#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 4:46 GMT TreeBASE (cc) 1994-2008 Study reference: Ando Y., Masuya H., Motohashi K., Linnakoski R., & Yamaoka Y. 2016. Phylogenetic relationship of Japanese isolates belonging to the Grosmannia piceiperda complex (Ophiostomatales). Mycoscience, 57: 123-135. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S18144] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=74; TAXLABELS Grosmannia__piceiperda_D_JF280023 Grosmannia_aenigmatica_AY534937 Grosmannia_aenigmatica_AY534938 Grosmannia_aenigmatica_YCC111 Grosmannia_aenigmatica_YCC72 Grosmannia_huntii_DQ354932 Grosmannia_huntii_DQ354933 Grosmannia_laricis_DQ062008 Grosmannia_laricis_DQ062009 Grosmannia_laricis_YCC277 Grosmannia_laricis_YCC349 Grosmannia_laricis_YCC389 Grosmannia_laricis_YCC440 Grosmannia_laricis_YCC441 Grosmannia_laricis_YCC488 Grosmannia_laricis_YCC590 Grosmannia_piceiperda_B_AY707195 Grosmannia_piceiperda_B_DQ268644 Grosmannia_piceiperda_B_JF280025 Grosmannia_piceiperda_B_JF280033 Grosmannia_piceiperda_C_DQ296112 Grosmannia_piceiperda_C_JF280026 Grosmannia_piceiperda_C_JF280030 Grosmannia_piceiperda_C_JF280031 Grosmannia_piceiperda_C_JF280032 Grosmannia_piceiperda_D_JF280024 Grosmannia_piceiperda_E_DQ268642 Grosmannia_piceiperda_E_DQ268643 Grosmannia_piceiperda_F_FJ269188 Grosmannia_piceiperda_F_FJ269189 Grosmannia_sp._D_YCC242 Grosmannia_sp._D_YCC549 Grosmannia_sp._D_YCC593 Grosmannia_sp._D_YCC625 Grosmannia_sp._D_YCC626 Grosmannia_sp._D_YCC631 Grosmannia_sp._D_YCC694 Grosmannia_sp._D_YCC695 Grosmannia_sp._D_YCC710 Grosmannia_sp._D_YCC711 Grosmannia_sp._D_YCC724 Grosmannia_sp._D_YCC733 Grosmannia_sp._D_YCC734 Grosmannia_sp._D_YCC735 Grosmannia_sp._D_YCC736 Grosmannia_sp._J1_YCC348 Grosmannia_sp._J1_YCC614 Grosmannia_sp._J1_YCC705 Grosmannia_sp._J1_YCC723 Grosmannia_sp._J2_YCC312 Grosmannia_sp._J2_YCC314 Grosmannia_sp._J3_YCC495 Grosmannia_sp._J3_YCC496 Grosmannia_sp._J3_YCC497 Grosmannia_sp._J4_YCC318 Grosmannia_sp._J4_YCC399 Grosmannia_sp._J4_YCC591 Grosmannia_sp._J5_YCC300 Grosmannia_sp._J5_YCC416 Grosmannia_sp._J5_YCC417 Grosmannia_sp._J5_YCC468 Grosmannia_sp._J5_YCC469 Grosmannia_sp._J5_YCC615 Grosmannia_sp._J5_YCC679 Grosmannia_sp._J5_YCC681 Grosmannia_sp._J6_YCC432 Grosmannia_sp._J6_YCC433 Grosmannia_sp._J6_YCC470 Grosmannia_sp._J7_YCC452 Grosmannia_sp._J7_YCC453 Grosmannia_sp._J7_YCC455 Grosmannia_sp._J7_YCC501 Grosmannia_sp._J8_YCC507 Grosmannia_sp._J8_YCC508 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=110; TAXLABELS Grosmannia_abiocarpa_AJ538339 Grosmannia_aenigmatica_AY553389 Grosmannia_aenigmatica_YCC111 Grosmannia_aenigmatica_YCC72 Grosmannia_alacris_JN135313 Grosmannia_clavigera_AY544613 Grosmannia_cucullata_AJ538335 Grosmannia_dryocoetidis_AJ538340 Grosmannia_galeiformis_AY744552 Grosmannia_koreana_AB222065 Grosmannia_laricis_DQ062074 Grosmannia_laricis_YCC277 Grosmannia_laricis_YCC349 Grosmannia_laricis_YCC389 Grosmannia_laricis_YCC441 Grosmannia_laricis_YCC488 Grosmannia_laricis_YCC590 Grosmannia_leptographioides_AF343710 Grosmannia_olivacea_AJ538337 Grosmannia_olivaceapini_AJ538336 Grosmannia_penicillata_DQ097851 Grosmannia_piceiperda_B_AY707209 Grosmannia_piceiperda_B_JF279973 Grosmannia_piceiperda_C_JF279969 Grosmannia_piceiperda_C_JF279970 Grosmannia_piceiperda_C_JF279971 Grosmannia_piceiperda_C_JF279972 Grosmannia_piceiperda_D_JF279968 Grosmannia_radiaticola_AY744551 Grosmannia_robusta_AY544619 Grosmannia_serpens_JN135314 Grosmannia_sp._D_YCC242 Grosmannia_sp._D_YCC549 Grosmannia_sp._D_YCC593 Grosmannia_sp._D_YCC625 Grosmannia_sp._D_YCC626 Grosmannia_sp._D_YCC631 Grosmannia_sp._D_YCC694 Grosmannia_sp._D_YCC695 Grosmannia_sp._D_YCC710 Grosmannia_sp._D_YCC711 Grosmannia_sp._D_YCC724 Grosmannia_sp._D_YCC733 Grosmannia_sp._D_YCC734 Grosmannia_sp._D_YCC735 Grosmannia_sp._D_YCC736 Grosmannia_sp._J1_YCC348 Grosmannia_sp._J1_YCC614 Grosmannia_sp._J1_YCC705 Grosmannia_sp._J1_YCC723 Grosmannia_sp._J2_YCC312 Grosmannia_sp._J2_YCC314 Grosmannia_sp._J3_YCC495 Grosmannia_sp._J3_YCC496 Grosmannia_sp._J3_YCC497 Grosmannia_sp._J4_YCC318 Grosmannia_sp._J4_YCC399 Grosmannia_sp._J4_YCC591 Grosmannia_sp._J5_YCC300 Grosmannia_sp._J5_YCC416 Grosmannia_sp._J5_YCC417 Grosmannia_sp._J5_YCC468 Grosmannia_sp._J5_YCC469 Grosmannia_sp._J5_YCC615 Grosmannia_sp._J5_YCC679 Grosmannia_sp._J5_YCC681 Grosmannia_sp._J6_YCC432 Grosmannia_sp._J6_YCC433 Grosmannia_sp._J6_YCC470 Grosmannia_sp._J7_YCC452 Grosmannia_sp._J7_YCC453 Grosmannia_sp._J7_YCC455 Grosmannia_sp._J7_YCC501 Grosmannia_sp._J8_YCC507 Grosmannia_sp._J8_YCC508 Leptographium_abieticolens_AF343701 Leptographium_alethinum_AF343685 Leptographium_altius_HQ406851 Leptographium_americanum_DQ062079 Leptographium_bhutanense_EU650187 Leptographium_bistatum_AY348305 Leptographium_castellanum_JN135317 Leptographium_celere_HQ406834 Leptographium_chlamydatum_EU979333 Leptographium_curviconidium_HQ406850 Leptographium_curvisporum_EU979328 Leptographium_douglasii_AY553381 Leptographium_eucalyptophilum_AF343703 Leptographium_fruticetum_DQ097847 Leptographium_gibbsii_JN135316 Leptographium_latens_HQ406845 Leptographium_longiclavatum_AY816686 Leptographium_lundbergii_DQ062068 Leptographium_manifestum_HQ406839 Leptographium_neomexicanum_AY553382 Leptographium_pinicolum_DQ062060 Leptographium_pinidensiflorae_AY707199 Leptographium_pistaciae_HQ406846 Leptographium_pityophilum_AF343679 Leptographium_pyrinum_DQ062072 Leptographium_reconditum_AF343690 Leptographium_sinoprocerum_EU296773 Leptographium_taigense_JF279980 Leptographium_terebrantis_EU296777 Leptographium_truncatum_DQ062052 Leptographium_wageneri_var._ponderosum_AF343708 Leptographium_wageneri_var._pseudotsugae_AF343706 Leptographium_wageneri_var._wageneri_AF343707 Leptographium_yamaokae_JN135315 Leptographium_yunnanense_AY553415 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=67; TAXLABELS Grosmannia_aenigmatica_AY536184 Grosmannia_aenigmatica_YCC111 Grosmannia_aenigmatica_YCC72 Grosmannia_huntii_DQ354937 Grosmannia_huntii_DQ354938 Grosmannia_laricis_DQ062041 Grosmannia_laricis_DQ062042 Grosmannia_laricis_YCC277 Grosmannia_laricis_YCC349 Grosmannia_laricis_YCC389 Grosmannia_laricis_YCC440 Grosmannia_laricis_YCC441 Grosmannia_laricis_YCC488 Grosmannia_laricis_YCC590 Grosmannia_piceiperda_B_JF280077 Grosmannia_piceiperda_B_JF280078 Grosmannia_piceiperda_B_JF280079 Grosmannia_piceiperda_C_JF280072 Grosmannia_piceiperda_C_JF280073 Grosmannia_piceiperda_C_JF280074 Grosmannia_piceiperda_C_JF280075 Grosmannia_piceiperda_C_JF280076 Grosmannia_piceiperda_D_JF280070 Grosmannia_piceiperda_D_JF280071 Grosmannia_sp._D_YCC242 Grosmannia_sp._D_YCC549 Grosmannia_sp._D_YCC593 Grosmannia_sp._D_YCC625 Grosmannia_sp._D_YCC626 Grosmannia_sp._D_YCC631 Grosmannia_sp._D_YCC694 Grosmannia_sp._D_YCC695 Grosmannia_sp._D_YCC710 Grosmannia_sp._D_YCC711 Grosmannia_sp._D_YCC724 Grosmannia_sp._D_YCC733 Grosmannia_sp._D_YCC734 Grosmannia_sp._D_YCC735 Grosmannia_sp._D_YCC736 Grosmannia_sp._J1_YCC348 Grosmannia_sp._J1_YCC614 Grosmannia_sp._J1_YCC705 Grosmannia_sp._J1_YCC723 Grosmannia_sp._J2_YCC312 Grosmannia_sp._J2_YCC314 Grosmannia_sp._J3_YCC495 Grosmannia_sp._J3_YCC496 Grosmannia_sp._J3_YCC497 Grosmannia_sp._J4_YCC318 Grosmannia_sp._J4_YCC399 Grosmannia_sp._J4_YCC591 Grosmannia_sp._J5_YCC300 Grosmannia_sp._J5_YCC416 Grosmannia_sp._J5_YCC417 Grosmannia_sp._J5_YCC468 Grosmannia_sp._J5_YCC615 Grosmannia_sp._J5_YCC679 Grosmannia_sp._J5_YCC681 Grosmannia_sp._J6_YCC432 Grosmannia_sp._J6_YCC433 Grosmannia_sp._J6_YCC470 Grosmannia_sp._J7_YCC452 Grosmannia_sp._J7_YCC453 Grosmannia_sp._J7_YCC455 Grosmannia_sp._J7_YCC501 Grosmannia_sp._J8_YCC507 Grosmannia_sp._J8_YCC508 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M32972] TITLE Grosmannia_piceiperda_complex_Fig1_BT_ML; LINK TAXA = Taxa1; DIMENSIONS NCHAR=277; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Grosmannia__piceiperda_D_JF280023 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_aenigmatica_AY534937 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAAAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGTCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_aenigmatica_AY534938 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAAAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGTCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_aenigmatica_YCC111 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAAAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGTCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_aenigmatica_YCC72 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAAAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGTCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_huntii_DQ354932 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTCCGGGTCTGGAAGAATGTCTATGGTGTGTAAGTGTATCTAATTTGTTCTATCAGGTACAACGGCACGTCTGAGCTCCAGCTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTACGTGCCTCGCGCCGTCCTAGTCGATCTCGAGCCCGGTACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCTGACAACTTCGTTTT Grosmannia_huntii_DQ354933 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTCCGGGTCTGGAAGAATGTCTATGGTGTGTAAGTGTATCTAATTTGTTCTATCAGGTACAACGGCACGTCTGAGCTCCAGCTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTACGTGCCTCGCGCCGTCCTAGTCGATCTCGAGCCCGGTACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCTGACAACTTCGTTTT Grosmannia_laricis_DQ062008 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_laricis_DQ062009 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_laricis_YCC277 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_laricis_YCC349 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_laricis_YCC389 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_laricis_YCC440 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_laricis_YCC441 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_laricis_YCC488 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_laricis_YCC590 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_B_AY707195 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGTACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_B_DQ268644 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGTACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_B_JF280025 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGTACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_B_JF280033 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGTACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_C_DQ296112 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAATAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_C_JF280026 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAATAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_C_JF280030 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAATAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_C_JF280031 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAATAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_C_JF280032 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAATAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_D_JF280024 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_E_DQ268642 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_E_DQ268643 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_F_FJ269188 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTCTCAGATACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_piceiperda_F_FJ269189 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTCTCAGATACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC242 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC549 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC593 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC625 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC626 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC631 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC694 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC695 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC710 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC711 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC724 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC733 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC734 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC735 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._D_YCC736 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGAAAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J1_YCC348 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J1_YCC614 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J1_YCC705 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J1_YCC723 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTAAAAGAGTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J2_YCC312 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J2_YCC314 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J3_YCC495 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J3_YCC496 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J3_YCC497 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J4_YCC318 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J4_YCC399 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J4_YCC591 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J5_YCC300 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J5_YCC416 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J5_YCC417 AGGCAGCAGATCTCCAGCGAGCACGGTCTTGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J5_YCC468 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J5_YCC469 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J5_YCC615 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J5_YCC679 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J5_YCC681 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J6_YCC432 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J6_YCC433 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J6_YCC470 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J7_YCC452 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAAATTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J7_YCC453 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAAATTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J7_YCC455 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAAATTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J7_YCC501 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAAATTGTCTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTGCGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J8_YCC507 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTTTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTACGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT Grosmannia_sp._J8_YCC508 AGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGCGTGTAGGTTTTCAGTTGTGAAAGAATGTTTATTGTGTGTATGTGTATCTAATTCATTCTATCAGGTACAACGGCACGTCTGAGCTCCAACTCGAGCGCATGAGCGTGTACTTCAACGAGGCTTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACGATGGATGCCGTACGCGCCGGCCCCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTTTT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M32973] TITLE Grosmannia_piceiperda_complex_Fig2_EF1a_ML; LINK TAXA = Taxa3; DIMENSIONS NCHAR=500; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Grosmannia_aenigmatica_AY536184 CCACCGTTGCTATGGGATAATTCTTTTTACCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCTATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATCCCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_aenigmatica_YCC111 CCACCGTTGCTATGGGATAATTCTTTTTACCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCTATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATCCCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_aenigmatica_YCC72 CCACCGTTGCTATGGGATAATTCTTTTTACCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCTATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATCCCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_huntii_DQ354937 CCATCCCACCTGTTGGAGAAGTCTCTCTGCTTTTCCCCTACTGCACGACACGTTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCTTCCCTGTCCTTTCTGCCTTGTGGGCCCTAAAATTTTTTGGGCGGTCAGGTTCCAAGCATAACCATCTGGTGTGCACGGACCATAAATTAAAACCCCATACCCCCATAACCACTCTACTCACGCCATCTCGTCTCCACCTGCTTGCGTTCGAATTCGCCGCTAACACCCACACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACCGTCATTGACGCCCCGGGTCATCGTGATTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCCGGTACGGGTGAGTT Grosmannia_huntii_DQ354938 CCATCCCACCTGTTGGAGAAGTCTCTCTGCTTTTCCCCTACTGCACGACACGTTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCTTCCCTGTCCTTTCTGCCTTGTGGGCCCTAAAATTTTTTGGGCGGTCAGGTTCCAAGCATAACCATCTGGTGTGCACGGACCATAAATTAAAACCCCATACCCCCATAACCACTCTACTCACGCCATCTCGTCTCCACCTGCTTGCGTTCGAATTCGCCGCTAACACCCACACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCCCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACCGTCATTGACGCCCCGGGTCATCGTGATTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCCGGTACGGGTGAGTT Grosmannia_laricis_DQ062041 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTACTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_laricis_DQ062042 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTACTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_laricis_YCC277 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTACTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_laricis_YCC349 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTACTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_laricis_YCC389 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTACTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_laricis_YCC440 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTACTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_laricis_YCC441 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTACTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_laricis_YCC488 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTACTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_laricis_YCC590 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTACTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_piceiperda_B_JF280077 CCACCGTTGCTATGGGATAATTCTTTTTACCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCTATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCTGAATCGGCCGCTAATACTCAAACCAGGAAGCTGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_piceiperda_B_JF280078 CCACCGTTGCTATGGGATAATTCTTTTTACCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCTATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCTGAATCGGCCGCTAATACTCAAACCAGGAAGCTGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_piceiperda_B_JF280079 CCACCGTTGCTATGGGATAATTCTTTTTACCCTTTCCCTACTGCACGACACTTTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCTATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCTGAATCGGCCGCTAATACTCAAACCAGGAAGCTGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_piceiperda_C_JF280072 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTTGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCTTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_piceiperda_C_JF280073 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAAAAAGTGGGGTTTGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCTTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_piceiperda_C_JF280074 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTTGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCTTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_piceiperda_C_JF280075 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTTGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCTTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACGATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_piceiperda_C_JF280076 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAAAAAGTGGGGTTTGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCTTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACGATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_piceiperda_D_JF280070 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_piceiperda_D_JF280071 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC242 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCTATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC549 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC593 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC625 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC626 CCACCGTTGCTATGGAATAATTGTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC631 CCATCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC694 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC695 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC710 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC711 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC724 CCACCGTTGCTATGGAATAATTGTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC733 CCATCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC734 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC735 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._D_YCC736 CCACCGTTGCTATGGAATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACTCAAACTAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J1_YCC348 CCACCATTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTCCTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J1_YCC614 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTCCTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J1_YCC705 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTCCTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J1_YCC723 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCGAAAAGTGGGGTTGGAGGGGCAATTCCTCCATGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAGAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACATACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J2_YCC312 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTAAGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J2_YCC314 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTAAGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J3_YCC495 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGTCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTAAGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J3_YCC496 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGTCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTAAGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J3_YCC497 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGTCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTAAGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J4_YCC318 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATCTCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTAAGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J4_YCC399 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATCTCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTAAGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J4_YCC591 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATCTCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTAAGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J5_YCC300 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J5_YCC416 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J5_YCC417 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J5_YCC468 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J5_YCC615 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J5_YCC679 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J5_YCC681 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J6_YCC432 CCACCGTTGCTATGGGATAACTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTACTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATTGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGTCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J6_YCC433 CCACCGTTGCTATGGGATAACTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTACTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATTGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGTCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J6_YCC470 CCACCGTTGCTATGGGATAACTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTACTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCATCTGGTGTGCCTGGACCACAATTGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGTCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J7_YCC452 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCAACTGCACGACACATTCTATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTTAGCAAAGCCATCTGGTGTGCCTAGACCACAATTGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGCCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAATACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J7_YCC453 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCAACTGCACGACACATTCTATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTTAGCAAAGCCATCTGGTGTGCCTAGACCACAATTGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGCCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAATACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J7_YCC455 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCAACTGCACGACACATTCTATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTTAGCAAAGCCATCTGGTGTGCCTAGACCACAATTGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGCCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAATACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J7_YCC501 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCAACTGCACGACACATTCTATTATCAGAAAGTGGGGTTGGAGGGGCAATTCCTCCCTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTTAGCAAAGCCATCTGGTGTGCCTAGACCACAATTGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGCCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAATACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J8_YCC507 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCTTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCGTCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT Grosmannia_sp._J8_YCC508 CCACCGTTGCTATGGGATAATTCTTTTTGCCCTTTCCCTACTGCACGACACATTCCATTATCAGAAAGTGGGGCTGGAGGGGCAATTCCTCCTTGTCTTTTCTGCCTTGTGGGCCCTGAAAATTTTTGGGCGGTCAGGTTTTAAGCAAAGCCGTCTGGTGTGCCTGGACCACAATCGGATCTACTCCAACCCCATACCCCATCCACTCACGCCATGTCGTCCCCACCTACTTATGTCCGAATCGGCCGCTAATACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGCGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTCACGGTCATTGACGCCCCGGGCCATCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCCGCTGGTACGGGTGAGTT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M32971] TITLE Grosmannia_piceiperda_complex_FigS1_rDNA_M; LINK TAXA = Taxa2; DIMENSIONS NCHAR=522; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Grosmannia_abiocarpa_AJ538339 CGTGGTGTTGGGGCATCTGCGGCGGCCGAGGCCCCGCAGCCTAAAACCCAGTGGCGGGCCGGCAGAGGCTCCGAGCGCAGTAAGCATTAGCCCTCGCTCCGGACGCCCCTGCGCAGCTCGCCCTGGCTTGCAGACTTCTAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAA Grosmannia_aenigmatica_AY553389 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_aenigmatica_YCC111 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_aenigmatica_YCC72 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_alacris_JN135313 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_clavigera_AY544613 CGTGGTGTTGGGGCGTCTGCGGCCAGTAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCTGGACGCTCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_cucullata_AJ538335 CGTGGTGTTGGGGCGACTGCGACCGATCGTCCGGCGCAGCCTCAAAGCAAGTGGCGGGCCGGCAGCGTCTCCGAGCGCAGTAAGCATTTGCCCTCGCCCTGGACGATGCTGCGCGCCCTGCCCCCGCAAGTCTATCTCAAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTTGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCGTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCTAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_dryocoetidis_AJ538340 CGTGGTGTTGGGGCGTCTGCGGCGGCCGAGGCCCCGCAGCCCGAAACCCAGTGGCGGGCCGGCAGAGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCTGGACGCCCCTGCGCAGCTCGCCCTGGCTTGCAGATATTCAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCTCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCTTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_galeiformis_AY744552 CGTGGTGTTGGGGCGTCTGCGGCGGCCCGGCCGGCGCAGCCCGAAAGCCAGTGGCGGGCCGGCGGCGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCCGGACGCCACCGCGCGCCCTGCCCAGGCGAGTCTCCTCACAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGGAATTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCCAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_koreana_AB222065 CGTGGTGTTGGGGCGTCTGCGGTCAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCCGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_laricis_DQ062074 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCTTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_laricis_YCC277 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCTTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_laricis_YCC349 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCTTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_laricis_YCC389 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCTTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_laricis_YCC441 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCTTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_laricis_YCC488 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCTTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_laricis_YCC590 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCTTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_leptographioides_AF343710 CGCGGTGTTGGGGCGCTCTGCCTGGGCCGCCCGGGGCAGCCCGAAATCCAGTGGCGGGCCGTCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCCGGACGCCCCTGCGCGCCCTGCCCCAGCCCCCCCTCTCGCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCGTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCTAGCCGATGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAA Grosmannia_olivacea_AJ538337 CGTGGTGTTGGGGCGACTGCGACCGACCGCCCGGCGCAGCCCCAAAGCAAGTGGCGGGCCGGCAGCGTCTCCGAGCGCAGTAAGCATGTGCCCTCGCTCTGGACGATGCTGCGCGCCCTGCCCCCGCAAGTCTATCTCAAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAGAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCTCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCGTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCTAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_olivaceapini_AJ538336 CGTGGTGTTGGGGCGACTGCGACCGATCGTCCGGCGCAGCCTCAAAGCAAGTGGCGGGCCGGCAGCGTCTCCGAGCGCAGTAAGCATTCGCCCTCGCTCTGGACGATGCTGCGCGCCCTGCCCCCGCAAGTCTATCTCAAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTTGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCGTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCTAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_penicillata_DQ097851 CGTGGTGTTGGGGCATCTGCGGCTGCCGAGGCACCGCAGCCTGAAACCCAGTGGCGGGCCGGCAGAGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCCGGACGCCCCTGCGCAGCTCGCCCTGGCTTGCAGATCTTAAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAA Grosmannia_piceiperda_B_AY707209 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_piceiperda_B_JF279973 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_piceiperda_C_JF279969 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_piceiperda_C_JF279970 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_piceiperda_C_JF279971 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_piceiperda_C_JF279972 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_piceiperda_D_JF279968 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_radiaticola_AY744551 CGTGGTGTTGGGGCGTCTGCGGCGGCCCGGCCGGCGCAGCCCGAAAGCCAGTGGCGGGCCGGCGGCGGCTCCGAGCGCAGTAAGCACCAGCCCTCGCTCCGGACGCCACCGCGCGCCCTGCCCAGGCGAGTCTCCTCACAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCCAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_robusta_AY544619 CGTGGTGTTGGGGTGTCTGCGGCCAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCTGGACGCTCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_serpens_JN135314 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC242 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC549 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC593 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC625 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC626 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC631 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC694 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC695 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC710 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC711 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC724 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC733 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC734 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC735 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._D_YCC736 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCTTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J1_YCC348 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCTTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J1_YCC614 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCTTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J1_YCC705 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCTTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J1_YCC723 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCTTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J2_YCC312 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J2_YCC314 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J3_YCC495 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J3_YCC496 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J3_YCC497 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J4_YCC318 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J4_YCC399 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J4_YCC591 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J5_YCC300 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J5_YCC416 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGTGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J5_YCC417 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J5_YCC468 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J5_YCC469 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J5_YCC615 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J5_YCC679 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J5_YCC681 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J6_YCC432 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J6_YCC433 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J6_YCC470 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J7_YCC452 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J7_YCC453 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J7_YCC455 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J7_YCC501 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCTGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J8_YCC507 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Grosmannia_sp._J8_YCC508 CGTGGTGTTGGGGCGTCTGCGGCTAGCATGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTTTGGACGCCCCCGCGCGCCCTGCCCCCGTAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCTGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_abieticolens_AF343701 CGTGGTGTTGGGGCATCTGCGGCAGCCAAGGCTTCGCAGCCTGAAACCCATAGGCGGGCCGGTAGAGGCTCCGAGCGCAGTAAGCATTACCCCTCGCTTTGGAAGCCCCTGCGCAGCTCGCCCTGGTTTGCGGATTTCTAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTTTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_alethinum_AF343685 GCTGGTGTTGGGGCATCTGCAGCTGCCAAGGCACCGGAGCCCTAAAACCCAGAGCGGGCCGGCAGAGGCTCCGAGCGCAGTAAGCATTAGCCCTCGCTCCGGACGCCCCTGCGCAGCTCGCCCTGGCTTGCAGAATTTTAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAA Leptographium_altius_HQ406851 CGTGGTGTTGGGGCATCTGCGGCTGCCGAGGCGCCGCAGCCTGAAACCCAGTGGCGGGCCGGCAGAGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCCGGACGCCCCTGCGCAGCTCGCCCTGGCTTGCAGATCTTAAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAA Leptographium_americanum_DQ062079 CGTGGTGTTGGGGCATCTGCGGCTGCCAAGGCACCGCAGCCTAAAACCCAGTGGCGGGCCGGCAGAGGCTCCGAGCGCAGTAAGCATTAGCCCTCGCTCCGGACGCCCCTGCGCAGCTCGCCCTGGCTTGCAGATTTTTAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAA Leptographium_bhutanense_EU650187 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCTCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCTCCGCGCGCCCTGCCCCAGCAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_bistatum_AY348305 CGTGGTGTTGGGGCATCTGCGGCAGCCAAGGCTTCGCAGCCTGAAACCCATAGGCGGGCCGGTAGAGGCTCCGAGCGCAGTAAGCATTAGCCCTCGCTTTGGAAGCCCCTGCGCAGCTCGCCCTGGTTTGCGGATTTCTAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTTTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_castellanum_JN135317 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_celere_HQ406834 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCTCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCTCCGCGCGCCCTGCCCCAGCAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_chlamydatum_EU979333 CGTGGTGTTGGGGCATCTGCGGCTGCCAAGGCACCGCAGCCTGAAACCCAGTGGCGGGCCGGCAGAGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCTGGACGCCCCTGCGCAGCTCGCCCTGGCTTGCAGATTTCTAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGTCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAA Leptographium_curviconidium_HQ406850 CGTGGTGTTGGGGCATCTGCGGCTGCCGAGGCGCCGCAGCCTGAAACCCAGTGGCGGGCCGGCAGAGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCCGGACGCCCCTGCGCAGCTCGCCCTGGCTTGCAGATCTTAAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAA Leptographium_curvisporum_EU979328 CGTGGTGTTGGGGCATCTGCGGCGGCCGAGGCCCCGCAGCCCGAAACCCAGTGGCGGGCCGGCAGAGGCTCCGAGCGCAGTAAGCATTAGCCCTCGCTCTGGACGCCCCTGCGCAGCTCGCCCTGGCTTGCAGATTTCTAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAA Leptographium_douglasii_AY553381 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCTAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCCAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_eucalyptophilum_AF343703 CGTGGTGTTGGGGCATCTGCGGCAGCCAAGGCTTCGCAGCCTGAAACCCATAGGCGGGCCGGTAGAGGCTCCGAGCGCAGTAAGCATTAGCCCTCGCTTTGGAAGCCCCTGCGCAGCTCGCCCTGGTTTGCGGATTTCTAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGCCCGAGTTGTAATCTGGAAAGGATGTTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACCCCGAGAAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTTTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_fruticetum_DQ097847 CGTGGTGTTGGGGCATCTGCGGCGGCCGAGGCCCCGCAGCCTGAAACCCAGTGGCGGGCCGGCAGAGGCTCCGAGCGTAGTAAGCATTAGCCCTCGCTCCGGACGCCCCTGCGCAGCTCGCCCTGGCTTGCAGACTTCTAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAA Leptographium_gibbsii_JN135316 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCTAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_latens_HQ406845 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCTCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCTCCGCGCGCCCTGCCCCAGCAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_longiclavatum_AY816686 CGTGGTGTTGGGGCGTCTGCGGCCAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCTGGACGCTCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_lundbergii_DQ062068 CGTGGTGTTGGGGCGTCTGCGGCCAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCCGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGTCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_manifestum_HQ406839 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCTCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCTCCGCGCGCCCTGCCCCAGCAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_neomexicanum_AY553382 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCCAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_pinicolum_DQ062060 CGTGGTGTTGGGGCGTCTGCGGTCAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCCGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_pinidensiflorae_AY707199 CGTGGTGTTGGGGCGTCTGCGGCCAGCAGGCCTCCGCAGCCCGAAAGCCAGCGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCTCCGCGCGCCCTGCCCCAGCAAGTCTTCTCTCAAGGTTGACCCCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCCTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGTAAAGCACTTTGAAAAGAG Leptographium_pistaciae_HQ406846 CGTGGTGTTGGGGCATCTGCGGCAGCCAAGGCTTCGCAGCCTGAAACCCATAGGCGGGCCGGTAGAGGCTCCGAGCGCAGTAAGCATTAGCCCTCGCTTTGGAAGCCCCTGCGCAGCTCGCCCTGGTTTGCGGATTTCTAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCTTCGGGCCCGAGTTGTAATCTGGAGAGGATGTTTCTGGCGGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACACCTAGCCTTTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_pityophilum_AF343679 GGTGGTGTTGGGGCGACTGCGGCCGATGGCCCGGCGCAGCCCGAAAGCGAGTGGCGGGCCGGCAGTGTCTCCGAGCGCAGTAAGCATCTGCCCTCGCTCTGGACGAAGCTGCGCGCCCTGCCTATGCAAGTCTATCTCAAAGGTTGACCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGTCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACCCCTAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_pyrinum_DQ062072 CGTGGTGTTGGGGCGTCTGCGGCCAGTAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCTGGACGCTCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_reconditum_AF343690 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCCAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_sinoprocerum_EU296773 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCTCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCTCCGCGCGCCCTGCCCCAGCAAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_taigense_JF279980 CGTGGTGTTGGGGCATCTGCGGCGGCCGAGGCCCCGCAGCCCTAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGAAGCCCTCGCTCTGGACGCCCCCGCGCTCCCGCCTACAGGAAGCTGCATCGCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCTAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_terebrantis_EU296777 CGTGGTGTTGGGGCGTCTGCGGCCAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCTGGACGCTCCCGCGCGCCCTGTCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_truncatum_DQ062052 CGTGGTGTTGGGGCGTCTGCGGTCAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCCGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_wageneri_var._ponderosum_AF343708 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAAGAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCCAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_wageneri_var._pseudotsugae_AF343706 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCAGCGAGTCTTTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAATAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCCAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_wageneri_var._wageneri_AF343707 CGTGGTGTTAGGGCGTCTGCGGCTAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCCAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATCCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_yamaokae_JN135315 CGTGGTGTTGGGGCGTCTGCGGCTAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGGCAGCGGCTCCGAGCGCAGTAAGCAGCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCAGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG Leptographium_yunnanense_AY553415 CGTGGTGTTGGGGCGTCTGCGGCCAGCAGGCCGCCGCAGCCCGAAAGCCAGTGGCGGGCCGTCAGCGGCTCCGAGCGCAGTAAGCATCAGCCCTCGCTCTGGACGCCCCCGCGCGCCCTGCCCCCGCGAGTCTCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAG ; END; BEGIN TREES; TITLE Grosmannia_piceiperda_complex_Fig2_EF1a_ML; LINK TAXA = Taxa3; TRANSLATE 1 Grosmannia_huntii_DQ354937, 2 Grosmannia_huntii_DQ354938, 3 Grosmannia_aenigmatica_YCC72, 4 Grosmannia_aenigmatica_YCC111, 5 Grosmannia_aenigmatica_AY536184, 6 Grosmannia_laricis_YCC277, 7 Grosmannia_laricis_YCC349, 8 Grosmannia_laricis_YCC488, 9 Grosmannia_laricis_YCC590, 10 Grosmannia_laricis_YCC389, 11 Grosmannia_laricis_YCC441, 12 Grosmannia_laricis_YCC440, 13 Grosmannia_laricis_DQ062041, 14 Grosmannia_laricis_DQ062042, 15 Grosmannia_sp._D_YCC242, 16 Grosmannia_sp._D_YCC549, 17 Grosmannia_sp._D_YCC593, 18 Grosmannia_sp._D_YCC625, 19 Grosmannia_sp._D_YCC626, 20 Grosmannia_sp._D_YCC631, 21 Grosmannia_sp._D_YCC694, 22 Grosmannia_sp._D_YCC695, 23 Grosmannia_sp._D_YCC710, 24 Grosmannia_sp._D_YCC711, 25 Grosmannia_sp._D_YCC724, 26 Grosmannia_sp._D_YCC733, 27 Grosmannia_sp._D_YCC734, 28 Grosmannia_sp._D_YCC735, 29 Grosmannia_sp._D_YCC736, 30 Grosmannia_piceiperda_D_JF280070, 31 Grosmannia_piceiperda_D_JF280071, 32 Grosmannia_sp._J1_YCC348, 33 Grosmannia_sp._J1_YCC614, 34 Grosmannia_sp._J1_YCC705, 35 Grosmannia_sp._J1_YCC723, 36 Grosmannia_sp._J2_YCC312, 37 Grosmannia_sp._J2_YCC314, 38 Grosmannia_sp._J4_YCC318, 39 Grosmannia_sp._J4_YCC399, 40 Grosmannia_sp._J3_YCC495, 41 Grosmannia_sp._J3_YCC496, 42 Grosmannia_sp._J3_YCC497, 43 Grosmannia_sp._J4_YCC591, 44 Grosmannia_sp._J5_YCC300, 45 Grosmannia_sp._J5_YCC416, 46 Grosmannia_sp._J5_YCC417, 47 Grosmannia_sp._J5_YCC468, 48 Grosmannia_sp._J5_YCC615, 49 Grosmannia_sp._J5_YCC679, 50 Grosmannia_sp._J5_YCC681, 51 Grosmannia_sp._J6_YCC433, 52 Grosmannia_sp._J6_YCC432, 53 Grosmannia_sp._J6_YCC470, 54 Grosmannia_sp._J7_YCC452, 55 Grosmannia_sp._J7_YCC453, 56 Grosmannia_sp._J7_YCC455, 57 Grosmannia_sp._J7_YCC501, 58 Grosmannia_sp._J8_YCC507, 59 Grosmannia_sp._J8_YCC508, 60 Grosmannia_piceiperda_B_JF280079, 61 Grosmannia_piceiperda_B_JF280078, 62 Grosmannia_piceiperda_B_JF280077, 63 Grosmannia_piceiperda_C_JF280072, 64 Grosmannia_piceiperda_C_JF280073, 65 Grosmannia_piceiperda_C_JF280074, 66 Grosmannia_piceiperda_C_JF280075, 67 Grosmannia_piceiperda_C_JF280076; TREE Fig._2 = [&R] (((((57:1.91699320435139E-6,55:1.91699320435139E-6):0.0019779080765672634,(56:1.91699320435139E-6,54:1.91699320435139E-6):1.91699320435139E-6):0.01217136633943172,((((8:1.91699320435139E-6,((((10:1.91699320435139E-6,(6:1.91699320435139E-6,14:1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6,((13:1.91699320435139E-6,12:1.91699320435139E-6):1.91699320435139E-6,11:1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6,9:1.91699320435139E-6):1.91699320435139E-6,7:1.91699320435139E-6):1.91699320435139E-6):0.002030404617101558,((35:1.91699320435139E-6,(34:1.91699320435139E-6,33:1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6,32:1.91699320435139E-6):1.91699320435139E-6):0.010166019636875849,((18:1.91699320435139E-6,((25:1.91699320435139E-6,19:1.91699320435139E-6):0.002074029583147891,(64:0.0020203451648499694,((67:0.00202034329584268,66:1.91699320435139E-6):0.0020694830838588886,(63:1.91699320435139E-6,65:1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6):0.004073747339694211):1.91699320435139E-6):1.91699320435139E-6,((((29:1.91699320435139E-6,(28:1.91699320435139E-6,24:1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6,(23:1.91699320435139E-6,22:1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6,((31:1.91699320435139E-6,((20:1.91699320435139E-6,((17:1.91699320435139E-6,(30:1.91699320435139E-6,27:1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6,26:1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6,21:1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6,16:1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6,15:0.0020179018636132676):0.002031198613235983):0.004084517696114539):1.91699320435139E-6,((((((45:1.91699320435139E-6,(47:1.91699320435139E-6,(48:1.91699320435139E-6,((((3:1.91699320435139E-6,4:1.91699320435139E-6):1.91699320435139E-6,5:1.91699320435139E-6):0.001988091686169592,(60:0.002022830583443712,(62:1.91699320435139E-6,61:1.91699320435139E-6):1.91699320435139E-6):0.008087816072356483):0.004019992948264233,(58:1.91699320435139E-6,59:1.91699320435139E-6):0.004088439443071619):1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6,50:1.91699320435139E-6):1.91699320435139E-6,49:1.91699320435139E-6):1.91699320435139E-6,44:1.91699320435139E-6):1.91699320435139E-6,46:1.91699320435139E-6):1.91699320435139E-6,((((42:1.91699320435139E-6,40:1.91699320435139E-6):1.91699320435139E-6,41:1.91699320435139E-6):0.0019888825485860637,(36:1.91699320435139E-6,37:1.91699320435139E-6):1.91699320435139E-6):1.91699320435139E-6,((38:1.91699320435139E-6,39:1.91699320435139E-6):1.91699320435139E-6,43:1.91699320435139E-6):0.004018380421280211):0.0020564217057536124):0.002079662680896601):0.001988370549870174):0.001026326300986812,((53:1.91699320435139E-6,52:1.91699320435139E-6):1.91699320435139E-6,51:1.91699320435139E-6):0.0093848245315483):0.14504886695485658,2:1.91699320435139E-6,1:1.91699320435139E-6); END; BEGIN TREES; TITLE Grosmannia_piceiperda_complex_FigS1_rDNA_MLT; LINK TAXA = Taxa2; TRANSLATE 1 Grosmannia_leptographioides_AF343710, 2 Grosmannia_aenigmatica_YCC72, 3 Grosmannia_aenigmatica_YCC111, 4 Grosmannia_aenigmatica_AY553389, 5 Grosmannia_laricis_YCC277, 6 Grosmannia_laricis_YCC349, 7 Grosmannia_laricis_YCC389, 8 Grosmannia_laricis_YCC441, 9 Grosmannia_laricis_YCC488, 10 Grosmannia_laricis_YCC590, 11 Grosmannia_laricis_DQ062074, 12 Grosmannia_sp._J1_YCC348, 13 Grosmannia_sp._J1_YCC614, 14 Grosmannia_sp._J1_YCC705, 15 Grosmannia_sp._J1_YCC723, 16 Grosmannia_sp._J2_YCC312, 17 Grosmannia_sp._J2_YCC314, 18 Grosmannia_sp._J3_YCC495, 19 Grosmannia_sp._J3_YCC496, 20 Grosmannia_sp._J3_YCC497, 21 Grosmannia_sp._J4_YCC318, 22 Grosmannia_sp._J4_YCC399, 23 Grosmannia_sp._J4_YCC591, 24 Grosmannia_sp._J5_YCC300, 25 Grosmannia_sp._J5_YCC416, 26 Grosmannia_sp._J5_YCC417, 27 Grosmannia_sp._J5_YCC469, 28 Grosmannia_sp._J5_YCC468, 29 Grosmannia_sp._J5_YCC615, 30 Grosmannia_sp._J5_YCC679, 31 Grosmannia_sp._J5_YCC681, 32 Grosmannia_sp._J6_YCC433, 33 Grosmannia_sp._J6_YCC432, 34 Grosmannia_sp._J6_YCC470, 35 Grosmannia_sp._J7_YCC452, 36 Grosmannia_sp._J7_YCC453, 37 Grosmannia_sp._J7_YCC455, 38 Grosmannia_sp._J7_YCC501, 39 Grosmannia_sp._J8_YCC507, 40 Grosmannia_sp._J8_YCC508, 41 Grosmannia_sp._D_YCC242, 42 Grosmannia_sp._D_YCC549, 43 Grosmannia_sp._D_YCC593, 44 Grosmannia_sp._D_YCC625, 45 Grosmannia_sp._D_YCC626, 46 Grosmannia_sp._D_YCC631, 47 Grosmannia_sp._D_YCC694, 48 Grosmannia_sp._D_YCC695, 49 Grosmannia_sp._D_YCC710, 50 Grosmannia_sp._D_YCC711, 51 Grosmannia_sp._D_YCC724, 52 Grosmannia_sp._D_YCC733, 53 Grosmannia_sp._D_YCC734, 54 Grosmannia_sp._D_YCC735, 55 Grosmannia_sp._D_YCC736, 56 Grosmannia_piceiperda_C_JF279969, 57 Grosmannia_piceiperda_C_JF279970, 58 Grosmannia_piceiperda_C_JF279971, 59 Grosmannia_piceiperda_C_JF279972, 60 Grosmannia_piceiperda_B_AY707209, 61 Grosmannia_piceiperda_B_JF279973, 62 Grosmannia_piceiperda_D_JF279968, 63 Grosmannia_clavigera_AY544613, 64 Leptographium_pyrinum_DQ062072, 65 Leptographium_longiclavatum_AY816686, 66 Leptographium_terebrantis_EU296777, 67 Grosmannia_robusta_AY544619, 68 Leptographium_truncatum_DQ062052, 69 Leptographium_pinicolum_DQ062060, 70 Grosmannia_koreana_AB222065, 71 Leptographium_yunnanense_AY553415, 72 Leptographium_lundbergii_DQ062068, 73 Leptographium_sinoprocerum_EU296773, 74 Leptographium_bhutanense_EU650187, 75 Leptographium_celere_HQ406834, 76 Leptographium_latens_HQ406845, 77 Leptographium_manifestum_HQ406839, 78 Leptographium_pinidensiflorae_AY707199, 79 Leptographium_gibbsii_JN135316, 80 Leptographium_castellanum_JN135317, 81 Grosmannia_serpens_JN135314, 82 Grosmannia_alacris_JN135313, 83 Leptographium_yamaokae_JN135315, 84 Leptographium_neomexicanum_AY553382, 85 Leptographium_douglasii_AY553381, 86 Leptographium_wageneri_var._wageneri_AF343707, 87 Leptographium_reconditum_AF343690, 88 Leptographium_wageneri_var._pseudotsugae_AF343706, 89 Leptographium_wageneri_var._ponderosum_AF343708, 90 Grosmannia_galeiformis_AY744552, 91 Grosmannia_radiaticola_AY744551, 92 Leptographium_taigense_JF279980, 93 Leptographium_curvisporum_EU979328, 94 Leptographium_americanum_DQ062079, 95 Leptographium_chlamydatum_EU979333, 96 Grosmannia_penicillata_DQ097851, 97 Leptographium_altius_HQ406851, 98 Leptographium_curviconidium_HQ406850, 99 Grosmannia_abiocarpa_AJ538339, 100 Leptographium_fruticetum_DQ097847, 101 Grosmannia_dryocoetidis_AJ538340, 102 Leptographium_eucalyptophilum_AF343703, 103 Leptographium_abieticolens_AF343701, 104 Leptographium_bistatum_AY348305, 105 Leptographium_pistaciae_HQ406846, 106 Leptographium_alethinum_AF343685, 107 Leptographium_pityophilum_AF343679, 108 Grosmannia_olivacea_AJ538337, 109 Grosmannia_olivaceapini_AJ538336, 110 Grosmannia_cucullata_AJ538335; TREE Supprementary_Fig._S1 = [&R] ((92:0.04066045196776879,(101:0.007687631925809117,(93:8.1678149436082E-7,(((102:0.010596819456104335,((105:8.1678149436082E-7,104:8.1678149436082E-7):8.1678149436082E-7,103:0.0020810587839900714):8.1678149436082E-7):0.03168843456429436,(95:0.004431719044922755,((94:0.0020855494760150207,106:0.028137859953563122):8.1678149436082E-7,((97:8.1678149436082E-7,98:8.1678149436082E-7):0.002147061768349509,96:8.1678149436082E-7):0.008718434404369917):0.006239611016640348):0.003091461442796247):0.0038403726800191745,(100:0.00652552498015063,99:0.002199003460409096):0.00424361492659328):0.006584050380808422):0.007968923601491493):0.08786866550603402):0.028633531070703218,((78:0.024128913713531024,((76:8.1678149436082E-7,77:8.1678149436082E-7):8.1678149436082E-7,((75:8.1678149436082E-7,73:8.1678149436082E-7):8.1678149436082E-7,74:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):0.004073921048475611,(((((((((((5:8.1678149436082E-7,(14:8.1678149436082E-7,11:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,(7:8.1678149436082E-7,10:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,13:8.1678149436082E-7):8.1678149436082E-7,(9:8.1678149436082E-7,6:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,(15:8.1678149436082E-7,12:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,8:8.1678149436082E-7):0.001870264084005028,25:0.0018699378102218374):8.1678149436082E-7,((((18:8.1678149436082E-7,(40:8.1678149436082E-7,(3:8.1678149436082E-7,((22:8.1678149436082E-7,((26:8.1678149436082E-7,(33:8.1678149436082E-7,((29:8.1678149436082E-7,((((19:8.1678149436082E-7,20:8.1678149436082E-7):8.1678149436082E-7,24:8.1678149436082E-7):8.1678149436082E-7,17:8.1678149436082E-7):8.1678149436082E-7,27:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,39:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,(32:8.1678149436082E-7,(4:8.1678149436082E-7,34:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,(30:8.1678149436082E-7,(16:8.1678149436082E-7,31:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,23:8.1678149436082E-7):8.1678149436082E-7,28:8.1678149436082E-7):8.1678149436082E-7,(21:8.1678149436082E-7,2:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,((((((((62:8.1678149436082E-7,(47:8.1678149436082E-7,(((41:8.1678149436082E-7,54:8.1678149436082E-7):8.1678149436082E-7,42:8.1678149436082E-7):8.1678149436082E-7,59:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,(56:8.1678149436082E-7,46:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,((58:8.1678149436082E-7,(43:8.1678149436082E-7,(48:8.1678149436082E-7,55:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,(45:8.1678149436082E-7,44:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7,51:8.1678149436082E-7):8.1678149436082E-7,49:8.1678149436082E-7):8.1678149436082E-7,((50:8.1678149436082E-7,53:8.1678149436082E-7):8.1678149436082E-7,(57:8.1678149436082E-7,52:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):0.0018625666326573791,(61:8.1678149436082E-7,60:8.1678149436082E-7):0.0037564298897085537):8.1678149436082E-7,(35:8.1678149436082E-7,(37:8.1678149436082E-7,(38:8.1678149436082E-7,36:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):0.0018697930449587204):0.024961640714498582,((107:0.018611507194878647,(108:0.006405253883344879,(109:0.002192848483654385,110:0.003926579780368952):0.008865377043226045):0.030233494349063042):0.08863897526720967,(((71:0.002000814528268009,((70:8.1678149436082E-7,69:8.1678149436082E-7):0.001963716583098316,68:0.001989549745669185):0.0019814759434459224):0.001963150328070381,(((66:0.0019707899334295716,65:8.1678149436082E-7):8.1678149436082E-7,67:0.0019707900386954783):8.1678149436082E-7,(64:8.1678149436082E-7,63:8.1678149436082E-7):0.001968927636563725):0.006016719136465897):0.0020900942898703146,72:0.0039660301930743444):0.00412842575227176):0.0038876594991815584):0.004683668649356211,((89:0.004049234880040824,(87:8.1678149436082E-7,(84:8.1678149436082E-7,((88:0.004045591289893737,((90:0.005886909195385566,91:0.0032376501555897285):0.05373612425324909,85:8.1678149436082E-7):0.004179040087606673):8.1678149436082E-7,86:0.004046636806299331):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):0.0020940195747059915,(79:0.004061958848282146,(83:8.1678149436082E-7,(81:8.1678149436082E-7,(80:8.1678149436082E-7,82:8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):8.1678149436082E-7):0.002024916366828387):0.012899725750174378):8.1678149436082E-7):0.03299079930203367,1:0.10370642158808752); END; BEGIN TREES; TITLE Grosmannia_piceiperda_complex_Fig1_BT_M; LINK TAXA = Taxa1; TRANSLATE 1 Grosmannia_huntii_DQ354932, 2 Grosmannia_huntii_DQ354933, 3 Grosmannia_aenigmatica_AY534938, 4 Grosmannia_aenigmatica_AY534937, 5 Grosmannia_aenigmatica_YCC72, 6 Grosmannia_aenigmatica_YCC111, 7 Grosmannia_piceiperda_D_JF280024, 8 Grosmannia__piceiperda_D_JF280023, 9 Grosmannia_laricis_YCC277, 10 Grosmannia_laricis_YCC349, 11 Grosmannia_laricis_YCC389, 12 Grosmannia_laricis_YCC440, 13 Grosmannia_laricis_YCC441, 14 Grosmannia_laricis_YCC488, 15 Grosmannia_laricis_YCC590, 16 Grosmannia_laricis_DQ062009, 17 Grosmannia_laricis_DQ062008, 18 Grosmannia_sp._J1_YCC348, 19 Grosmannia_sp._J1_YCC614, 20 Grosmannia_sp._J1_YCC705, 21 Grosmannia_sp._J1_YCC723, 22 Grosmannia_sp._D_YCC242, 23 Grosmannia_sp._D_YCC710, 24 Grosmannia_sp._D_YCC626, 25 Grosmannia_sp._D_YCC631, 26 Grosmannia_sp._D_YCC593, 27 Grosmannia_sp._D_YCC736, 28 Grosmannia_sp._D_YCC694, 29 Grosmannia_sp._D_YCC695, 30 Grosmannia_sp._D_YCC711, 31 Grosmannia_sp._D_YCC549, 32 Grosmannia_sp._D_YCC625, 33 Grosmannia_sp._D_YCC733, 34 Grosmannia_sp._D_YCC724, 35 Grosmannia_sp._D_YCC734, 36 Grosmannia_sp._D_YCC735, 37 Grosmannia_piceiperda_B_JF280025, 38 Grosmannia_piceiperda_B_JF280033, 39 Grosmannia_piceiperda_B_AY707195, 40 Grosmannia_piceiperda_B_DQ268644, 41 Grosmannia_piceiperda_C_JF280032, 42 Grosmannia_piceiperda_C_JF280026, 43 Grosmannia_piceiperda_C_JF280030, 44 Grosmannia_piceiperda_C_JF280031, 45 Grosmannia_piceiperda_C_DQ296112, 46 Grosmannia_sp._J2_YCC312, 47 Grosmannia_sp._J2_YCC314, 48 Grosmannia_sp._J4_YCC318, 49 Grosmannia_sp._J4_YCC399, 50 Grosmannia_sp._J3_YCC495, 51 Grosmannia_sp._J3_YCC496, 52 Grosmannia_sp._J3_YCC497, 53 Grosmannia_sp._J4_YCC591, 54 Grosmannia_sp._J5_YCC300, 55 Grosmannia_sp._J5_YCC416, 56 Grosmannia_sp._J5_YCC417, 57 Grosmannia_sp._J5_YCC469, 58 Grosmannia_sp._J5_YCC468, 59 Grosmannia_sp._J5_YCC615, 60 Grosmannia_sp._J5_YCC679, 61 Grosmannia_sp._J5_YCC681, 62 Grosmannia_piceiperda_E_DQ268643, 63 Grosmannia_piceiperda_E_DQ268642, 64 Grosmannia_piceiperda_F_FJ269189, 65 Grosmannia_piceiperda_F_FJ269188, 66 Grosmannia_sp._J6_YCC433, 67 Grosmannia_sp._J6_YCC432, 68 Grosmannia_sp._J6_YCC470, 69 Grosmannia_sp._J7_YCC452, 70 Grosmannia_sp._J7_YCC453, 71 Grosmannia_sp._J7_YCC455, 72 Grosmannia_sp._J7_YCC501, 73 Grosmannia_sp._J8_YCC507, 74 Grosmannia_sp._J8_YCC508; TREE Fig._1 = [&R] (2:8.9671896007902E-7,((((((((14:8.9671896007902E-7,13:8.9671896007902E-7):8.9671896007902E-7,(21:8.9671896007902E-7,11:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7,(17:8.9671896007902E-7,15:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7,(16:8.9671896007902E-7,(19:8.9671896007902E-7,(12:8.9671896007902E-7,(9:8.9671896007902E-7,18:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7,20:8.9671896007902E-7):8.9671896007902E-7,10:8.9671896007902E-7):0.003704366619916744,(((40:8.9671896007902E-7,39:8.9671896007902E-7):8.9671896007902E-7,(38:8.9671896007902E-7,37:8.9671896007902E-7):8.9671896007902E-7):0.0036621585617807578,(((((45:8.9671896007902E-7,44:8.9671896007902E-7):8.9671896007902E-7,42:8.9671896007902E-7):8.9671896007902E-7,(43:8.9671896007902E-7,41:8.9671896007902E-7):8.9671896007902E-7):0.0036875520898265257,(4:8.9671896007902E-7,(5:8.9671896007902E-7,(3:8.9671896007902E-7,6:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7):0.007375219171944867):8.9671896007902E-7,((((26:8.9671896007902E-7,30:8.9671896007902E-7):8.9671896007902E-7,(36:8.9671896007902E-7,((((25:8.9671896007902E-7,33:8.9671896007902E-7):8.9671896007902E-7,27:8.9671896007902E-7):8.9671896007902E-7,32:8.9671896007902E-7):8.9671896007902E-7,24:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7,(31:8.9671896007902E-7,22:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7,((29:8.9671896007902E-7,((28:8.9671896007902E-7,7:8.9671896007902E-7):8.9671896007902E-7,(35:8.9671896007902E-7,34:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7,(8:8.9671896007902E-7,23:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7):0.003776595608937692):0.0037044344147030553,(((65:8.9671896007902E-7,64:8.9671896007902E-7):0.00760684118623034,(73:8.9671896007902E-7,74:8.9671896007902E-7):0.007418137672588232):8.9671896007902E-7,((((48:8.9671896007902E-7,(58:8.9671896007902E-7,49:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7,((((((((((47:8.9671896007902E-7,59:8.9671896007902E-7):8.9671896007902E-7,((51:8.9671896007902E-7,54:8.9671896007902E-7):8.9671896007902E-7,55:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7,50:8.9671896007902E-7):8.9671896007902E-7,67:8.9671896007902E-7):8.9671896007902E-7,53:8.9671896007902E-7):8.9671896007902E-7,62:8.9671896007902E-7):8.9671896007902E-7,52:8.9671896007902E-7):8.9671896007902E-7,((68:8.9671896007902E-7,46:8.9671896007902E-7):8.9671896007902E-7,57:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7,63:8.9671896007902E-7):8.9671896007902E-7,(61:8.9671896007902E-7,60:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7,66:8.9671896007902E-7):8.9671896007902E-7,(56:0.003683078686308196,(72:8.9671896007902E-7,(71:8.9671896007902E-7,(69:8.9671896007902E-7,70:8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7):0.007520790267698276):8.9671896007902E-7):8.9671896007902E-7):8.9671896007902E-7):0.06877548660024634,1:8.9671896007902E-7); END;