#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 20:03 GMT TreeBASE (cc) 1994-2008 Study reference: Siahaan S.A., Kramadibrata K., Hidayat I., Meeboon J., & Takamatsu S. 2016. Erysiphe baliensis and E. sidae, two new species of anamorphic Erysiphe (powdery mildew) from Indonesia. Mycoscience, 57(1): 35-41. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17749] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=70; TAXLABELS Erysiphe_adunca_var._adunca_MUMH39_ex_Salix_vulpina Erysiphe_aquilegiae_Mumh287_ex_Ranunculus_japonicus Erysiphe_aquilegiae_Mumh293_ex_Clematis_stans Erysiphe_astragali_Mumh2585_ex_Astragalus_glycyphyllus Erysiphe_berchemiae_Mumh252_ex_Berchemia_racemosa Erysiphe_betae_Mumh395_ex_Ambrina_ambrosioides Erysiphe_blasti_Mumh20_ex_Celtis_sinensis Erysiphe_blasti_Mumh205_ex_Celastrus_orbiculatus Erysiphe_blasti_Mumh207_ex_Carpinus_cordata Erysiphe_blasti_Mumh211_ex_Fraxinus_longicuspis Erysiphe_blasti_Mumh235_ex_Firmiana_simplex Erysiphe_blasti_Mumh243_ex_Carpinus_japonica Erysiphe_blasti_Mumh2589_ex_Carpinus_betulus Erysiphe_blasti_Mumh2966_ex_Carpinus_cordata Erysiphe_buhrii_Mumh787_ex_Gypsophila_paniculata 'Erysiphe carpini-cordatae MUMH3408 ex Carpinus cordata' 'Erysiphe carpini-laxiflorae MUMH50 ex Carpinus laxiflora' Erysiphe_carpinicola_MUMH3503_ex_Carpinus_laxiflora Erysiphe_carpinicola_MUMH3620_ex_Carpinus_tschonoskii Erysiphe_carpinicola_MUMH51_ex_Carpinus_japonica Erysiphe_corylacearum_Mumh199_ex_Corylus_sieboldiana Erysiphe_cruciferarum_Mumh1430_ex_Cleome_sp. Erysiphe_epigena_Mumh2193_ex_Quercus_variabilis Erysiphe_erlangshanensis_Mumh2586_ex_Lonicera_maackii Erysiphe_fimbriata_MUMH3694_ex_Carpinus_laxiflora Erysiphe_glycines_Mumh396_ex_Desmodium_laxum Erysiphe_glycines_Mumh52_ex_Desmodium_podocarpum Erysiphe_glycines_Mumh56_ex_Amphicarpaea_edgeworthii Erysiphe_glycines_Mumh5688_ex_Sida_rhombifolia Erysiphe_huayinensis_Mumhs87_ex_Isodon_trichocarpus Erysiphe_hyperici_Mumh2547_ex_Hypericum_perforatum Erysiphe_juglandis_Mumh278_ex_Juglans_mandshurica Erysiphe_knautiae_Mumh2571_ex_Knautia_arvensis Erysiphe_ligustri_Mumh14_ex_Ligustrum_obtusifolium Erysiphe_limonii_Mumh2568_ex_Limonium_platyphyllum Erysiphe_menispermi_var._dahurica_Mumh282_ex_Menispermum_dauricum Erysiphe_nomurae_Mumh275_ex_Symplocos_chinensis Erysiphe_pulchra_Mumh90_ex_Cornus_controversa Erysiphe_russellii_Mumh105_ex_Oxalis_corniculata Erysiphe_sedi_Mumh2575_ex_Sedum_aizoon Erysiphe_sidae_MUMH5126_ex_Sida_rhombifolia Erysiphe_sp._DNA8_ex_Lagerstroemia_indica Erysiphe_sp._MUMH3789_ex_Liquidambar_formosana Erysiphe_sp._MUMH4640_ex_Betula_grossa Erysiphe_sp._MUMH4642_ex_Hydrangea_petiolaris Erysiphe_sp._MUMH4650_ex_Liquidambar_styraciflua Erysiphe_sp._MUMH510_ex_Alnus_firma Erysiphe_sp._MUMH514_ex_Hydrangea_paniculata Erysiphe_sp._MUMH5146_ex_Sida_rhombifolia Erysiphe_sp._MUMH530_ex_Vitis_vinifera Erysiphe_sp._MUMHs141_ex_Vitis_coignetiae Erysiphe_sp._MUMHs2_ex_Alnus_maximowiczii Erysiphe_sp._MUMHs4_ex_Alnus_serrulatoides Erysiphe_sp._MUMHs79_ex_Salix_bakko Erysiphe_sp._MUMHs81_ex_Fraxinus_lanuginosa Erysiphe_sp._MUMHs96_ex_Fraxinus_mandshurica Erysiphe_sp._TPU1832_ex_Morus_australis Erysiphe_syringae_Tpu1549_ex_Syringa_vulgaris Erysiphe_thaxteri_Mumh2465_ex_Berberis_darwinii Erysiphe_vanbruntiana_Mumh171_ex_Salix_futura Erysiphe_vanbruntiana_Mumh173_ex_Fraxinus_lanuginosa Leveillula_taurica_MUMH48_ex_Alnus_japonica Oidium_mangiferae_VPRI20379_ex_Mangifera_indica Pseudoidium_anacardii_Mumh2418_ex_Hevea_brasiliensis Pseudoidium_anacardii_Mumh3165_ex_Bixa_orellana Pseudoidium_anacardii_Mumh3230_ex_Bixa_orellana Pseudoidium_anacardii_Mumh781_ex_Anacardium_occidentale Pseudoidium_neolycopersici_Mumh66_ex_Lycopersicon_esculentum Pseudoidium_sp._Mumh1462_ex_Glycine_max Pseudoidium_sp._Mumh578_ex_Rhus_trichocarpa ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=46; TAXLABELS Erysiphe_astragali_Mumh2549_ex_Astragalus_sp. Erysiphe_astragali_Mumh2585_ex_Astragalus_glycyphyllus Erysiphe_astragali_Mumh2590_ex_Astragalus_glycyphyllus Erysiphe_baeumleri_Mumh2584_ex_Vicia_cassubica Erysiphe_baptisiae_Mumh1433_ex_Baptisia_australis Erysiphe_berberidicola_Mumh575_ex_Mahonia_fortunei Erysiphe_cruciferarum_Mumh1430_ex_Cleome_sp. Erysiphe_euonymi_Mumh2583_ex_Euonymus_europaea Erysiphe_guarinonii_Mumh1425_ex_Laburnum_alpinum Erysiphe_hyperici_Bcru04186_ex_Hypericum_perforatum Erysiphe_hyperici_Mumh2547_ex_Hypericum_perforatum Erysiphe_multappendicis_AB104520_ex_Berberis_vulgaris Erysiphe_myzodendri_Bcru04187_ex_Misodendrum_linearifolium Erysiphe_oehrensii_Mumh1866_ex_Maytenus_boaria Erysiphe_oehrensii_Mumh2492_ex_Maytenus_boaria Erysiphe_palczewskii_Mumh1423_ex_Caragana_arborescens Erysiphe_palczewskii_Mumh2581_ex_Caragana_arborescens Erysiphe_palczewskii_Mumhs111_ex_Robinia_pseudoacacia Erysiphe_robiniicola_Mumh67_ex_Robinia_pseudoacacia Erysiphe_russellii_Mumh105_ex_Oxalis_corniculata Erysiphe_sp._Mumh201_ex_Berberis_amurensis Erysiphe_sp._Mumh289_ex_Raphanus_sativus Erysiphe_trifoliorum_Mumh1046_ex_Trifolium_pratense Erysiphe_trifoliorum_Mumh701_ex_Trifolium_arvense Erysiphe_trifoliorum_Mumh833_ex_Trifolium_dubium Pseudoidium_sp._Bcru03842_Pseudoidium_sp._Bcru03842_ex_Lathyrus_magellanicus Pseudoidium_sp._Dna565_ex_Eustoma_russellianum Pseudoidium_sp._Mumh1162_ex_Glycine_soja Pseudoidium_sp._Mumh131_ex_Melilotus_officinalis Pseudoidium_sp._Mumh1462_ex_Glycine_max Pseudoidium_sp._Mumh1583_ex_Millettia_japonica Pseudoidium_sp._Mumh1623_ex_Aeschynomene_indica Pseudoidium_sp._Mumh1936_ex_Maytenus_sp. Pseudoidium_sp._Mumh240_ex_Vicia_hirsuta Pseudoidium_sp._Mumh2438_ex_Vicia_nigricans Pseudoidium_sp._Mumh2572_ex_Oenothera_amoena Pseudoidium_sp._Mumh2587_ex_Coronilla_varia Pseudoidium_sp._Mumh2593_ex_Xanthoxalis_sp. Pseudoidium_sp._Mumh5705_ex_Gliricidia_sepium Pseudoidium_sp._Mumh5712_ex_Gliricidia_sepium Pseudoidium_sp._Mumh598_ex_Millettia_japonica Pseudoidium_sp._Mumh837_ex_Vicia_faba Pseudoidium_sp._Mumh85_ex_Mirabilis_jalapa Pseudoidium_sp._Mumhs133_ex_Albizia_julibrissin Pseudoidium_sp._Pseudoidium_sp._Mumh2442_ex_Lathyrus_magellanicus Pseudoidium_sp._YNMH12360_ex_Vicia_amoena ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M35664] TITLE Erysiphe_28S_rDNA_Fig_2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=819; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_adunca_var._adunca_MUMH39_ex_Salix_vulpina TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGCAGCTTTGGGTTGTGGGACCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCTGCACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACACC-ACTGATCCGCGAGG-GTTCT---CTCTCGGGCACTCGGTGGGGTACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCCGAAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTTCGGTGCAATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--C-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTA-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTC--GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_aquilegiae_Mumh287_ex_Ranunculus_japonicus TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CATGG--CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCCCGA-GTTCT---CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC--GGGGAGTG-TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_aquilegiae_Mumh293_ex_Clematis_stans TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CATGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCCCGA-GTTCT---CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTC--GGGGAGTG-TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_astragali_Mumh2585_ex_Astragalus_glycyphyllus TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCTGATCACCTTGA-GGTCT--CCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTTGGGGGCGCATCATCGACCGATCCTGATGTCTTCGGA----------------------- Erysiphe_berchemiae_Mumh252_ex_Berchemia_racemosa TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGCGA--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCTGATCACCTTGA-GTTCT--TCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_betae_Mumh395_ex_Ambrina_ambrosioides TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CT-----GGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGACGCT-GCCGATCACCTTGA-GGTCT--CCTCGAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTT--TGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_blasti_Mumh20_ex_Celtis_sinensis TTGACCTCGAATCAGGTAGGGATACCCGCTG??CTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTA-CTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCCGAGG--CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTACCCAGAC-TTGGGCGCT-GCTGATCATCCAGA-GTTCT---CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGGGGAGTGTTTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT---GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_blasti_Mumh205_ex_Celastrus_orbiculatus TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCCGCAGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGC-CGAGAC-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGCTGATCATCCATGAGTTCT--TCTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCGGAGAAACGTAGCTCCCTCT---GGGAGTG-TTATAGTCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTTT---AGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTCT--GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_blasti_Mumh207_ex_Carpinus_cordata TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAG-GGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGAC-TCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACGCTGGCTGATCATCCATGAGTTTG--TCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGTCGGAGCAACGTAGCTCCCTTC--GAGGAGTG-TTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGA--------------------------------- Erysiphe_blasti_Mumh211_ex_Fraxinus_longicuspis -----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCGTCG-TCGT---GGCGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGC-CGTGGCTCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCTGATCATCTAGG-GTTCT---CCCTGGTGCACTCGGCAGCGGACAGGCCAGCATCGGTTCGAGTGGCTGGAGAAAGGTTGTAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTACGACGCAATGCAGCCCAGTCGGACCGAGGATCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCTTTC---GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_blasti_Mumh235_ex_Firmiana_simplex TTGACCTCGAATCAGGTATGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGCGGTAGGTGCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGCGG--CCTCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GTTGATCATCCAGA-GTTTT---CTCTGGTGCACTCGGCAGCGGACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGTGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_blasti_Mumh243_ex_Carpinus_japonica -TGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGAC-TCTGCGCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACGCTGGCTGATCATCCATGAGTTCG--TCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGCAACGTAGCTCCCTTC--GGGGAGTG-TTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_blasti_Mumh2589_ex_Carpinus_betulus TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCTGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCAGA-GTTCT---CTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCATTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_blasti_Mumh2966_ex_Carpinus_cordata TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGC-CGAGA--CTTGTGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACGCT-GCTGATCATCTAGG-GTTCT--TCTCTAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCTGTAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGT------------------------------------------------------------------------ Erysiphe_buhrii_Mumh787_ex_Gypsophila_paniculata TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CT-----GGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCCGATCACCTTGA-GGTCT--CCTCGAGTGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTAC----GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTTTGGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC 'Erysiphe carpini-cordatae MUMH3408 ex Carpinus cordata' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGC-CGAGA--CTTGTGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACGCT-GCTGATCATCTAGG-GTTCT--TCTCTAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCTGTAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTG----------------------------------------------------------------------- 'Erysiphe carpini-laxiflorae MUMH50 ex Carpinus laxiflora' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CAAGGT-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGCTGATCATCCAGA-GTTTT---CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGATTCGGGTGGTTGGATAAAGGCCGGAGAAACGTAGCTCCTCTC--GGGGAGTG-TTATAGTCTACGGTGCCATGCAGCCCAGCCGGATCGAGGACCGCGCCTTC----GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAGCCCCTTT--GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGA-CATAGC Erysiphe_carpinicola_MUMH3503_ex_Carpinus_laxiflora TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CAAGGT-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGCTGATCATCCAGA-GTTTT---CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGATTCGGGTGGTTGGATAAAGGCCGGAGAAACGTAGCTCCTCTC--GGGGAGTG-TTATAGTCTACGGTGCCATGCAGCCCAGCCGGATCGAGGACCGCGCCTTC----GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGCAGGTGA---------------------------------------------------------------------- Erysiphe_carpinicola_MUMH3620_ex_Carpinus_tschonoskii TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCTGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCAGA-GTTCT---CTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGCAGGTG----------------------------------------------------------------------- Erysiphe_carpinicola_MUMH51_ex_Carpinus_japonica TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTG-GGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGAC-TCTGCGCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACGCTGGCTGATCATCCATGA?TTCG--TCTCT?GTGCACTC?AC?GCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGCAACGTAGCTCCCTTC--GGGGAGTG-TTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATC------------------------------------------------ Erysiphe_corylacearum_Mumh199_ex_Corylus_sieboldiana TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGC-CGAGG--CCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCCTGA-GTTTT---CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_cruciferarum_Mumh1430_ex_Cleome_sp. TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTATGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCTGATCACCTTGC-GTTCT--CCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_epigena_Mumh2193_ex_Quercus_variabilis TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-GC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCCCGA-GTTCT---CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_erlangshanensis_Mumh2586_ex_Lonicera_maackii TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCTGCGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCCGATCACCCCGA-GTTCT---CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_fimbriata_MUMH3694_ex_Carpinus_laxiflora TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-AC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTCCGGCCTAAGTTCCTTGGAATAGGACGTCGGAGAGGGTGAGAATCCCGTCTGTGGC-CGAGG--CCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCAGA-GTTTA---CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC--GGGGAGTG-TTATAGCCTATGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGCAGGTGA---------------------------------------------------------------------- Erysiphe_glycines_Mumh396_ex_Desmodium_laxum ------------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG--TTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GTTGATCATCTAGA-GTTTT---CTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT--GGGGAGTG-TTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTG-AAACCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCCTTT--GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATG--------------------- Erysiphe_glycines_Mumh52_ex_Desmodium_podocarpum TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG--TTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GTTGATCATCTAGA-GTTTT---CTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT--GGGGAGTG-TTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTG-AAACCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCCTTT--GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_glycines_Mumh56_ex_Amphicarpaea_edgeworthii TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGCAGATTCAGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG--TTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GTTGATCATCCAGG-GTTTT---CTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTG-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGA------------- Erysiphe_glycines_Mumh5688_ex_Sida_rhombifolia TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCCCTG-TA--GAAGGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGGGA-CCCTGTGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGTT-ACCGATCAACCGGA-GTTCT---CTCTAGTGTACTCGGTAGTGTACAGGCCAGCATTGGTTCGGGTGGCTGGAGAAAGGTCGCAGGAACGTAGCTCCTTTC--GGGGAGTG-TTATAGCCTGCGGCGTAATGCAGCCTAGCCGGATCAAGGACCGCGCCTCTGTGGGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAAACCCATACGCGGAATGAAAGTGAACGGAGGTGAGA-GCCCTTT--GGGGTGCATCATCGACCGATCCTGATGTCATCGGATGGGATTTGAG------------ Erysiphe_huayinensis_Mumhs87_ex_Isodon_trichocarpus TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTGCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGCGG--CCCACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCTCGA-GTTCT---CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTGCCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCGGT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_hyperici_Mumh2547_ex_Hypericum_perforatum TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCTGATCACCTTGC-GGTCT--CCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_juglandis_Mumh278_ex_Juglans_mandshurica TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GTCGATCATCCTGA-GTTCT---CTCTGGTGCACTCGACAGCGGACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTT--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTAT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_knautiae_Mumh2571_ex_Knautia_arvensis TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CATGG--CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCCCGA-GTTCT---CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC--GGGGAGTG-TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_ligustri_Mumh14_ex_Ligustrum_obtusifolium TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCCTGA-GTTCT---CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGT------------------------------ Erysiphe_limonii_Mumh2568_ex_Limonium_platyphyllum TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG--CCCGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCCGATCACCTTGA-GTTCT--CCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGGAACGTAGCTCCCCTC--GGGGAGTG-TTATAGCCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGA-AAGCCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_menispermi_var._dahurica_Mumh282_ex_Menispermum_dauricum TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTT-CC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GTCGATCACCCCGA-GTTCT---CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGA--------------------------------- Erysiphe_nomurae_Mumh275_ex_Symplocos_chinensis TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CC-----AGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCCATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCATCTCGA-GTTCT---CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCTCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_pulchra_Mumh90_ex_Cornus_controversa TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCCGATCACCCAGA-GTTTC---TTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_russellii_Mumh105_ex_Oxalis_corniculata TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCT-GCTGATCACCTTGC-GGTCT--CCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTC--GGGGAGTG-TTATAGCCTATGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAGCCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCC------------------------------------ Erysiphe_sedi_Mumh2575_ex_Sedum_aizoon TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CATGG--CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCCCGA-GTTCT---CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC--GGGGAGTG-TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_sidae_MUMH5126_ex_Sida_rhombifolia TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCCCTG-TA--GAAGGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGGGA-CCCTGTGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGTT-ACCGATCAACCGGA-GTTCT---CTCTAGTGTACTCGGTAGTGTACAGGCCAGCATTGGTTCGGGTGGCTGGAGAAAGGTCGCAGGAACGTAGCTCCTTTC--GGGGAGTG-TTATAGCCTGCGGCGTAATGCAGCCTAGCCGGATCAAGGACCGCGCCTCTGTGGGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAAACCCATACGCGGAATGAAAGTGAACGGAGGTGAGA-GCCCTTT--GGGGTGCATCATCG-------------------------------------------- Erysiphe_sp._DNA8_ex_Lagerstroemia_indica TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTGGTAAC---GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGTGG--CTTGCGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGAC-TTGGGCATC-GCTGATCATCCGGG-GGTAT---CTCCGGTGCACTCGACGATGCACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCTGTGGGAACGTGGCTCCTTTC--GAGGAGTG-TTATAGCCCACGGTGCAATGCAGCCCATCCGGACCGAGGACCGCGCCCTTC--GGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTT--GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_sp._MUMH3789_ex_Liquidambar_formosana TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TTAGCCGGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGC-CGAGG--CCTACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTTGGGCACT-GCTGATCAGCCGGA-GTTCT---CTCCGATGCACTCGACAGCGCACAGGCCAGCATCGGTTTGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTTCC--GGGGAGTG-TTATAGCCTATGGTGCCATGCAGCCCATCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGAAGTCTAACATCTATGCGAGTGTTTGGGCGTCAAAACCCATACGCGGAATGAAAGTGAACG----------------------------------------------------------------------------- Erysiphe_sp._MUMH4640_ex_Betula_grossa ---------------------------------------CATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTCGTAGACTTGGCCTAAGTTCCTTGGAA?AGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGAC-CCTGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGTCGATCATCCATGAGTTCG--TCTCTGGTGCACTCGACCGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGAAACGTAGCTCGCTTC--GGCGAGTG-TTATAGTCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAGCCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_sp._MUMH4642_ex_Hydrangea_petiolaris TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGG-----------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-AC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGCAGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCATCCTGG-GCTTTTGTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGTTGGCTGGATAAAGGCCGTAGGAACGTAGCTTCTCTC--GGGGAGTA-TTATAGCCTACGGTGCCATGCAGCCCAGCTGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAGCCCCGTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAGGAGCATAGC Erysiphe_sp._MUMH4650_ex_Liquidambar_styraciflua ------------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCC-TTAGCCGGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGC-CGAGG--CCTACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTTGGGCACT-GCTGATCAGCCGGA-GTTCT---CTCCGATGCACTCGACAGCGCACAGGCCAGCATCGGTTTGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTTCC--GGGGAGTG-TTATAGCCTATGGTGCCATGCAGCCCATCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTC---GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_sp._MUMH510_ex_Alnus_firma TTGATCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTCGCAGACTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGAC-CCTGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGTTGATCATCCATGAGTTTT--GCTCTGGTGCACTCGGCAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGACACGTAGCTCGCTTC--GGGGAGTG-TTATAGTCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAGCCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-A------------------ Erysiphe_sp._MUMH514_ex_Hydrangea_paniculata TTGACCTCGAATCAGGTAGGAAAACCCGCTGAA--------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGTTCAAATTTGAAATCTGGTTCCT-TC-----GGAGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGC-CGTGG--CCTACGCCTGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GCTGATCATCCAGA-GGTTT---CTCTGGTGCACTCGACAACGCACAGGCCAGCATCGGTTCGGATGGTTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAACCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAAGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAGAGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATACACGGAATGAAAGTGAACGTTGGTAAGAGCCCCGTT--GGGGTGCATCATCGACCGATCCTGATTTCTTCGGATGG-ATTTGAGTAAGAACATAGC Erysiphe_sp._MUMH5146_ex_Sida_rhombifolia TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCCCTG-TA--GAAGGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGGGA-CCCTGTGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGTT-ACCGATCAACCGGA-GTTCT---CTCTAGTGTACTCGGTAGTGTACAGGCCAGCATTGGTTCGGGTGGCTGGAGAAAGGTCGCAGGAACGTAGCTCCTTTC--GGGGAGTG-TTATAGCCTGCGGCGTAATGCAGCCTAGCCGGATCAAGGACCGCGCCTCTGTGGGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAAACCCATACGCGGAATGAAAGTGAACGGAGGTGAGA-GCCCTTT--GGGGTGCATCATCGACCGA--------------------------------------- Erysiphe_sp._MUMH530_ex_Vitis_vinifera TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTG-GGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCTGTAGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG--CTTGCGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCGGATCACCTCGG-GTTTT---CTCGAGGGCACTCGGTAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCCGTTGGAACGTAGCTCCCCTC--GGGGAGTG-TTATAGCCAACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAAACCCACACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTCT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_sp._MUMHs141_ex_Vitis_coignetiae TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTG-GGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCTGTAGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG--CTTGCGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTGAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCGGATCACCTCGG-GTTTT----TCGAGGGCACTCGGTAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCCGTTGGAACGTAGCTCCCCTC--GGGGAGTG-TTATAGCCAACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAAACCCACACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTCT--GGGGCGCATCATCGACCGATCCT----------------------------------- Erysiphe_sp._MUMHs2_ex_Alnus_maximowiczii -----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTCGCAGACTTGGCCTAAGTTCCTTGGAACAGGACGTCATAAAAGGTGAGAATCCCGTATGTGGC-CGAGAC-CCTGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGTTGATCATCCATGAGTTTT--GCTCTGGTGCACTCGGCAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAAAAACGTACCTCGCTTC--GGGGAGTG-TTATAGTCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAGCCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAATA---------- Erysiphe_sp._MUMHs4_ex_Alnus_serrulatoides TTGATCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTCGCAGACTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGAC-CCTGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGTTGATCATCCATGAGTTTT--GCTCTGGTGCACTCGGCAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGAAACGTAGCTCGCTTC--GGGGAGTG-TTATAGTCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCCTACGCGGAATGAAAGTGAACGTAGGTGAGAGCCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAATAAGAACATAGC Erysiphe_sp._MUMHs79_ex_Salix_bakko TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGCAGCTTTGGGTTGTGGGACCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCTGCACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACACC-ACTGATCCGCGAGG-GTTCT---CTCTCGGGCACTCGGTGGGGTACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCCGAAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTTCGGTGCAATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTA-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTC--GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAACATAC- Erysiphe_sp._MUMHs81_ex_Fraxinus_lanuginosa -----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCGCCG-TTAC---GGCGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCAAAGAGGGTGAGAATCCCGTCTGCGGC-CGTGGCTCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACGCT-ACTGATCATCTAGG-GTTTT--TCCCTGGTGCACTCGGCAGTGGACAGGCCAGCATCGGTTCGAGTGGCTGGAGAAAGGTTGTAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTACGGCGCAATGCAGCCCAGTCGGACCGAGGAACGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCTTTC---GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_sp._MUMHs96_ex_Fraxinus_mandshurica TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCGTCG-TTAT---GGCGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGC-CGTGGCTCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACGCT-ACTGATCATCTAGG-GTTTT---CCCTGGTGCACTCGGCAGCGGACAGGCCAGCATCGGTTCGAGTGGCTGGAGAAAGGTTGTAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTACGGCGCAATGCAGCCCAGTCGGACCGAGGAACGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACTTTC----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAA--------- Erysiphe_sp._TPU1832_ex_Morus_australis TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGACCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCTGATCATCCAGA-GTTCT---CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTCTCGGGGGAGTG-TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGCAGGTG----------------------------------------------------------------------- Erysiphe_syringae_Tpu1549_ex_Syringa_vulgaris TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-AC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCCCGA-GTTCT---CTCGGGTGCACTCGACCGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTCC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-AT----------------- Erysiphe_thaxteri_Mumh2465_ex_Berberis_darwinii TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-CT-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCTTGA-GTTCT--TCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGATAAAGGCCGTAGGAATGTGGCTCCCTTC--GGGGAGTG-TTATAGCCTATGGTGCCCTGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Erysiphe_vanbruntiana_Mumh171_ex_Salix_futura TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGCAGCTTTGGGTTGTGGGACCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCTGCACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACACC-ACTGATCCGCGAGG-GTTCT---CTCTCGGGCACTCGGTGGGGTACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCCGAAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTTCGGTGCAATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTA-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTC---GGGGTGCATCATCGACCGATCCTGATGTCTTCGGAT---------------------- Erysiphe_vanbruntiana_Mumh173_ex_Fraxinus_lanuginosa TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTATCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCGCCG-TTAC---GGCGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCAAAGAGGGTGAGAATCCCGTCTGCGGC-CGTGGCTCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACGCT-ACTGATCATCTAGG-GTTTT--TCCCTGGTGCACTCGGCAGTGGACAGGCCAGCATCGGTTCGAGTGGCTGGAGAAAGGTTGTAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCCTACGGCGCAATGCAGCCCAGTCGGACCGAGGAACGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCTTTC---GGGGTGCATCGTCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGT----------- Leveillula_taurica_MUMH48_ex_Alnus_japonica TTGATCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAA--G-GGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTCGCAGACTTGGCCTAAGTTCCTTGGAACAGGACTTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGAC-CCTGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGTTGATCATCCATGAGTTTT--GCTCTGGTGCACTCGGCAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGAAACGTAGCTCGCTTC--GGGGAGTG-TTATAGTCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAGCCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Oidium_mangiferae_VPRI20379_ex_Mangifera_indica TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTT-CC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GTCGATCACCCCGA-GTTCT---CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Pseudoidium_anacardii_Mumh2418_ex_Hevea_brasiliensis TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTT-CC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCTTGA-GTTTT---CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGA--------------------------------- Pseudoidium_anacardii_Mumh3165_ex_Bixa_orellana TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTT-CC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCTTGA-GTTTT---CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Pseudoidium_anacardii_Mumh3230_ex_Bixa_orellana TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTT-GC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCTTGA-GTTTT---CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Pseudoidium_anacardii_Mumh781_ex_Anacardium_occidentale TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTT-CC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGG--CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCTTGA-GTTTT---CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTC--GGGGAGTG-TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Pseudoidium_neolycopersici_Mumh66_ex_Lycopersicon_esculentum TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CATGG--CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCT-GCCGATCACCCCGA-GTTCT---CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC--GGGGAGTG-TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Pseudoidium_sp._Mumh1462_ex_Glycine_max ------------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGCAGATTCAGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGC-CGAGG--TTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACT-GTTGATCATCCAGG-GTTTT---CTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC--GGGGAGTG-TTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTG-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT--GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGG-ATTTGAGTAAGAGCATAGC Pseudoidium_sp._Mumh578_ex_Rhus_trichocarpa TTGATCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCG-GGATTACCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCG-TC-----GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTCGCAGACTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGC-CGAGAC-CCTGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGGTTGATCATCCATGAGTTTT--GCTCTGGTGCACTCGGCAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGAAACGTAGCTCGCTTC--GGGGAGTG-TTATAGTCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC----GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCCATGCTATTGTTTGGGTGTT-AAACCCATACCCGGAATGAAAGTGAACGTAGGTGAGAGCCCCTTT--GGGGCGCATCATCGACCG---------------------------------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M35663] TITLE 'Erysiphe ITS + 28S rDNA Fig 1'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1366; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_astragali_Mumh2549_ex_Astragalus_sp. CAGAGTGCGAGGCTCAGTCGTAGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTCGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCGCAAGG-ACATGCGTCGGCC-GCCCACCGG---TT--TCGACTGGAGCGCGCCCGCCAAAGACCCAATCAAAA-CTCATGTTGTTTATGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-GCTCCACTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGCAGGAACGTAGCTCCTTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTTGGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_astragali_Mumh2585_ex_Astragalus_glycyphyllus CAGAGTGCGAGGCTCAGTCGTAGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCGCAAGG-ACATGCGTCGGCC-GCCCACCGG---TT--TCGACTGGAGCGCGCCCGCCAAAGACCCAATCAAAA-CTCATGTTGTTTATGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-GCTCCACTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTTGGGGGCGCATCATCGACCGATCCTGATGTCTTCGGA---------------------- Erysiphe_astragali_Mumh2590_ex_Astragalus_glycyphyllus CAGAGTGCGAGGCTCAGTCGTAGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCGCAAGG-ACATGCGTCGGCC-GCCCACCGG---TT--TCGACTGGAGCGCGCCCGCCAAAGACCCAATCAAAA-CTCATGTTGTTTATGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-GCTCCACTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTTGGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_baeumleri_Mumh2584_ex_Vicia_cassubica --------------------------------------------ACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTTGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CCCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTGACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAACATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGA---------------------- Erysiphe_baptisiae_Mumh1433_ex_Baptisia_australis ----------------------------------TGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACATGCCTCGGCC-GCCCACCGG---TT-TCGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTCTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCCCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGA---------------------- Erysiphe_berberidicola_Mumh575_ex_Mahonia_fortunei CAGAGTGCGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATATCTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCACATGG-ACATGCGCCGGCC-GCCCACCGGTGGTT-ATCCACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTACCTTTGT--GTGGCTGCGGTGTTGGGGCGCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAATCTCCCTATTGCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_cruciferarum_Mumh1430_ex_Cleome_sp. CAGAGTGCGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCGCATGGGACATGCGTCGGCC-GCCCACCGG---TTTCACGACTGGAGCGCGTCCGCCAAAGACCCAACCAAAAACTCATGTTGTCTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCCCTTTA-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTATGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGTTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_euonymi_Mumh2583_ex_Euonymus_europaea -------------------------------------------GACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_guarinonii_Mumh1425_ex_Laburnum_alpinum CAGAGTGCGAGGCTCAGTCGTGGCGCCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACATGCCTCGGCC-GCCCACCGG---TT-TCGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTCTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCCCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGT----------------------------------------------------------------------- Erysiphe_hyperici_Bcru04186_ex_Hypericum_perforatum --------------------------------------------ACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGG-----------------------------------------------------------------------------------------------------------------ATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_hyperici_Mumh2547_ex_Hypericum_perforatum ----GTGCGAGGCTCAGTCGCGGCGTCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_multappendicis_AB104520_ex_Berberis_vulgaris CAGAGTGCGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTATATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCACATGG-ACATGCGTCGGCC-GCCCACCGGTGGTTTATCCACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTACCTTTGT--GTGGCTGCGGTGTTGGGGCGCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCTCCCTATTGCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCATCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT-------------------------- Erysiphe_myzodendri_Bcru04187_ex_Misodendrum_linearifolium CAGAGTGCGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTCCGCATGG-ACATGCGTCGGCC-GCCCACCGG---TTTTTCAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCAACGCGGCGGCCCTTAAAGGCAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-GCTCCAGTCACATGGATCACAGGTGGACCTCGAATCTGGTATGAATATCCGCTGAACTTAAGCATATATATAAGCGGAGGA------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCT--------------------------- Erysiphe_oehrensii_Mumh1866_ex_Maytenus_boaria CAGAGTGCGAGGCTCAGTCGTAGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGCCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTCCGCATGG-ACATCCGTCGGCC-GCCCACCGG---TT-TTCAACTGGAGCGCGCCCGCCAAAGGCCCAATCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCGTTTGT--GTCGCTGCGGTGTTGGGGCTCGTCGCGATGCGGTGGCCCCTAAAAACAGTGGCGGTCCCGGCGTCGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAAACAACCCTCTTATGCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTA----------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTTATGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAACATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGATGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_oehrensii_Mumh2492_ex_Maytenus_boaria CAGAGTGCGAGGCTCAGTCGTAGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGCCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTCCGCATGG-ACATCCGTCGGCC-GCCCACCGG---TT-TTCAACTGGAGCGCGCCCGCCAAAGGCCCAATCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCGTTTGT--GTCGCTGCGGTGTTGGGGCTCGTCGCGATGCGGTGGCCCCTAAAAACAGTGGCGGTCCCGGCGTCGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAAACAACCCTCTTATGCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTTATGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAACATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGATGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_palczewskii_Mumh1423_ex_Caragana_arborescens CAGAGTGCGAGGCTCAGTCGTAGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACATGCGTCGGCC-GCCCACCGG---TT-TTTCACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTAGGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGT----------------------------------------------------------------------- Erysiphe_palczewskii_Mumh2581_ex_Caragana_arborescens CAGAGTGCGAGGCTCAGTCGTAGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACATGCGTCGGCC-GCCCACCGG---TT-TTTCACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTAGGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGA--------------------------------------------------------------------- Erysiphe_palczewskii_Mumhs111_ex_Robinia_pseudoacacia CAGAGTGCGAGGCTCAGTCGTAGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACATGCGTCGGCC-GCCCACCGG---TT-TTTCACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-GCTCCAGTCACATGGATCACAGG---------------------------------------------------------------------------------------CGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTAGGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_robiniicola_Mumh67_ex_Robinia_pseudoacacia CAGAGTGCGAGGCTCAGTCGCGGCGTCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGCCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Erysiphe_russellii_Mumh105_ex_Oxalis_corniculata CAGAGTGCGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCTACATGG-ACATGCGTCGGCC-GCCCACCGG---TT-TTCAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTATATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGGCGAC-GGTGGCTTGCCAAAACAACCCTTTTCT-GCTCCAGTCATATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTATGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAG-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCC----------------------------------- Erysiphe_sp._Mumh201_ex_Berberis_amurensis CAGAGTGCGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATATCTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCACATGG-ACATGCGCCGGCC-GCCCACCGGTGGTT-ATCCACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTACCTTTGT--GTGGCTGCGGTGTTGGGGCGCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAATCTCCCTATTGCTCCAGTCACATGGATCACAGG----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_sp._Mumh289_ex_Raphanus_sativus CAGAGTGCGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCGCATGGGACATGCGTCGGCC-GCCCACCGG---TTTCACGACTGGAGCGCGTCCGCCAAAGACCCAACCAAAAACTCATGTTGTCTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCCCTTTA-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTATGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGTTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_trifoliorum_Mumh1046_ex_Trifolium_pratense ??GAGTGC?AGGCTC?GTCGCGGCGTCGGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTCCGCAAGG-ACGTGCGTCGGCC-GCCCACCGG---TT-TAGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGG-----------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_trifoliorum_Mumh701_ex_Trifolium_arvense CAGAGTGCGAGGCTCAGTCGCGGCGTCGGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACGTGCGTCGGCC-GCCCACCGG---TT-TAGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGG-----------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_trifoliorum_Mumh833_ex_Trifolium_dubium CAGAGTGCGAGGCTCAGTCGCGGCGTCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TC-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTCTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGG-----------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Pseudoidium_sp._Bcru03842_Pseudoidium_sp._Bcru03842_ex_Lathyrus_magellanicus ------------------------------------------------TCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA----------------------------------------------------------TGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGG----------------------- Pseudoidium_sp._Dna565_ex_Eustoma_russellianum CAGAGTGCGAGGCTCAGTCGCGGCGTCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTAGTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Pseudoidium_sp._Mumh1162_ex_Glycine_soja CAGAGTGCGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGCTGTTGCAGTCCGCATGG-ACATGCGTCGGCCGCCCCCCCGG---TG-TTCCACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTATCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCATTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTTCCGACGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-GCTCCAGTCACATGGATCACAGG-----------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAACCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Pseudoidium_sp._Mumh131_ex_Melilotus_officinalis CAGAGTGCGAGGCTCAGTCGCGGCGTCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTCCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TAGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCCCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Pseudoidium_sp._Mumh1462_ex_Glycine_max CAGAGTGCGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGCTGTTGCAGTCCGCATGG-ACATGCGTCGGCCGCCCCCCCGG---TG-TTCCACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTATCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCATTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTTCCGACGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-GCTCCAGTCACATGGATCACAGG------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAACCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Pseudoidium_sp._Mumh1583_ex_Millettia_japonica CAGAGTGCGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCCTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCGCATGG-ACATGCGTCGGCC-GCCCACCGG---TT-TTTCACTGGAGCGCGCCCGCCAAAGACCCCACCAAAAACTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGGC-GGTGGCTTGCCAGGACAACCCCCTTTT-GCTCCAGTCACATGGATCACAGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudoidium_sp._Mumh1623_ex_Aeschynomene_indica CAGAGTGCGAGGCTCAGTCGCGGCGTCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGG---------------------------------------------------------------------------------------CGGCGAGTGAAGCGGTACCAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGC Pseudoidium_sp._Mumh1936_ex_Maytenus_sp. CAGAGTGCGAGGCTCAGTCGTAGCGT-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGCCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTCCGCATGG-ACATCCGTCGGCC-GCCCACCGG---TT-TTCAACTGGAGCGCGCCCGCCAAAGGCCCAATCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCGTTTGT--GTCGCTGCGGTGTTGGGGCTCGTCGCGATGCGGTGGCCCCTAAAAACAGTGGCGGTCCCGGCGTCGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAAACAACCCTCTTATGCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA-------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTTATGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAACATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGATGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Pseudoidium_sp._Mumh240_ex_Vicia_hirsuta CAGAGTGCGAGGCTCAGTCGCGGCGTCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TC-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTCTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGG-----------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGA-------------------------------- Pseudoidium_sp._Mumh2438_ex_Vicia_nigricans CAGAGTGCGAGGCTCAGTCGCGGCGTCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Pseudoidium_sp._Mumh2572_ex_Oenothera_amoena CAGAGTGCGAGGCTCAGTCGTGGCATCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCGCTGTCGCTGTCCGCATGG-ACATGCGTTGGCC-GCCCACCGG---TT-TTCAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGATAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACCGGTGGCTTGCCAGAACAACCCTCATTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAGCCCC-TTT-GGGGCGCATCATCGACCGATCCTGA-GTCTTCG------------------------ Pseudoidium_sp._Mumh2587_ex_Coronilla_varia CAGAGTGCGAGGCTCACTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTATATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCAGTTCGCAAGG-ACTTGCGTCGGCC-GCCCACCGG---TG-TCCAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGCTGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-GCTCCAGTCGCATGGATCACAGGCTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCACGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCTGTAGGAACGTAGCTCCCTCCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAC- Pseudoidium_sp._Mumh2593_ex_Xanthoxalis_sp. CAGAGTGCGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCTACATGG-ACATGCGTCGGCC-GCCCACCGG---TT-TTCAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTATATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGGCGAC-GGTGGCTTGCCAAAACAACCCTTTTCT-GCTCCAGTCATATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTATGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGG----------------------- Pseudoidium_sp._Mumh5705_ex_Gliricidia_sepium ------------------CGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCCTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCGCATGG-ACATGCGTCGGCC-GCCCACCGG---TT-TTTCACTGGAGCGCGCCCGCCAAAGACCCCACCAAAAACTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGGC-GGTGGCTTGCCAGGACAACCCCCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCACGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGTTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAAACCCATACGCGAAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT--- Pseudoidium_sp._Mumh5712_ex_Gliricidia_sepium --------------CAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCCTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCGCATGG-ACATGCGTCGGCC-GCCCACCGG---TT-TTTCACTGGAGCGCGCCCGCCAAAGACCCCACCAAAAACTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGGC-GGTGGCTTGCCAGGACAACCCCCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCACGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGTTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAAACCCATACGCGAAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCAT--- Pseudoidium_sp._Mumh598_ex_Millettia_japonica CAGAGTGCGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCCTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCGCATGG-ACATGCGTCGGCC-GCCCACCGG---TT-TTTCACTGGAGCGCGCCCGCCAAAGACCCCACCAAAAACTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGGC-GGTGGCTTGCCAGGACAACCCCCTTTT-GCTCCAGTCACATGGATCACAGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudoidium_sp._Mumh837_ex_Vicia_faba CAGAGTGCGAGGCTCAGTCGCGGCGTCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTAGTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGG---------------------------------------------------------------------------------------------------CGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Pseudoidium_sp._Mumh85_ex_Mirabilis_jalapa CAGAGTGCGAGGCTCAGTCGCGGCGTCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTAGTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT----G----------------------------------------------------- Pseudoidium_sp._Mumhs133_ex_Albizia_julibrissin CAGAGTGCGAGGCTCAGTCGCGGCGTCGGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGG---------------------------------------------------------------------------------------------------------------------GAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCAAAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGC Pseudoidium_sp._Pseudoidium_sp._Mumh2442_ex_Lathyrus_magellanicus CAGAGTGCGAGGCTCAGTCGCGGCGTCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TT-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTTTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAG- Pseudoidium_sp._YNMH12360_ex_Vicia_amoena CAGAGTGCGAGGCTCAGTCGCGGCGTCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGTTCGCAAGG-ACCTGCGTCGGCC-GCCCACCGG---TC-TTGAACTGGAGCGCGCCCGCCAAAGACCCAACCAAAA-CTCATGTTGTCTGTGTCGTCTCAGCTTTATTATGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCGTCTTTT-GCTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGT----------------------------------------------------------------------- ; END; BEGIN TREES; TITLE Erysiphe_28S_rDNA_Fig_2; LINK TAXA = Taxa1; TRANSLATE 1 Erysiphe_sp._DNA8_ex_Lagerstroemia_indica, 2 Erysiphe_russellii_Mumh105_ex_Oxalis_corniculata, 3 Erysiphe_ligustri_Mumh14_ex_Ligustrum_obtusifolium, 4 Erysiphe_cruciferarum_Mumh1430_ex_Cleome_sp., 5 Pseudoidium_sp._Mumh1462_ex_Glycine_max, 6 Erysiphe_vanbruntiana_Mumh171_ex_Salix_futura, 7 Erysiphe_vanbruntiana_Mumh173_ex_Fraxinus_lanuginosa, 8 Erysiphe_corylacearum_Mumh199_ex_Corylus_sieboldiana, 9 Erysiphe_blasti_Mumh20_ex_Celtis_sinensis, 10 Erysiphe_blasti_Mumh205_ex_Celastrus_orbiculatus, 11 Erysiphe_blasti_Mumh207_ex_Carpinus_cordata, 12 Erysiphe_blasti_Mumh211_ex_Fraxinus_longicuspis, 13 Erysiphe_epigena_Mumh2193_ex_Quercus_variabilis, 14 Erysiphe_blasti_Mumh235_ex_Firmiana_simplex, 15 Pseudoidium_anacardii_Mumh2418_ex_Hevea_brasiliensis, 16 Erysiphe_blasti_Mumh243_ex_Carpinus_japonica, 17 Erysiphe_thaxteri_Mumh2465_ex_Berberis_darwinii, 18 Erysiphe_berchemiae_Mumh252_ex_Berchemia_racemosa, 19 Erysiphe_hyperici_Mumh2547_ex_Hypericum_perforatum, 20 Erysiphe_limonii_Mumh2568_ex_Limonium_platyphyllum, 21 Erysiphe_knautiae_Mumh2571_ex_Knautia_arvensis, 22 Erysiphe_sedi_Mumh2575_ex_Sedum_aizoon, 23 Erysiphe_astragali_Mumh2585_ex_Astragalus_glycyphyllus, 24 Erysiphe_erlangshanensis_Mumh2586_ex_Lonicera_maackii, 25 Erysiphe_blasti_Mumh2589_ex_Carpinus_betulus, 26 Erysiphe_nomurae_Mumh275_ex_Symplocos_chinensis, 27 Erysiphe_juglandis_Mumh278_ex_Juglans_mandshurica, 28 Erysiphe_menispermi_var._dahurica_Mumh282_ex_Menispermum_dauricum, 29 Erysiphe_aquilegiae_Mumh287_ex_Ranunculus_japonicus, 30 Erysiphe_aquilegiae_Mumh293_ex_Clematis_stans, 31 Erysiphe_blasti_Mumh2966_ex_Carpinus_cordata, 32 Pseudoidium_anacardii_Mumh3165_ex_Bixa_orellana, 33 Pseudoidium_anacardii_Mumh3230_ex_Bixa_orellana, 34 'Erysiphe carpini-cordatae MUMH3408 ex Carpinus cordata', 35 Erysiphe_carpinicola_MUMH3503_ex_Carpinus_laxiflora, 36 Erysiphe_carpinicola_MUMH3620_ex_Carpinus_tschonoskii, 37 Erysiphe_fimbriata_MUMH3694_ex_Carpinus_laxiflora, 38 Erysiphe_sp._MUMH3789_ex_Liquidambar_formosana, 39 Erysiphe_adunca_var._adunca_MUMH39_ex_Salix_vulpina, 40 Erysiphe_betae_Mumh395_ex_Ambrina_ambrosioides, 41 Erysiphe_glycines_Mumh396_ex_Desmodium_laxum, 42 Erysiphe_sp._MUMH4640_ex_Betula_grossa, 43 Erysiphe_sp._MUMH4642_ex_Hydrangea_petiolaris, 44 Erysiphe_sp._MUMH4650_ex_Liquidambar_styraciflua, 45 Leveillula_taurica_MUMH48_ex_Alnus_japonica, 46 'Erysiphe carpini-laxiflorae MUMH50 ex Carpinus laxiflora', 47 Erysiphe_carpinicola_MUMH51_ex_Carpinus_japonica, 48 Erysiphe_sp._MUMH510_ex_Alnus_firma, 49 Erysiphe_sidae_MUMH5126_ex_Sida_rhombifolia, 50 Erysiphe_sp._MUMH514_ex_Hydrangea_paniculata, 51 Erysiphe_sp._MUMH5146_ex_Sida_rhombifolia, 52 Erysiphe_glycines_Mumh52_ex_Desmodium_podocarpum, 53 Erysiphe_sp._MUMH530_ex_Vitis_vinifera, 54 Erysiphe_glycines_Mumh56_ex_Amphicarpaea_edgeworthii, 55 Erysiphe_glycines_Mumh5688_ex_Sida_rhombifolia, 56 Pseudoidium_sp._Mumh578_ex_Rhus_trichocarpa, 57 Pseudoidium_neolycopersici_Mumh66_ex_Lycopersicon_esculentum, 58 Pseudoidium_anacardii_Mumh781_ex_Anacardium_occidentale, 59 Erysiphe_buhrii_Mumh787_ex_Gypsophila_paniculata, 60 Erysiphe_pulchra_Mumh90_ex_Cornus_controversa, 61 Erysiphe_sp._MUMHs141_ex_Vitis_coignetiae, 62 Erysiphe_sp._MUMHs2_ex_Alnus_maximowiczii, 63 Erysiphe_sp._MUMHs4_ex_Alnus_serrulatoides, 64 Erysiphe_sp._MUMHs79_ex_Salix_bakko, 65 Erysiphe_sp._MUMHs81_ex_Fraxinus_lanuginosa, 66 Erysiphe_huayinensis_Mumhs87_ex_Isodon_trichocarpus, 67 Erysiphe_sp._MUMHs96_ex_Fraxinus_mandshurica, 68 Erysiphe_syringae_Tpu1549_ex_Syringa_vulgaris, 69 Erysiphe_sp._TPU1832_ex_Morus_australis, 70 Oidium_mangiferae_VPRI20379_ex_Mangifera_indica; TREE Fig._2 = [&R] (1:0.0285955,((64:0.002984,(6:0.003097,39:0.001756):0.0):0.047447,((38:0.001639,44:1.0E-8):0.02835,(((50:0.05166,(37:0.014992,43:0.033729):0.006419):2.14E-4,(((5:1.0E-8,54:1.0E-8):0.006367,(41:1.0E-8,52:1.0E-8):0.00471):0.013536,((((53:1.0E-8,61:0.001578):0.040908,(12:0.005357,(67:0.003267,(7:0.001989,65:1.0E-8):0.010266):0.00605):0.03945):0.005618,(14:0.022956,((31:1.0E-8,34:1.0E-8):0.014484,(49:1.0E-8,(51:1.0E-8,55:1.0E-8):1.0E-8):0.091434):0.007971):0.004153):5.9839E-7,((10:0.03464,35:0.011865):5.98389E-7,((11:0.008303,(16:0.005163,47:0.001032):0.002845):0.029605,(46:0.009365,(42:0.008392,(45:0.001568,((48:0.001548,56:0.007909):0.001534,(62:0.00652,63:0.002279):3.39416E-8):0.002257):0.010002):0.024211):0.001507):0.0):0.017996):0.001652):0.002555):0.005084,((25:1.0E-8,36:0.001686):0.009911,((27:0.015149,(9:0.007941,69:0.014297):0.011272):0.0075,(24:0.001804,((3:0.002189,8:0.002524):0.006446,((60:0.019925,66:0.0196):0.00287,((30:1.0E-8,(21:1.0E-8,22:1.0E-8,29:1.0E-8,57:0.001543):0.004666):0.006444,((13:0.006597,68:0.008283):0.002566,((28:1.0E-8,70:1.0E-8):0.003136,(((17:0.01433,26:0.006944):0.002938,(15:1.0E-8,32:1.0E-8,33:0.001552,58:1.0E-8):0.005279):0.0,(18:0.006745,(20:0.015742,((40:0.004689,59:0.004688):0.003936,(23:0.001547,(4:0.00783,(2:0.004738,19:0.001531):0.0):0.003148):0.002274):0.001611):0.001566):0.006694):0.004087):0.002898):0.005262):0.002267):0.002876):0.003937):0.006338):0.001999):0.002147):0.005055):0.012099):0.0285955); END; BEGIN TREES; TITLE 'Erysiphe ITS + 28S rDNA Fig 1'; LINK TAXA = Taxa2; TRANSLATE 1 Erysiphe_multappendicis_AB104520_ex_Berberis_vulgaris, 2 Pseudoidium_sp._Bcru03842_Pseudoidium_sp._Bcru03842_ex_Lathyrus_magellanicus, 3 Erysiphe_hyperici_Bcru04186_ex_Hypericum_perforatum, 4 Erysiphe_myzodendri_Bcru04187_ex_Misodendrum_linearifolium, 5 Pseudoidium_sp._Dna565_ex_Eustoma_russellianum, 6 Erysiphe_trifoliorum_Mumh1046_ex_Trifolium_pratense, 7 Erysiphe_russellii_Mumh105_ex_Oxalis_corniculata, 8 Pseudoidium_sp._Mumh1162_ex_Glycine_soja, 9 Pseudoidium_sp._Mumh131_ex_Melilotus_officinalis, 10 Erysiphe_palczewskii_Mumh1423_ex_Caragana_arborescens, 11 Erysiphe_guarinonii_Mumh1425_ex_Laburnum_alpinum, 12 Erysiphe_cruciferarum_Mumh1430_ex_Cleome_sp., 13 Erysiphe_baptisiae_Mumh1433_ex_Baptisia_australis, 14 Pseudoidium_sp._Mumh1462_ex_Glycine_max, 15 Pseudoidium_sp._Mumh1583_ex_Millettia_japonica, 16 Pseudoidium_sp._Mumh1623_ex_Aeschynomene_indica, 17 Erysiphe_oehrensii_Mumh1866_ex_Maytenus_boaria, 18 Pseudoidium_sp._Mumh1936_ex_Maytenus_sp., 19 Erysiphe_sp._Mumh201_ex_Berberis_amurensis, 20 Pseudoidium_sp._Mumh240_ex_Vicia_hirsuta, 21 Pseudoidium_sp._Mumh2438_ex_Vicia_nigricans, 22 Pseudoidium_sp._Pseudoidium_sp._Mumh2442_ex_Lathyrus_magellanicus, 23 Erysiphe_oehrensii_Mumh2492_ex_Maytenus_boaria, 24 Erysiphe_hyperici_Mumh2547_ex_Hypericum_perforatum, 25 Erysiphe_astragali_Mumh2549_ex_Astragalus_sp., 26 Pseudoidium_sp._Mumh2572_ex_Oenothera_amoena, 27 Erysiphe_palczewskii_Mumh2581_ex_Caragana_arborescens, 28 Erysiphe_euonymi_Mumh2583_ex_Euonymus_europaea, 29 Erysiphe_baeumleri_Mumh2584_ex_Vicia_cassubica, 30 Erysiphe_astragali_Mumh2585_ex_Astragalus_glycyphyllus, 31 Pseudoidium_sp._Mumh2587_ex_Coronilla_varia, 32 Erysiphe_astragali_Mumh2590_ex_Astragalus_glycyphyllus, 33 Pseudoidium_sp._Mumh2593_ex_Xanthoxalis_sp., 34 Erysiphe_sp._Mumh289_ex_Raphanus_sativus, 35 Pseudoidium_sp._Mumh5705_ex_Gliricidia_sepium, 36 Pseudoidium_sp._Mumh5712_ex_Gliricidia_sepium, 37 Erysiphe_berberidicola_Mumh575_ex_Mahonia_fortunei, 38 Pseudoidium_sp._Mumh598_ex_Millettia_japonica, 39 Erysiphe_robiniicola_Mumh67_ex_Robinia_pseudoacacia, 40 Erysiphe_trifoliorum_Mumh701_ex_Trifolium_arvense, 41 Erysiphe_trifoliorum_Mumh833_ex_Trifolium_dubium, 42 Pseudoidium_sp._Mumh837_ex_Vicia_faba, 43 Pseudoidium_sp._Mumh85_ex_Mirabilis_jalapa, 44 Erysiphe_palczewskii_Mumhs111_ex_Robinia_pseudoacacia, 45 Pseudoidium_sp._Mumhs133_ex_Albizia_julibrissin, 46 Pseudoidium_sp._YNMH12360_ex_Vicia_amoena; TREE Fig._1 = [&R] ((17:1.0E-8,18:1.0E-8,23:1.0E-8):0.0098045,((12:1.0E-8,34:7.45E-4):0.006969,((15:1.0E-8,(38:1.0E-8,(35:1.0E-8,36:1.0E-8):0.0):0.0):0.008603,((25:0.001499,30:1.0E-8,32:1.0E-8):0.007783,((7:7.61E-4,33:1.0E-8):0.00789,(1:8.96E-4,(19:1.0E-8,37:1.0E-8):0.002979):0.007843):6.89E-4,(4:0.007124,(26:0.007269,(8:1.0E-8,14:1.0E-8):0.010342):0.001295,(31:0.012711,((10:1.0E-8,27:1.0E-8,44:1.0E-8):0.003765,((11:1.0E-8,13:1.0E-8):0.004647,(29:0.004011,(2:8.18E-4,28:7.84E-4,(9:0.002264,(6:7.94E-4,40:2.21362E-7):0.001609):7.51E-4,(21:1.0E-8,22:1.0E-8,39:0.001421):7.46E-4,(3:1.0E-8,24:1.0E-8,(16:1.0E-8,45:0.001628):0.001602,(5:1.0E-8,42:1.0E-8,43:1.0E-8):7.48E-4,(20:1.0E-8,41:1.0E-8,46:7.79E-4):0.001498):7.47E-4):0.0):0.003051):7.32E-4):0.0):0.002307):7.67E-4):0.001466):7.27E-4):0.0098045); END;