#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2020; 17:19 GMT TreeBASE (cc) 1994-2008 Study reference: Anil raj K., Deepna latha K., Rajan I., & Manimohan P. 2016. Rhodophana squamulosa —a new species from India. Mycoscience, 57 (2): 90-95. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17819] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=102; TAXLABELS 82Rhodophana_sp__6167_TJB_KC816983 Clitocella_fallax_KC816936 Clitocella_fallax_KC816937 Clitocella_fallax_KC816938 Clitocella_mundula_KC816948 Clitocella_mundula_KC816950 Clitocella_mundula_KC816951 Clitocella_mundula_KC816952 Clitocella_mundula_KC816953 Clitocella_mundula_KC816954 Clitocella_popinalis_KC816970 Clitocella_popinalis_KC816971 Clitocella_popinalis_KC816973 Clitocella_popinalis_KC816974 Clitocella_popinalis_KC816976 Clitopilopsis_hirneola_KC816904 Clitopilopsis_hirneola_KC816905 Clitopilopsis_hirneola_KC816977 Clitopilus_aff__hobsoni_KC816928 Clitopilus_aff__hobsonii_grp__KC816918 Clitopilus_apalus_KC816906 Clitopilus_cf__argentines_KC81690 Clitopilus_cf__prunulus_KC816927 Clitopilus_crispus_KC816910 Clitopilus_crispus_KC816911 Clitopilus_fallax_GQ289275 Clitopilus_fallax_GQ289276 Clitopilus_geminus_GQ289277 Clitopilus_hirneolus_GQ289278 Clitopilus_hobsonii_KC816912 Clitopilus_hobsonii_KC816913 Clitopilus_hobsonii_KC816914 Clitopilus_hobsonii_KC816915 Clitopilus_hobsonii_KC816916 Clitopilus_hobsonii_KC816918 Clitopilus_nitellinus__GQ289282 Clitopilus_nitellinus_GQ289281 Clitopilus_pallidogriseus_GQ289283 Clitopilus_paxilloides_KC816919 Clitopilus_peri_KC816920 Clitopilus_peri_KC816921 Clitopilus_peri_KC816922 Clitopilus_popinalis_GQ289280 Clitopilus_prunulus_KC816923 Clitopilus_prunulus_KC816924 Clitopilus_prunulus_KC816925 Clitopilus_prunulus_KC816926 Clitopilus_pseudopiperitus_GQ289284 Clitopilus_sp__8024_TJB_KC816908 Clitopilus_sp__8133_TJB_KC816909 Clitopilus_sp_7130_TJB_KC816929 Clitopilus_stanglianus_GQ289285 Clitopilus_venososulcatus_KC816930 Entoloma_albidoquadratum_GQ289223 Entoloma_crassicystidiatum_JQ993083 Entoloma_griseolazulinum_GQ289237 Entoloma_indoviolaceum_GQ289243 Entoloma_prunuloides_GQ289255 Entoloma_serrulatum_GQ289263 Entoloma_tectonicola_GQ289266 Entoloma_violaceovillosum_GQ289273 Pouzarella_pamiae_HQ876496 Rhodocybe_alutacea_KC816931 Rhodocybe_caelata_KC816932 Rhodocybe_caelata_KC816933 Rhodocybe_caelata_KC816934 Rhodocybe_caelata_KC816978 Rhodocybe_collybioides_KC816935 Rhodocybe_formosa_KC816939 Rhodocybe_fuliginea_KC816940 Rhodocybe_hondensis_KC816941 Rhodocybe_lateritia_KC816942 Rhodocybe_luteocinnamomea_KC816943 Rhodocybe_mellea_KC816944 Rhodocybe_minutispora_KC816947 Rhodocybe_pallidogrisea_KC816968 Rhodocybe_paurii_KC816969 Rhodocybe_pseudopiperita_KC816979 Rhodocybe_reticulate_KC816980 Rhodocybe_rhizogena_KC816981 Rhodocybe_roseiavellanea_KC816982 Rhodocybe_sp__DLL10032_KC816991 Rhodocybe_sp__DLL10218_KC816990 Rhodocybe_sp__DLL9846_KC816985 Rhodocybe_sp__DLL9851_KC816986 Rhodocybe_sp__DLL9952_KC816988 Rhodocybe_sp__DLL9957_KC816989 Rhodocybe_stipitata_KC816993 Rhodophana_aff__nitellina_5528_TJB_KC816962 Rhodophana_aff__nitellina_DLL10199_KC816967 Rhodophana_melleopallens_KC816945 Rhodophana_melleopallens_KC816946 Rhodophana_nitellina_KC816955 Rhodophana_nitellina_KC816957 Rhodophana_nitellina_KC816960 Rhodophana_nitellina_KC816963 Rhodophana_nitellina_KC816964 Rhodophana_nitellina_KC816965 Rhodophana_sp__434_HAMA_KC816984 Rhodophana_squamulosa Rhodophana_stangliana_KC816992 Tricholoma_aurantium_JN019705 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M37377] TITLE Rhodophana_squamulosa; LINK TAXA = Taxa1; DIMENSIONS NCHAR=571; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 82Rhodophana_sp__6167_TJB_KC816983 ----------------------------TCGTACTCTGCGCCCGTCATTGAGTTCTTGGAAGAGTGGGGTTTGGAATCCTTGGAAGAAAATGCTCATTCCACAACGCCTTGCACAAAAGTATTTGTGAACGGTGTTTGGATGGGTGTGCATCGTGATCCTGCGAACTTGGTGAAAACTATCAAGAAGTTGCGACGAAAGGACGATATCAGTCCTGAAGTTTCTGT-GTGCGGGATATCCGAGAAAAAGAGCTTCGTTT-TACACAGACGCTGGCCGTGTCTGTCGACCTCTTTTCATCGTCGAAAATCAGCAACTGGCGCTTCAGAAGAAACACATAAAATGGCT-AACGAAGGCTACAATGATGATGGAGACGATTACAAATGGGAACACCTCGTGAAGGGTGGTGTTGTTGAGCTTCTGGACGCGGAGGAGGAGGAGACTGTAATGATTTCTATGACGCCAGAGGATCTGGAGAATTCTCGATTGCAACAGAGTGGTATGAATCCGAACACGAATGAGGAAGAATT-GATCCAGCAGCGCGACTCAAAGCGGGCATTAA-TCCCACAC- Clitocella_fallax_KC816936 GGCTCTTATGGCCTGTATCTCCGTCGGCTCATACTCGGCACCGGTCATCGAATTCTTGGAGGAGTGGGGACTTGAATCCTTGGAGGAAAATGCCCACTCTTCGACCCCTTGTACGAAAGTCTTTGTCAATGGTGTTTGGATGGGCGTTCACCGTGACCCTGCGAATCTCGTCAAAACCCTTAGGAAGCTACGACGGAAGGATGACATCAGCCCTGAAGTTTCTATCGTGCGTGATATAAGAGAGAAGGAGCTCCGTCTCTACACGGATGCAGGGCGTGTCTGCCGACCACTTTTCATTGTCGAGAACCAAGAACTTATGCTAAAGAAGAAGCATGTCCGGTGGCTGAACAATGGTGCAGATGATAGCGGGGAGGAATACAAATGGGAACACCTTGTCAAAGGTGGTGTCATCGAGCTTTTGGATGCTGAGGAAGAGGAAACTGTGATGATATCGATGACCCCAGAAGATCTCGAGAATTCGAGGCTACAGCAAAGCGGTATTCATCCTGAGCAGAACGACAGTGACTTTGATCCAGCTGCCCGTCTCAAGGCTGGTATCAACTCTCATAC- Clitocella_fallax_KC816937 AGCTCTTATGGCCTGTATCTCCGTCGGCTCATACTCGGCACCAGTCATCGAATTCTTGGAGGAGTGGGGACTTGAATCCTTGGAAGAAAATGCTCACTCTTCGACCCCTTGCACGAAAGTTTTCGTCAACGGTGTTTGGATGGGCGTTCACCGTGACCCTGCAAATCTCGTCAAAACTCTTAGGAAGCTACGACGGAAGGATGACATCAGTCCCGAAGTTTCCATCGTGCGCGATATAAGAGAAAAGGAGCTTCGTCTCTACACGGATGCAGGGCGTGTCTGCCGACCACTTTTCATTGTCGAGAACCAAGAACTTATGCTAAAGAAGAAGCATGTCCGATGGCTTAACAATGGTGCAGATGATAGCGGGGAGGAATATAAATGGGAACACCTTGTCAAAGGTGGTGTTATCGAGCTTTTGGATGCTGAGGAAGAGGAAACTGTGATGATATCGATGACCCCAGAGGATCTCGAGAATTCGAGGTTACAGCAAAGCGGTATTCATCCTGAACAGAATGACAGTGACTTTGATCCAGCTGCTCGTCTCAAGGCTGGTATCAATTCTCATAC- Clitocella_fallax_KC816938 GGCTCTTATGGCCTGTATCTCCGTCGGCTCATACTCGGCACCGGTCATCGAATTCTTGGAGGAGTGGGGACTTGAATCCTTGGAGGAAAATGCCCACTCTTCGACCCCTTGTACGAAAGTCTTTGTCAATGGTGTTTGGATGGGCGTTCACCGTGACCCTGCGAATCTCGTCAAAACCCTTAGGAAGCTACGACGGAAGGATGACATCAGCCCTGAAGTTTCTATCGTGCGTGATATAAGAGAGAAGGAGCTCCGTCTCTACACGGATGCAGGGCGTGTCTGCCGACCACTTTTCATTGTCGAGAACCAAGAACTTATGCTAAAGAAGAAGCATGTCCGGTGGCTGAACAATGGTGCAGATGATAGCGGGGAGGAATACAAATGGGAACACCTTGTCAAAGGTGGTGTCATCGAGCTTTTGGATGCTGAGGAAGAGGAAACTGTGATGATATCGATGACCCCAGAAGATCTCGAGAATTCGAGGCTACAGCAAAGCGGTATTCATCCTGAGCAGAACGACAGTGACTTTGATCCAGCTGCCCGTCTCAAGGCTGGTATCAACTCTCATAC- Clitocella_mundula_KC816948 --------------------------GTTCGTATTCGGCACCGGTCATTGAATTCTTGGAGGAGTGGGGTCTTGAATCCTTGGAAGAGAATGCCCACTCTTCGACACCTTGCACGAAAGTTTTCGTCAATGGTGTTTGGATGGGCGTTCACCGTGACCCCGCGAATCTCGTCAAAACTCTCAAGAAGCTCCGACGGAAGGACGATATTAGCCCCGAAGTTTCTATCGTGCGCGATATAAGAGAGAAGGAGCTTCGTCTCTACACGGATGCAGGGCGTGTCTGCCGACCACTTTTCATTGTTGAGAACCAAGAGCTTGTGCTGAAAAAGAAGCATATCCGGTGGTTGAACAACGGTGTAGAGGATAATGGGGAGGGATACAAGTGGGAGCATCTCGTTAAAGGTGGGATTATTGAGCTCTTGGATGCCGAGGAAGAGGAAACTGTGATGATATCGATGACCCCAGAAGATCTCGAGACCTCAAGATTGCAGCAAAGTGGCATTCATCCTGAACAGAATGACACTGACTTCGATCCAGCTGCCCGTCTCAAAGCTGGTATCAATTCCCAT--- Clitocella_mundula_KC816950 AGCTCTTATGGCATGTATTTCCGTTGGTTCGTATTCGGCACCAGTCATCGAATTCTTGGAGGAGTGGGGTCTTGAATCTTTGGAAGAGAATGCCCACTCTTCGACACCTTGCACGAAAGTTTTCGTCAATGGTGTTTGGATGGGCGTTCACCGTGACCCCGCTAATCTCGTCAAAACTCTTAAGAAGCTACGACGGAAGGACGATATTAGCCCTGAAGTTTCTATCGTGCGCGACATAAGAGAGAAGGAGCTTCGTCTTTATACGGATGCGGGGCGTGTCTGCCGACCACTTTTCATTGTTGAGAACCAAGAGCTTGTTCTGAAGAAGAAGCATGTCCGGTGGTTGAACAATGGTGTGGAAGATAGCGGGGAGGAATACAAGTGGGAGCATCTTGTTAAAGGTGGTATTATTGAGCTCTTGGATGCCGAGGAAGAGGAAACCGTGATGATATCGATGACCCCAGAGGATCTCGAGACTTCAAGATTGCAGCAAAGTGGCATTCACCCCGAGCAGAATGACACTGACTTTGATCCAGCTGCTCGTCTGAAGGCTGGTATCAATTCCCATAC- Clitocella_mundula_KC816951 AGCTCTTATGGCATGTATTTCCGTTGGCTCGTATTCGGCACCAGTCATCGAATTCTTGGAGGAGTGGGGTCTTGAATCCTTGGAAGAGAATGCCCACTCTTCGACACCTTGCACGAAAGTTTTCGTCAATGGTGTTTGGATGGGTGTTCACCGTGACCCCGCTAATCTCGTCAAAACTCTTAAGAAGCTACGACGGAAGGATGATATCAGCCCTGAAGTTTCTATCGTGCGCGACATAAGAGAGAAGGAGCTTCGTCTCTATACGGATGCGGGGCGTGTCTGCCGACCGCTTTTCATTGTCGAGAACCAAGAGCTTGTTCTGAAGAAGAAGCATGTCCGGTGGTTAAACAATGGCGTGGAAGATAGCGGGGAGGAATACAAGTGGGAGCATCTTGTTAAAGGTGGTATTATTGAGCTCTTGGATGCCGAGGAAGAGGAAACCGTGATGATATCGATGACCCCAGAGGATCTCGAGACTTCAAGATTGCAGCAAAGTGGCATTCATCCCGAGCAGAATGACACTGACTTTGATCCAGCTGCTCGTCTAAAGGCTGGTATCAATTCCCATAC- Clitocella_mundula_KC816952 AGCTCTTATGGCATGTATTTCCGTTGGCTCGTATTCGGCACCAGTCATCGAATTCTTGGAGGAGTGGGGTCTTGAATCCTTGGAAGAGAA-GCCCACTCTTCGACACCTTGCACGAAAGTTTTCGTCAATGGTGTTTGGATGGG-GTTCA-CGTGACCCCGCTAATCTCGTCAAAACTCTTAAGAAGCTACGACGGAAGGA-GATATCAGCCCTGAAGTTTCTATCGTGCGCGACATAAGAGAGAAGGAGCTTCGTCTCTATACGGATGCGGGGCGTGTCTGCCGACCGCTTTTCATTGT-GAGAACCAAGAGCTTGTTCTGAAGAAGAAGCATGTCCGGTGGTT-AAC-ATGGCGTGGAAGATAGCGGGGAGGAATACAA-TGGGAGCATCTTGTTAAAGGTGGTATTATTGAGCTCTTGGATGCCGAGGAAGAGGAAACCGTGATGATATCGATGAC-CCAGAGGATCTCGAGACTTCAAGATTGCAGCAAAGTGGCATTCATCCCGAGCAGAATGACACTGACTTTGATCCAGCTGCTCGTCTGAAGGCTGGTATCAATTCCCATAC- Clitocella_mundula_KC816953 AGC-CTTATGGCCTGTATCTCCGTTGGCTCATACTCGGCACCAGTCATTGAGTTCTTGGAGGAGTGGGGGCTTGAATCCTTGGAGGAAAATGC-CACTCTTCGACACCTTGCACGAAAGTTTTCGTTAATGGTGTTTGGATGGGTGTTCACCGTGACCCTGCGAATCTCGTCAAAACTCTTAAGAAGCTACGACGGAAGGACGACATCAGCCCTGAAGTTTCTATCGTGCGCGATATAAGGGAGAAGGAACTTCGTCTCTACACGGATGCGGGGCGTGTCTGCCGACCACTTTTCATTGTCGAGAACCAAGA-CTTATACTGAAGAAGAAGCATGTCCGGTGGTTGAA-AATGGTGTAGATGACAGCGGGGAGGAGTATAAATGGGAGCACCTTGTCAAAGGTGGGGTTGTTGAGCTTTTGGATGCTGAGGAAGAGGAAACTGTGATGATATCAATGACCCCAGAAGATCTCGAGACTTCGAG-TTACAGCAAAGCGGTATTCATCCTGAGCAGAACGACAGTGACTTTGATCCAGCTGCTCGTCTCAAGGCTGGTATCAATTCTCACAC- Clitocella_mundula_KC816954 GGCTCTTATGGCATGTATCTCTGTTGGTTCGTATTCGGCACCGGTCATTGAATTCTTGGAGGAGTGGGGTCTTGAATCCTTGGAAGAGAATGCCCACTCTTCGACACCTTGTACGAAAGTTTTCGTCAATGGTGTTTGGATGGGCGTTCACCGTGACCCCGCGAATCTCGTCAAAACTCTTAAGAAGCTCCGACGGAAGGACGATATTAGCCCCGAAGTTTCTATCGTGCGCGATATAAGAGAGAAGGAGCTTCGTCTCTACACGGATGCGGGGCGTGTCTGCCGACCACTTTTCATTGTTGAGAACCAAGAGCTTGTGCTGAAAAAGAAGCATATCCGGTGGTTGAACAACGGTGTAGAGGATAGTGGGGAGGAATATAAATGGGAGCATCTCGTTAAAGGTGGGATTATTGAGCTCTTGGATGCCGAGGAAGAGGAAACTGTGATGATATCGATGACCCCAGAAGATCTCGAGACCTCAAGATTGCAGCAAAGTGGCATTCATCCTGAGCAGAATGACACTGACTTTGATCCAGCTGCTCGTCTCAAAGCTGGCATCAATTCTCATAC- Clitocella_popinalis_KC816970 GGCTCTTATGGCATGTATCTCTGTCGGTTCGTATTCGGCACCGGTCATTGAATTCTTGGAGGAGTGGGGTCTTGAATCCTTGGAAGAGAATGCCCACTCTTCGACACCTTGCACGAAAGTTTTCGTCAATGGTGTTTGGATGGGCGTTCACCGTGACCCCGCGAATCTCGT-AAAACTCTCAAGAAGCTCCGACGGAAGGACGATATTAGCCCCGAAGTTTCTATCGTGCGCGATATAAGAGAGAAGGAGCTTCGTCTCTACACGGATGCGGGGCGTGTCTGCCGACCACTTTTCATTGTTGAGAACCAAGAGCTTGTGCTGAAAAAGAAGCATATCCGGTGGTTGAACAACGGTGTAGAGGATAATGGGGAGGGATACAAGTGGGAGCATCTCGTTAAAGGTGGGATTATTGAGCTCTTGGATGCCGAGGAAGAGGAAACTGTGATGATATCGATGACCCCAGAAGATCTCGAGACCTCAAGATTGCAGCAAAGTGGCATTCATCCTGAGCAGAATGACACTGACTTCGATCCAGCTGCCCGTCTCAAAGCTGGTATCAATTCCCATAC- Clitocella_popinalis_KC816971 GGCTCTTATGGCATGTATCTCTGTTGGTTCGTATTCGGCACCGGTCATTGAATTCTTGGAGGAGTGGGGTCTTGAATCCTTGGAAGAGAATGCCCACTCTTCGACACCTTGCACGAAAGTTTTCGTCAATGGTGTTTGGATGGGCGTTCACCGTGACCCCGCGAATCTCGTCAAAACTCTCAAGAAGCTCCGACGGAAGGACGATATTAGCCCCGAAGTTTCTATCGTGCGCGA-ATAAGAGAGAAGGAGCTTCGTCTCTACACGGATGCGGGGCGTGTCTGCCGACCACTTTTCATTGTTGAGAACCAAGAGCTTGT-CTGAAAAAGAAGCATATCCGGTGGTTGAACAACGGTGTAGAGGATAATGGGGAGGGATACAAGTGGGAGCATCTCGTTAAAGGTGG-ATTATTGAGCTCTTGGATGCCGAGGAAGAGGAAACTGTGATGATATCGATGACCCCAGAAGATCTCGAGAC-TCAAGATTGCAGCAAAGTGGCATTCATCCTGAGCAGAATG----------------------------------------------------- Clitocella_popinalis_KC816973 ---------------------------------------------------------------------TCTTGAATCCTTGGAAGAGAATGCCCACTCTTCGACACCTTG-ACGAAAGTCTTCGTCAATGG-GTTTGGATGGGCGTTCACCG-GACCCCGCTAA-CTCGTCAAAACTCT-AAGAAGCTACGACGGAAGGACGATATTAGCCCTGAAGTTTCTATCGTGCGCGACATAAGAGAGAAGGAGCTTCGTCTCTATACGGATGC-GGGCGTGTCTGCCGACC-CTTTTCATTGTTGAGAACCAAGAGCTTGTTCTGAAGAAGAAGCATGTCCGGTGGTTGAA-AATGGTGTGGAAGATAGCGGGGAGGAATACAA-TGGGAGCATCTTGTTAAAGGTGGTATTATTGAGCTCTTGGATGC-GAGGAAGAGGAAACCGTGATGATATCGATGACCCCAGAGGATCTCGAGACTTCAAGATTGCAGCAAAGTGGCATTCATCCCGAGCAGAATGACACTGA-TTTGATCCAGCTGCTCGTCTGAAGGCTGGTATCAATTC-CATAC- Clitocella_popinalis_KC816974 GGCTCTTATGGCATGTATCTCTGT-GGTTCGTATTCGGCACCGGTCATTGAATTCTTGGAGGAGTGGGGTCTTGAATCCTTGGAAGAGAATGCCCACTCTTCGACACCTTGCACGAAAGTTTTCGTCAATGGTGTTTGGATGGGCGTTCACCGTGACCCCGCGAATCTCGTCAAAACTCTCAAGAAGCTCCGACGGAAGGACGATATTAGCCCCGAAGTTTCTATCGTGCGCGA-ATAAGAGAGAAGGAGCTTCGTCTCTACACGGATGCGGGGCGTGTCTGCCGACCACTTTTCATTGTTGAGAACCAAGAGCTTGT-CTGAAAAAGAAGCATATCCGGTGGTTGAACAACGGTGTAGAGGATAATGGGGAGGGATACAAGTGGGAGCATCTCGTTAAAGGTGG-ATTATTGAGCTCTTGGATGCCGAGGAAGAGGAAACTGTGATGATATCGATGACCCCAGAAGATCTCGAGACCTCAAGATTGCAGCAAAGTGGCATTCATCCTGAGCAGAATGACACTGACTTCGATCCAGCTGCCCGTCTCAAAGCTGGTATCAATTCCCATAC- Clitocella_popinalis_KC816976 GGCTCTTATGGCATGTATCTCTGT-GGTTCGTATTCGGCACCGGTCATTGAATTCTTGGAGGAGTGGGGTCTTGAATCCTTGGAAGAGAATGCCCACTCTTCGACACCTTGCACGAAAGTTTTCGTCAATGGTGTTTGGATGGGCGTTCACCGTGACCCCGCGAATCTCGTCAAAACTCTCAAGAAGCTCCGACGGAAGGACGATATTAGCCCCGAAGTTTCTATCGTGCGCGATATAAGAGAGAAGGAGCTTCGTCTCTACACGGATGCGGGGCGTGTCTGCCGACCACTTTTCATTGTTGA-AACCA-GAGCTTGTGCTGAAAAAGAAGCATATCCGGTGGTTGAACAACGGTGTAGAGGATAATGGGGAGGGATACAAGTGGGAGCATCTCGTTAAAGGTGG-ATTATTGAGCTCTTGGATGCCGAGGAAGAGGAAACTGTGATGATATCGATGACCCCAGAAGATCTCGAGAC-TCAAGATTGCAGCAAAGTGGCATTCATCCTGAGCAGAATGACACTGACTTCGATCCAGCTGCCCGTCTCAAAGCTGGTATCAATTCCCATAC- Clitopilopsis_hirneola_KC816904 GGCCCTTATGGCCTGTATCTCTGT-GGTTCATATTCAGCGCCCGTCATCGAGTTCTTGGAGGAGTGGGGTCTCGAATCA-TGGAGGAGAACGCCCACTCTGCCACACCATGCACCAAGGTTTTCGTCAACGGTGTTTGGATGGGTGTCCATCGCGATCCAGCGAATCTCGTCAAAACACTCAGGAAACTA-GACGGAAGGA-GATATCAGCCCCGAAGT-TCTATTGTACGAGATATCAGAGAAAAGGAGCTTCGTCT-TACACCGACGCTGG-CGTGTTTGTCGACCACTGTTCATTGT-GAAAACCAGCAGCTCGTGCTACAGAAGAAGAACGTGCGTTATTTGAATGATGGTACAGATG-TAACGGGGAGGAGTACAAGTGGGA-CACCTTGTGAAAGGTGGCATTATTGAGCTGTTGGATGC-GAAGAAGAAGAGACAGTTATGATTTCGATGACGCCCGAAGATTTGGAGACATCTCGGTTACAACAAAGCGGCATCAGCACAGAGACAAACGAAAATGAATTCGACCCAGCTGCACGTCTGAAAGCTGG-ATAAATTCTCACAC- Clitopilopsis_hirneola_KC816905 GGCCCTTATGGCCTGTATCTCTGTCGGTTCATATTCAGCGCCCGTCATCGAGTTCTTGGAGGAGTGGGGTCTCGAATCATTGGAGGAGAACGCTCACTCTGCCACACCATGCACCAAGGTTTTCGTCAACGGTGTTTGGATGGGTGTCCATCGCGATCCAGCGAATCTCGTCAAAACACTCAGGAAACTACGACGGAAGGACGATATCAGCCCCGAAGTCTCTATTGTACGAGATATCAGAGAAAAGGAGCTTCGTCTATACACCGACGCTGGTCGTGTTTGTCGACCACTGTTCATTGTTGAAAACCAGCAGCTCGTGCTACAGAAGAAGAACGTGCGTTACTTGAATGAGGGTACAGATGCCAACGGGGAGGAGTACAAGTGGGAACACCTTGTGAAAGGTGGCATTATTGAGCTTTTGGATGCTGAAGAAGAAGAGACAGTTATGATTTCGATGACGCCCGAAGATTTGGAGACTTCTCGGTTACAACAAAGCGGCATCAGCACAGAGACAAACGAAAATGAATTCGACCCAGCTGCACGTCTGAAAGCTGGTATAAATTCTCACAC- Clitopilopsis_hirneola_KC816977 GGCCCTTATGGCCTGTATCTCTGT-GGTTCATATTCAGCGCCCGTTATCGAGTTCTTGGAGGAGTGGGGTCTCGAATCATTGGAGGAGAACGCCCACTCTGCCACACCATG-ACCAAGGTTTTCGTCAACGGTGTTTGGATGGGTGTCCATCGCGATCCAGC-AATCTCGTCAAAACTCTCAGGAAACTACGACGGAAGGACGATATCAGCCCCGAAGTCTCTATTGTACGAGATATCAGAGAAAAGGAGCTTCGTCTATACACCGACGCTGGTCGTGTTTGTCGACCACT-TTCATTGTCGAAAACCAGCAGCTCGTGCTACAGAAGAAGAACGTGCGTTATTTGAATGATGGTACAGATG-TAA-GGGGAGGAGTACAAGTGGGAACACCTTGTGAAAGGTGGCATTATTGAGCTGTTGGATGCTGAAGAAGAAGAGACAGTTATGATTTCGATGAC-CCCGAAGATTTGGAGACATCTCGGTTACAACAAAGCGGCATCAGCACAGAGACAAACGAAAATGAATTCGACCCAGCTGCACG-CTGAAAGCTGG-ATAAATTCTCACAC- Clitopilus_aff__hobsoni_KC816928 GGCCCTGATGTCCTGTATCTCCGTGGGTTCATACTCTGCGCCGGTCATCGAATTTTTGGAAGAGTGGGGTCTGGAATCGCTGGAAGAGAATGCCCATTCATCTACTCCATGCACCAAAGTGTTCGTCAATGGCGTTTGGATGGGTGTCCATCGTGATCCTGCCAATCTCGTCAAGACTCTGAGGAAATTGCGACGAAAGGACGATATCAGTCCTGAAGTCTCCATTGTTCGGGACATTCGAGAGAAGGAGCTTCGTCTTTATACCGATGCTGGCCGTGTTTGTCGGCCACTGTTCATTGTGGAGAATCAGGAACTCGTACTCAAGAAGAAACACATTCAGTGGATCAACCAGGGAGTAGATGATAATGCAGAGGAATTCAAGTGGGAGCACCTGATTAAGACTGGTGTTGTCGAGTTGCTCGATGCTGAAGAGGAGGAGACAGTCATGATTTCGATGACTCCCGAGGATCTAGAGACGTCCAGACTACAGCAAAGTGGTATGCAGCCTGAGCAGAACGAGGAGGACTTCGACCCCGCTGCTCGTCTCAAGGCAGGCATCAACTCACATAC- Clitopilus_aff__hobsonii_grp__KC816918 GGCCCTAATGTCGTGTATCTC-GTCGGTTCATATTCCGCGCCCGTTATCGAGTTCTTGGAAGAATGGGGTCTTGAATCCCTCGAAGAGAA-GCACACTCCTCTACCCC-TGCACGAAGGTATTCGTCAATGGTGTCTGGATGGGTGTTCATCGTGACCCCGCAAATCTCGTGAAAACCCTTAGGAAACTACGACGAAAGGACGATATCAGTCCAGAAGTTTCCATTGTCCGTGATATCCGAGAGAGGGA-CTTCGTCTTTACACCGACGCAGGTCGTGT-TGTCG-CCGGTGTTTATTGTGGAGAATCAAGAACTTGTGTTGAAGAAAAAGCATGTGCGATGGATTAATGAAGGGCAGGATGAGAATGGCGAAGAATTCAA-TGGGAACACCTCATCAAAAGTGGTGTAGTCGAGCTGTTGGATGCGGAGGAGGAAGAGACGGTTATGATTTCGATGACACCCGAGGATCTTGAAAACTCAAGGTTGCAGCAAAGCGGCATGCAGCCCGAGCAGAATGATGACGAATT-GACCCTGCCGCTCGTCTCAAAGCAGGCACTAATTCGCATAC- Clitopilus_apalus_KC816906 GGCTCTCATGTCATGTATATCCGTTGGTTCTTACTCGGCGCCAGTCATCGAATTCCTGGAGGAGTGGGGCTTGGAATCGTTGGAAGAGAATGCCCATTCTTCGACACCTTGCACCAAGGTTTTCGTCAATGGTGTCTGGATGGGTGTTCACCGTGATCCAGCCAACTTGGTGAAGACACTCAAGAAACTACGACGAAAAGACGACATCAGCCCTGAAGTCTCGATCGTGCGGGATATTCGAGAGAAGGAACTACGTCTATATACTGACGCTGGTCGTGTTTGTCGACCTCTCTTCATCGTCGAAAACCAAGAGCTTGTGCTGAAGAAGAAGCATGTCCGGTGGCTCAATGACGGAATGGATGATAATGGGGAGGAATATAAGTGGGAGCACTTAATCAAGGGAGGTGTCGTGGAACTATTGGATGCTGAAGAAGAGGAAACTGTTATGATCTCCATGACGCCAGAAGATCTGGAGACATCGAGAATGCAGCAAAGCGGCATCCAGCCCGAGCAGAACGAGGCTGATTTCGACCCTGCTGCCCGTCTCAAAGC-GGCATCAACACACACAC- Clitopilus_cf__argentines_KC81690 GGCGCTAATGTCATGTATCTCCGTCGGCTCATACTCCGCACCTGTGATCGAATTCTTGGAAGAATGGGGTCTGGAAGCACTGGAAGAGAATGCGCATTCATCTACGCCTTGCACGAAAGTTTTCGTCAATGGTGTCTGGATGGGTGTGCATCGTGATCCTGCAAATCTTGTCAAGACGCTCAGGAAGTTGCGAAGGAAAGACGACATTAGTCCCGAAGTCTCGATCGTTCGTGATATTCGAGAGAAAGAACTTCGCCTCTACACCGACGCTGGTCGCGTTTGCCGGCCGCTTTTCATCGTGGAGAACCAAGAGCTTGTGCTTAGGAAGAAACACGTCCAGTGGATCAACCAGGGCGTGGATGATGATGGAAACAAATTCGAATGGGAACACTTGATCAAGACGGGCGTGGTCGAGTTGTTGGATGCTGAAGAGGAAGAAACTGTCATGATCTCGATGACTCCAGAAGATCTCGAGACATCTCGATTACAGCAGAGTGGCATACAGCCCGAGCAGAACGAGGATGAATTCGA---------------------------------------- Clitopilus_cf__prunulus_KC816927 -----------C----ATTTCCGTCGGTTCTTATTCTGCACCGGTAATTGAATTTCTGGAGGAATGGGGTCTAGAGTCTCTGGAAGAAAATGCCCATTCCTCCACACCTTGTACTAAGGTTTTCGTCAATGGCGTTTGGATGGGTGTTCACCGTGATCCCGCCAATTTGGTCAAAACACTCAGGAAATTGCGACGAAAGGACGACATAAGTCCTGAAGTTTCTATCGTGCGGGATATTCGAGAGAAGGAGCTGCGCCTCTACACAGACGCCGGCCGCGTATGTCGACCTTTATTTATCGTCGAAAACCAGGAACTCGTTCTAAAGAAGAAGCATGT-CGGTGGCTTAACGAGGGAGCGGACGATAGTGGAGAAGAGTATAAATGGGAGCATTTGATCAAGGGTGGTATCATAGAGCTTTTGGACGCTGAGGAGGAAGAAACCGTAATGATCTCTATGACACCTGAAGATCTGGAGACTTCCAGATTGCAACAGAGTGGCATTCAGCCAGAGCAGAATGACGCTGAATTCGA---------------------------------------- Clitopilus_crispus_KC816910 GGCTCTCATGTCATGTATATCCGTTGGTTCTTACTCGGCGCCAGTCATCGAATTCCTGGAGGAGTGGGGCTTGGAATCGTTGGAAGAGAATGCCCATTCTTCGACACCTTGCACCAAGGTTTTCGTCAATGGTGTCTGGATGGGTGTTCACCGTGATCCAGCCAACTTGGTGAAGACACTCAAGAAACTACGACGAAAAGACGACATCAGCCCTGAAGTCTCGATCGTGCGGGATATTCGAGAGAAGGAACTACGTCTATATACTGACGCTGGTCGTGTTTGTCGACCTCTCTTCATCGTCGAAAACCAAGAGCTTGTGCTGAAGAAGAAGCATGTCCGGTGGCTCAATGACGGAATGGATGATAATGGGGAGGAGTACAAGTGGGAGCACTTAATCAAGGGAGGTGTCGTGGAACTATTGGATGCTGAAGAAGAGGAAACTGTTATGATCTCCATGACGCCAGAAGATCTGGAGACATCGAGAATGCAGCAAAGCGGCATCCAGCCCGAGCAGAACGAGGCTGATTTCGACCCTGCTGCCCGTCTCAAAGCTGGCATCAACACACACAC- Clitopilus_crispus_KC816911 GGCTCTCATGTCATGTATATCCGTTGGTTCTTACTCGGCGCCAGTCATCGAATTCCTGGAGGAGTGGGGCTTGGAATCGTTGGAAGAGAATGCCCATTCTTCGACACCTTGCACCAAGGTTTTCGTCAATGGTGTCTGGATGGGTGTTCACCGTGATCCAGCCAACTTGGTGAAGACACTCAAGAAACTACGACGAAAAGACGACATCAGCCCTGAAGTCTCGATCGTGCGGGATATTCGAGAGAAGGAACTACGTCTATA-ACTGACGCTGGTCGTGTTTGTCGACCTCTCTTCATCGTCGAAAACCAAGAGCTTGTGCTGAAGAAGAAGCATGTCCGGTGGCTCAATGACGGAATGGATGATAATGGGGAGGA-TACAAGTGGGAGCACTTAATCAAGGGAGGTGTCGTGGAACTATTGGATGCTGAAGAAGAGGAAACTGTTATGATCTCCATGACGCCAGAAGAT-TGGAGACATCGAGAATGCAGCAAAGCGGCATCCAGCCCGAGCAGAACGAGGCTGATTTCGACCCTGCTGCCCG-CTCAAAGCTGGCATCAACACACACAC- Clitopilus_fallax_GQ289275 GGCTCTTATGGCCTGTATCTCCGTCGGCTCATACTCGGCACCGGTCATCGAATTCTTGGAGGAGTGGGGACTTGAATCCTTGGAGGAAAATGCCCACTCTTCGACCCCTTGTACGAAAGTCTTTGTCAATGGTGTTTGGATGGGCGTTCACCGTGACCCTGCGAATCTCGTCAAAACCCTTAGGAAGCTACGACGGAAGGATGACATCAGCCCTGAAGTTTCTATCGTGCGTGATATAAGAGAGAAGGAGCTCCGTCTCTACACGGATGCAGGGCGTGTCTGCCGACCACTTTTCATTGTCGAGAACCAAGAACTTATGCTAAAGAAGAAGCATGTCCGGTGGCTGAACAATGGTGCAGATGATAGCGGGGAGGAATACAAATGGGAACACCTTGTCAAAGGTGGTGTCATCGAGCTTTTGGATGCTGAGGAAGAGGAAACTGTGATGATATCGATGACCCCAGAAGATCTCGAGAATTCGAGGCTACAGCAAAGCGGTATTCATCCTGAGCAGAACGACAGTGACTTTGATCCAGCTGCCCGT-TCAAGGCTGGTATCAACT-TCATAC- Clitopilus_fallax_GQ289276 AGCTCTTATGGCATGTATCTCCGTCGGCTCATACTCGGCACCAGTCATCGAATTCTTGGAGGAGTGGGGGCTTGAATCCTTGGAAGAAAATGCTCACTCTTCGACCCCTTGCACGAAAGTTTTCGTCAATGGTGTTTGGATGGGCGTTCACCGTGACCCTGCAAATCTCGTCAAAACTCTTAGGAAGCTACGACGGAAGGATGATATCAGTCCCGAAGTTTCCATCGTGCGCGATATAAGAGAGAAGGAGCTTCGTCTCTATACAGATGCAGGGCGTGTCTGTCGACCACTTTTCATTGTCGAGAACCAAGAACTTATGCTCAAGAAGAAGAATGTCCGGTGGCTGAACAACGGTGCAGACGATAGCGGAGAGGAATACAAATGGGAACACCTCGTCAAAGGTGGTGTTATCGAGCTTTTGGATGCTGAGGAAGAGGAAACTGTAATGATATCGATGACCCCAGAGGATCTCGAGAATTCGAGGTTACAGCAAAGCGGTGTCCATCCTGAACAGAATGACAGTGACTTTGATCCAGCTGCTCGTCTCAAAGCTGGTATCAACTCTCATAC- Clitopilus_geminus_GQ289277 GGCTCTCATGGCTTGTATATCCGTTGGTTCATATTCAGCCCCTGTCATTGAGTTCTTGGAAGAGTGGGGTCTAGAATCCTTGGAAGAAAATGCTCACTCCTCGACACCTTGCACTAAGGTATTTGTAAACGGCGTTTGGATGGGTGTACACCGTGACCCCGCAAACCTCGTCAAAACACTTAGGAAACTGAGAAGAAAGGATGATATCAGTCCCGAAGTCTCTGTTGTCAGGGATATTCGAGAGAGAGAGCTTCGTCTGTACACTGACGCAGGCCGTGTTTGTCGGCCACTGTTCATCGTCGAAAACCAACAATTGGCCTTGCAGAAAAAGCACGTCAAGTGGCTTAATGAAGGGATAAATGAGGATGCGGAAGAGTATAAGTGGGAGCATCTTGTCAAGGGTGGCATTGTTGAGCTACTAGACGCCGAGGAAGAGGAGACAGTCATGATTTCAATGACTCC-GAAGACTTGGAAACTTCTCGATTGCAACAGAGTGGTATTAGTACAAGCCCGACAGAAGGTGATTTCGATCCCGCA-CAAGGTTGAAAGCTGGCATCAACTCTCATAC- Clitopilus_hirneolus_GQ289278 GGCCCTTATGGCCTGTATCTCTGTCGGTTCATATTCAGCGCCCGTTATCGAGTTCTTGGAGGAGTGGGGTCTCGAATCATTGGAGGAGAACGCCCACTCTGCCACACCATGCACCAAGGTTTTCGTCAACGGTGTTTGGATGGGTGTCCATCGCGATCCAGCGAATCTCGTCAAAACACTCAGGAAACTACGACGGAAGGACGATATCAGCCCCGAAGT-T-TATTGTACGAGATATCAGAGAAAAGGAGCTTCGTCTATACACCGACGCTGGTCGTGTTTGTCGACCACT-TTCATTGTCGAAAACCAGCAGCTCGTGCTACAGAAGAAGAACGTGCGTTATTTGAATGATGGTACAGATG-TAA-GGGGAGGAGTACAAGTGGGA-CACCTTGTGAAAGGTGGCATTATTGAGCTGTTGGATGCTGAAGAAGAAGAGACAGTTATGATTTCGATGACGCCCGAAGATTTGGAGACATCTCGGTTACAACAAAGCGGCATCAGCACAGAGACAAACGAAAATGAATTTGATCCA-CTGCACGCCTGAAAGCTGGTATAAATTCTCACAC- Clitopilus_hobsonii_KC816912 GGCCCTAATGTCGTGTATCTCCGTCGGTTCATATTCCGCACCCGTTATCGAGTTCTTGGAAGAATGGGGTCTTGAATCCCTCGAAGAGAACGCACATTCCTCTACACCTTGTACGAAGGTATTCGTCAATGGTGTCTGGATGGGTGTCCACCGTGACCCCGCAAATCTCGTCAAAACGCTTAGGAAACTACGACGAAAGGACGATATCAGTCCAGAAGTTTCCATTGTCCGTGATATCCGAGAGAGGGAACTTCGTCTTTACACCGACGCAGGTCGTGTCTGTCGCCCAGTGTTTATTGTGGAGAATCAAGAACTTGTGTTGAAGAAGAAGCATGTGCGATGGATCAATGAAGGGCAGGATGACAATGGCGAAGAATTCAAGTGGGAACACCTCATCAAGAATGGTGTAGTCGAACTGTTGGATGCGGAGGAAGAAGAGACGGTGATGATTTCAATGACTCCTGAGGATCTTGAAAACTCGAGGTTGCAGCAGAGCGGCATGCAACCCGAGCAGAATGATGACGAATTTGACCCTGCCGCTCGTCTCAAAGCAGGCACTAATTCGCATAC- Clitopilus_hobsonii_KC816913 GGCTCTTATGGCTTGTATCTCCGTCGGTTCATACTCCGCGCCTGTCATCGAGTTCCTGGAGGAGTGGGGTCTCGAATCGCTTGAAGAGAACGCACATTCTTCTACACCATGCACGAAGGTATTCGTCAATGGTGTCTGGATGGGTGTTCACCGCGACCCTGCCAATCTCGTAAAAACTCTCAGGAAATTGCGCCGAAAAGACGACAT-AGTCCAGAAGTGTCCATCGTACGCGATACTCGAGAGAAGGAGCTTCGACTGTACACTGACGCAGGCCGTGTCTGCCGGCCAGTGTTTATCGTGGAGAATCAAGAACTTGTACTCAAGAAGAAGCATGTTCGATGGCTCAACGAGGGCGTAGACGAGAATGGCGAAGAGTATAAATGGGAGCACCTTATCAAGAGTGGCGTAATTGAGCTCCTGGATGCAGAAGAAGAGGAGACAGTTATGATCTCTATGACCCCCGAAGA-CTCGAAACCTCAAGATTGCAGCAGAGCGGTATGCAGCCTGAACA-AATGAAGAAGAGTTTGATCCTGCTGCTCGTCTAAAAGCAGGC--------------- Clitopilus_hobsonii_KC816914 GGCTCTCATGTCATGTATCTCCGTCGGTTCATACTCTGCGCCCGTTATCGAGTTCTTGGAAGAGTGGGGTCTTGAATCGCTGGAAGAGAACGCACACTCGTCCACACCCTGCACGAAGGTATTCGTCAACGGTGTCTGGATGGGCGTTCACCGTGACCCTGCAAATCTCGTGAAAACCCTCCGCAAACTACGTCGAAAGGACGATATCAGTCCCGAAGTTTCTATTGTCCGTGATATTCGAGAGAAGGAGCTTCGCCTCTACACTGATGCGGGCCGTGTCTGCCGACCAGTATTCATTGTGGAGAATCAGGAACTCGTTCTGAAGAAGAAGCATATTCGATGGCTTAATGAAGGGGTTGACGAGAATGGCGAGGAATACAAGTGGGAGCACCTCATCAAGAGTGGCGTGGTTGAGCTGTTGGATGCAGAGGAAGAGGAGACGGTCATGATCTCCATGACCCCTGAAGACCTCGAGACTTCAAGGTTGCAACAAAGTGGTATGCAGCCGGAGCAGAACGAGGATGAATTCGATCCAGCTGCTCGCCTGAAAGCAGGCATCAATTCGCACAC- Clitopilus_hobsonii_KC816915 GGCTCTCATGTCATGTATCTCCGTCGGTTCATACTCTGCGCCCGTTATCGAGTTCTTGGAAGAGTGGGGTCTTGAATCGCTGGAAGAGAACGCACACTCGTCCACACCCTGCACGAAGGTATTCGTCAACGGTGTCTGGATGGGCGTTCACCGTGACCCTGCAAATCTCGTGAAAACCCTCCGCAAACTACGTCGAAAGGACGATATCAGTCCCGAAGTTTCTATTGTCCGTGATATTCGAGAGAAGGAGCTTCGCCTCTACACTGATGCGGGCCGTGTCTGCCGACCAGTATTCATTGTGGAGAATCAGGAACTCGTTCTGAAGAAGAAGCATATTCGATGGCTTAATGAAGGGGTTGACGAGAATGGCGAGGAATACAAGTGGGAGCACCTCATCAAGAGTGGCGTGGTTGAGCTGTTGGATGCAGAGGAAGAGGAGACGGTCATGATCTCCATGACCCCTGAAGACCTCGAGACTTCAAGGTTGCAACAAAGTGGTATGCAGCCGGAGCAGAACGAGGATGAATTCGATCCAGCTGCTCGCCTGAAAGCAGGCATCAATTCGCACAC- Clitopilus_hobsonii_KC816916 GGCCCTCATGTCGTGTATCTCTGTCGGTTCCTACTCTGCACCAGTTATCGAGTTTTTGGAAGAGTGGGGTCTTGAATCCCTCGAGGAGAACGCACATTCCTCTACTCCTTGCACGAAGGTTTTCGTCAATGGAGTTTGGATGGGTGTCCATCGCGATCCCGCAAACCTCGTCAAAACTTTGAGGAAGTTGCGCCGAAAAGACGACATCAGTCCAGAGGTTTCCATTGTTCGTGATATCCGAGAGAAGGAGCTTCGACTTTACACTGACGCAGGTCGGGTCTGCCGACCCGTGTTCATTGTGGAGAACCAAGAACTTGTACTGAAGAAGAAGCATGTTCGATGGCTCAACGAAGGAGCGGATGAGAGTGGCGAGGAATACAAGTGGGAACATCTCATCAAGAGCGGCGTTATTGAGCTTTTGGATGCAGAAGAAGAGGAGACTGTCATGATTTCAATGACCCCCGAAGACCTCGAAACCTCACGCCTACAGCAAAGTGGCATACAGCCTGAGCAGAATGACGAGGAATTCGATCCTGCTGCTCGCCTGAAAGCGGGTATAAACTCACATAC- Clitopilus_hobsonii_KC816918 GGCTCT-ATGTCCTGTATCTCTGTGGGTTCATACTCTGCACCCGTCATCGAATTCTTGGAGGAGTGGGGTCTGGAATCACT-GAAGAGAATGCTCATTCATCTACTCCATGCACCAAAGTGTTCGTCAATGGTGTTTGGATGGGTGTTCACCGTGATCCCGCCAA-CTTGTCAA-ACTCTGAGGAAATTGCGACGAAAAGACGATAT-AGTCC-GA-GTCTCCATTGTTCGGGATATTCG-GAGAAGGAGCT-CGTCTCTATAC-GATGCTGGTCGCGTTTGTCGGCC-CTGTTCATCGTAGAGAACCAGGAACTCGT-CT-AAGAAAAAACA-ATTCAGTGGATCAACCAGGGGGTAGACGA-AACGGAGAGGAATTCAAGTGGGAACA-CTGAT-AAGAC-GGTGT-GT-GAGTTGCT-GATGCTGAAGAGGAGGAAAC-GTCATGATTTCGATGACTCCGGAGGATCTCGAGACGTCCAGGCTACAGCAGAGTGGCATGCAGCCCGAACAGAACGAGGAGGACTTCGACCCCGCCGCTCGCCT-AAGGCCGGTATCAACTCCCATAC- Clitopilus_nitellinus__GQ289282 AGCACTCATGGCTTGTATCTCTGTCGGCTCGTACTCTGCGCCCGTCATTGAGTTCTTGGAAGAGTGGGGTTTGGAATCCTTGGAAGAAAATGCTCATTCCACAACGCCTTGCACAAAAGTATTTGTGAACGGTGTTTGGATGGGTGTGCATCGTGATCCTGCGAAC-TGGTGAAAACTATCAAGAAGCTGCGACGAAAGGACGATATCAGTCCTGAAGTTTCTGT-GTGCGGGATATCCGAGAAAAGGAGCTTCGTTTATA-AC-GACGCTGGCCGTGTCTGTCGACCTCTTTTCATAGTCGAAAATCAGCAACTGGCGCTTCAGAAGAAGCACAT-AA-TGGCTTAA-GAAGGCTACAATGATGATGGAGACGATTACAAATGGGAACACCT-GTGAAGGGTGGTGTTGTTGAGCTTCTGGACGCGGAGGAGGAGGAGACTGTAATGATTTCTATGACGCCAGAGGATCTGGAGAATTCTCGATTGCAACAGAGTGGTATGAATCCGAACACGAATGAGGAAGAATTTGATCCAGCAGCGCGACTCAAAGCGGGCATTAACTCCCACAC- Clitopilus_nitellinus_GQ289281 GGCACTCATGGCTTGTATCTCTGTCGGGTCATACTCTGCGCCCGTTATTGAGTTCTTGGAAGAGTGGGGCTTGGAATCCCTTGAAGAAAATGCTCATTCCACAACACCTTGCACAAAGGTGTTTGTGAATGGTGTATGGATGGGTGTACATCGTGACCCTGCAAATTTGGTAAAAACTATCAAGAAGTTGCGACGAAAGGATGATATCAGTCCTGAAGTTTCTGTTGTACGGGACATCCGAGAAAAAGAACTTCGTTTATACACAGATGCTGGCCGCGTCTGTCGACCTCTTTTCATTGTTGAAAACCAACAATTGGCCCTTCAGAAGAAGCACATCAAATGGCTTAATGATGGCTACAACGACGATATAGAGGAGTACAAATGGGAACATCTCGTGAAGGGTGGTGTTATTGAGCTTCTGGACGCAGAAGAGGAGGAGACTGTGATGATTTCTATGACACCAGAGGATCTGGAGACTTCTCGACTACAGCAGAGTGGTGTCAACACAAACACGAATGACGAAGAGTTCGATCCAGCAGCTCGACTCAAAGCGGGTATCAACTCCCACAC- Clitopilus_pallidogriseus_GQ289283 GGCTCTTATGGCTTGTATATCTGTTGGTTCATATTCGGCCCCTGTCATCGAATTTTTGGAAGAGTGGGGATTGGAATCCTTGGAAGAAAATGCTCATTCCTCGACACCTTGCACCAAAGTGTTTGTCAACGGTGTATGGATGGGTGTTCACCGTGACCCCGCAAACCTCGTCAAAACGCTTAGGAAGCTGAGGAGAAAAGATGATATCAGCCCTGAAGTCTCTGTCGTCAGAGATATTCGAGAGAAGGAGCTTCGTCTATACACTGACGCAGGTCGTGTTTGTCGGCCATTGTTCATCGTAGAAAATCAACAGCTAGCATTGCAAAAAAAGCATATCAAATGGCTTAATGAAGGGAGGAATGATGAAGGGGAGGAGTATAAATGGGAGCATCTTGTTAAGGGCGGCATTATCGAACTCCTAGATGCTGAAGAAGAGGAGACGGTCATGATATCAATGACACCAGAAGATTTGGAATCTTCTCGATTGCAACAGAGCGGTATCAGCACTAGTCCGAACGATGGTGATTTTGATCCAGCAGCAAGGCTGAAAGCTGGTATAAATTCTCATAC- Clitopilus_paxilloides_KC816919 GGCTCTCATGTCGTGTATTTCCGTCGGTTCTTATTCTGCACCTGTAATCGAATTTCTGGAAGAATGGGGTCTAGAGTCCCTGGAAGAGAATGCCCATTCCTCTACACCTTGTACTAAGGTTTTCGTCAATGGCGTTTGGATGGGTGTTCACCGTGATCCCGCCAATTTGGTCAAAACACTCAGGAAATTGCGACGAAAGGACGACATAAGTCCTGAAGTTTCTATCGTACGGGATATTCGAGAGAAGGAGCTGCGCCTCTACACAGACGCCGGTCGCGTATGTCGACCTCTATTTATCGTCGAAAACCAGGAACTCGTTCTAAAGAAGAAGCATGTACGGTGGCTCAACGAGGGAGCGGACGACAGTGGAGAGGAGTATAAGTGGGAGCACTTGATCAAGGGTGGTATTATAGAGCTTTTGGACGCTGAGGAGGAAGAAACCGTAATGATCTCTATGACACCTGAGGATCTGGAGACTTCCAGATTGCAACAGAGTGGCATTCTGCCGGAGCAGAATGACGCTGAATTCGACCCTGCTGCTCGCCTAAAAGCTGGCATTAACTCGCACAC- Clitopilus_peri_KC816920 GGCACTCATGTCATGTATATCCGTTGGTTCCTACTCGGCGCCGGTCATCGAATTTTTAGAGGAGTGGGGCTTGGAATCGTTGGAAGAGAATGCCCATTCCTCTACACCTTGTACCAAGGTTTTCGTCAATGGTGTCTGGATGGGCGTTCACCGTGATCCTGCAAATTTGGTCAAGACACTTAAGAAATTACGACGGAAAGATGATATCAGTCCTGAAGTCTCTATTGTACGGGATATTCGAGAGAAGGAACTGCGTCTATATACTGACGCTGGTCGTGTTTGTCGACCTCTTTTCATCGTCGAAAACCAAGAACTTGTGCTGAAGAAGAAGCATGTCCGTTGGCTCAATGATGGAGCGGATGACAGTGGGGAGGAATACAAGTGGGAGCACTTGATCAAGGGCGGTGTTGTGGAACTCTTGGATGCTGAAGAAGAGGAAACCGTGATGAT-TCTATGACACCAGAGGATCTAGAGACATCAAGACTGCAGCAAAGTGGTATCCAGCCTGAGCAGAACGAGGCTGATTTCGA-CCTGCTGCTCGTCTCAAAGCTGGCATTAATACACACAC- Clitopilus_peri_KC816921 GGCACTCATGTCATGTATATCCGTTGGTTCCTACTCGGCGCCGGTCATCGAATTTTTAGAGGAGTGGGGCTTGGAATCGTTGGAAGAGAATGCCCATTCCTCTACACCTTGTACCAAGGTTTTCGTCAATGGTGTCTGGATGGGCGTTCACCGTGATCCTGCAAATTTGGTCAAGACACTTAAGAAATTACGACGGAAAGATGATATCAGTCCTGAAGTCTCTATTGTACGGGATATTCGAGAGAAGGAACTGCGTCTATATACTGACGCTGGTCGTGTTTGTCGACCTCTTTTCATCGTCGAAAACCAAGAACTTGTGCTGAAGAAGAAGCATGTCCGTTGGCTCAATGATGGAGCGGATGACAGTGGGGAGGAATACAAGTGGGAGCACTTGATCAAGGGCGGTGTTGTGGAACTCTTGGATGCTGAAGAAGAGGAAACCGTGATGATCTCTATGACACCAGAGGATCTAGAGACATCAAGACTGCAGCAAAGTGGTATCCAGCCTGAGCAGAACGAGGCTGATTTCGATCCTGCTGCTCGTCTCAAAGCTGGCATTAATACACACAC- Clitopilus_peri_KC816922 GGCACTCATGTCATGTATATCCGTTGGTTCCTACTCGGCGCCGGTCATCGAATTTTTAGAGGAGTGGGGCTTGGAATCGTTGGAAGAGAATGCCCATTCCTCTACACCTTGTACCAA-GTTTTCGTCAATGGTGTCTGGATGGGCGTTCA-CGTGATCCTGCAAATTTGGTCAAGACACTTAAGAAATTACG-CGGAAAGATGATATCAGTCCTGAAGTCTCTATTGTACGGGATATTCGAGAGAAGGAACTGCGTCTATATACTGACGCTGGTCGTGTTTGTCGACCTCTTTTCATCGTCGAAAACCAAGAACTTGTGCTGAAGAAGAAGCATGTCCGTTGGCTCAATGATGGAGCGGATGACAGTGGGGAGGAATACAAGTGGGAGCACTTGATCAAGGGCGGTGTTGTGGAACTCTTGGATGCTGAAGAAGAGGAAAC-GTGATGAT-TC-ATGACACCAGAGGATCTAGAGACATCAAGACTGCAGCAAAGTGGTAT-CAGCCTGAGCAGAACGAGGCTGATTTCGATCCTGCTGCTCGTCTCAAAGCTGGCATTAATACACACAC- Clitopilus_popinalis_GQ289280 AGCTCTTAAGGCATGTATTTCCGTTGGCTCGTATTCGGCACCAGTCATCGAATTCTTGGAGGAGTGGGGTCTTGAATCCTTGGAAGAGAATGCCCACTCTTCGACACCTTG-ACGAAAGTCTTCGTCAATGGTGTTTGGATGGGCGTTCACCGCGACCCCGCTAATCTCGTCAAAACTCTTAAGAAGCTACGACGGAAGGACGATATTAGCCCTGAAGTTTCTATCGTGCGCGACATAAGAGAGAAGGAGCTTCGTCTCTATACGGATGC-GGGCGTGTCTGCCGACC-CTTTTCATTGTTGAGAACCAAGAGCTTGTTCTGAAGAAGAAGCATGTCCGGTGGTTGAACAATGGTGTGGAAGATAGCGGGGAGGAATACAA-TGGGAGCATCTTGTTAAAGGTGGTATTATTGAGCTCTTGGATGC-GAGGAAGAGGAAACCGTGATGATATCGATGACCCCAGAGGATCTCGAGACTTCAAGATTGCAGCAAAGTGGCATTCATCCCGAGCAGAATGACACTGA-TTTGATCCA-CTGCTCGTCTGAAGGCTGGTATCAATTC-CATAC- Clitopilus_prunulus_KC816923 GGCTCTCATGTCGTGTATTTCCGTCGGTTCTTATTCTGCACCTGTAATCGAATTTCTGGAAGAATGGGGTCTAGAGTCCCTGGAAGAGAATGCCCACTCCTCTACACCTTGTACTAAGGTTTTCGTCAATGGCGTTTGGATGGGTGTTCACCGTGATCCCGCCAATTTGGTCAAAACACTCAGGAAATTGCGACGAAAGGACGACATAAGTCCTGAAGTTTCTATCGTACGGGATATTCGAGAGAAGGAGCTGCGCCTCTACACAGACGCCGGTCGCGTATGTCGACCTCTATTTATCGTCGAAAACCAGGAACTCGTTCTAAAGAAGAAGCATGTACGGTGGCTCAACGAGGGAGCGGACGACAGTGGAGAGGAGTATAAGTGGGAGCACTTGATCAAGGGTGGTATTATAGAGCTTTTGGACGCTGAGGAGGAAGAAACCGTAATGATCTCTATGACACCTGAGGATCTGGAGACTTCCAGATTGCAACAGAGTGGCATTCAGCCGGAGCAGAATGACGCTGAATTCGACCCTGCTGCTCGCCTAAAAGCTGGCATTAACTC------- Clitopilus_prunulus_KC816924 AGCTCTGATGTCGTGCATTTCCGTCGGTTCTTATTCTGCACCGGTAATCGAATTTCTGGAAGAATGGGGTCTAGAGTCCCTGGAAGAGAATGCCCATTCCTCTACACCTTGTACTAAGGTTTTCGTCAATGGCGTTTGGATGGGTGTTCACCGTGATCCCGCCAATTTGGTCAAAACACTCAGGAAATTACGACGAAAGGACGACATAAGTCCTGAAGTTTCTATCGTACGGGATATTCGAGAGAAGGAGCTGCGCCTCTACACAGACGCCGGCCGTGTATGTCGACCTCTATTTATCGTCGAAAACCAGGAACTCGTTCTAAAGAAGAAGCATGTACGGTGGCTCAATGAGGGGGCGGACGACAGTGGAGAGGAGTATAAGTGGGAGCACTTGATCAAGGGTGGTATCATAGAGCTTTTGGACGCTGAAGAGGAAGAAACCGTAATGATCTCTATGACACCTGAGGATCTGGAGACTTCCAGATTGCAACAGAGTGGCATTCAGCCGGAGCAGAATGACGCTGAATTCGACCCTGC-GCTCGCCTAAAAGCTGGCATTAACTCGCACAC- Clitopilus_prunulus_KC816925 -------ATGTCGTGCATTTCCGTCGGTTCTTATTCTGCACCGGTAATCGAATTTCTGGAAGAATGGGGTCTAGAGTCCCTGGAAGAAAATGCCCACTCCTCTACACCTTGTACTAAGGTTTTCGTCAATGGCGTTTGGATGGGTGTTCACCGTGATCCCGCGAATTTGGTCAAAACACTCAGGAAATTGCGACGAAAGGACGACATAAGCCCTGAAGTTTCTATCGTACGGGATATTCGAGAGAAGGAGCTGCGCCTCTACACAGATGCCGGCCGCGTATGTCGACCCTTATTTATCGTCGAAAACCAGGAACTTGTTCTGAAGAAGAAGCATGTACGGTGGCTTAATGAGGGGGCGGACGACAGTGGAGAGGAGTATAAGTGGGAGCACTTGATCAAGGGTGGTATTATAGAGCTTTTGGACGCTGAAGAGGAAGAAACTGTAATGATCTCTATGACACCTGAGGATCTGGAGACTTCCAGATTGCAACAGAGTGGCATTCAGCCGGAGCAGAATGACGCTGAATTCGACCCTGCTGCTCGCCTAAAAGCTGGCATCAACTCGCACAC- Clitopilus_prunulus_KC816926 --------------------------GTTCTTATTCTGCACCTGTAATCGAATTTCTGGAAGAATGGGGTCTAGAGTCCCTGGAAGAGAATGCCCATTCCTCTACACCTTGTACTAAGGTTTTCGTCAATGGCGTTTGGATGGGTGTTCACCGTGATCCCGCCAATTTGGTCAAAACACTCAGGAAATTGCGACGAAAGGACGACATAAGTCCTGAAGTTTCTATCGTACGGGATATTCGAGAGAAGGAGCTGCGCCTCTACACAGACGCCGGTCGCGTATGTCGACCTCTATTTATCGTCGAAAACCAGGAACTCGTTCTAAAGAAGAAGCATGTACGGTGGCTCAACGAGGGAGCGGACGACAGTGGAGAGGAGTATAAGTGGGAGCACTTGATCAAGGGTGGTATTATAGAGCTTTTGGACGCTGAGGAGGAAGAAACCGTAATGATCTCTATGACACCTGAGGATCTGGAGACTTCCAGATTGCAACAGAGTGGCATTCTGCCGGAGCAGAATGACGCTGAATTCGACCCTGCTGCTCGCCTAAAAGCTGGCATTAACTC------- Clitopilus_pseudopiperitus_GQ289284 GGCACTCATGGCTTGTATATCCGTTGGTTCCTATTCAGCCCCTGTTATCGAGTTCTTGGAAGAGTGGGGTTTAGAATCCTTGGAAGAAAACGCTCACTCCTCAACACCTTGTACTAAGGTCTTTGTCAACGGTGTTTGGATGGGTGTACATCGTGACCCCGCAAATCTCGTCAAAACGCTCAGGAAGCTGAGGAGAAAGGATGATATTAGCCCCGAAGTCTCTGTTGTCAGGGATATTCGAGAGAGGGAACTCCGTTTGTACACTGACGCAGG-CGCGTTTGTCGGCCTTTGTTCATCGTTGAAAATCAACAGTTGGCCTTGCAGAAGAAGCATGTCAGGTGGCTTAATGAAGGGGTGAATGACGATGGGGAAGAGCATAAGTGGGAGCATCTTGTCAAGGGTGGTATCGTTGAGCTGCTAGACGCTGAAGAAGAGGAGACGGTCATGATCTCTATGACTCCAGAAGATTTGGAAACTTCTCGATTGCAACAGAGCGGTATCAATACGAGCCCAACCGATGGTGATTTTGATCCGGCTGCTAGACTGAAGGCTGGCATCAACTCTCATAC- Clitopilus_sp__8024_TJB_KC816908 GGCGCTGATGTCCTGTATCTCCGTCGGTTCATACTCCGC-CC-GTCATCGAGTTCTTGGA-GAGTGGGGC-TGGA-GCGCTGGAAGAGAATGCCCATTCATCTACCCCTTG-ACGAAAGTTTTCGTCAA-GGTGTTTGGATGGGTGTACATCGTGA-CCTGCAAATCTTGTCAAGACGCTCAGGAAGTTGCGAAGAAAGGATGATATCAGTCCGGAAGT-TCCATCGTCGGG-ATATCCGAGAGAAGGAACTTCGTCTCTACACCGACGCTGGACGCGTCTGCCGGCCGCTTTTCATCGTGGAGAACCAAGAGCTTGTGCTGAGGAAGAAACACGTCCAGTGGATCAACCAAGGCTCAGATGACGAAGGAAACAAATTCGAGTGGGAACAC-TGATTAAGACAGGCGTGGT-GAGTTGCTCGATGC-GAAGAGGAGGAAACCGTCATGATCTCGATGAC-CCAGAAGATCTCGAGACATCTCGATTACAGCAGAGTGGCATGCAGCCTGAGCAGAA-GAGGAGGACTTCGACCCTGCTGCTCG-CTTAA-GCAGGCATTAACTCGCATAC- Clitopilus_sp__8133_TJB_KC816909 GGCGCTGATGTCCTGTATCTCCGTCGGTTCATACTCCGCACCAGT-ATCGAGTTCTTGGA-GAGTGGGGCCTGGAGGCGCTGGAAGAGAATGCCCATTCATC-ACCCCTTGCACGAAAGTTTT-GTCAA-GGTGTTTGGATGGGTGTACATCGTGATCCTGCAAATCTTGTCAAGACGCTCAGGAAGTTGCG-AGAAAGGATGATATCAGTCCGGAAGT-TCCATCGTTCGGGATAT-CGAGAGAAGGA-CTTCGTCTCTACACCGACGCTGGACGCGTCTGTCGGCCGCTTTT-ATCGTGGAGAACCAAGAGCT-GTGCTGAGGAAGAAACA-GTCCAGTGGATCAACCAAGGCTCAGATGACGAAGGAAA-AAATTCGAGTGGGAACACCTGATTAAGACAGGCGTGGT-GAGTTGCTCGATGCTGAAGAGGAGGAAACCGTCATGATCTCGATGACTCCAGAAGATCTCGAGACATCTCGATTACAGCAGAGTGGCATGCAGCC-GAGCAGAA-GAGGAGGACTTCGACCCTGCTGCTCG-CT-AA-GCAGGCATTAACTCGCATAC- Clitopilus_sp_7130_TJB_KC816929 GGCGCTAATGTCATGTATCTCCGTCGGCTCATACTCCGCACCTGTGATCGAATTCTTGGAAGAATGGGGTCTGGAAGCACTGGAAGAGAATGCGCATTCATCTACGCCTTGCACGAAAGTTTTCGTCAATGGTGTCTGGATGGGTGTGCATCGTGATCCTGCAAATCTTGTCAAGACGCTCAGGAAGTTGCGAAGGAAAGACGACATTAGTCCCGAAGTCTCGATCGTTCGTGATATTCGAGAGAAAGAACTTCGCCTCTACACCGACGCTGGTCGCGTTTGCCGGCCGCTTTTCATCGTGGAGAACCAAGAGCTTGTGCTTAGGAAGAAACACGTCCAGTGGATCAACCAGGGCGTGGATGATGATGGAAACAAATTCGAATGGGAACACTTGATCAAGACGGGCGTGGTCGAGTTGTTGGATGCTGAAGAGGAAGAAACTGTCATGATCTCGATGACTCCAGAAGATCTCGAGACATCTCGATTACAGCAGAGTGGCATACAGCCCGAGCAGAACGAGGATGAATTCGACCCTGCCGCTCGCCTTAAGGCAGGCATCAACTCGCATAC- Clitopilus_stanglianus_GQ289285 GGCATTAATGGCCTGCATCTCTGTCGGCTCTTACTCTGCGCCCGTTATTGAATTCCTGGAAGAGTGGGGCTTGGAATCTTTGGAAGAAAACGCCCATTCCACAACACCTTGTACGAAGGTATTTGTGAATGGTGTTTGGATGGGCGTGCATCGTGATCCAGCGAATTTGGTGAAAACGATCAAGAAGCTACGACGGAAGGATGATATCAGCCCGGAAGTCTCTGTCGTGCGGGACATCCGAGAAAAGGAGCTTCGATTATATACCGACGCTGGTCGTGTCTGTCGACCTCTTTTCATCGTTGAAAACCAGCAATTGGCGCTTCAGAAGAAGCACATTAAATGGCTCAACGACGATTGTAATGATGATGGCGAGGAGT-TAAGTGGGAACACCTCGTGAAGGGCGGTGTGGTTGAGCTTCTGGACGCTGAGGAGGAGGAAA-TGTTATGATTTC---------------------------------------------------------------------------------------------------------------------- Clitopilus_venososulcatus_KC816930 GGCGCTGATGTCCTGTATCTCCGTCGGTTCATACTCCGCACCGGTCATCGAGTTCTTGGAAGAGTGGGGCTTGGAAGCGCTGGAAGAGAATGCTCATTCATCCACCCCTTGTACGAAAGTTTTCGTCAATGGTGTTTGGATGGGTGTACATCGGGATCCTGCAAATCTTGTCAAGACGCTCAGGAAGTTGCGAAGAAAGGATGATATCAGTCCGGAAGTCTCTATCGTTCGGGATATTCGAGAGAAGGAACTTCGTCTCTACACCGACGCTGGACGCGTTTGTCGGCCGCTTTTCATCGTGGAGAACCAAGAGCTTGTACTGAGGAAGAAACACGTCCAGTGGATCAACCAAGGCTCAGATGACGAAGGAAATAAATTTGAGTGGGAACACCTGATTAAGACAGGCGTGGTCGAGTTGCTCGATGCTGAAGAGGAGGAAACCGTCATGATCTCGATGACTCCAGAAGATCTCGAGACATCTCGGTTACAGCAGAGTGGCATGCAGCCGGAGCAGAATGAGGAGGACTTCGACCCTGCTGCCCGCCTTAAGGCAGGCATCAACTCGCATAC- Entoloma_albidoquadratum_GQ289223 GGCTTTGATGGCTTGCATTTCGGTAGGATCCTACTCCGCCCCTGTCATCGAATTTTTAGAAGAGTGGGGGTTGGAATCCTTGGAAGAAAATGCACACTCTCAGACGCCTTGTACCAAAGTGTTTGTCAATGGTGTTTGGATGGGTGTTCACCGTGATCCTGCGAACCTCGTGAAAACAATCAAAAAGCTCAGGCGGAAAGATGACATTAGCCCCGAAGTTTCGGTTGTTCGTGACATCCGAGAAAAGGAACTTCGCTTGTATACGGACGCCGGTCGTGTATGCCGGCCTCTGTTCATCGTCGAGAATCAGCAGCTAGCCCTGCAGAAAAAACACATCAAGTGGCTCATTGATGGTTGTAACGACGAGGGAGAGGAGTACAAGTGGGAACATCTAGTCAAGGGTGGCGTTATTGAACTTCTGGATGCTGAAGAGGAGGAGACGGTGATGATATCTATGACACCAGAAGACCTTGAAAACTCTCGATTGCAGCAAAGTGGCATCGATACCTCCGTCAATGATGGCGAATTTGACCCAGCAGCGAGACTCAAGGCTGGGATAAACTCTCACAC- Entoloma_crassicystidiatum_JQ993083 GGCACTTATGGCTTGTATCTCTGTTGGCTCCTACTCAGCTCCTGTCATCGAATTTTTAGAGGAATGGGGTCTGGAATCTCTTGAAGAAAATGCGCATTCTCAGACCCCTTGTACCAAAGTATTTGTTAACGGTGTCTGGATGGGCGTTCACCGGGATCCTGCAAACTTGGTCAAAACTATCAAAAAGCTAAGACGAAAAGATGATATTAGTCCTGAGGTCTCCGTCGTTCGGGATATACGAGAAAAGGAGCTACGTCTCTACACGGATGCTGGACGCGTCTGTCGACCCCTTTTCATCGTCGAAAACCAGCAGCTGGCACTTCAGAAGAAACATGTCAGGTGGCTTAGCGAGGGTCGAGACGATGAAGGAGAAGACTATAAGTGGGATAACCTCGTCAAAGGCGGCATAATAGAACTCCTAGACTCCGAGGAAGAGGAGACTGTGATGATATCTATGACTCCAGAGGATCTCGAAAATTCTCGTTTACAACAGAGTGGCATAGATCCTACTGTCAATGATGGAGATTTTGATCCCGCTGCAAGGCTGAAAGCAGGAGTTAACTCGCACAC- Entoloma_griseolazulinum_GQ289237 GGCTCTCATGGCTTGCATCTCTGTCGGTTCATACTCAGCACCCGTCATTGAATTCTTGGAAGAGTGGGGTTTAGAGTCCTTGGAGGAAAATGCGCATTCTCAAACTCCTTGCACCAAGGTTTTTGTCAACGGTGTTTGGATGGGCGTTCATCGTGATCCTGTAAATCTGGTCAAGACGATTAAGAAGTTGCGACGAAAGGACGACATCAGTCCAGAGGTGTCTGTTGTCCGCGATATTCGAGAAAAGGAACTCCGTTTGTACACGGATGCTGGCCGTGTTTGTCGACCTTTGTTCATTGTTGAAAACCAACAATTGGCACTTCAGAAGAAACATATAAAGTGGCTCATTGATGGGTGCAATGACGAAGGAGAAGAATTCAAGTGGGAGCACCTAGTCAAGGGTGGAGTGGTGGAGTTGTTGGACGCTGAAGAGGAGGAGACTGTTATGATATCTATGACTCCGGAGGACCTTGAGAATTCACGTTTACAACAGAGTGGTATGGATCCCAATGCCAATGATGGAGAGTTTGACCCAGCAGCAAGACTCAAAGCTGGCATCAATTCGCATAC- Entoloma_indoviolaceum_GQ289243 AGCCCTTATGGCTTGCATATCTGTCGGTTCCTACTCCGCTCCTGTCATCGAATTTTTGGAGGAATGGGGACTGGAGTCACTGGAAGAGAATGCACATTCCCAAACGCCGTGTACAAAAGTGTTTGTCAACGGAGTTTGGATGGGTGTACATCGTGATCCCGCCAACCTCGTAAAAACAATCAAAAAGCTTCGCCGGAAGGATGATATCAGCCCCGAGGTTTCTGTTGTTCGGGATATTCGGGAGAAGGAGCTACGTCTGTATACAGACGCCGGCCGGGTTTGCAGACCTTTGTTTATTGTTGAAAATCAACAGCTGGCTCTCCAGAAGAAACATGTCAGATGGCTCAGCAATGGTTACAATGATGAAGGCGAGGAATATAAGTGGGAGCATCTTGTGAAGGGCGGCGTTGTGGAGCTCCTGGACGCAGAGGAAGAGGAGACTGTCATGATCTCAATGACTCCAGAAGACCTCGAAACCTCTCGTTTACAACAGAGCGGGATTGATACCACAACTAATGACGGCGAGTTCGACCCAGCAGCAAGACTCAAGGCTGGGATAAATTCGCACAC- Entoloma_prunuloides_GQ289255 GGCCCTAATGGCTTGTATCTCCGTCGGCTCATATTCTGC-CCTGTCATCGAATTCCTGGAAGAATGGGGGTTGGAGTCTCTAGAAGAAAATGCGCATTCTCAAACCCCTTGTACCAAAGTATTTGTCAATGG-GTCTGGATGGGTGTTCATCGTGATCC-GCAAATCTCGTCAAAACGATCAAGAAATTGCGGCGGAAGGA-GATATCAGTCCTGAGGTTTCTGTTGTCCGCGATATCCGAGAAAAGGAGCTTCGACTCTACACAGACGCCGGCCGCGTTTGTCGACCTCTATTTATTGTGGAAAACCAACAGCTAGCTCTTCAGAAGAAGCATGTCAAATGGCTCAGTGGCGGATATAATGACGAGGGAGAAGAATACAAGTGGGAACACCT-GTCAAGGGTGGAGTGATAGAA-TGTTGGATGCGGAAGAGGAGGAGACTGTCATGATATCTATGACTCCAGAAGATCTTGAGAATTCTCGTTTACAACAGAGTGGCATTGATCCTAACGCCAATGA-GGAGACTTCGACCCAGCGGCAAGACTGAAAGCTGGCATTAACTCGCATAC- Entoloma_serrulatum_GQ289263 GGCCCTAATGGCCTGCATCTCTGTCGGCTCATATTCGGCTCCTGTTATCGAGTTTTTGGAAGAATGGGGTCTAGAGTCACTCGAGGAGAATGCCCATTCACAGACGCCTTGTACGAAGGTATTCGTGAACGGTGTTTGGATGGGTGTCCATCGGGACCCAGCAAATCTCGTGAAAACGATCAAAAAGCTACGACGAAAAGACGACATCAGCCCAGAAGTCTCTGTCGTTCGGGACATACGAGAGAAGGAACTTCGATTGTATACGGACGCCGGACGCGTTTGTAGGCCCCTCTTCATCGTTGAAAATCAACAACTGGCAGTCCAGAAGAAGCATATTAAGTGGCTTAACGATGGTTACAATGACGAGGGGGAAGAATTCAAGTGGGAGCATCTTGTCAAGGGCGGCGTGGTGGAACTTTTGGACGCGGAAGAAGAGGAGACTGTCATGATATCCATGACTCCCGAAGATCTCGAGAACTCTCGTCTGCAGCAGAGTGGAATCGATACTACAGTGAACGACGGGGAGTTTGATCCCGCAGCGAGGCTAAAAGCTGGAATTAACTCTCACAC- Entoloma_tectonicola_GQ289266 GGCGCTTATGGCCTGCATTTCCGTTGGTTCTTATTCTGCTCCTGTCATTGAGTTTTTGGAGGAGTGGGGTTTGGAATCATTGGAAGAAAATGCACATTCTCAAACGCCTTGTACGAAGGTGTTCGTCAATGGTGTATGGATGGGTGTCCACCGCGATCCCGCAAACCTCGTCAAAACGATCAAGAAGTTACGACGTAAGGACGACATAAGCCCCGAGGTCTCTGTTGTGCGGGATATTCGAGAGAAGGAGCTTCGCTTGTATACGGATGCTGGCCGTGTTTGCAGACCTCTATTTATTGTTGAAAACCAGCAGCTAGCGCTCCAGAAGAAGCACATCAAGTGGCTAAACGAGGGCTTTAATGATGAGGGAGAAGAATTCAAGTGGGAGCATCTCATCAAGGGCGGCATTGTAGAGCTTCTGGATGCTGAAGAAGAGGAAACTGTGATGATATCGATGACTCCAGAGGACCTCCAGAACTCTCGTTTACAGCAAAATGG-ATCGATACTTCGGCCAATGACGGGGAGTTCGATCCACCGGGAAGGCTGAAAGCCGGGATCAATTCTCATAC- Entoloma_violaceovillosum_GQ289273 -------------------TCCGTTGGTTCCTATTCCGCTCCTGTCATCGAATTTCTTGAGGAATGGGGTTTGGAATCATTGGAAGAGAACGCACATTCTCAGACGCCGTGTACCAAGGTATTTGTTAACGGTGTCTGGATGGGTGTCCACCGTGACCCTGCGAACTTGGTGAAAACAATCAAAAAGCTCAGGCGGAAAGATGACATTAGCCCAGAAGTTTCCGTCGTGCGGGATACACGAGAGAAGGAGCTGCGCCTCTATACGGATGCCGGACGCGTCTGTCGACCTCTTTTCATCGTTGAAAACCAACAGCTGGTACTCCAGAAGAAACACGTCAGGTGGCTTAGCGAGGGCCGTGATGACGACGGGGAAGAATACAAGTGGGATAACCTCGTCAAAGGCGGTATTGTAGAACTCCTGGACGCCGAGGAAGAGGAGACTGTCATGATTTCAATGACTCCAGAGGACCTCGAGAATTCTCGTTTACAGCAGAGTGGTATTGATCCTGCTGCCAATGATGGGGATTTTGATCCTGCGGCGAGGCTAAAAGCTGGGGTTAACTCGCATAC- Pouzarella_pamiae_HQ876496 GTCTCTGATGGCTTGCATCTCTGTTGGTTCGTATTCGGCTCCCGTCATCGAATTCTTGGAGGAGTGGGGCTTGGAATCTCTCGAGGAAAATGCACACTCTCAATCCCCGTGTACAAAGGTATTTGTCAATGGTGTGTGGATGGGTGTCCATCGGGATCCTGCAAACTTAGTCAAAACGATCAAAAAGCTGAGACGGAAGGACGATATAAGCCCCGAAGTGTCCGTCGTTCGAGACATACGAGAAAAGGAGTTACGTCTTTACACGGATGCTGGACGCGTTTGCCGACCTCTTTTCATTGTCGAAAATCAGCAGCTGGCACTGCAGAAAAAACATGTCAAATGGCTGAGCGAGGGTCACGATGATCAGGGAGAAGAGTACAAGTGGGATAACCTCGTCAAAGGCGGCATAATAGAACTTCTAGACGCCGAGGAAGAGGAGACTGTAATGATTTCCATGACACCGGAAGATCTTGAGAATTCTCGCCTGCAGCAGAGTGGCATCGATCCTACGGCCAATGATGGGGAATTTGATCCTGCGGCGAGACTGAAAGCGGGCGTCAACTCACATAC- Rhodocybe_alutacea_KC816931 GGCCCTCATGGCTTGTATATCCGTTGGTTCCTACTCAGCCCCTGTTATCGAGTTCTTAGAGGAGTGGGGTTTAGAATCATTGGAAGAAAACGCCCACTCCTCAACACCTTGTACTAAGGTTTTTGTCAACGGTGTTTGGATGGGTGTACACCGTGACCCTGCAAATCTCGTCAAAACGCTCAGGAAGCTGAGGAGAAAGGATGATATTAGCCCCGAAGTCTCTGTTGTCAGGGATATTCGAGAGAGGGAACTCCGTTTATACACTGACGCAGGTCGCGTTTGCCGGCCTTTGTTCATCGTCGAAAACCAACAGCTGGCCTTACAGAAGAAGCATATCAGGTGGCTTAATGAAGGGGTGAATGACGATGGGGAAGAGCATAAGTGGGAGCATCTTGTCAAGGGTGGTATCGTTGAGCTGCTAGACGCTGAGGAAGAGGAGACGGTCATGATCTCTATGACTCCAGAAGATTTGGAAACTTCTCGGTTGCAACAGAGCGGTATCAGTACGAGCCCAACCGATGGTGATTTTGATCCGGCTGCTAGACTGAAGGCTGGCATCAACTCTCATAC- Rhodocybe_caelata_KC816932 GGCTCTTATGGCTTGCATATCTGTTGGTTCATACTCGGCTCCTGTCATCGAGTTCTTGGAAGAGTGGGGGCTGGAATCTTTGGAAGAAAATGCTCACTCTTCGACACCTTGCACCAAAGTGTTTGTCAATGGTGTTTGGATGGGTGTTCACCGTGACCCTGCAAATCTCGTTAAAACGCTCAGGAAGCTGAGGAGAAAAGATGACATCAGCCCTGAAGTCTCTGTCGTCAGGGATATTCGAGAGAAAGAACTTCGTCTATACACTGACGCAGGTCGCGTTTGTCGGCCATTGTTTATCGTAGAAAATCAACAGCTGGCCTTGCAGAAGAAGCACATTAAATGGCTTAATGAAGGGATGAATGACGATGGAGAGGAGTATAAATGGGAGCATCTTGTCAAAGGTGGTATTGTCGAGTTGCTAGATGCCGAGGAAGAAGAGACAGTTATGATCTCAATGACGCCAGA-GATTTGGAAACTTCTCGATTGCAACAGAGCGGTATCAATACGAACCCGAACGACAGCGAATTCGACCCAGCAGCAAGACTGAAAGCTGGCATAAATTCTCATAC- Rhodocybe_caelata_KC816933 GGCTCTGATGGCTTGTATATCTGTCGGTTCATATTCAGCGCCTGTCATTGAGTTCTTGGAGGAGTGGGGGCTCGAATCTTTGGAAGAAAATGCTCA-TCTTCAACACCTTGCACGAAAGTATTCGTCAATGGTGTTTGGATGGGTGTTCACCGGGACCCTGCAAATCTTGTCAAAACGCTTAGAAAACTGAGACGAAAAGATGACATCAG-CCTGAAGTGTCTGTCGTCAGGGATATTCGAGAAAAGGAACTT--T-TGTACACCGATGCAGGCCGTGTTTGCCGACCACTGTTTATCGTAGAAAATCAACAACTGGCGCTGCAGAAGAAGCATGTCAGATGGCTTAATGATGGGATG-ACGACAA-G-GGAAGAGTATAAGTGGGA-CATCTTGTCAAAGGTGGTATTGTCGAGTTGTTAGATGC-GAGGAAGAGGAGACAGTCATGATCTCAATGACCCCAGAAGATCTAGAAACGTCTCGATTGCAACAAAGCGGTATCAATACGAACCAGAACGATGGTGATTTCGATCCAGCAGCAAGATTGAAAGCGGGAATAAACTCTC-TAC- Rhodocybe_caelata_KC816934 -------------------------GGTTCGTACTCAGCGCCTGTCATCGAATTCTTGGAAGAGTGGGGACTCGAATCTTTGGAAGAGAATGCTCACTCTTCGACACC-TGCACCAAGGTGTTCGTCAACGGTGTTTGGATGGGTGTCCACCGCGATCCTGCCAATCTCGTAAAAACGCTCAGGAAGTTGAGAAGAAAGGATGATATTAGCCCTGAAGTCTCTGTTGTTAGAGATATCAGGGAGAAGGAGCTTCGCCTGTACACCGATGCAGGCCGTGTTTGTCGACCGCTGTTCATTGTTGAGAACCAGCAGTTGGCACTACAAAAGAAGCATATCAAATGGCTTAATGATGGAACAAACGACGATGGTGAAGAGTATAAGTGGGAGCACCTTGTCAAAGGTGGCATTGTTGAGCTGCTGGATGC-GA-GAAGAGGAGACAGTGATGATCTCGATGACTCCCGAAGATCTAGAGACCTCTCGGCTACAACAGAGTGGACTAAGCACGAATCAGCTTGACGGCGATTTCGACCCTGCAGCAAGGCTGAAAGCTGGTATCAATTCTCATAC- Rhodocybe_caelata_KC816978 GGCTCTTATGGCTTGCATATCTGTTGGTTCGTACTCAGCGCCTGTCATCGAGTTCTTGGAAGAGTGGGGACTCGAATCCTTGGAAGAAAATGCTCACTCTTCGACACCCTGTACCAAAGTGTTTGTCAATGGTGTTTGGATGGGTGTTCACCGTGACCCTGCAAATCTCGTCAAAACGCTCAGGAAGCTAAGGAGAAAAGACGATATCAGTCCTGAAGTCTCCGTCGTCAGGGATATCCGAGAGAAAGAGCTTCGTCTATACACCGACGCAGGTCGTGTTTGTCGGCCATTGTTCATCGTAGAAAACCAACAGCTGGTATTGCAGAAGAAGCACGTCAGGTGGCTTAATGAAGGGATGAATAACGATGGGGAGGAGTATAAGTGGGAACACCTTGTCAAAGGTGGTATTGTCGAGTTGTTAGATGCCGAGGAAGAGGAGACAGTTATGATATCAATGACGCCAGAAGACTTGGAAGCTTCTCGACTGCAACAGAGCGGTATTAGTACCAGCCCGAACGATAGCGATTTCGATCCGGCTGCAAGATTGAAGGCTGGTATAAATTCCCATAC- Rhodocybe_collybioides_KC816935 GGCTCTTATGGCTTGTATCTCTGTCGGCTCTTACTCAGCGCCCGTTATCGAATTCTTGGAGGAGTGGGGGCTCGAATCTTTAGAAGAGAATGCTCACTCTTCGACGCCTTGTACCAAAGTGTTTGTCAATGGTGTTTGGATGGGTGTTCACCGGGATCCCGCAAATCTTGTCAAAACACTCAGGAAGTTGAGAAGAAAAGACGATATCAGTCCCGAGGTCTCTGTTGTGAGAGATATTAGAGAAAAAGAACTTCGTCTCTACACCGACGCAGGCCGTGTCTGTCGGCCGTTATTCATTGTCGAAAACCAGCAGCTAGTGCTGCAAAAGAAACATGTCAAATGGCTCAACGACGGCATCAATGACGATAGTGAGGAGTACAAATGGGAGCATCTCGTCAAAAGTGGTATTGTTGAGCTGCTTGATGCTGAGGAAGAGGAGACAGTCATGATCTCGATGACACCAGAAGATCTGGAGACTTCACGGTTACAACAGAGCGGCATTAGTGCGAATCAAAATGACGGCGACTTCGACCCAGCAGCAAGGTTGAAAGCTGGTATTAACTCTCATAC- Rhodocybe_formosa_KC816939 GGCTCTTATGGCTTGCATATCTGTTGGTTCGTACTCAGCGCCTGTCATCGAGTTCTTGGAAGAGTGGGGACTCGAATCCTTGGAAGAAAATGCTCACTCTTCGACACCCTGTACCAAAGTGTTTGTCAATGGTGTTTGGATGGGTGTTCACCGTGACCCTGCAAATCTCGTCAAAACGCTCAGGAAGCTAAGGAGAAAAGACGATATCAGTCCTGAAGTCTCCGTCGTCAGGGATATCCGAGAGAAAGAGCTTCGTCTATACACCGACGCAGGTCGTGTTTGTCGGCCATTGTTCATCGTAGAAAACCAACAGCTGGTATTGCAGAAGAAGCACGTCAGGTGGCTTAATGAAGGGATGAATAACGATGGGGAGGAGTATAAGTGGGAACACCTTGTCAAAGGTGGTATTGTCGAGTTGTTAGATGCCGAGGAAGAGGAGACAGTTATGATATCAATGACGCCAGAAGACTTGGAAGCTTCTCGACTGCAACAGAGCGGTATTAGTACCAGCCCGAACGATAGCGATTTCGATCCGGCTGCAAGATTGAAGGCTGGTATAAATTCCCATAC- Rhodocybe_fuliginea_KC816940 -----------CTTGTATATCTGTCGGTTCATATTCAGCGCCTGTCATTGAGTTCTTGGAGGAATGGGGGCTCGAATCTTTGGAAGAAAATGCTCATTCCTCAACACCTTGCACGAAAGTATTCGTCAATGGTGTTTGGATGGGTGTTCACCGGGACCC-GCAAATCTTGTCAAAACGCTCAGAAAACTGAGACGGAAAGATGACATTAGCCCTGAAGTGTCTGTCGTCAGGGATATTCGAGAAAAAGAACTTCGCTT-TACACCGACGCAGGCCGTGTTTGCCGGCCACTGTTTATTGTAGAAAATCAGCAACTGGCGCTGCAGAAGAAGCATGTCAGGTGGCTTAATGACGGAATGAACGACAATGGGGAAGAGTATAAGTGGGAACATCTTGTCAAAGGCGGTATTGTCGAGTTGTTAGATGCTGAGGAAGAGGAGACAGTCATGATCTCAATGACTCCAGAAGATCTGGAAACGTCTCGGTTACAACAAAGCGGTATCAATACGAACCAGAATGATGGCGATTTCGATCCAGCAGCAAGATTGAAAGCGGGAATAAATTCTCATAC- Rhodocybe_hondensis_KC816941 GGCCCTCATGGCTTGTATATC-GTTGGTTCCTACTCAGCCCCTGTTATCGAGTTCTTGGAAGAATGGGGTTTAGAATCCTTGGAAGAAAATGCTCACTCCTCAACACCTTGTACTAAGGTCTTTGTCAACGGTGTTTGGATGGGCGTACACCGTGACCCTGCAAATCTCGTCAAAACGCTCAGGAAGCTGAGGAGAAAGGATGATATTAGCCCCGAAGTCTCTGTTGTCAGGGATATTCGAGAGCGGGAACTCCGTTTGTACACTGACGCAGGCCGTGTTTGTCGGCCTTTGTTCATCGTTGAAAACCAACAGTTGGCCTTGCAGAAGAAGCATGTCAGGTGGCTTAATGAAGGGGTGAATGACGATGGGGAAGAGCATAAGTGGGAGCATCTTGTCAAGGGTGGTATCGTTGAGCTACTAGACGCTGAGGAAGAGGAGACGGTCATGATCTCTATGACTCCAGAAGATTTGGAAACTTCTCGATTGCAACAGAGCGGTATCAGTACGAGCCCAACCGATGGTGATTTTGATCCGGCTGCTAGACTGAAGGCTGGCATCAACTCTCATAC- Rhodocybe_lateritia_KC816942 AGCTCTCATGGCCTGTATATCCGTTGGTTCATACTCAGCCCCCGTCATTGAGTTCTTGGAAGAGTGGGGTCTGGAATCCTTGGAAGAAAATGCTCACTCCGCTACACCTTGCACCAAAGTATTTGTTAACGGTGTTTGGATGGGTGTACATCGTGACCCTGCAAACCTCGTCAAAACACTTAGAAAGCTGAGGAGAAAGGATGATATTAGCCCCGAAGTCTCTGT-GTCAGGGACATTCGAGAGAGGGAGCTTCGTCTGTACACTGACGCAGGCCGTGTTTGTCGGCCATTGTTTATCGTCGAAAACCAACAGCTGGCATTACAAAAGAAGCATGTCAAATGGCTTAATGAAGGAATGAATGACCAGGGGGAAGAGTACAAATGGGAACACCTTGTCAAGGGCGGTAT-GTTGAGCTACTAGACGCCGAGGAAGAGGA-ACGGTTATGATCTCAATGACACCAGAAGACTTGGAAACCTCTCGATTACAACAGAGCGGTATCAG--C---------------------------------------------------------------- Rhodocybe_luteocinnamomea_KC816943 GGCTCTCATGGCTTGTATATCCGTTGGTTCATACTCGGCCCCTGTTATTGAGTTCTTGGAGGAATGGGGTTTGGAATCTTTGGAGGAAAACGCTCATTCTTCGACACCTTGCACTAAGGTATTCGTCAACGGTGTTTGGATGGGTGTACATCGTGACCCTGCGAATCTCGTCAAAACGCTTAGGAAACTGAGGAGGAAGGATGATATCAGTCCCGAGGTGTCCGTTGTCAGAGATATTCGAGAGAGGGAGCTTCGTTTGTACACAGACGCAGGTCGTGTTTGCCGACCGTTGTTCATCGTTGAAAATCAACAGTTGGCATTGCAGAAGAAGCACATCAGATGGCTAAATGAAGGAATGAACGACGATGGGGAAGAGTATAAGTGGGAGCACCTTGTCAAGGGCGGCATTGTTGAGCTACTGGATGCCGAAGAAGAGGAGACTGTAATGATTTCGATGACCCCCGAAGACTTGGAAACTTCTCGTTTGCAACAAAGTGGTATTAGCACGAGTCCAACCGATGGTGATTTCGATCCGGCGGCAAGACTAAGAGCTGGTATCAATTCTCATAC- Rhodocybe_mellea_KC816944 GGCTCTTATGGCTTGTATCTCTGTCGGCTCATATTCAGCACCCGTCATCGAATTCTTAGAGGAGTGGGGTCTCGAATCCTTGGAAGAGAACGCCCACTCTTCGACGCCTTGCACCAAGGTGTTTGTCAATGGCGTTTGGATGGGTGTTCACCGGGACCCTGCAAACCTCGTCAAAACCCTGAGGAAGCTGAGGAGAAAAGATGATATTAGTCCAGAAGTCTCCGTCGTCAGAGATATTCGAGAAAAAGAGCTCCGTCTTTACACTGATGCAGGTCGTGTTTGTCGGCCATTGTTCATCGTAGAAAACCAGCAGCTGGCATTACAAAAGAAGCACGTCAAATGGCTTAATGAAGGCATGAACGACGAGGGGGATGAGTATAAGTGGGAGCATCTCGTCAAGGGTGGTATTGTCGAGCTATTGGATGCCGAAGAAGAAGAGACAGTCATGATCTCGATGACACCGGAGGACCTAGAGACTTCTCGACTGCAACAAAGTGGGATCAATGCAGATCCTAATGACGGCGACTTTGATCCGGCGGCAAGATTGAAGGCCGGGATAAATTCTCATAC- Rhodocybe_minutispora_KC816947 GGCTCTTATGGCTTGCATATCTGTTGGTTCGTACTCAGCGCCTGTCATCGAGTTCTTGGAAGAGTGGGGACTCGAATCCTTGGAAGAAAATGCTCACTCTTCGACACCCTGTACCAAAGTGTTTGTCAATGGTGTTTGGATGGGTGTTCACCGTGACCCTGCAAATCTCGTCAAAACGCTCAGGAAGCTAAGGAGAAAAGACGATATCAGTCCTGAAGTCTCCGTCGTCAGGGATATCCG-GAGAAAGAGCTTCGTCTATACACCGACGCAGGTCGTGTTTGTCGGCCATTGTTCATCGTAGAAAACCAACAGCTGGTATTGCAGAAGAAGCACGTCAGGTGGCTTAATGAAGGGATGAATAACGATGGGGAGGAGTATAAGTGGGAACACCTTGTCAAAGGTGGTATTGTCGAGTT-TTAGATGCCGAGGAAGAGGAGACAGTTATGATATCAATGACGCCAGAAGACTTGGAAGCTTCTCGACTGCAACAGAGCGGTATTAGTACCAGCCCGAACG----------------------------------------------------- Rhodocybe_pallidogrisea_KC816968 GGCTCTTA-GGCTTGTATATCTGTTGGTTCATATTCGGCCCCTGTCATCGAATTTTTGGAAGAGTGGGGATTGGAATCCTTGGAAGAAAATGCTCATTCCTCGACACCTTGCACCAAAGTGTTTGTCAACGGTGTATGGATGGGTGTTCACCGTGACCCCGCAAACCTCGTCAAAACGCTTAGGAAGCTGAGGAGAAAAGATGATATCAGCCCTGAAGTCTCTGTCGTCAGAGATATTCGAGAGAAGGAGCTTCGTCTATACACTGACGCAGGTCGTGTTTGTCGGCCATTGTTCATCGTAGAAAATCAACAGCTAGCATTGCAAAAAAAGCATATCAAATGGCTTAATGAAGGGAGGAATGATGAAGGGGAGGAGTATAAATGGGAGCATCTTGTTAAGGGCGGCATTATCGA-CTCCTAGATGCTGAAGAAGAGGAGACGGTCATGATATCAATGACACCAGAAGATTTGGAATCTTCTCGATTGCAACAGAGCGGTATCAGCACTAGTCCGAACGATGGTGATTTTGATCCAGCAGCAAGGCTGAAAGCTGGTATAAATTCTCATAC- Rhodocybe_paurii_KC816969 GGCCCTGATGGCTTGCATCTCTGTTGGTTCATACTCAGCGCCTGTTATCGAGTTCTTGGAAGAGTGGGGCCTGGAATCTCTGGAAGAAAATGCTCACTCTTCGACACCTTGCACCAAAGTCTTTGTCAATGGCGTTTGGATGGGTGTTCACCGTGACCCTGCGAATCTCGTCAAAACACTCAGGAAGCTGAG-AGAAAAGATGATATCAGCCCCGAAGTCTCTGTCGTCAGGGATATTCGAGAGAAGGAACTTCGTCTGTACACTGACGCAGGCCGTGTTTGTCGGCCATTGTTCATCGTAGAAAATCAACAGCT-GCATTGCAGAAGAAACA-ATCAAGTGGCTCAACGAGGGGATGAATGACGACGGGGAGGAGTACAAGTGGGAACATCTTGTCAAAGGTGGTATTATCGAGCTGTTAGATGCTGAGGAGGAAGAGACGGTTATGATCTCAATGACACCAGAAGATTTGGAGACTTCTCGGTTACAACAAAGCGGTATCAGTACGGGCCCGACTGATGGTGATTTCGATCCAGCAGCAAGGCTAAAAGCTGGCATAAACTCCCATAC- Rhodocybe_pseudopiperita_KC816979 ------------------------------------------------------------------GGGTTTAGAATCCTTGGAAGAAAACGCTCACTCCTCAACACCTTGTACTAAGGTCTTTGTCAACGGTGTTTGGATGGGTGTACACCGTGACCCTGCAAATCTCGTCAAAACGCTCAGGAAGCTGAGGAGAAAGGATGATATTAGCCCCGAAGTCTCTGTTGTCAGGGATATTCGAGAGAGGGAACTCCGTTTGTACACTGACGCAGGCCGCGTTTGTCGGCCTTTGTTCATCGTTGAAAATCAACAGCTGGCCTTGCAGAAGAAGCATGTCAAGTGGCTTAATGAAGGGGTGAATGACGTTGGGGAAGAGCATAAGTGGGAGCATCTTGTCAAGGGTGGTATCATTGAGCTGCTAGACGCTGAAGAAGAGGAGACGGTCATGATCTCTATGACTCCAGAAGATTTGGAAACTTCTCGATTGCAACAGAGCGGTATCAGTACGAGCCCAACCGATGGTGATTTTGATCCGGCTGCTA-ACTGAAGGC-GGC-TCAACTCT------ Rhodocybe_reticulate_KC816980 GGCTCTTA-GGCTTGTATATCTGTTGGTTCATATTCGGCCCCTGTCATCGAATTTTTGGAAGAGTGGGGATTGGAATCCTTGGAAGAAAATGCTCATTCCTCGACACCTTGCACCAAAGTGTTTGTCAACGGTGTATGGATGGGTGTTCACCGTGACCCCGCAAACCTCGTCAAAACGCTTAGGAAGCTGAGGAGAAAAGATGATATCAGCCCTGAAGTCTCTGTCGTCAGAGATATTCGAGAGAAGGAGCTTCGTCTATACACTGACGCAGGTCGTGTTTGTCGGCCATTGTTCATCGTAGAAAATCAACAGCTAGCATTGCAAAAAAAGCATATCAAATGGCTTAATGAAGGGAGGAATGATGAAGGGGAGGAGTATAAATGGGAGCATCTTGTTAAGGGCGGCATTATCGA-CTCCTAGATGCTGAAGAAGAGGAGACGGTCATGATATCAATGACACCAGAAGATTTGGAATCTTCTCGATTGCAACAGAGCGGTATCAGCACTAGTCCGAACGATGGTGATTTTGATCCAGCAGCAAGGCTGAAAGCTGGTATAAATTCTCATAC- Rhodocybe_rhizogena_KC816981 GGCTCTTATGGCTTGCATATCTGTTGGTTCATACTCAGCGCCTGTCATTGAGTTCTTGGAGGAGTGGGGACTGGAATCCTTGGAAGAAAATGCTCACTCTTCGACACCTTGCACCAAAGTGTTTGTCAATGGGGTCTGGATGGGCGTTCATCGTGACCCTGCGAATCTCGTTAAAACGCTCCGAAAGCTGAGGAGAAAAGACGATATTAGCCCTGAGGTCTCTGTCGTCAGAGATATTCGAGAGAAGGAGCTTCGCCTATACACTGACGCAGGTCGTGTTTGTCGGCCGTTGTTCATCGTAGAGAATCAACAGCTGGCATTGCAGAAGAAGCACATCAAATGGCTTAATGATGGGATGACTGACGATGGGGAGGAGTATAAGTGGGAGCATCTTGTCAAGGGTGGTATTGTCGAGTTGCTAGATGCTGAGGAAGAAGAGACAGTTATGATCTCAATGACACCAGAAGATTTGGAAACTTCCCGATTGCAACAGAGTGGTATTAATACGAGTCCGAACGACGGTGATTTTGATCCAGCAGCAAGGCTG------------------------ Rhodocybe_roseiavellanea_KC816982 GGCTCTTATGGCTTGTATATCCGTTGGTTCGTACTCAGCTCCTGTCATCGAGTTCTTGGAAGAGTGGGGTCTGGAATCCTTGGAAGAAAATGCTCATTCCGCGACACCTTGCACTAAGGTCTTTGTCAACGGTGTTTGGATGGGTGTACATCGTGACCCTGCAAATCTTGTCAAAACACTCAGGAAGCTGAGGAGAAAGGATGATATTAGTCCCGAAGTCTCGGTTGTTAGGGATATTCGAGAGAGGGAGCTTCGTCTATATACTGACGCGGGCCGTGTTTGTCGGCCATTGTTCATCGTCGAAAATCAGCAGCTGGCATTACAGAAGAAGCACGTTAAATGGCTCAATGAAGGCTTGAATGACGATGGGGAAGAGTACAAATGGGAGCACCTTGTTAAGGGCGGTATTGTTGAACTACTAGATGCCGAGGAGGAGGAGACGGTCATGATCTCAATGACACCAGAAGATTTGGAAACTTCTCGACTGCAACAGAGTGGTATTAGCACGAGTCCGAACGACGGTGATTTTGATCCGGCGGCAAGGCTGAAAGCTGGTATTAATTCTCATAC- Rhodocybe_sp__DLL10032_KC816991 GGCTCTGATGGCTTGTATATCTGTTGGTTCATATTCAGCGCCTGTCATTGAGTTCTTGGAAGAGTGGGGGCT-GAGTCTTTGGAAGAGAATGCTCATTCCTCAACACCTTGCACGAAAGTATTTGTCAATGGTGTTTGGATGGGTGTTCACCGGGACCCTGCAAATCTTGTCAAAACGCTCAGAAAACTGAGACGGAAAGATGACATTAGCCCTGAAGTGTCTGTCGTCAGGGATATCCGAGAAAAAGAACTTCGTTTGTACACCGACGCAGGCCGTGTTTGCCGGCCACTGTTTATTGTAGAAAATCA-CAACTGGCGCTGCAGAAAAAACATGTCAGGTGGCTCAATGACGGGATGAACGACAATGG-GAAGAGTATAAATGGGAACATCTTGTTAAAGGCGGCATTGTCGAGTTGTTAGATGCCGAAGAAGAGGAGACAGTCATGATCTCAATGACCCCAGAAGATTTAGAAACGTCTCGATTGCAACAAAGCGGTATTAACACGAATCAGAACGATGGTGATTTTGATCCAGCAGCAAGATTAAAAGCGGGAATAAATTCTCATAC- Rhodocybe_sp__DLL10218_KC816990 GGCTTTGATGGCTTGTATATCTGTCGGTTCATATTCGGCGCCTGTCATTGAGTTCTTGGAGGAATGGGGGCTCGAATCTTTGGAAGAAAATGCCCATTCTTCAACACCTTGCACGAAAGTATTCGTCAACGGTGTTTGGATGGGTGTTCACCGGGACCCTGCAAATCTTGTCAAAACGCTCAGAAAACTGAGGCGGAAAGACGACATTAGCCCTGAAGTGTCTGT-GTCAGGGATATTCGAGAAAAAGAACTTCGCTTGTACACCGACGCAGGCCGTGTTTGCCGGCCACTGTTTATTGTAGAAAATCAGCAACTGGCGCTGCAGAAGAAGCATGTCAGGTGGCTTAATGACGGAATGAACGACAATGGGGAAGAGTATAAGTGGGAACATCTTGTCAAAGGCGGTATTGTCGAGTTGTTAGATGCTGAGGAAGAGGAGACAGTCATGATCTCAATGACTCCAGAAGATCTGGAAACGTCTCGGTTACAACAAAGCGGTATCAATACGAACCAGAATGATGGCGATTTCGATCCAGCAGCAAGATTGAAAGCGGGGATAAATTCTCATAC- Rhodocybe_sp__DLL9846_KC816985 GGCTTTGATGGCTTGTATATCTGTCGGTTCATATTCAGCGCCTGTCATTGAGTTCTTGGAGGAATGGGGGCTCGAATCTTTGGAAGAAAATGCCCATTCTTCAACACCTTGCACGAAAGTATTCGTCAACGGTGTTTGGATGGGTGTTCACCGGGACCCTGCAAATCTTGTCAAAACGCTCAGAAAACTGAGGCGGAAAGACGACATTAGCCCCGAAGTGTCTGTCGTCAGGGATATTCGAGAAAAAGAACTTCGCTTGTACACCGACGCAGGCCGTGTTTGCCGGCCACTGTTTATTGTAGAAAATCAGCAACTGGCGCTGCAGAAGAAGCATGTCAGGTGGCTTAATGACGGAATGAACGACAATGGGGAAGAGTATAAGTGGGAACATCTTGTCAAAGGCGGTATTGTCGAGTTGTTAGATGCTGAGGAAGAGGAGACAGTCATGATCTCAATGACTCCAGAAGATCTGGAAACGTCTCGGTTACAACAAAGCGGTATCAATACGAACCAGAATGATGGCGATTTCGATCCAGCAGCAAGATTGAAAGCGGGGATAAATTCTCATAC- Rhodocybe_sp__DLL9851_KC816986 GGCTCTTATGGCTTGTATATCTGTTGGTTCATACTCAGCCCCTGTCATCGAGTTCTTGGAAGAGTGGGGGTTGGAATCCTTGGAAGAGAATGCTCACTCCTCGACGCCTTGCACCAAGGTGTTTGTCAACGGTGTATGGATGGGTGTTCATCG-GACCCAGCGAATCTCGTCAAAACGCTTAGGAAGTTGAGGAGAAAAGATGATATCAGTCCTGAAGTCTCTGTTGTCAGGGATATCCGAGAGAAGGAGCTTCGT-TATATACTGACGCAGGTCGTGT-TGTCGGCCATTGTTCATCGTAGAAAATCAACAGCTGGCATTGCAGAAGAAGCACGTCAAATGGCTTAATGAAGGGATGAATGACGACGGGGAGGAGTATAAATGGGAGCATCTTGTTAAGGGTGGTATTGTCGAACTGCTGGACGCCGAGGAAGAGGAGACGGTTATGATCTCAATGACCCCAGAAGACTTGGAAACTTCTCGATTGCAACAAAGCGGTATCAATACAAATCCGAACGACGGCGATTTCGATCCAGCAGCAAGATTGAAAGCTGGCATCAATTCTCATAC- Rhodocybe_sp__DLL9952_KC816988 GGCTCTTATGGCCTGTATCTCTGTTGGTTCATACTCAGCCCCTGTCATTGAGTTCTTAGAAGAGTGGGGGTTGGAATCCTTGGAAGAAAATGCTCATTCCTCGACACCTTGCACCAAGGTGTTTGTCAACGGCGTATGGATGGGCGTTCACCGTGACCCTGCAAACCTCGTCAAAACGCTCAGGAAGTTGAGAAGAAAAGACGATATCAGCCCTGAAGTCTCTGTTGTCAGGGATATTCGAGAGAAGGAGCTTCGTCTATACACTGACGCAGGTCGTGTTTGTCGGCCATTGTTCATTGTAGAAAATCAACAGTTGGCATTGCAGAAGAAGCACGTCAAATGGCTTAATGAAGGGATGAATGATGATGGAGAGGAGTATAAATGGGAGCATCTTGTTAAGGGTGGTATTGTCGAGCTGCTAGACGCCGAGGAAGAGGAGACAGTCATGATCTCAATGACCCCAGAAGATTTGGAAACCTCTCGATTGCAACAGAGTGGTATCAGTACGGGCCCGAACGACGGCGATTTCGATCCAGCAGCAAGGCTGAAAGCTGGTATAAATTCTCATAC- Rhodocybe_sp__DLL9957_KC816989 AGCTCTTATGGCGTGTATCTCTGTCGGTTCATATTCGGCGCCTGTCATCGAGTTCTTAGAGGAGTGGGGTCTCGAATCTTTGGAAGAAAATGCTCACTCTTCAACGCCTTGCACTAAAGTATTTGTCAACGGTGTTTGGATGGGCGTTCATCGAGACCCTGCAAATCTCGTTAAAACGCTGAGGAAGCTGAGGAGAAAAGATGACATTAGCCCAGAAGTCTCTGTTGTTAGGGATATTCGAGAAAAAGATCTTCGTCTGTACACTGATGCCGGCCGTGTTTGTCGACCATTGTTCATCGTAGAGAATCAGCAGCTAGCACTGCAGAAGAAGCACGTCAAGTGGCTTAACGAAGGCATGAACGACGAAGGGGACGAGTATAAATGGGAGCATCTTGTCAAAGGCGGTATTGTCGAGCTATTGGATGCCGAAGAAGAGGAGACGGTCATGATCTCGATGACACC-GAAGACTTGGAAACTTCTCGACTACAACAGAGTGGGGTCGGTACAAATCTCAACGACGGCGACTTTGATCCAGC-GCAAGGTTGAAGGCTGGCATAAATTCTCACAC- Rhodocybe_stipitata_KC816993 GGCTCTGATGGCTTGTATATCTGTCGGTTCATATTCAGCGCCTGTCATTGAGTTCTTGGAGGAGTGGGGGCTCGAAT-TTTGGAAGAAAATGCTCATTCTTCAACACCTTGCACGAAAGTATTCGTCAATGGTGTTTGGATGGGTGTTCACCGGGACCCTGCAAATCTTGTCAAAACGCTTAGAAAACTGAGACGAAAAGATGACATCAG-CCTGAAGTGTCTGTCGTCAGGGATATTCGAGAAAAGGAACTTCGT-TGTACACCGATGCAGGCCGTGTTTGCCGACCACTGTTTATCGTAGAAAATCA-CAACTGGCGCTGCAGAAGAAGCATGTCAGATGGCTTAATGATGGGATG-ACGACAA-G-GGAAGAGTATAAGTGGGAACATCTTGTCAAAGGTGGTATTGTCGAGTTGTTAGATGC-GAGGAAGAGGAGACAGTCATGATCTCAATGACCCCAGAAGATCTAGAAACGTCTCGATTGCAACAAAGCGGTATCAATACGAACCAGAACGATGGTGATTTCGATCCAGCAGCAAGATTGAAAGCGGGAATAAACTCTC-TAC- Rhodophana_aff__nitellina_5528_TJB_KC816962 -----------------------------------------------------------------GGGGTTTGGAATCCTTGGAAGAAAATGCTCATTCCACAACGCCTTGCACAAAAGTATTTGTGAACGGTGTTTGGATGGGTGTGCATCGTGATCCTGCGAACTTGGTGAAAACTATCAAGAAGCTGCG-CGAAAGGACGATATCAGTCCTGAAGTTTCTGTTGTGCGGGATATCCGAGAAAA-GAGCTTCGTTTATACACAGACGCTGGCCGTGTCTGTCGACCTCTTTTCATCGTCGAAAATCAGCAACTGGCGCTTCAGAAGAAACACATAAAATGGCTTAACGAAGGCTACAATGATGATGGAGACGATTACAAATGGGAACACCTCGTGAAGGGTGGTGTTGTTGAGCTTCTGGACGCGGAGGAGGAGGAGACTGTAATGATTTCTATGACGCCAGAGGATCTGGAGAATTCTCGATTGCAACAGAGTGGTATGAATCCGAACACGAATGAGGAAGAATTTGATCCAGCAGCGCGACTCAAAGCGGGCATTAACTCCCACAC- Rhodophana_aff__nitellina_DLL10199_KC816967 AGCACTCATGGCTTGTATTTCCGTTGGTTCGTACTCTGCGCCCGTTATCGAGTTCTTGGAGGAGTGGGGCTTAGAGTCTCTGGAAGAAAATGCTCATTCCACAACACCTTGCACAAAAGTGTTCGTAAATGGTGTTTGGATGGGTGTACATCGTGATCCAGCAAATTTGGTGAAAACTATCAAAAAGTTGCGACGAAAGGATGATATCAGTCCCGAAGTTTCTGTTGTGCGGGATATCCGAGAAAAAGAGCTTCGGTTATACACAGATGCTGGTCGTGTCTGTCGACCTCTTTTCATCGTCGAAAATCAACAATTAGCACTTCAGAAAAAGCACATTAAGTGGCTTAATGATGGTTACAATGATGATGGAGAAGAGTACAAGTGGGAACATCTCGTGAAAGGTGGTGTTGTTGAGCTCTTGGATGCGGAGGAGGAAGAAACTGTGATGATCTCTATGACACCAGAGGACCTAGAGACGTCTCGATTACAGCAGAGTGGCGTCAATACGGATGTGAATGAGGACGAATTTGATCCAGCCGCACGACTCAAAGCGGGTGTCAACTCACATAC- Rhodophana_melleopallens_KC816945 ----------------------------------------------ATTGAGTTC-TGGAGGAGTGGGGTTTGGAATCCTTGGAAGAAAATGCTCATTCCACAACGCCTTGCACAAAGGTATTCGTGAATGGCGTTTGGATGGGTGTGCATCGTGATCCTGCGAAT-TGGTGAAAACTATCAAGAAGCTGCGACGAAAGGACGATATCAGTCCTGAAGTCTCTGTTGTGCGGGATATCCGAGAAAAGGAGCTTCGTTTATACACAGATGCTGGCCGTGTCTGTCGACCTCTTTTCATGTCGAGAATCAGCAACTGGCGCTT-CA-AAGAAACACATCAAATGGCTTAATGATGGCTGCAATGATGATGGGGACGATTACAAATGGGAACACCTCGTGAAGGGTGGTGTTGTTGAGCTTTT-GACGCGGAGGAGGAGGAGACTGTAATGATTTCTATGACACCAGAGGATCTGGAGACCTCTCGATT-CAACAGAGTGGTGTCAATACGAACACGAATGAGGAAGAATTTGATCC-GCAGCACGACT-AAAGCTGGCATCAACTCCCACAC- Rhodophana_melleopallens_KC816946 GGCACTCATGGCTTGTATCTCCGTCGGGTCATATTCTGCGCCCGTTATTGAGTTCTTGGAAGAATGGGGCTTGGAATCCCTGGAAGAAAACGCTCATTCCACAACGCCTTGCACAAAGGTGTTTGTGAATGGTGTATGGATGGGTGTACATCGTGACCCTGCAAATTTGGTAAAAACTATCAAGAAATTGCGACGAAAGGATGATATCAGTCCTGAAGTTTCTGTTGTACGGGACATCCGAGAAAAGGAGCTTCGTTTATACACAGATGCTGGCCGCGTCTGTCGACCTCTTTTCATTGTTGAAAACCAGCAATTGGCCCTTCAGAAGAAGCACATCAAATGGCTTAA-GATGGCTACAATGACGATATAGAGGAGTATAAATGGGAACATCTCGTGAAGGGCGGTGTTATTGAGCTTCTGGACGCAGAAGAGGAGGAGACTGTGATGATTTCTATGACACCAGAGGATCTGGAGACTTCTCGACTACAGCAGAGTGGTGTCAACAC-AACACGAATGACGAAGAGTTCGATCCAGCAGCTCGACTCAAAGCGGGTATCAACTCCCACAC- Rhodophana_nitellina_KC816955 AGCACTCATGGCTTGTATCTCTGTCGGCTCGTACTCTGCGCCCG-TATTGAGTTCTTGGAAGAGTGGGGTTTGGAATCCTTGGAAGAAAATGCCCATTCCACAACGCCTTGCACAAAAGTGTTTGTGAATGGTGTTTGGATGGGTGTTCATCGTGATCCTGCGAATTTGGTGAAAACTATCAAGAAGCTGCGACGGAAGGACGATATCAGTCCTGAAGTCTCTGTTGTACGGGATATCCGAGAAAAGGAGCTTCGTTTATACACAGACGCTGGTCGTGTCTGTCGACCTCTTTTCATCGTCGAAAATCAGCAACTGGCGCTTCAAAAGAAGCACATAAAATGGCTTAATGAAGGTTACAATAATGATGGAGACGATTACAAATGGGAACACCTCGTGAAGGGCGGTGTTGTTGAGCTTCTGGACGCGGAGGAGGAGGAGACTGTCATGATTTCTATGACACCAGAGGATCTGGAGAACTCTCGATTGCAACAGA--GGTATCAATCCAAA-ACGAATGAGGAAGAATTCGATCCAGCA-CACGACTCA-AGCGGGCATTAACTCCCACAC- Rhodophana_nitellina_KC816957 ---------------------------CTCGTACTCTGCGCCCGTTATTGAGTTCTTGGAAGAGTGGGGCTTGGAATCCTTGGAAGAAAATGCCCATTCCACAACGCCTTGCACAAAAGTGTTTGTGAATGGTGTTTGGATGGGTGTTCATCGTGATCCTGCGAATTTGGTGAAAACTATCAAGAAGCTGCGACGGAAGGACGATATTAGTCCTGAAGTCTCTGTTGTACGTGATATCCGAGAAAAGGAGCTTCGTTTATACACAGACGCTGGCCGTGTTTGTCGACCTCTTTTCATCGTCGAAAATCAGCAACTGGCGCTTCAGAAGAAGCATATAAAATGGCTTAATGAAGGTTACAATGATGATGGAGACGATTACAAATGGGAACACCTCGTGAAGGGCGGTGTTGTTGAGCTTCTGGACGCGGAGGAGGAGGAGACTGTAATGATTTCTATGACACCAGAGGATCTGGAGAACTCTCGATTGCAACAGAGTGGTCTCAATCCGAACACGAATGAGGAAGAATTCGATCCAGCGGCACGACTCAAAGCGGGCATTAACTCCCACAC- Rhodophana_nitellina_KC816960 AGCGCTCATGGCTTGTATCTCTGTCGGCTCGTACTCTGCGCCCGTTATTGAGTTCTTGGAAGAGTGGGGTTTGGAATCTCTAGAAGAAAATGCTCATTCAACAACTCCTTGCACAAAAGTATTTGTAAATGGTGTTTGGATGGGTGTGCATCGTGATCCTGCGAATTTGGTAAAAACTATCAAGAAGCTACGACGAAAGGACGATATCAGTCCTGAAGTCTCTGTTGTGCGAGATATCCGAGAAAAGGAGCTTCGTTTATACACAGACGCTGGCCGTGTTTGTCGACCTCTTTTCATCGTCGAAAATCAACAACTAGCGCTTCAGAAGAAGCACATCAAATGGCTTAACGACGGCTATAATGACGATGGAGACGATTACAAATGGGAGCACCTCGTGAAGGGTGGGGTTGTTGAGCTTTTGGACGC-GAGGAGGAGGAGACCGTAATGATTTCTATGACACCAGAGGACCTGGAGACCTCTCGATTGCAACAGAGTGGTATCAATACGAA-ACGAATGAGGAAGAATTTGATCCAGCAGCACGACTCA-AGCGGGCATCAACTCCCACAC- Rhodophana_nitellina_KC816963 AGCACTCATGGCTTGTATTTCCGTTGGTTCATACTCTGCGCCCGTTATCGAGTTCTTGGAGGAGTGGGGCTTGGAGTCTTTGGAAGAAAATGCTCATTCCACAACACCTTGCACAAAGGTATTTGTAAATGGTGTTTGGATGGGTGTACATCGTGATCCAGCAAATTTGGTGAAAACTATCAAAAAATTACGACGAAAAGATGATATCAGTCCCGAAGTTTCTGTTGTGCGGGATATCCGAGAAAAAGAGCTTCGCTTATACACAGATGCTGGTCGTGTCTGTCGACCTCTTTTCATCGTCGAAAACCAGCAATTAGCACTTCAAAAAAAGCACATAAAATGGCTTAACGATGGCTACAATGATGATGGAGAAGAGTATAAGTGGGAACATCTCGTGAAGGGTGGTGTTATTGAGCTTTTGGATGCAGAGGA-GAAGAAACTGTGATGATCTCTATGACACCAGAGGACCTAGAGACCTCTCGATTACAGCAGAGTGGCGTCAATACGGATGTGAATGAAGACGAATTTGATCCGGCCGCACGACTCAAAGCAGGTGTCAACTCACATAC- Rhodophana_nitellina_KC816964 GGCACTCATGGCTTGTATCTCCGTCGGGTCATACTCTGCGCCCGTTATTGAGTTCTTGGAAGAATGGGGCTTGGA-TCC-TGGAAGAAAACGCTCATTCCACAACGCCTTGCACAAAGGTGTTTGTGAATGGTGTATGGATGGGTGTACATCGTGACCCTGCAAATTTGGTAAAAACTATCAAGAAATTGCGACGAAAGGATGATATCAGTCCTGAAGTTTCTGTTGTACGGGACATCCGAGA-AAGGAGCTTCGTTTATACACAGATGCTGGCCGCGTCTGTCGACCTCTTTTCATTGTTGAAAACCAGCAATTGGCCCTTCAGAAGAAGCACATCAAATGGCTTAATGATGGCTACAATGACGATATAGAGGAGTATAAATGGGAACATCTCGTGAAGGGCGGTGT-ATTGAGCTTCTGGACGCAGAAGAGGAGGAGACTGTGATGATTTCTATGACACCAGAGGATCTGGAGACTTCTCGACTACAGCAGAGTGGTG-CAACACAAACACGAATGACGAAGAGTTCGATCCAGCGGCTCGACTCAAAGCGGGTATCAACTCCCACAC- Rhodophana_nitellina_KC816965 GGCACTCATGGCTTGTATCTCCGTCGGGTCATACTCTGCGCCCGTTATTGAGTTCTTGGAAGAGTGGGGCTTGGAATCC-TGGAAGAAAATGCTCATTCCACAACGCCTTGCACAAAGGT-TTTGTGAATGGTGTATGGATGGGTGTACATCGTGACCCTGCAAATTTGGTAAAAACTATCAAGAAGTTGCGACGAAAGGATGATATCAGTCCTGAAGTTTCTGTTGTACG-GACATCCGAGAAAAGGAGCTTCGTTTATACACAGATGCTGGCCGCGTCTGTCGACCTCTTTTCATTGTTGAAAACCAGCAATTGGCCCTTCAGAAGAAGCACATCAAATGGCTCAATGATGGCTACAATGACGACATAGAGGAGTACAAATGGGAACATCTCGTGAAGGGCGGTGTTATTGAGCTTCTGGATGCAGAAGAGGAGGAGACTGTGATGATTTCTATGAC-CCAGAGGATCTGGAGACTTCTCGACTACAGCAGAGTGGTGTCAACGCAAACACGAATGACGAAGAGTTCGATCCAGCAGCTCGACTCAAAGCGGGTATCAACTCCCACAC- Rhodophana_sp__434_HAMA_KC816984 GGCACTCATGGCATGTATCTCTGTCGGTTCGTACTCTGCGCCTGTTATCGAGTTCTTAGAAGAGTGGGGCTTGGAATCTTTGGAAGAGAATGCTCATTCAACAACGCCTTGCACAAAGGTATTCGTGAATGGTGTTTGGATGGGTGTGCATCGTGATCCTGCAAATTTGGTGAAAACTATCAAGAAATTGCGACGAAAGGATGATATTAGTCCTGAAGTTTCTGTTGTGCGGGACATCCGGGAAAAGGAACTTCGTTTATATACGGATGCTGGTCGCGTTTGTCGGCCTCTTTTCATCGTCGAAAATCAGCAATTGGCGCTCCAGAAGAAGCATATTAGGTGGCTTAACGAGGGCTATAATGACGAAGGAGAGGAGTACAAGTGGGAGCACCTTGTGAAGGGGGGTGTTGTTGAGCTACTAGACGCGGAGGAAGAGGAAACCGTAATGATTTCTATGACACCAGAAGATCTGGAGACCTCGCGATTACAACAGAGTGGTGTTAATACGAATCCGAATGACGAAGAGTTTGACCCAGCAGCAAGACTTAAAGCGGGCATCAACTCTCACAC- Rhodophana_squamulosa AGCACTCATGGCATGCATCTCTGTCGGTTCGTACTCTGCACCTGTTATCGAGTTCTTAGAAGAGTGGGGTTTGGAATCTTTGGAAGAAAATGCTCATTCAACAACTCCTTGCACAAAGGTATTTGTGAATGGTGTTTGGATGGGCGTGCACCGTGATCCTGCAAATTTGGTGAAAACTATCAAGAAATTGCGACGAAAGGATGATATTAGTCCTGAAGTTTCTGTTGTGCGGGACATCCGGGAAAAGGAGCTTCGTTTATATACGGATGCTGGTCGCGTCTGTCGGCCTCTTTTCATTGTCGAAAACCAGCAATTGGCGCTCCAGAAGAAACATGTTAGATGGCTTAATGATGGCTACAACGATGAAGGAGAGGAGTACAAGTGGGAGCACCTTGTGAAGGGCGGTGTTGTTGAACTACTAGACGCAGAGGAAGAGGAGACCGTAATGATTTCTATGACACCAGAAGATCTGGAGACCTCACGATTACAACAGAGCGGTGTTCATACGAATCCGAATGACGAAGACTTTGACCCAGCAGCAAGACTTAAAGCGGGCATCAACTCCCACAC- Rhodophana_stangliana_KC816992 GGCATTAATGGCCTGTATCTCTGTCGGTTCTTACTCTGCGCCCGTTATTGAGTTTTTGGAGGAGTGGGGCTTGGAGTCCTTGGAAGAAAACGCCCATTCCACAACGCCTTGTACAAAGGTATTTGTGAATGGTGTTTGGATGGGCGTGCATCGTGATCCAGCGAATTTGGTGAAAACGATCAAGAAGCTACGACGAAAAGATGATATCAGCCCGGAAGTCTCTGTCGTGCGGGATATCCGAGAAAAGGAGCTCCGATTATACACCGACGCTGGTCGTGTCTGCCGACCTCTTTTTATCGTTGAAA-CCAACAATTGGCGCTTCAGAAGAAGCACATCAAATGGCTCAATGACGATTGCAATGATGATGGCGAGGAGTACAAGTGGGAGCACCTCGTGAAGGGCGGTGTTGTTGAGCTTCTGGACGCCGAGGAGGAAGAGACTGTTATGATTTCTATGACACCAGAGGATCTGGAGACTTCTCGATTACAGCAAAGTGGTGTTAGCACAAACACGAACGACGAGGAGTTTGATCCAGCAGCTCGACTCAAAGCAGGCATCAACTCCCACAC- Tricholoma_aurantium_JN019705 ---------------TATATCTGTCGGCTCCTATTCTGCGCCTGTCATCGAGTTCCTGGAAGAGTGGGGACTAGAATCTCTTGAGGAGAATGCACATTCATCCACACCTTGTACCAAAGTGTTTGTCAATGGTGTGTGGATGGGTGTTCACCGTGACCCTGCAAATCTAGTGAAGACCATCAAAAAGTTGCGACGAAAAGATGATATCAGCCCTGAGGTGTCGGTTGTTCGGGATATCCGGGAGAAGGAATTGCGATTGTACACTGATGCAGGACGCGTTTGTCGACCACTATTCATCGTCGAAAATCAACAGCTAGCGCTACAAAAGAAGCATATAAGGTGGCT-AACAGCGGATTCAATGACGATGGAGAAGAATATAAGTGGGAGCAGCTTGTGAAAGGCGGTATCATTGAGTTATTAGACGCGGAGGAGGAAGAAACCGTCATGATATCAATGACACCGGAAGATCTGGAGAACTCCAGGTTGCATCAGAGCGGAATTGATCCTCATACCA-TGACGGGGAGTTCGATCCTGCTGCACGATTGAAAGCTGGAATCAACTCGCACACG ; END; BEGIN TREES; TITLE Rhodophana_squamulosa; LINK TAXA = Taxa1; TRANSLATE 1 Tricholoma_aurantium_JN019705, 2 Rhodophana_squamulosa, 3 Rhodophana_nitellina_KC816960, 4 Rhodophana_sp__434_HAMA_KC816984, 5 Clitopilus_nitellinus__GQ289282, 6 Rhodophana_melleopallens_KC816946, 7 Rhodophana_nitellina_KC816964, 8 Clitopilus_apalus_KC816906, 9 Clitopilus_cf__argentines_KC81690, 10 Clitopilus_sp__8024_TJB_KC816908, 11 Clitopilus_sp__8133_TJB_KC816909, 12 Clitopilus_crispus_KC816910, 13 Clitopilus_crispus_KC816911, 14 Clitopilus_hobsonii_KC816916, 15 Clitopilus_hobsonii_KC816912, 16 Clitopilus_aff__hobsoni_KC816928, 17 Clitopilus_hobsonii_KC816913, 18 Clitopilus_hobsonii_KC816914, 19 Clitopilus_hobsonii_KC816915, 20 Clitopilus_hobsonii_KC816918, 21 Clitopilus_aff__hobsonii_grp__KC816918, 22 Clitopilus_paxilloides_KC816919, 23 Clitopilus_peri_KC816921, 24 Clitopilus_peri_KC816920, 25 Clitopilus_peri_KC816922, 26 Clitopilus_cf__prunulus_KC816927, 27 Clitopilus_prunulus_KC816926, 28 Clitopilus_prunulus_KC816923, 29 Clitopilus_prunulus_KC816924, 30 Clitopilus_prunulus_KC816925, 31 Clitopilus_sp_7130_TJB_KC816929, 32 Clitopilus_venososulcatus_KC816930, 33 Rhodocybe_alutacea_KC816931, 34 Rhodocybe_caelata_KC816933, 35 Rhodocybe_caelata_KC816934, 36 Rhodocybe_caelata_KC816932, 37 Rhodocybe_caelata_KC816978, 38 Rhodocybe_collybioides_KC816935, 39 Clitocella_fallax_KC816938, 40 Clitocella_fallax_KC816936, 41 Clitocella_fallax_KC816937, 42 Rhodocybe_formosa_KC816939, 43 Rhodocybe_fuliginea_KC816940, 44 Clitopilopsis_hirneola_KC816904, 45 Clitopilopsis_hirneola_KC816905, 46 Clitopilopsis_hirneola_KC816977, 47 Rhodocybe_hondensis_KC816941, 48 Rhodocybe_lateritia_KC816942, 49 Rhodocybe_luteocinnamomea_KC816943, 50 Rhodocybe_mellea_KC816944, 51 Rhodophana_melleopallens_KC816945, 52 Rhodocybe_minutispora_KC816947, 53 Clitocella_mundula_KC816952, 54 Clitocella_mundula_KC816954, 55 Clitocella_mundula_KC816950, 56 Clitocella_mundula_KC816953, 57 Clitocella_mundula_KC816951, 58 Clitocella_mundula_KC816948, 59 Rhodophana_nitellina_KC816957, 60 Rhodophana_nitellina_KC816963, 61 Rhodophana_nitellina_KC816965, 62 Rhodophana_nitellina_KC816955, 63 Rhodophana_aff__nitellina_5528_TJB_KC816962, 64 Rhodophana_aff__nitellina_DLL10199_KC816967, 65 Rhodocybe_pallidogrisea_KC816968, 66 Rhodocybe_paurii_KC816969, 67 Clitocella_popinalis_KC816971, 68 Clitocella_popinalis_KC816974, 69 Clitocella_popinalis_KC816976, 70 Clitocella_popinalis_KC816970, 71 Clitocella_popinalis_KC816973, 72 Rhodocybe_pseudopiperita_KC816979, 73 Rhodocybe_reticulate_KC816980, 74 Rhodocybe_rhizogena_KC816981, 75 Rhodocybe_roseiavellanea_KC816982, 76 Rhodocybe_sp__DLL9851_KC816986, 77 Rhodocybe_sp__DLL9846_KC816985, 78 Rhodocybe_sp__DLL9952_KC816988, 79 Rhodocybe_sp__DLL9957_KC816989, 80 Rhodocybe_sp__DLL10218_KC816990, 81 Rhodocybe_sp__DLL10032_KC816991, 82 Rhodophana_stangliana_KC816992, 83 Rhodocybe_stipitata_KC816993, 84 82Rhodophana_sp__6167_TJB_KC816983, 85 Clitopilus_fallax_GQ289276, 86 Clitopilus_fallax_GQ289275, 87 Clitopilus_geminus_GQ289277, 88 Clitopilus_hirneolus_GQ289278, 89 Clitopilus_popinalis_GQ289280, 90 Clitopilus_nitellinus_GQ289281, 91 Clitopilus_pallidogriseus_GQ289283, 92 Clitopilus_pseudopiperitus_GQ289284, 93 Clitopilus_stanglianus_GQ289285, 94 Entoloma_albidoquadratum_GQ289223, 95 Entoloma_griseolazulinum_GQ289237, 96 Entoloma_indoviolaceum_GQ289243, 97 Entoloma_tectonicola_GQ289266, 98 Entoloma_crassicystidiatum_JQ993083, 99 Entoloma_violaceovillosum_GQ289273, 100 Entoloma_prunuloides_GQ289255, 101 Entoloma_serrulatum_GQ289263, 102 Pouzarella_pamiae_HQ876496; TREE 'PAUP_1' = [&R] ((1:0.250883,(((95:0.108259,100:0.090502):0.031429,(94:0.179656,(96:0.160421,((97:0.123202,101:0.154244):0.030816,(102:0.125706,(98:0.080012,99:0.094166):0.013529):0.124916):0.006295):0.007935):0.05468):0.060834,((2:0.02928,4:0.021506):0.048168,((82:0.020685,93:0.03808):0.07453,((60:0.019122,64:0.024423):0.086735,((90:0.010588,(61:0.006328,(6:0.001555,7:0.001532):0.006256):0.001842):0.053695,(51:0.051262,(3:0.035932,((59:0.011596,62:0.007996):0.013316,(5:0.001601,(63:1.0E-8,84:0.002423):0.002594):0.013708):0.008777):0.009458):0.021787):8.81E-4):8.59691E-7):0.022202):0.092936):0.019312):0.0361065,(((35:0.092945,38:0.09324):0.013511,((50:0.078714,79:0.061515):0.052118,((81:0.035707,((34:1.0E-8,83:1.0E-8):0.018437,(43:8.81409E-7,(77:0.001525,80:0.001521):0.009847):0.019398):1.72853E-6):0.094461,((66:0.07138,(74:0.051289,(36:0.029241,(52:1.0E-8,(37:1.0E-8,42:1.0E-8):0.0):0.060355):0.004887):0.002449):0.006986,(((76:0.038393,78:0.031808):0.003504,(73:1.0E-8,(65:1.0E-8,91:1.0E-8):1.0E-8):0.060777):0.007115,((48:0.050375,75:0.053221):0.012228,(87:0.054919,(49:0.099509,(33:0.021117,(47:0.009556,(72:0.00666,92:0.006953):0.004488):0.0):0.050186):0.012693):0.013552):0.03467):0.013954):0.022477):0.011535):0.04698):0.025853,((45:0.006701,(44:1.0E-8,(46:0.001596,88:0.004138):0.002275):0.004091):0.126584,(((56:0.027937,((41:0.008323,85:0.027828):0.012312,(40:1.0E-8,(39:1.0E-8,86:1.0E-8):1.0E-8):0.021811):0.020525):0.016841,(((53:1.0E-8,57:0.00303):0.009312,(55:0.006179,(71:1.0E-8,89:1.0E-8):0.004878):0.0):0.019274,(54:0.006671,(67:1.0E-8,(69:1.0E-8,(68:1.0E-8,(58:0.003167,70:6.31387E-7):1.23147E-7):0.0):0.002384):0.008069):0.025979):0.031517):0.097523,((((8:0.001387,(12:1.0E-8,13:1.0E-8):0.001651):0.060195,(25:1.0E-8,(23:1.0E-8,24:1.0E-8):1.0E-8):0.035349):0.051785,(26:0.028202,(30:0.020495,(29:0.009179,(28:0.001506,(22:1.0E-8,27:1.0E-8):0.001559):0.00819):0.001276):2.60644E-6):0.12917):0.058889,(((14:0.110505,17:0.102535):0.018879,((15:0.022962,21:0.016923):0.100111,(18:1.0E-8,19:1.0E-8):0.085333):2.74884E-6):0.090688,((16:0.03957,20:0.039966):0.037574,((9:1.0E-8,31:1.0E-8):0.066798,(32:0.020546,(10:0.005797,11:1.0E-8):0.006601):0.01798):0.073911):0.089):0.026771):0.051305):0.080305):0.068938):0.0361065); END;