazureus -------------------------------------CGATTAAGTAGG-TAGGACATTA-------ATAAAATAAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATACAA-----TTCAAT------------------------AAAT-AG----------------------------------------TATAACATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAATTT-TA-ATTTATTTTTAAAAAA-GAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------------CTA--TT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAA{AC}ACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGA----------AGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGCTAAGTTATGTAGATACAATCGGGATCCAAATA--------------------CAATA-----------------------------------------------------------------------TTAA-TTAATATT-ATAT-ATATTATATTATAATTATATATTT---------------------------ATATAATATTAATTAATATTTATA-------------------C---------------------------------ATTTCATTATTTA------------ATA-------AT------AAAAACTAGAAATA-----------ATGAAAT------A-TAAGGAGAAAAATCTAAGTTAAGTATAAAAAAAACTTGTATTGGATTG-CACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATT---------TTAATTAAGTC-----------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGGCCGAACAGT Neoraimondia_arequipensis_subsp._roseiflora --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACTAGTTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGA----------AGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATG-------GGATATGTTATGTAGATACAATCGGGATCAAAATATAA-TTCAAA--TTGAATTGAAATA------------------------------------------TAAATATTGAATTGCAATATAAATTATAT--------------------------ATA--AATTATATATTTAG------------------------------------------------ATAATTAGAATAGAAAATATATA--------TAA--TTTATATATA---ATTTCATTTCATTATTTA-------AAT--AT-ATAATTAAT------AAAAAATAGAAATAGGATAGAAATAATGAAATTGAAATA-TAAGGAGAAAAATCTAAGTTAAGTAT-AAAAAAACTTGTGTTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAAAAAA-GTTATACC--------ACCTC-------ATTCTATC---TTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTTAAAATATCGTAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATAGAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTC---------------- Neoraimondia_herzogiana --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTCTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA-TTTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCTCCGGACGGAAATGCTTTTCCCTTATAAAAAGTCTTGTGATATACGTAAAAATGAATATCTTTGAGCAAGGAATAATCATTTGAGTGATTCACAATCAA-----TATCATTACACGTACTAGAACTTAAATACACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGTTACCTAGATAAGACTTTG-TTATACCTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------CATT-----AAAATGAGTAGATGAT------GCCCCGGAA-GGGGAATGCCAAAATAGATATGTTATGTAGATACAATCGGGATCAAAATATAA-TTCAAA--TTGAATTGAAATA------------------------------------------TAAATATTGAATTGCAATATAAATTATAT--------------------------ATA--AATTATATATTTAG------------------------------------------------ATAATTAGAATAGAAAATATATA--------TAA----TA-ATATA---ATTTCATTTCATTATTTA------------ATAATAATTAAT------AAAAAATAGAAATAGGATAGAAATAATGAAATTGAAATA-TAAGGAGAAAAATCTAAGTTAAGTAT-AAAAAAACTTGTGTTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAAAAAA-GTTATACC--------ACCTC-------ATTCTATC---TTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTTAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATAGAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGAGTTCTCTTCCCTCTCTTCGGGACCGA----- Neowerdermannia_vorwerkii AAAATAAAATAAAAGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATAAGACAT----------------------------AGGAGTTAG-------CACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTCCATT---------------TTGA-------------------------CTTATTCAATTCA-ATTTCAA-TG--------AGTGAATTCTCAAGTTCACTCAA--------CTTATTTTCAAAAAA--AAA-AAT-A-------------------------------------------------------------------------------------------------------------AA----TCAATCAGTATATTGAGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGCCTCTTATTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-C-CATC{GT}{AG}GGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAGAAGGTGGTCAGA------------------------------------------------AACGCT-----TATTTCACTCCCTAACTAGTTT--TCCTTTTTTTATTAA-CAGTTTGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGATTATATTCCTTA--TTTTTT---TTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCTCCGGACAGAAATGCTTTTCCCTTATCAAAAGTCTTGTGATATACGTAAAAATTAATATCTTTGAGCAAGGAATAATTATTTGAGTGATTCACAATCAA-----TATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATTGTGCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTCATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAG---AT------GCCCCAGAAGGGGCAATG------------TGTTATGATTTAT{ACG}TTTTA----------AAAA-CTCAAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAAGATGGAAATAATGCAATTGAAATA-TAAGGAGAAAAA-CTCAGTTTAGTA-------AACTTGTGTTGGATTGGCACTAAATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCGAGAACCTC-------TATTTATC-TTATTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAA-CCTCTGCCC------------------------------------------------------------------------------TCTTTAAAATATCATAAACGGGTTCCGTAG-TTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA--TTTGATT-TTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Oreocereus_celsianus AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCCATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTACATTATAA-----------CATA--------------------TTTCACATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATAGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAT------TATATTT--------CTAGCC------------------------------------------------------------------------TATCTCGTTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Oroya_peruviana -------------------ATAGC{CG}TAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCCATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTACATTATAA-----------CATA--------------------TTTCACATATTCGATGCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTTCAAAAAA-AAAA-TATCA-------------------------------------------------------------------------------------------------------------AATAGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTATTATTATTATATTT--------CTATCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCG-TTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTC-TTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Parodia_magnifica ------------------GATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATAAGACAT----------------------------AGGAGTTAG-------CACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTCCATTTT----------------------------------------GACTTATTCGATTCA-ATTTCAATTG--------AGTGAATTCTCAAGTTCACTCAA--------CTTATTTTCAAAAAA-AAAAAAATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTTATTTGTTCTATCATTATAGACAATCCTTTCGATATTATCTACGAAAATCGTAACCTATACTATATA------ACAAATA-TATCAATTGAATTTAT-GAAT{AT}CA{AT}TATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------AATAT{AT}G--------ATA-------------------------------------------------------------------------TATGTCT-GCC------------------------------------------------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCTCCGGACGGAAATGCTTTTCCCTTATCAAAAGTCTTGTGATATACGTAAAAATGAATATCTTTGAGCAAGGAATAATCATTTGAGTGATTCACAATCAA-----TATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAAGGAGTAGATGAT------GCGCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATAGAATCGGG------ATAAAA-TTCAAA--TTGCTTTG----------ATTTCAATTCA---------TTATTATATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAAAGAAAAA-TA-AAA---GATGTAAATAATGCAA-----AGACTAAGGAGAAAAATCAAAGTTTAGTATAAAAAAAACTTGTGTTGGATTGGCACTAAATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTTAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTC{CT}CTCTCTTCGGGACC------- Parodia_microsperma -------------------------------------------------------------------ATAAAATAAGACAT----------------------------AGGAGTTAG-------CACTCCATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------TAATTCAATTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATATTGATATA-TGTATCT-------TATAGCCTCTTCGTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTACGATATATATATACAACATATCCCGCCGTGAAGAGTGAATTTCAAATTA-TTTAGGTCTTTCGATTCAAAATGTGGTAAGAAATTGAAAACTTGAAAAATAAACAAGGGTTGGGTTACACCATATATAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTCAA-----GTCCCTCTATCCCC----------------------------------------------------------------------------------------------------------------------------------------------------------------AGAC-TTGTTTATACTTTTCGTC---{AT}---TT-ACATAGACCCGAGTTCTC-------TATTTGAAGGAAAGGAGTAGATGAT------GCGCCAGAAGGGGGAATG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Rauhocereus_riosaniensis ---------TAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATTAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTACATTTTAA-----------CATA--------------------TTTAACATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAA--------TTAATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATAGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTGAG------TATATTT--------CTAGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAGACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTTA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTCATTTACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT{AC}AGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATTAAGTCAAAATTCTTTATTCTTTAAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_deminuta -----AAAATAAATGTCCG-TAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATAAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCCATTTTTT--------------------GGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTACATTTTAA-----------TATG--------------------TTGAACATATTCGAGTCA-ACTTCAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTTCGAAA{AG}A-TA-----------------------------------------------------------------------------------------------------------------------TGGATGAATAA{AG}{AG}ATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGA{AG}TTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT--TTTTATCCTTTCCTGATGGAATTCCGCATATTTTTCACATCTAGGATATAC{AT}A-T-CGA{CG}ATATCTCGCCGTCAAGAGTGAAT-TCGA-TGA-ATTAGGTCTT-CGATTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATAT{AT}GA-ATAGAATAGAATAACCCGATTGAAGCGTAACGATCAATTGAAACGCCCAAAACAAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC---------------AAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTC------TATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTAAAAGAAACTTAGAGACAAAGTCATTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTT-TTATACTTTT-----TTTGAATTG----------GAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAAT--------------------------------------------------------------------------------------------------TCA-TGAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_einsteinii AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACAT---------------------------------------------------AGGAGTTAG-G-TTAG{CG}ACTCCATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-------------TTCACT--------------T-ATTACATTTTAA-----------CATA--------------------TT-AACATATTCGAGTCA-ACGTCAA-TG---------------TCTCAAGTTCACTTCA--------TTTATTTTCAAAAAA-TA-----------------------------------------------------------------------------------------------------------------------TGGAGGAATAAT--TCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CCAATA-TTTCAATTGAATTGAT-GA-TTCAGGATTTCGAGCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT---------TAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACAGCTAGGATATATATA-A-AA-ATATTTCGC-GTCAAGAGTGAA------------------------------------------------------------------------------------------AA-----------TTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGT----------------------------------------------------------------------------------------AAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTCAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATCAGACTTTG-TTATACTTTTCGTCCTTTTAATTG----------GAGTTCTC-------TATG-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATGGAATTGCAATA-----------------------------------------------------------------------TTAA-TTAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATCGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTGAACTTCTTTTAATTCAGTCCAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCT{AT}CGGGACCGAACA-T Rebutia_fiebrigii -----------------------------AGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATAAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCCATTTTTT--------------------GGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTACATTTTAC----ATGTTAATATC--------------------TTCAACATGTGC-ACGCA-ACGTCAA-TG---------------T-TCAAGTTCACTTAA-------ATTTATTTTCGA{AG}A{AG}A-TGA----------------------------------------------------------------------------------------------------------------------TGGATGAATAC---TGTTGAG{AC}GCGTCTTTT-----------------------------------------------------C---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATATAGA-ATAGAATAGAATAACCCGATTGAAGCGTAACGATCAATTGAAACGCCCAAAACAAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC---------------AAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTC------TATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTAAAAGAAACTTAGAGACAAAGTCATTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTT-TTATACTTTT-----TTTGAATTG----------GAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT{AC}AGTTATGTAGATACAATCGGGATCCAAAT--------------------------------------------------------------------------------------------------TCA-TGAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_minuscula AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-GAAGACATGA-------ATAAAATTAGACAT----------------------------AGGAATTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAA-------------------------TTCAATTGTTCACT--------------T-ATTCCATAATAA-----------CAT---------------------TTTAACGTATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTTCAAAAAA-TAAA-T---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------ATAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATC{GT}AGGATATAC--------------TCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTTGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACGA{GT}ATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------T---------ACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCCAGATAAGACTTTG-TTATACTTTT-----TTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT{AC}AGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAAT----------TA-----------------------------------------------------------------------TTAA-TAAATAT--ATAT-AT-T---------------TATTTAG------------------------------------------------ATAATTATAATAGAAAATATATAATATTAATTAATATTTATATAAAAATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAA{CT}ATTTAAATAA-GTGTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGG-CCGAACA-T Rebutia_padcayensis -----------------------CATAACAGATT---C-ATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAA-------------------------TTCAATTGTTCACT--------------T-ATTCCATAATAA-----------CAT---------------------TTTAACGTATTCGATTCA-A------------------------------------TTCA--------TTTATTTTCAA{AG}{AG}{AG}A-T------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTATATT-------CA{AG}{AG}T{AG}-TTTCAGTTGAGTTTAT-GA-{AT}TCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------AGGGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCGTATTTT-CACATCTAGGA-AT{AG}CA---------TATCTCGCCGTCAAGAGTGA-TTTCGGGT-A-TTTAGGTCTTTCGATTCAG--GGGGG-AAGGGGTTGGAGGCTTCAAGGGGCG-CGAGGGTTGGG---------------AAAGCT-----TATTTCACTCCCTAACTAGTTA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------T---------ACAATCAATATAATATCATTACACGTACTCAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCCAGATAAGACTTTG-TTATACTTTT-----TTTTAATTGACATAGACCCGAGTTCTC-------TATT-----CAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATG------------------------------GGGATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCAGAAACGGTTTCCGTAG-TTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_pseudodeminuta ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAA--------------------TTATATAGA-ATAGAATAGAATAACCCGATTGAAGCGTAACGATCAATTGAAACGCCCAAAACAAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----------------AGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTC------TATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTAAAAGAAACTTAGAGACAAAGTCATTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTT-TTATACTTTT-----TTTGAATTG----------GAGT{GT}CTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAAT--------------------------------------------------------------------------------------------------TCA-TGAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_pygmaea_CA08 --------------------TA{AT}CATAGCAGATTGATCG{ACG}{ACT}TAATTAAAATAAGACAT---------------------------------------------------AGGAGTTAG-G-TTAGCACTCCATTTTTT--------------------TGGTAC-----------CAT-{CG}CAA-------------------------TTCCATTGTTCACT--------------T-ATTACATTGTAA-----------CATG--------------------TTTCACATATTCGAGTCA-ACTTAAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTTCAAA{AG}{AG}A-{GT}A-----------------------------------------------------------------------------------------------------------------------TGGATGAATAA{AG}{AG}ATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAAGA-TTTCAATTGA{AG}TTTAT-GA-TTCATTCTTTCTATCGCACTGGAAC{GT}-------{AG}{AG}GTTC------TTATTTAG------TATATTT--------CT{AG}GCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACA---------TATCTCGCCGTCAAGAGTGAATGGCGAATTA-TTTAGGTCT{CT}TCGATTC----------AAGAGATTGG{AG}AACGTAAAGGGCAAAC{AG}AGGGTTGGGTGG{CG}GCGGGG------AAGCT-----TATTTCACTCC-------------------------------------GCTGTCCATGGATCAAATTCTTTCTTTGGATTGGCTTCACTTTATTTTCTACAGCTCCTTTGCGTGTGCTCGGGGTAGAAGTTTTGTATAAATGTATGGTCATGCTATTAAGTATTTTGATGAAAGTTTCTTTTCTTCTTTTTCTTTATAATGAGATAGAATAGAATAACCCGATTGAAGCGTAACGATCAATTGAAACGCCCAAAA-AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCCAA-----TGTGATATACGTA---------------------------------TGAGTGATTCTCAATCAATATAATATCATTACACGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATCAGACTTTG-TTATACTTTTCGTC-TTTTAATTG----------GAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAAT--------------------------------------------------------------------------------------------------TCA-TTAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTGAACTTCTTTTAATTAA---------CTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_pygmaea_CA93 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATTTTCTACAGCTCCTTTGCGTGTGCTCGGGGTAGAAGTTTTGTATAAATGTATGGTCATGCTATTAA----TTTGATTAAAGTTTCTTTTCTTCTTTTTCTTGATAATGAGATAGAATAGAATAACCCGATTGAAGCGTAACGATCAATTGAAACGCCCAAAACAAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAA-----TGTGATATACGTA---------------------------------TGAGTGATTGAGAATCAATATAATATCATTACACGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATCAGACTTTG-TTATACTTTTCGTCCTTTTAATTG----------GAGTTCTC-------TATT-----AAAATGAGTAGATGAT------------------------CTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAAT--------------------------------------------------------------------------------------------------TCA-TTAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTGAACTTCTTTTAATTAA---------CTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Rebutia_steinmannii ----------------------------------GATCGATTAATTAAA-TAAGACAT---------------------------------------------------AGGAGTTAG-G-TTAGCACTCCATTTTTT--------------------TGGTAC-----------CAT-CCAA-------------------------TTCCATTGTTCACT--------------T-ATTACATTGTAA-----------CATG--------------------TTTCACATATTCGAGTCA-ACTTAAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTTCAAAAAA-TA-----------------------------------------------------------------------------------------------------------------------TGGATGAGTAAAAATCTTGAGA{AG}AGTCTTTT-----------------------------------------------------CCTAAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATT{AT}CACTTTATTTTC{AT}ACAGCTCCTTTGCGTGTGCTCGGGGTAGAAGTTTTGTATAAATGTATGGTCATGCTATTAAGTATTTTGATGAAAGTTTCTTTTCTTCTTTTTCTTTATAATGAGATAGAATAGAATAACCCGATTGAAGCGTAACGATCAATTGAAACGCCCAAAACAAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCCAA-----TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATCAGACTTTG-TTATACTTTTCGTCCTTTTAATTG----------GAGTTCTC-------TATT-----AAAA------------------------------------CTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAAT--------------------------------------------------------------------------------------------------TCA-TTAA-----------------------------TATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTGAACTTCTTTTAATTAA---------CTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Samaipaticereus_corroanus AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATTAGACAT----------------------------AGGAGTTAG-G-TTAGCACTAAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTACATTTTAA-----------CATA--------------------TTTAA{CG}ATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAA-------TTTTTTTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATCAAAATCGTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACGATATT-------CAAATA-TTTCAATTGAGTTTAT-GA-TTCATTATTTCGATCGCACTGGAAC{GT}-------AAGTTC------TTATTTAG------TATATTT--------CGAGCC------------------------------------------------------------------------TATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAGAAGGGGG{AT}AAGA{AT}ATTGGAAACGGAAAAG{AT}CAAACAAGGGTTGGGTTG------------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AATTTTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTAT---------TGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTAAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--TCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GT{GT}TGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Stetsonia_coryne AAAATAAAATAAATGTCCGATAGTATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATAAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTA--GTATAA-----------CATA--------------------TTTTACATATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTAA--------TTTATTTTCAAAAAA-TAAA-TATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATA----------------------------------------------------------------------------ATCATATA----ATATCTCGCTGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA--TTTTTTTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG----------GAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAACTTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATT---------TTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCCCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Sulcorebutia_arenacea AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA---------TA-------ATAAAATTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTTAAA-TG---------------TCTCAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGATAAAGTCTTTT-----------------------------------------------------CCTAAACTATAA-CTATATTCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATAT---ACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGG--------------------------------------------------------GCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTAAAAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTGCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA--AAAAAAATTGAATTGCAATA-----------------------------------------------------------------------TT----------------------------------------TAT------------------------------------------------ATAATTAGAATATAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCT{CT}TTCGGGACCGAACA-T Sulcorebutia_canigueralii_CA103 AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA--------TTA-------ATAAAATTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGTTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTTTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTGAAA-TG---------------TCTCAAGTTCACTTTATTT-TAAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGA-----------------AATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC--------------T-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGT{GT}GATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCT{GT}GAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGC--TCTCTTCCCTCTCTTCGGGACCGAACA-- Sulcorebutia_canigueralii_CA104 AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA--------TTA-------ATTAAATTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTA{AC}-----------CGT---------------------TTTTACGTATTCGATTCA-ATTGAAA-TG---------------TCTCAAGTTCACTTTATTT-TAAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATAT{AC}T--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATAC{AG}ACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGA-----------------AATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC----------{CT}TGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAATTGGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCT{GT}GAACCTC-------ATTCTATC-TTTTTTTTTGATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGC--TCTCTTCCCTCTCTTCGGGACCGAACA-- Sulcorebutia_canigueralii_CA27 -----AAAATAAATGTCCGATAGC-TAGCAGATTGATCGATTAATTAAA--------TTA-------ATAAAATTAGAAAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGTTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTGAAA-TG---------------TCTCAAGTTCACTTTATTT-TAAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGA-----------------AATTGGAAAATTAAAAAACAAACAAGGGTTGGGTTGCACGA{GT}ATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTC-TTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGC--TCTCTTCCCTCTCTTCGGGACCGAACA-- Sulcorebutia_cardenasiana AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA------------------------TTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTTCA------------------------AGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-GAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTC-----------------GAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC-------------------------------------AGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAAGAAA-GTTATACCAAGCT{GT}GAACCTC-------ATTCTATC-TTTTTTTTTGATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-- Sulcorebutia_crispata_CA09 AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA------------------------TTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTGAAA-TG---------------TCTCAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT-CTTTTATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACCAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACTAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCAAA-TAAAAAAATGGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCCAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Sulcorebutia_crispata_CA106 AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA------------------------TTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTGAAA-TG---------------TCTCAAGTTCACTTTATTT-TTAATTTA{AC}{AC}TTCTTT{AT}{ACT}{ACT}-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GGGTGGAGGGCTGGAGA{AG}AGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATAT{AC}T--------{CG}TAGCCTATTCTTTT-CTTTTATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTAATTTAGGTCTTTCGAT----------------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACTAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCAAA-TAAAAAAATGGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCCAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCG------ Sulcorebutia_mentosa -----AAAATCAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA------------------------TTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-AGTTCAC------------------TTTCAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGAAATTGGAAACT--AAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAAT--------------------------------TTT------TTTTAATTG---------CGAGTGCTC-------TATT-----AAAATGAGTAGATGAT------GCCCC-------------CTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAAGAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Sulcorebutia_purpurea --------------------------------TTGATCGATTAATTAAA-TAAGACATTC-------ATCAAATTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATAATTTCAATTGAATTTATTGA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACA------ACATATCTCGCCGTCA-GAGTGAATTTCGAATTA-TTTAGG-CTTTC---------GGGGGTAAGAAATTGGA-ACTTAAA--GCA-ACAAGGGT-------------------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAAT--------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTATACCAAGCTAGAACCTCATTCTATATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Sulcorebutia_spec._CA101 AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA---------TA-------ATAAAATTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTTATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTTCAA-TG---------------TCTCAAGTTCACTTTATTTTTA-ATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATTCCAAATTCAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATAT---------ACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGA------------------------------------------------AAAGCTTCTTTTATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGTGGTTATGTTCCTTA-TTTTTTTTTTTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTAATATACGTA---------------------------------TGAGT-ATT-ACAATCAATATAATATCATTACCCGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGT{CGT}CTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATG---------------------------------------ATACAA---AAAAAATTGAATTGCAATA-----------------------------------------------------------------------TTAA-T--ATAT--ATA-------------------TATATTTAT------------------------------------------------ATAATTAGAATATAAAATATC---------------------------------ATTTCATTATTTA------------ATAATAATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAATTGAAATA-TAAGGAGACAAATCTAAGTTAAGTATAAAAAAAACTTGTATTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTGTGATTCTTTATTGGATCATAAAAAC{GT}CAC----------------------------------------- Sulcorebutia_spec._CA99 AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA--------TTA-------ATAAAATTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTGAAA-TG---------------TCTCAAGTTCACTTTATTT-TAAATTTATTTTCAAAAAA-TAAA-T{GT}T----------------------------------------------------------------------------------------------------------------------GAAT{GT}A{GT}{GT}{CGT}TCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------CTCCTTTCCTGATGGCATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGA------------------ATTGGA-ACTTAA----------------------------------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTCATATACGTA---------------------------------TGAGTCATTCACAATCAATATAATA-------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGC--{GT}CTCTTCCCTCTCT-CGGGACCGAACA-T Sulcorebutia_steinbachii_CA107 AAAATAAAATCAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA------------------------TTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-AGTTCAC------------------TTTCAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAA{AG}ACAAACAAGGGTTGGGTTGCAC---------AAAGCT-----TATTTCACTCCC{AT}AACTAGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAAT--------ACGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAAT--------------------------------TTTTCGTCG------------------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATGGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAAGAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATCTTTTTTTTTT-ATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-- Sulcorebutia_steinbachii_CA28 -----AAAATCAATGTCCGATAGCA-AGCAGATTGATCGATTAATTAAA------------------------TTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-AGTTCAC------------------TTTCAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-GACATCTAGGATATACATATACAACATATATCGCCGTGAAGAGTGAATTTCGAATTA-TTTAGGTGTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACGATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAAT--------------------------------TTTTCGTC---------G---------CGAGTGCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATCCAAATAAAAAAATGGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAAGAAA-GTTATACCAAGCT{AG}GAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Sulcorebutia_steinbachii_CA29 AAAATAAAATCAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA------------------------TTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-AGTTCAC------------------TTTCAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCACCATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAAT--------------------------------TTTTCGTC---------G---------CGAGTGCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATGGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAAGAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Sulcorebutia_tarijensis AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA--------TTA-------ATAAAATTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TG----------CCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTGAAA-TG---------------TATCAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-GAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTTTCTTTTATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATAT--AACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGA-----------------AATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC---------AA{GT}GCT-----TATTTCACTCCCTAACTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------G-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAGAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TCAAAAAATGGAATTGCAATA-----------------------------------------------------------------------TTAA-TAAATAT--ATA-------------------TATATTTAT------------------------------------------------ATAATTATAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTCAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Uebelmannia_pectinifera_subsp._flavispina AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATAAGACAT----------------------------AGGAGTTAG-G-TTAGCACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTCCAG----------------------------------------TTTAACATATTCGATTCA-ATTTAAA-TG---------------TCTCAAGTTCACTTAATTT-TA-ATTTATTTTCAAAAAA-GAAA-TATAA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAA----------------------------------------------------------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAGTTTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAA----------CCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCATAAGGGGGAATGCTAAAAGGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAATTGCAATA-----------------------------------------------------------------------TTAA-TCAATAT--ATAT-ATAT-ATAT----ATT-TCTATTTAG------------------------------------------------ATAATTAGAATAGAAAATATC---------------------------------ATTTCATTATTTT------------ATAATAATTAAT------AAAAACTAGAAATAGGATAGAAATAATGAAATTTCAATA-T--------AAATCTAAGTTAAGTATAAAAAAAACTTGTGTTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTACGGGACCGAACA-T Weingartia_buiningiana ---ATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA--------TTA-------ATCAAATTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TG---------------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTCTTCACT--------------T-ATTCCATTATAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTTCAA-TG---------------TCTAAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TCT----------------------------------------------------------------------------------------------------------------------GAAT---------------------------------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGCTGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGG------------------------------------------AAAGCT-----TATTTCACTCCCTAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTCTATTAACTATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT-AGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTT{AC}CCTCTCT-CGGGACCGAACA-T Weingartia_cintiensis ------------------------ATAGCAGAT---------------------------------------ATTAGACAT----------------GGA-GTT------AGAGTTAG-GATTAGCATT-----------------------------TGGTAG-----------GAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGAGTCA-ATTTAAA-TG---------------TCTAAAGTTCACTTCATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTTTCTTTTATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGA-----------------AATT{CG}{CG}AAA{CG}TTAAAAAA{CG}AAA-AA{CG}{CG}{CG}TT{CG}{CG}{CG}TT{CG}{CG}A{CG}-ATATATATAAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAACTCAAAAAATTGAATTGCAATA-----------------------------------------------------------------------TTAA-TAAATATATA---------------------TATATTTAT------------------------------------------------ATAATTATAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCT{CG}TCTTCGGGACCGAACA-T Weingartia_fidaiana AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA--------TTA-------ATAAAATTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTGAAA-TG---------------TCTCAAGTTCACTTAATTTATTAATTTATTTTCAAAAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCGTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAAGTTAAAA-A{CG}AAACAAGGGTT-----------------------------TATTT{CG}ACTCCCTAACTAGTTA--TC------TTATTAA-CAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TA--TTTTTTTTGTTTTC-----A-------------GCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGG-TAAGTTATGTAGATACAATCGGGATCCA{AC}ATAAAA-AAAAAAAATTGAATTGCAATA-----------------------------------------------------------------------TTAA-T--ATAT--ATAT-A----------------TATATTTAT------------------------------------------------ATAATTAGAATATAAAATATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AT----TC-TTTTTTTTTTATTTCATTAATTGAACTTCTTT---------------------------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTT-TTGGATCATAAAAACCC{AC}CTTTCCGCAGA--T-TCTTCCCTCT{CT}TTCGGGACCGAACA-T Weingartia_neocumingii_subsp._pulquinensis AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTCAA--------TTC-------ATAAAATTAGACAT----------------GGGAGGGGAGGG-GGAGTTAG-GATTAGCATT-----------------------------TGCACT-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTATAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTTCAA-TG---------------TCTAAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACA------------------------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATT{CG}ACAATCAATATAATA-------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Weingartia_neocumingii_var._hediniana -----AAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA--------TTA-------ATAAAATTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TG---------------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTATAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTTCAA-TG---------------TCTAAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAAT---------------------------------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATAC{AG}ACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC{CG}A{GT}ATATATAAAGCT-----TATTTCACTCCCTAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTC-TTTTAATTG---------CGAGTTCTCTATTAACTATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGAT{AC}AGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Weingartia_neocumingii_var._longigibba AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA------------------------TTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TG---------------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTATAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTTCAA-TG---------------TCTAAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAACAAACAAGGGTTGGGTTGCAC------------GCT-----TATTTCACTCCCTAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAACTCTTGT{AT}ATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTGAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTCTATTAACTATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCT-CGGGACCGAACA-T Weingartia_neocumingii_var._neocumingii AAAATAAAATAAATGTCCGATAGCATAGCAGATTGATCGATTAATTAAA------------------------TTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TG---------------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTATAG-----------CGT---------------------TTTTACGTATTCGATTCA-ATTTCAA-TG---------------TCTAAAGTTCACTTTATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAAT---------------------------------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGGGGTAAGAAATTGGAAACTTAAAAAA{CG}AAA{CG}AAGGGTTGGGTTGCA--ATATATATAAAGCT-----TATTTCACTCCCTAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTG---------CGAGTTCTCTATTAACTATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAA-TAAAAAAATTGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATTGGCACTACATAATAAATCTACATAAATAGATGAATAGAAAAGGAAGAATAAAATAAA-GTTATACCAAGCTAGAACCTC-------ATTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCAGAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGATTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Weingartia_westii -----AAAATAAA{GT}GTCCGATAGCATAGCAGATTGATCGATTAATTAAA------------------------TTAGACAT----------------GGGAGG-------GGAGTTAG-GATTAGCATT-----------------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAAACTCCTTTAATTGTTCACT--------------T-ATTCCATTTTAG-----------CGT---------------------TTTTACGTATTCGAGTCA-ATTTAAA-TG---------------TCTAAAGTTCACTTAATTT-TTAATTTATTTTCAAAAAA-TAAA-TAT----------------------------------------------------------------------------------------------------------------------GAATAAAAATCTTGAGAAAGTCTTTT-----------------------------------------------------CCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTT--------CTAGCCTATTCTTTTTCTTTTATCCTTTCCTGATGGA-TTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGA-----------------AATTGGAAACTTAAAAAAC-----------------------------AAAGCT-----TATTTCACTCCCTAACTAGTTA--TCCTTTTTTTATTAA-CAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGTTTTC-----AA--TTTCAAAAAGGCT-----AAAGGCCCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTA---------------------------------TGAGTGATTCACAATCAATATAATA-------ACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTTGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTC-TTTTAATTG---------CGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCCCCAGAAGGGGGAATGCTAAAAAGGATAAGTTATGTAGATACAATCGGGATCCAAATAAAACTCAAAAAATTGAATTGCAATA-----------------------------------------------------------------------TTAA-TAAATAT--ATA-------------------TATATTTAT------------------------------------------------ATAATTATAATAGAAAATATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCATTAATTGAACTTCTTTTAATTAAGTCAAAATTCTTT-------AAAAACCTCTGCCC------------------------------------------------------------------------------TCTTAAAAATATCATAAACGGTTTCCGTAGGTTGAGCGCCTTTTTCAAGAAAATATAGAATAGCAGGAACATTTAAATAA-GTTTGAGTCTTTATTGGATCATAAAAACCCACTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAACA-T Yavia_cryptocarpa A-AATCAAATAAAAGTCCGATAGCATAGCAGATTGATCGATTAATTAAA-TAAGACATTA-------ATAAAATAAGACAT----------------------------AGGAGTTAG-------CACTCAATTTTTT--------------------TGGTAC-----------CAT-CCAAA----------TGAATCCAA-----TTCAATTGTTCACT--------------T-ATTCCATTTT----------------------------------------GACTTATTCGATTCA-ATTTCAA-TG--------AGTGAATTCTCAAGTTCACTCAA--------CTTATTTTCAAAAAA-AAAAATATCA-------------------------------------------------------------------------------------------------------------AATGGATGAATAAAAATCTTGAGAA-----TTTATTTGT-CTATCATTATAGACAATCCTTTCAATATTATCTACGAAAATCGAAACCTAAACTATATT-------CAAATA-TTTCAATTGAATTTAT-GA-TTCATTATTTCTATCGCACTGGAACT-------AAGTTC------TTATTTAG------TATATTGATTTATGTCTAGCCTATTCTTTT------ATCCTTTCCTGATGGAATTCCGCATATTTT-CACATCTAGGATATACATATACAACATATCTCGCCGTCAAGAGTGAATTTCGAATTA-TTTAGGTCTTTCGATTCAAAAGGTGGTAAGAAATTGGAAACTTGAAAAACAAACAAGGGTTGGGTTGCACCATATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACT-----AAAGGCTCCGGACGGAA-----TTTCCCTTATCAAAAGTCTTGTGATATACGTAAAAATGAATATCTTTGAGCAAGGAATAATTATTTGAGTGATTCACAATCAA-----TATCATTACACGTACTAAAACTTAAATAAACTTAGAGACAAAGTCCTTCTTTTCGAAGACCAAAGAAATT--GCGGTACCTAGATAAGACTTTG-TTATACTTTTCGTCCTTTTAATTGACATAGACCCGAGTTCTC-------TATT-----AAAATGAGTAGATGAT------GCGCCAGAAGGGGGAATGCTAAAAAGGATAA----------TCGAATCGGGATCAAAATCTAA-TTCAAA-------TTGCAATATTTTTATTTCAATTCAATATTGATTTTATTATATCTATTTTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACTCAAAATAGGATGGAAATAATGCAATTGAAATACTAAGGAGAAAAATCTCAGTTTAGTATAAAAAAAACTTGTGTTGGATTGGCACTAAATAATAAATCCACATAA--------------------------------------------------------------TTCTATC-TTTTTTTTTTATTTCATTAATTGAACTTCTTTTAATTAAGTCAA-----TTT-------TAAAACCTTTGCCC------------------------------------------------------------------------------TCTTTAACATATCATAAACGGTTTCCGTAG-TTGAGCGCCTTTTTCAAGAAAATCTAGAATAGCAGGAACATTTAAATAA-ATTTGATTCTTTATTGGATCATAAAAACCCAGTTTCCGCAGA--TCTCTTCCCTCTCTTCGGGACCGAGCA-T ; END; BEGIN TREES; TITLE Tb8317; LINK TAXA = Taxa1; TRANSLATE 1 Weingartia_cintiensis, 2 Sulcorebutia_arenacea, 3 Cintia_knizei_CA01, 4 Cintia_knizei_CA13, 5 Sulcorebutia_crispata_CA106, 6 Sulcorebutia_crispata_CA09, 7 Sulcorebutia_canigueralii_CA27, 8 Sulcorebutia_canigueralii_CA103, 9 Sulcorebutia_canigueralii_CA104, 10 Sulcorebutia_spec._CA99, 11 Weingartia_neocumingii_subsp._pulquinensis, 12 Weingartia_neocumingii_var._longigibba, 13 Weingartia_neocumingii_var._neocumingii, 14 Weingartia_buiningiana, 15 Weingartia_neocumingii_var._hediniana, 16 Sulcorebutia_steinbachii_CA28, 17 Sulcorebutia_steinbachii_CA29, 18 Sulcorebutia_mentosa, 19 Sulcorebutia_cardenasiana, 20 Sulcorebutia_purpurea, 21 Echinopsis_pentlandii, 22 Echinopsis_tiegeliana, 23 Echinopsis_cinnabarina, 24 Echinopsis_huotii, 25 Echinopsis_ancistrophora_subsp._arachnacantha, 26 Echinopsis_schickendantzii, 27 Echinopsis_mamillosa, 28 Matucana_aurantiaca, 29 Oroya_peruviana, 30 Oreocereus_celsianus, 31 Cleistocactus_strausii, 32 Echinopsis_mirabilis, 33 Denmoza_rhodacantha, 34 Austrocactus_philippii, 35 Haageocereus_pacalaensis, 36 Samaipaticereus_corroanus, 37 Espostoa_lanata, 38 Espostoa_ritteri, 39 Espostoa_guentheri, 40 Weingartia_fidaiana, 41 Weingartia_westii, 42 Sulcorebutia_tarijensis, 43 Sulcorebutia_steinbachii_CA107, 44 Gymnocalycium_rauschii, 45 Gymnocalycium_leptanthum, 46 Gymnocalycium_andreae_subsp._carolinense, 47 Gymnocalycium_paraguayense, 48 Gymnocalycium_carminanthum, 49 Gymnocalycium_anisitsii_subsp._anisitsii, 50 Gymnocalycium_schickendantzii, 51 Gymnocalycium_bruchii, 52 Gymnocalycium_pflanzii_subsp._argentinense, 53 Gymnocalycium_pflanzii_subsp._pflanzii, 54 Rauhocereus_riosaniensis, 55 Rebutia_pseudodeminuta, 56 Rebutia_fiebrigii, 57 Rebutia_deminuta, 58 Rebutia_pygmaea_CA08, 59 Rebutia_steinmannii, 60 Rebutia_pygmaea_CA93, 61 Rebutia_einsteinii, 62 Rebutia_padcayensis, 63 Rebutia_minuscula, 64 Echinopsis_atacamensis_subsp._pasacana, 65 Coleocephalocereus_fluminensis, 66 Uebelmannia_pectinifera_subsp._flavispina, 67 Copiapoa_laui, 68 Espostoopsis_dybowskii, 69 Cipocereus_minensis, 70 Cereus_hildemannianus, 71 Stetsonia_coryne, 72 Sulcorebutia_spec._CA101, 73 Neoraimondia_arequipensis_subsp._roseiflora, 74 Neoraimondia_herzogiana, 75 Eriosyce_napina, 76 Browningia_candelaris, 77 Browningia_hertlingiana, 78 Yavia_cryptocarpa, 79 Parodia_microsperma, 80 Parodia_magnifica, 81 Micranthocereus_auriazureus, 82 Arrojadoa_rhodantha_CA83, 83 Arrojadoa_rhodantha_CA38, 84 Coleocephalocereus_goebelianus, 85 Discocactus_zehntneri_subsp._boomianus, 86 Melocactus_oreas, 87 Neowerdermannia_vorwerkii; TREE Fig._2 = [&R] (((((((((((((1,41),42),(((5,6),40),(((7,8),9),10))),2),(3,4)),72),((((11,12,13),15),14),(((((16,18),17),43),19),20))),((62,63)Rebutia_II,76)),77)Cactaceae_clade_E,((((((((((21,22),(23,25)),64),27),((28,29),30,35)),((26,36),(((37,38),(((((44,51),(45,46)),47),48),((49,50),(52,53)))Cactaceae_clade_C),54))),((((24,31),32),39),33))Cactaceae_clade_B),71),((((65,84),(69,(85,86))),68),(81,(82,83)))Cactaceae_clade_A),(((55,56),57),(((58,59),60),61))Rebutia_I)),70),66)Cactaceae_BCT_clade; END; BEGIN TREES; TITLE Tb8318; LINK TAXA = Taxa1; TRANSLATE 1 Weingartia_cintiensis, 2 Sulcorebutia_arenacea, 3 Cintia_knizei_CA01, 4 Cintia_knizei_CA13, 5 Sulcorebutia_crispata_CA106, 6 Sulcorebutia_crispata_CA09, 7 Sulcorebutia_canigueralii_CA27, 8 Sulcorebutia_canigueralii_CA103, 9 Sulcorebutia_canigueralii_CA104, 10 Sulcorebutia_spec._CA99, 11 Weingartia_neocumingii_subsp._pulquinensis, 12 Weingartia_neocumingii_var._longigibba, 13 Weingartia_neocumingii_var._neocumingii, 14 Weingartia_buiningiana, 15 Weingartia_neocumingii_var._hediniana, 16 Sulcorebutia_steinbachii_CA28, 17 Sulcorebutia_steinbachii_CA29, 18 Sulcorebutia_mentosa, 19 Sulcorebutia_cardenasiana, 20 Sulcorebutia_purpurea, 21 Echinopsis_pentlandii, 22 Echinopsis_tiegeliana, 23 Echinopsis_cinnabarina, 24 Echinopsis_huotii, 25 Echinopsis_ancistrophora_subsp._arachnacantha, 26 Echinopsis_schickendantzii, 27 Echinopsis_mamillosa, 28 Matucana_aurantiaca, 29 Oroya_peruviana, 30 Oreocereus_celsianus, 31 Cleistocactus_strausii, 32 Echinopsis_mirabilis, 33 Denmoza_rhodacantha, 34 Austrocactus_philippii, 35 Haageocereus_pacalaensis, 36 Samaipaticereus_corroanus, 37 Espostoa_lanata, 38 Espostoa_ritteri, 39 Espostoa_guentheri, 40 Weingartia_fidaiana, 41 Weingartia_westii, 42 Sulcorebutia_tarijensis, 43 Sulcorebutia_steinbachii_CA107, 44 Gymnocalycium_rauschii, 45 Gymnocalycium_leptanthum, 46 Gymnocalycium_andreae_subsp._carolinense, 47 Gymnocalycium_paraguayense, 48 Gymnocalycium_carminanthum, 49 Gymnocalycium_anisitsii_subsp._anisitsii, 50 Gymnocalycium_schickendantzii, 51 Gymnocalycium_bruchii, 52 Gymnocalycium_pflanzii_subsp._argentinense, 53 Gymnocalycium_pflanzii_subsp._pflanzii, 54 Rauhocereus_riosaniensis, 55 Rebutia_pseudodeminuta, 56 Rebutia_fiebrigii, 57 Rebutia_deminuta, 58 Rebutia_pygmaea_CA08, 59 Rebutia_steinmannii, 60 Rebutia_pygmaea_CA93, 61 Rebutia_einsteinii, 62 Rebutia_padcayensis, 63 Rebutia_minuscula, 64 Echinopsis_atacamensis_subsp._pasacana, 65 Coleocephalocereus_fluminensis, 66 Uebelmannia_pectinifera_subsp._flavispina, 67 Copiapoa_laui, 68 Espostoopsis_dybowskii, 69 Cipocereus_minensis, 70 Cereus_hildemannianus, 71 Stetsonia_coryne, 72 Sulcorebutia_spec._CA101, 73 Neoraimondia_arequipensis_subsp._roseiflora, 74 Neoraimondia_herzogiana, 75 Eriosyce_napina, 76 Browningia_candelaris, 77 Browningia_hertlingiana, 78 Yavia_cryptocarpa, 79 Parodia_microsperma, 80 Parodia_magnifica, 81 Micranthocereus_auriazureus, 82 Arrojadoa_rhodantha_CA83, 83 Arrojadoa_rhodantha_CA38, 84 Coleocephalocereus_goebelianus, 85 Discocactus_zehntneri_subsp._boomianus, 86 Melocactus_oreas, 87 Neowerdermannia_vorwerkii; TREE Fig._1 = [&R] (87,((((((1,41),(5,6),(7,8,9,10),(11,(12,13,14,15)),((16,17),18,43),19,20,42,2,(3,4),40,72)'Sulcorebutia-Weingartia-Cintia complex',(((62,63)Rebutia_II,76),77))Cactaceae_clade_E,((((((21,23),22),25)Lobivia,27),(((24,31,39),32),33),(26,36),(28,29),30,35,((37,38),54),64)Cactaceae_clade_B,(((((44,51),(45,46)),47),48),((49,50),(52,53)))Gymnocalycium),((((55,56,57),((58,59),60)),61)Rebutia_I,70,71)),(((((65,84),69,(85,86)),68),(82,83)),81)Cactaceae_clade_A),66)Cactaceae_BCT_clade,(34,(73,74)),67,75,78,79,80); END;