#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 22:57 GMT TreeBASE (cc) 1994-2008 Study reference: Cornejo C., & Scheidegger C. 2015. Multi-gene phylogeny of the genus Lobaria: Evidence of species-pair and allopatric cryptic speciation in East Asia. American Journal of Botany, 102(12). TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S18155] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=57; TAXLABELS 'Lobaria anomala CY_08' Lobaria_anomala_X107 'Lobaria chinensis CT3_02a' 'Lobaria immixta SG3_01a' 'Lobaria immixta SH1_02g' 'Lobaria immixta SP3_10a' 'Lobaria immixta ST2_01g' Lobaria_immixta_X3 'Lobaria isidiophora CT3_01b' 'Lobaria isidiophora TW3_01_10' 'Lobaria kazawaensis RS_104' 'Lobaria kurokawae CY_18' Lobaria_linita_CH 'Lobaria linita RS_63' Lobaria_linita_X122 'Lobaria macaronesica G_38' 'Lobaria macaronesica PM12_13c' 'Lobaria macaronesica PM16_14b' 'Lobaria macaronesica PS_19a' 'Lobaria orientalis RS_58a' 'Lobaria orientalis RS_83' 'Lobaria pindarensis NE23_02a' 'Lobaria pindarensis NE23_02d' 'Lobaria pseudopulmonaria CY_20' 'Lobaria pseudopulmonaria CY_53' 'Lobaria pulmonaria PS_22a' 'Lobaria pulmonaria SH1_02a' 'Lobaria pulmonaria TK_01a' 'Lobaria retigera CB_05' 'Lobaria sachalinensis RS_100' 'Lobaria sachalinensis RS_113a' 'Lobaria sachalinensis RS_121' 'Lobaria spathulata RS_153' 'Lobaria spathulata RS_75' 'Lobaria spathulata RS_96g' 'Lobaria species 377_2' 'Lobaria species 381_1' 'Lobaria species 388_1' 'Lobaria species CT10_04a' 'Lobaria species CT11_02a' 'Lobaria species CT12_04a' 'Lobaria species RS_84' 'Lobaria species TW2_02_20' 'Lobaria species TW2_02_22' 'Lobaria species TW2_03_5' 'Lobaria species TW2_03_6' 'Lobaria tuberculata RS_62a' 'Lobaria tuberculata RS_67' 'Lobaria tuberculata RS_95' 'Lobaria yunnanensis CT10_02a' 'Lobaria yunnanensis TW2_02_14' 'Lobarina scrobiculata CB_02' 'Lobarina scrobiculata CY_06' 'Lobarina scrobiculata RS_44' Lobarina_scrobiculata_X62 'Ricasolia amplissima TUY_15b' Ricasolia_amplissima_X60 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M38422] TITLE Cornejo; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1783; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Lobaria anomala CY_08' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCTGCCACGCACCACAGCCTTCCTTGAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTTTCTCGAGGTTTT-AGCTAGATTTTTCACCTTGC-GCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTTCTTATCCGCGAAATTAACGGACAATTCTCGTGCCTC-AAATATATTCGTCCAAACAGCGGGAAACGCGACCAACCACCATGTTGACAATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATCGCGCTGTGGAAGTTTGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTGCGAA-CCCGTTTTGATACTTGAATGATATTTACGGTCGCTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGAGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTGACCCTGTGGCCACGCAGCTTGCGTTGCTTTGGCGGCTGCA---TGCCGCCAGCAAGCCTCAAAACCCTGATAC--AGTGTCGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCTCTCAAGCCTGGCTTGGTCTTGGGCTCGCGTCTCTGGGACGGGCCTGAATAGCAGTGGCGGTCCGGCGTGGACTTCAAGCGCAGTGAACGCTTGGAAGGCGCCCCGG---CTCGCCAGACAACC--TCACGCCATCCGGGGCTAGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTTGAAGAATATGAACCGCTCCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGCCATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTTTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTCGGACCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGACAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTATGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCATCGATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCACTGTGAAATTCATCCCAGTATGATTCTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA Lobaria_anomala_X107 CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCTGCCACGCACCACAGCCTTCCTTGAAATTCCACTCACAAATAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTTTCTCGAGGTTTT-AGCTAGATTTTTCACCTTGC-GCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTTCTTATCCGCGAAATTAACGGACAATTCTCGTGCCTC-AAATATATTCGTCCAAACAGCGGGAAACGCGACCAACCACCATGTTGACAATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATCGCGCTGTGGAAGTTTGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTGCGAA-CCCGTTTTGATACTTGAATGATATTTACGGTCGCTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGAGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTGACCCTGTGGCCACGCAGCTTGCGTTGCTTTGGCGGCTGCA---TGCCGCCAGCAAGCCTCAAAACCCTGATAC--AGTGTCGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCTCTCAAGCCTGGCTTGGTCTTGGGCTCGCGTCTCTGGGACGGGCCTGAATAGCAGTGGCGGTCCGGCGTGGACTTCAAGCGCAGTGAACGCTTGGAAGGCGCCCCGG---CTCGCCAGACAACC--TCACGCCATCCGGGGCTAGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTTGAAGAATATGAACCGCTCCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGCCATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTTTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTCGGACCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTATGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCATCGATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCACTGTGAAATTCATCCCAGTATGATTCTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria chinensis CT3_02a' CAACGTGGTCGTTATCGGCCACGTCGATTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTGCTCAAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGAGTTTT-CAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAACGGGAAACGCGACCAATCACCATGTTGACAATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACCATCCGTGGTGCTTTGGCGGTTGAAAATCGCCGCC-GAAACCCTCCAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCGGGCCCTCGCCAGACAACCCATCATTCAATCCGGGACTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTCAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATGA 'Lobaria immixta SG3_01a' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGCCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCGGTTTTTATACCTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGTTTCGGCCCCCGACTCATTACCCTGTGGCTACACGCTCCGTGTTGCTTTGGCGGTC--AAACCGCCGCCAGAAACCCTTAAAACTCTGATATCATGTGTGGTCCGAGTCATATGCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAAGAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCTTGGCCCTCGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTGATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTCGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGCCTGGTGCGGGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACCAAGGAGCATGTCAACAAGCTTGAAGACGATAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCAGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTTATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria immixta SH1_02g' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGCTTCTAAATACATTCGTCCAAACAGCGTGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCGGTTTTTATACCTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGTTTCGGCCCCCGACTCATTACCCTGTGGCTACACGCTCCGTGTTGCTTTGGCGGTC--AAACCGCCGCCAGAAACCCTTAAAACTCTGATATCATGTGTGGTCCGAGTCATATGCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAAGAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCTTGGCCCTCGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTGATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTCGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGGGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACCAAGGAGCATGTCAACAAGCTTGAAGACGATAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCAGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTTATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria immixta SP3_10a' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCATCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGCCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCGGTTTTTATACCTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAAAGGCGTCAGCCTCGGGGGTTTCGGCCCCCGACTCATTACCCTGTGGCTACACGCTCCGTGTTGCTTTGGCGGTC--AAACCGCCGCCAGAAACCCTTAAAACTCTGATATCATGTGTGGTCCGAGTCATATGCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAAGAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCTTGGCCCTCGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTGATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTCGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGCCTGGTGCGGGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACCAAGGAGCATGTCAACAAGCTTGAAGACGATAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCAGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTTATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria immixta ST2_01g' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGCCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCGGTTTTTATACCTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGTTTCGGCCCCCGACTCATTACCCTGTGGCTACACGCTCCGTGTTGCTTTGGCGGTC--AAACCGCCGCCAGAAACCCTTAAAACTCTGATATCATGTGTGGTCCGAGTCATATGCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAAGAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCTTGGCCCTCGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTGATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTTTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTCGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGCCTGGTGCGGGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACCAAGGAGCATGTCAACAAGCTTGAAGACGATAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCAGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTTATCCTCGTTCAATGTGGTGCACTGCTGATAA Lobaria_immixta_X3 CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGCCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCGGTTTTTATACCTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGTTTCGGCCCCCGACTCATTACCCTGTGGCTACACGCTCCGTGTTGCTTTGGCGGTC--AAACCGCCGCCAGAAACCCTTAAAACTCTGATATCATGTGTGGTCCGAGTCATATGCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAAGAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCTTGGCCCTCGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTGATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTTTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTCGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGCCTGGTGCGGGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACCAAGGAGCATGTCAACAAGCTTGAAGACGATAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCAGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTTATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria isidiophora CT3_01b' CAACGTGGTCGTTATCGGCCACGTCGATTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTGCTCAAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGAGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATTTTCGTCCAAACAACGGGAAACGCGACCAATCACCATGTTGACAATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATCCGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACCATCCGTGGTGCTTTGGCGGTTGAAAATCGCCGCC-GAAACCCTCCAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCCTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTGGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCGGGCCCTCGCCAGACAACCCATCATTCAATCCGGGACTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTCAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTTTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria isidiophora TW3_01_10' CAACGTGGTCGTTATCGGCCACGTCGATTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTGCTCAAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGAGTTTT-CAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAACGGGAAACGCGACCAATCACCATGTTGACAATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACCATCCGTGGTGCTTTGGCGGTTGAAAATCGCCGCC-GAAACCCTCCAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCGGGCTCTCGCCAGACAACCCATCATTCAATCCGGGACTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTCAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTTTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria kazawaensis RS_104' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTGCTCAAAATACCACTCACAAACAGCAGGTCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTATTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCACGAAATTAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGACATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACTTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCATCAGCCTCGGGGGCTTCGGCCCCCAACTCTTTACCCCGTGGCTACACGTTCCGTGTTGCTTTGGCGGTTCAAAATCGCCGCC-GAAACCCCCAAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAATAGCAGTGGCGGTCCGACGTAGGCTTCAAGCGCAGTAGACGCTTGGAAGGCTCGCCTGGCCCTTGCCAGACAAACCATCACGCAATCCGGGGCTCGTGAAAAATCTTGCATTAATGTGCTACATCACCGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTTGGGGTTCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGATGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAGGAAGACAAATTCAGAGGCTGGAAAGGTTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCAAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGGGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria kurokawae CY_18' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACAACCGGTAGGCCCGCCACCCACCACAGCCTTCCTCAAAATTCCACTGACAACCAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCATCCAAAATTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTCTCTTATCCGCGAAATTAATGGACAAATCTCGTGCCTCCAAATATATTCGTCCAAACAGTGGGAAACGCGACCGATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATCGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTGCGAAACCCGTATTGATACTTGAATGATATTTATGGTCGGTATTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGG-GGCTTCGGCCCCCAACTCTTTACCCTGTGGCTGCACAGCCAGTGTTGCTTCGGCGGCC--GAATCGCCGCCAGAAACCCCCAAA-CTCTGAT-TCA-GTGTCGTCCGAGTCATACGCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCCTGGCTTGGTGTTGGGCTCACGTCCC-GGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTGGACTTCGAGCGCAGTAAACGCTTGGAAGGCGCGCCTGGATCTCGCCAGACAACCCATCATTCCATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTTGAAGAGTATGAACCGCTCCGCTCTCCCAATGCAACGAAAGTCTTTGTCAATGGAGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTTTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGACAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGCGTCGTAGAGTATGTTGATGCTGAGGAAGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCACTGTGAAATTCATCCCAGTATGATTCTGGGGATATGTGCAAGCATTATTCCCTTTCCCGATCACAATCAGGTATTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA Lobaria_linita_CH CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTTTCTCGAGTTTTCCA-CCAAATTTTTCACCCTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTTCTTATCCGCGAAATTAATGGACAATCCTTGTTCCTACAAACATATTCGTCCAAACAGTGGGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATCGCACTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTGCGAAACCCAATTCGATACTTGAATGATATTTATGGTCGGTATTAGATGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTTGGCTCC-GACTCTTTACCCGGTGGCTATGCAGCTCAAGTCCCTTTGGCGGC--ACATTGGTCGCCAGGAGCCCT-AAAATTCTGCCATCAAGTGTTGTCCGAGTCATATTGAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCCT-CGCCCCCGGGACGGGCCTGAATGGCAGTGGCGGTCCGACGTGG-CTTCAAGCGCAGTGAACGCTTGGAAGGCGCTCTGGGTCC-CGCCAGACAACCCATGGCT--ATCCGGGGCTCGTGAAAAATTTAGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTCATGATACAGAGGAATATGGAAGTGCTGGAAGAGTATGAACCGCTGCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCAGCTCACCTTGTCAGCACAGTACAGACTCTGCGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCCGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGGAATCTCGTGTTGACAAAGGAGCATGTCAATAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGACAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTATGTTGATGCTGAGGAAGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCAGAACCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTAATCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria linita RS_63' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCATGCACCACAGCCTTCCTCAAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTTTCTCGAGTTTTCCA-CCAAATTTTTCACCTTGCGGCCTTGGTGGGGCAATTCTCCCCGCGCTTACTATCGCACCAATTTTCTTATCCGCGAAATTAACGGACAATCCTTGTTCCTACAAACATATTCGTCCAAACAGTGGGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATCGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTGCGAAACCCAATTCGATATTTGAATGATATTTATGGTCGGTATTAGATGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCTCC-GACTCTTTACCCGGTGGCTATGCAGCTCAAGTCCCTTTGGCGGC--ACATTGGTCGCCAGGAGCCTT-AAAACTCTGCCATCA-GTGTTGTCCGAGTCATATTGAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCCT-CGTCCCCGGGACGGGCCTGAATGGCAGTGGCGGTCCGACGTGG-CTTCAAGCGCAGTGAACGCTTGGAAGGCGCCCTGGGTCC-CGCCAGACAACCCATGGCT--ATCCGGGGCTTGTGAAAAATCTAGCATTAATGTGCTACATCACTGTTGGTACACCCAGCGAACCTATCATTGATTTTATGATACAGAGGAATATGGAGGTGCTTGAAGAGTATGAGCCGCTGCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCAGCTCACCTTGTAAGCACAGTACAGACTCTGCGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGGGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGGAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGACAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTATGTTGATGCTGAGGAAGAAGAAACCGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCAGAACCTTCGATTGATGATCCCAATAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTAATCATCCTCGTTCAATGCGGTGCACTGCTGATAA Lobaria_linita_X122 CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTTTCTCGAGTTTTCCA-CCAAATTTTTCACCCTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTTCTTATCCGCGAAATTAATGGACAATCCTTGTTCCTACAAACATATTCGTCCAAACAGTGGGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATCGCACTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTGCGAAACCCAATTCGATACTTGAATGATATTTATGGTCGGTATTAGATGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTTGGCTCC-GACTCTTTACCCGGTGGCTATGCAGCTCAAGTCCCTTTGGCGGC--ACATTGGTCGCCAGGAGCCCT-AAAATTCTGCCATCAAGTGTTGTCCGAGTCATATTGAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCCT-CGCCCCCGGGACGGGCCTGAATGGCAGTGGCGGTCCGACGTGG-CTTCAAGCGCAGTGAACGCTTGGAAGGCGCTCTGGGTCC-CGCCAGACAACCCATGGCT--ATCCGGGGCTCGTGAAAAATTTAGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTCATGATACAGAGGAATATGGAAGTGCTGGAAGAGTATGAACCGCTGCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCAGCTCACCTTGTCAGCACAGTACAGACTCTGCGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCCGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGGAATCTCGTGTTGACAAAGGAGCATGTCAATAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGACAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTATGTTGATGCTGAGGAAGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCAGAACCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTAATCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria macaronesica G_38' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCGAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGTCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGACCAACCACCATGTTGACGATTTTGATAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGTTTCGGCCCCCGACTCTTTACCCTGTGGCTACACGGTCCGTGTTGCTTTGGCGGTC--AAACCGCCGCCAGAAACCCTTAAAACTCTGATATCATGTGTGGTCCGAGTCATATGCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGTGCCCGAAGAGCAGTGGCGGTCCGACGTGGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCTTGGCCCTTGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTGATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTTCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGTGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACCAAGGAGCATGTCAACAAGCTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGATGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTAGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCGGATCACAATCAGGTACTGCTCATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria macaronesica PM12_13c' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCGAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGTCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGACCAACCACCATGTTGACGATTTTGATAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGTTTCGGCTCCCGACTCTTTACCCTGTGGCTACACGGTCCGTGTTGCTTTGGCGGTC--AAACCGCCGCCAGAAACCCTTAAAACTCTGATATCATGTG--GTCCGAGTCATATGCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCCCGTCCCCGGGACGGGCCCGAAGAGCAGTGGCGGTCCGACGTGGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCTTGGCCCTTGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTGATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTTCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGTGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACCAAGGAGCATGTCAACAAGCTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGATGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTAGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCGGATCACAATCAGGTACTGCTCATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria macaronesica PM16_14b' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCGAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGTCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGACCAACCACCATGTTGACGATTTTGATAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGTTTCGGCTCCCGACTCTTTACCCTGTGGCTACACGGTCCGTGTTGCTTTGGCGGTC--AAACCGCCGCCAGAAACCCTTAAAACTCTGATATCATGTG--GTCCGAGTCATATGCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCCCGTCCCCGGGACGGGCCCGAAGAGCAGTGGCGGTCCGACGTGGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCTTGGCCCTTGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTGATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTTCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGTGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACCAAGGAGCATGTTAACAAGCTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGATGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTAGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCGGATCACAATCAGGTACTGCTCATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria macaronesica PS_19a' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCGAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGTCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGACCAACCACCATGTTGACGATTTTGATAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGTTTCGGCCCCCGACTCTTTACCCTGTGGCTACACGGTCCGTGTTGCTTTGGCGGTC--AAACCGCCGCCAGAAACCCTTAAAACTCTGATATCATGTGTGGTCCGAGTCATATGCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGTGCCCGAAGAGCAGTGGCGGTCCGACGTGGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCTTGGCCCTTGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTGATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTTCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGTGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACCAAGGAGCATGTTAACAAGCTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGATGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTAGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCGGATCACAATCAGGTACTGCTCATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria orientalis RS_58a' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTGAAAAATCCACTCACAAACAGCAGGGCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTAGAGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATT---------TCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCATCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACAATTATGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTTGAAATCGCCGCC-GAAACCCTC-AAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCGGGCCCTCGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria orientalis RS_83' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTGAAAAATCCACTCACAAACAGCAGGGCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTAGAGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATT---------TCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCATCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACAATTATGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTTGAAATCGCCGCC-GAAACCCTC-AAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCGGGCCCTCGCCAGACAACCCATCATTCCATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCGCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTAGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria pindarensis NE23_02a' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGAGTTTTTCAGTCGGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCTCCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTTAAAATCGCCGCC-GAAACCCT-AAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAATTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCTGGCCCTCGCCAGACAACCTATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria pindarensis NE23_02d' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGAGTTTTTCAGTCGGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTTGTGCCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCTCCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTTAAAATCGCCGCC-GAAACCCT-AAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTTGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCTGGCCCTCGCCAGACAACCTATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria pseudopulmonaria CY_20' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACAACCGGTAGGCCCGCTACCCACTATAGCCTTCCTCAAAATTCCACTTACAACCAGCAGGCCATTTGATCTATAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCATCCAAATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTTCTTATCCGCGAAACTAATGGACAAATCTCGTGCCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATCGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTGACTGTTATCGGTGAGTGCGAAACCCGTTTTGATACTTGAATGATATTTATGGTCGGTATTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGG-GGCTTCGGCCCCCAACTCTTCACCCTGTGGCTGCACAGCCGGTGTTGCTTTGGCGGCC--AAATCGTCGCCGGAAACCCCCAAAACTCTGATATCA-GTGTCGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCCTGGCTTGGTGCTGGGCCTGCGTCCCCGGGACGGGCCTGAACGGCAGTGGCGGTCCGACGTCGGCTTCAAGCGCAGTAGACGCTTGGAAGGCGCGCCGAGATCTCGCCAGATAACCCATCACTCCATCAGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTTGAAGAGTATGAACCGCTCCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTCAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTTTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGACAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTATGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCACTGTGAAATTCATCCCAGTATGATTCTGGGAATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAG 'Lobaria pseudopulmonaria CY_53' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACAACCGGTAGGCCCGCCACCCACCACAGCCTTCCTCAAAATTCCACTTACAACCAGCAGGCCATTTGATCTATAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCATCCAAATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTTCTTATCCGCGAAATTAATGGACAAATCTCGTGCCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATCGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTGACTGTTATCGGTGAGTGCGAAACCCGTTTTGATACTTGAATGATATTTATGGTCGGTATTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGG-GGCTTCGGCCCCCAACTCTTCACCCTGTGGCTGCACAGCCGGTGTTGCTTTGGCGGCC--AAATCGTCGCCGGAAACCCCCAAAACTCTGATATCA-GTGTCGTCCGAGTCACATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCCTGGCTTGGTGTTGGGCCTGCGTCCC-GGGACGGGCCTGAACGGCAGTGGCGGTCTGACGTCGGCTTCAAGCGCAGTAGACGCTTGGAAGGCGCGCCGAGATCTCGCCAGATAACCCATCATTCCATCAGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTTGAAGAGTATGAACCGCTCCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTCAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTTTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGACAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTATGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCACTGTGAAATTCATCCCAGTATGATTCTGGGAATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAG 'Lobaria pulmonaria PS_22a' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGCCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGATCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTAGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACTTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGTTTCGGCCCCCAACTCTTTACCCTGTGGCTACACGGTCCGTGTTGCTTTGGCGGTT--AAATCGCCGCCAGAAACCCTCAAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCGTGGCTTGGTGTTGGGCTCGCGTCCCCGGGATGGGCCTGAAGAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCTGGGCTCTCGCCAGACAAACCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTTTGGTGCGGGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACCAAGGAGCATGTCAACAAGCTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGACAAATTCAGAGGCTGGAAAGGCTTGGTTAACCAAGGTGTCGTAGAGTACGTCGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCGGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria pulmonaria SH1_02a' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGCCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGATCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTAGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACTTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGTTTCGGCCCCCAACTCTTTACCCTGTGGCTACACGGTCCGTGTTGCTTTGGCGGTT--AAATCGCCGCCAGAAACCCTCAAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCGTGGCTTGGTGTTGGGCTCGCGTCCCCGGGATGGGCCTGAAGAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCTGGGCTCTCGCCAGACAAACCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTTTGGTGCGGGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACCAAGGAGCATGTCAACAAGCTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGACAAATTCAGAGGCTGGAAAGGCTTGGTTAACCAAGGTGTCGTAGAGTACGTCGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCGGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria pulmonaria TK_01a' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGCCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGATCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTAGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACTTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGTTTCGGCCCCCAACTCTTTACCCTGTGGCTACACGGTCCGTGTTGCTTTGGCGGTT--AAATCGCCGCCAGAAACCCTCAAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCGTGGCTTGGTGTTGGGCTCGCGTCCCCGGGATGGGCCTGAAGAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCTGGGCTCTCGCCAGACAAACCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACAGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTTTGGTGCGGGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGACCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACCAAGGAGCATGTCAACAAGCTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGACAAATTCAGAGGCTGGAAAGGCTTGGTTAACCAAGGTGTCGTAGAGTACGTCGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCGGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria retigera CB_05' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACAACCGGTAGGCCCGCAACCCACCACAGCCTTCCTCAAAATTCCACTGACAACCAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCATCCAAAATTTTCACCTTGCGGCCTTGGTGGGGCAATTTCCCCCGCGCTTACTATCGCACCAATTTTCTTATCCGCGAAATTAATGGACAAATCTCGTGCCTCCAAATATATTCGTCCAAACAGTGGGAAACGCGACCGATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATCGCTCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTGCGAAACCCGTATTGATACTTGAATGATATTTATGGTCGGTATTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGG-GGCTTCGGCCCCCAACTCTTTACCCTGTGGCTGCACAGCCGGTGTCGCTTTGGCGGCC--GAGTCGTCGTCGGAAACCCCCAAA-CTCTGAT-TCA-GTGTCGTCCGAGTCATACGCAATAACTACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCCTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTGGACTTCAAGCGCAGTAAACGCTTGGAAGGCGCGCCTGGATCTCGCCAGACGAACCATCATTCCAACCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACGGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTTGAAGAGTATGAACCGCTCCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGAGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTTTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGACAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGCGTCGTAGAGTATGTTGATGCTGAGGAAGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCACTGTGAAATTCATCCCAGTATGATTCTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTATTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria sachalinensis RS_100' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTGCTCAAGATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTATTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCCCCAATCTCCTTATCCGCGAAATTAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGACATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACTTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTTACCCCGTGGCTACACGTTCCGTGTTGCTTTGGCGGTTCAAAATCGCCGCC-GAAACCCCCAAAACTCCGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAATAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCCTGGCCCTTGCCAGACAA-CCATCACGCAATCCGGGGCTCGTGAAAAATCTTGCATTAATGTGCTACATCACCGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTTGGGGTTCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAGGAAGACAAATTCAGAGGCTGGAAAGGTTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria sachalinensis RS_113a' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTGCTCAAGATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTATTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCCCCAATCTCCTTATCCGCGAAATTAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGACATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACTTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTTACCCCGTGGCTACACGTTCCGTGTTGCTTTGGCGGTTCAAAATCGCCGCC-GAAACCCCCAAAACTCCGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAATAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCCTGGCCCTTGCCAGACAA-CCATCACGCAATCCGGGGCTCGTGAAAAATCTTGCATTAATGTGCTACATCACCGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTTGGGGTTCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAGGAAGACAAATTCAGAGGCTGGAAAGGTTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria sachalinensis RS_121' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTGCTCAAGATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTATTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCCCCAATCTCCTTATCCGCGAAATTAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGACATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACTTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTTACCCCGTGGCTACACGTTCCGTGTTGCTTTGGCGGTTCAAAATCGCCGCC-GAAACCCCCAAAACTCCGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAATAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCCTGGCCCTTGCCAGACAA-CCATCACGCAATCCGGGGCTCGTGAAAAATCTTGCATTAATGTGCTACATCACCGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTTGGGGTTCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAGGAAGACAAATTCAGAGGCTGGAAAGGTTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria spathulata RS_153' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTGAAAAACCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGCGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGCGAAATTAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTCATGGTCGGTACCAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTCAGAATCGCCGCC-GAAACCC-CAAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGTAGTGAACGCTTGGAAGGCTCGCCTGGCCTTTGCCAGACAATCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACAGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATCCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCAGTGCACTGCTGATAA 'Lobaria spathulata RS_75' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTGAAAAACCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGCGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTCATGGTCGGTACCAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTCAGAATCGCCGCC-GAAACCC-CAAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGTAGTGAACGCTTGGAAGGCTCGCCTGGCCTTTGCCAGACAATCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACAGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATCCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCAGTGCACTGCTGATAA 'Lobaria spathulata RS_96g' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTGAAAAACCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGCGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTCATGGTCGGTACCAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTCAGAATCGCCGCC-GAAACCC-CAAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGTAGTGAACGCTTGGAAGGCTCGCCTGGCCTTTGCCAGACAATCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACAGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATCCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCAGTGCACTGCTGATAA 'Lobaria species 377_2' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCTGCCACGCACCACAGCCTTCCCCAAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCTGCGAAATTAACGGTCAATTCTCGTGCCTCCAAATAT--TCGTCCAAACAGCGGGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTATTATACTTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCT-CGGCCCCCAACTCTTTACCCTGTGGCTACACGATCTGTGTTGCTTTGGCGGTTTACAATCGCCGCCAGAAACCCTCAAAACTCTGATATCATGTGTGGTCCGAGTCATGTTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCCTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCCTGGCCCTCGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCCTTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAAAGGAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAGGAAGATAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGATCTCGAGATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria species 381_1' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCTGCCACGCACCACAGCCTTCCCCAAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCTGCGAAATTAACGGTCAATTCTCGTGCCTCCAAATAT--TCGTCCAAACAGCGGGAAACGCGACCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTATTATACTTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCT-CGGCCCCCAACTCTTTACCCTGTGGCTACACGATCTGTGTTGCTTTGGCGGTTTACAATCGCCGCCAGAAACCCTCAAAACTCTGATATCATGTGTGGTCCGAGTCATGTTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCCTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTCGCCTGGCCCTCGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAAAGGAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAGGAAGATAAATTCAGAGGCTGGAAAGGCTTGGTTAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGATCTCGAGATTTCGAGGCAGATACAAGCCGGCTACGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria species 388_1' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTGAAAAATCCACTCACAAACAGCAGGGCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTAGAGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATT---------TCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCATCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACAATTAAGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTTGAAATCGCCGCC-GAAACC-TC-AAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCGGGCCCTCGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTGATGTGCTACATCACTGTTGGTACACCTAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGATAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria species CT10_04a' CAACGTGGTTGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACTGGTAGGCCTGTCACGCACCACAGCCTTCCTGAAAAATCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGAGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGTGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCTCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTTGAAATCGCCGCC-GAAACCCTCCAAACTCTGATATCATGTGCGGTCCGAGTCACATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTACTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGCAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCTGGCCCTCGCCAGACAATCCATCGTTCAACCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAACGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTCGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria species CT11_02a' CAACGTGGTTGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACTGGTAGGCCCGCCACGCACCACAGCCTTCCTGAAAAATCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGAGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTCGTGTCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTTGAAATCGCCGCC-GAAACCCTCCAAACTCTGATATCATGTGCGGTCCGAGTCACATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTACTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGCAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCTGGCCCTCGCCAGACAATCCATCGTTCAACCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTCGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria species CT12_04a' CAACGTGGTTGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACTGGTAGGCCCGCCACGCACCACAGCCTTCCTGAAAAATCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGAGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTCGTGTCTCCAAATATATTCGTCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGATGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTTGAAATCGCCGCC-GAAACCCTCCAAACTCTGATATCATGTGCGGTCCGAGTCACATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTACTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGCAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCTGGCCCTCGCCAGACAATCCATCGTTCAACCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAACCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGGGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTCGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria species RS_84' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTGAAAAATCCACTCACAAACAGCAGGGCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTAGAGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATT---------TCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCATCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACAATTATGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTTGAAATCGCCGCC-GAAACCCTC-AAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCGGGCCCTCGCCAGACAACCCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTGATGTGCTACATCACTGTTGGTACACCTAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGATAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria species TW2_02_20' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGAGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAACGGGAAACGCGATCAATCACCATGTTGACAATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGAGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACCATCCGTGGTGCTTTGGCGGTTTAGAATCGCCGCC-GAAACCCT-AAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCACGTCCCCGGGACGGGCTCGAATGGCAGTGGCGGTCCGACGCAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCGGGCCCTCGCCAGACAAACCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGGCTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTAGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria species TW2_02_22' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTGAAAAATCCACTCACAAACAGCAGGGCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTAGAGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCACACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCATCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACAATTATGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGAGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACGATCCGTGATGCTTTGGCGGTTTAAAATCGCCGCC-AAAACCC-CAAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGTCGGGCCCTCGCCAGACAACCCATCATTCCAACCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATTACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGGCGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATCCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATGG 'Lobaria species TW2_03_5' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAATTCCACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTCGAGTTTTTCGGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCGTCCAAACAACGGGAAACGCGATCAATCACCATGTTGACAATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGAGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACGATCCGTGGTGCTTTGGCGGTTTAGAATCGCCGCC-GAAACCCT-AAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCACGTCCCCGGGACGGGCTCGAATGGCAGTGGCGGTCCGACGCAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGCCGGGCCCTCGCCAGACAAACCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGGGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAA 'Lobaria species TW2_03_6' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTTTTGAAAAATCCACTCACAAACAGCAGGGCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATGTTCTCTAGAGTTTTTCAGTCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCACACCAATCTCCTTATCCGCGAAATGAACGGTCAATTCTCGTGCCTCCAAATATATTCATCCAAACAGCGGGAAACGCGACCAATCACCATGTTGACAATTATGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCTTTTTTATACGTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGAGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCCGTGGCTACACGATCCGTGATGCTTTGGCGGTTTAAAATCGCCGCC-GAAACCC-CAAAACTCTGATATCATGTGTGGTCCGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCTCGCGTCCTCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTGAACGCTTGGAAGGCTCGTCGGGCCCTCGCCAGACAACCCATCATTCCAACCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGAAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTTGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGATGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGGCGAGAAAAAGAAGATAAGTTCAGAGGCTGGAAGGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGACCTCGAAATTTCGAGGCAAATACAAGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTTTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTAGGGATATGTGCAAGCATTATCCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCACTGCTGATAG 'Lobaria tuberculata RS_62a' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGCCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGACCAATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACTTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTTACCCTGTGGCTACACGGTCCGTGTTGCTTTGGCGGTT--CAACCGCCGCCAGACACCC--AAAACTCTGATATCACGTGTGGTCCGAGTCAT--TCAATAACTACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCGTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCTGAAGAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTTGCTGGGCCCTCGCCAGACAA-CCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACAGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTCAAAATCTTCACCGACGCCGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCGGAAGACCTCGAAATTTCGAGGCAAATACAGGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCTCTGCTGATAA 'Lobaria tuberculata RS_67' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGCCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGACCAATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACTTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTTACCCTGTGGCTACACGGTCCGTGTTGCTTTGGCGGTT--CAACCGCCGCCAGACACCC--AAAACTCTGATATCACGTGTGGTCCGAGTCAT--TCAATAACTACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCGTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCTGAAGAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTTGCTGGGCCCTCGCCAGACAA-CCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACAGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTCAAAATCTTCACCGACGCCGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCGGAAGACCTCGAAATTTCGAGGCAAATACAGGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCTCTGCTGATAA 'Lobaria tuberculata RS_95' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAAGTCCACTCACAAACAGCAGGCCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGATTTTTCACCTTGCGGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATTTCCTTATCCGCCAAATTAACGGACAATTCTCGTGCCTCTAAATACATTCGTCCAAACAGCGTGAAACGCGACCAATCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACTTGAATGATATTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTTACCCTGTGGCTACACGGTCCGTGTTGCTTTGGCGGTT--CAACCGCCGCCAGACACCC--AAAACTCTGATATCACGTGTGGTCCGAGTCAT--TCAATAACTACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCGTGGCTTGGTGTTGGGCTCGCGTCTCCGGGACGGGCCTGAAGAGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTAAACGCTTGGAAGGCTTGCTGGGCCCTCGCCAGACAA-CCATCATTCAATCCGGGGCTCGTGAAAAATCTCGCATTAATGTGCTACATCACTGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCCCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACAGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGAGAATTCAAAATCTTCACCGACGCCGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTCGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGACGAGAAAAAGAAGATAAATTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCGGAAGACCTCGAAATTTCGAGGCAAATACAGGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGTGAAATTCATCCCAGTATGATTCTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGCGGTGCTCTGCTGATAA 'Lobaria yunnanensis CT10_02a' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCGCGCATCACAGCCTTCCTCAAAATTCTACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGCTTTTTCACCTTGCAGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGTGAAATTAACGGTCAACACTCGTGCCTCCGAATATATTCGTCCAAACAGTGGGAAACGCGATCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACTCGAATGATGTTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCTCTGGCTACACCGTCCGTGTTGCTTTGGCGGTTTGAAATCGCCGCC-GAAACCCTCAAACCTCTGATATCGCGTGTGGTCTGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCCTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTGAACGCTTGGAAGCCTCGCCGGGCCCTCGCCAGACAA---ATCGCTCGATCTGGGGCTCGTGAAAAATCTTGCATTAATGTGCTACATCACCGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGTGTGTGGGTTGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTAGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTTGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGGCGAGAAAAAGAAGACAAGTTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAGGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAATAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACCTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCTCGTTCAATGTGGTGCACTGCTGATAA 'Lobaria yunnanensis TW2_02_14' CAACGTGGTCGTTATCGGCCACGTCGACTCTGGCAAGTCGACCACTACCGGTAGGCCCGCCGCGCATCACAGCCTTCCTCAAAATTCTACTCACAAACAGCAGGCCATTTGATCTACAAGTGCGGAGGTATTGATCGTCGTACCATCGAGAAATTTGAGAAGGTACGAGCATATTCTCTCGAGTTTTTCAGCCAGCTTTTTCACCTTGCAGCCTTGGTGGGGCAATTTTCCCCGCGCTTACTATCGCACCAATCTCCTTATCCGTGAAATTAACGGTCAACACTCGTGCCTCCGAATATATTCGTCCAAACAGTGGGAAACGCGATCAACCACCATGTTGACGATTTTGACAGGAAGCTGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAACTAAAGGCTGAGCGTGAACGTGGTATCACCATCGATATTGCGCTATGGAAGTTTGAGACTCCAAAATACTATGTTACTGTCATCGGTGAGTGCGAAACCCGTTTTTATACTCGAATGATGTTTATGGTCGGTACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGGGGCGTCAGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCTCTGGCTACACCGTCCGTGTTGCTTTGGCGGTTTGAAATCGCCGCC-GAAACCCTCAAACCTCTGATATCGCGTGTGGTCTGAGTCATATTCAATAACTACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCCTGGCTTGGTGTTGGGCTCGCGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGACGTAGACTTCAAGCGCAGTGAACGCTTGGAAGCCTCGCCGGGCCCTCGCCAGACAA---ATCGCTCGATCTGGGGCTCGTGAAAAATCTTGCATTAATGTGCTACATCACCGTTGGTACACCCAGTGAACCTATCATTGATTTTATGATACAGAGGAATATGGAAGTGCTCGAAGAGTATGAACCGCTTCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGTGTGTGGGTTGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGACTCTACGAAGGCGACATTGGATCTCTCATGAAGTCAGTCTAGTGCGAGATATTCGTGATCGAGAATTTAAAATCTTCACCGACGCTGGAAGAGTCTGTCGACCGCTATTCGTGATTGATAACGATCCCAAAAGTCCGAATCGTGGTAATCTTGTGTTGACAAAGGAGCATGTCAACAAACTTGAAGACGACAAGGAGCTTGGGCCAGAGCTGGACGCCGAAGGGCGAGAAAAAGAAGACAAGTTCAGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTAGAGTACGTTGATGCTGAGGAGGAAGAAACTGTCATGATTGTCATGACGCCAGAAGACCTCGAGATTTCGAGGCAAATACAGGCCGGCTATGTGATGCCCGAGCCTTCAATTGATGATCCCAATAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACCTGGACGCATTGTGAAATTCATCCCAGTATGATTTTGGGGATATGTGCAAGCATTATTCCCTTTCCAGATCACAATCAGGTACTGCTCATCCT-------------------------- 'Lobarina scrobiculata CB_02' CAACGTGGTCGTCATCGGCCATGTCGACTCTGGCAAGTCGACCACTACTGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAACTCCACTCACAAATAGCAGGCCATTTGATCTATAAATGCGGAGGTATTGACCGTCGTACCATCGAGAAATTTGAGAAGGTATGAGCATACTCTCTCAAGTTTTTCCACCGAAATTTTCACGCTGTAGCCTTGGTGGGGCAAATTTCCCCGCGCTTACTATCGCACCAATTT-CTTATCCGCAAAATTACCGGGCAATTCTCGGACCCCC-AACATATTCGTCCAATTTGCCGGAAACGCGACAAGCCACCATGTTGACAATCTTTACAGGAAGCCGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAGCTAAAGGCTGAGCGCGAGCGTGGCATCACCATCGATATCGCGCTATGGAAGTTCGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTCGAGAACCTGTTTTGATTAGTTAATTATACTTATGTTCAATACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGAGGC-TCGGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCTGTGCGCATCCAACCCGTGTTGCTTTGACGGCATTCA--CGCCGTCCAAGACCATCAAA--CTCGGCATCA-GTGTCGTCGGAGCCATCT--AATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCG-ACGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGGCGTGG-CTTCAAGCGCAGTAGACGCTTGGGAGCCATCTCGGGTCC-CGCCAGTCAACCCA---CTCCAACCGGGGCTCGTGAAAAATCTGGCATTGATGTGCTACATCACTGTGGGTACACCCAGTGAACCCATCATCGATTTCATGATACAGAGAAATATGGAAGTACTTGAAGAGTATGAACCGCTCCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGTCTCTGCGAAGACGGCATTGGATTTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGGGAATTCAAAATCTTCACCGACGCTGGGAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAGAGTCCGAATCGTGGGAATCTCGTGTTGACAAAGGAACATGTCAACAAACTCGAAGACGACAAGGAACTTGGACCTGACGTGGACCCCGAAGGGCGAGAA------GACAAATTCAGAGGCTGGAAAGGCTTAGTCAACCAAGGGGTCGTAGAGTATGTGGATGCTGAGGAAGAAGAAACTGTCATGATTGTCATGACGCCAGAAGATCTCGAGATTTCCCGGCAAATACAAGCAGGCTACGTGATGCCGGAACCTTCAATTGATGACCCCAACAAACGAGTCAAGGCGCCTCTGAACCCAACCGCGCATACTTGGACGCATTGTGAGATTCATCCTAGTATGATTCTGGGGATTTGTGCAAGCATTATCCCCTTTCCAGATCACAATCAGGTATTGTTCACTCTCGCTCAATTCGGTGCAGTGCTAACAA 'Lobarina scrobiculata CY_06' CAACGTGGTCGTCATCGGCCATGTCGACTCTGGCAAGTCGACCACTACTGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAACTCCACTCACAAATAGCAGGCCATTTGATCTATAAATGCGGAGGTATTGACCGTCGTACCATCGAGAAATTTGAGAAGGTATGAGCATACTCTCTCAAGTTTTTCCACCGAAATTTTCACGCTGTAGCCTTGGTGGGGCAAATTTCCCCGCGCTTACTATCGCACCAATTT-CTTATCCGCAAAATTACCGGGCAATTCTCGGACCCCC-AACATATTCGTCCAATTTGCCGGAAACGCGACAAGCCACCATGTTGACAATCTTTACAGGAAGCCGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAGCTAAAGGCTGAGCGCGAGCGTGGCATCACCATCGATATCGCGCTATGGAAGTTCGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTCGAGAACCTGTTTTGATTAGTTAATTATACTTATGTTCAATACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGAGGC-TCGGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCTGTGCGCATCCAACCCGTGTTGCTTTGACGGCATTCA--CGCCGTCCAAGACCATCAAA--CTCGGCATCA-GTGTCGTCGGAGCCATCT--AATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCG-ACGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGGCGTGG-CTTCAAGCGCAGTAGACGCTTGGGAGCCATCTCGGGTCC-CGCCAGTCAACCCA---CTCCAACCGGGGCTCGTGAAAAATCTGGCATTGATGTGCTACATCACTGTGGGTACACCCAGTGAACCCATCATCGATTTCATGATACAGAGAAATATGGAAGTACTTGAAGAGTATGAACCGCTCCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGTCTCTGCGAAGACGGCATTGGATTTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGGGAATTCAAAATCTTCACCGACGCTGGGAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAGAGTCCGAATCGTGGGAATCTCGTGTTGACAAAGGAACATGTCAACAAACTCGAAGACGACAAGGAACTTGGACCTGACGTGGACCCCGAAGGGCGAGAA------GACAAATTCAGAGGCTGGAAAGGCTTAGTCAACCAAGGGGTCGTAGAGTATGTGGATGCTGAGGAAGAAGAAACTGTCATGATTGTCATGACGCCAGAAGATCTCGAGATTTCCCGGCAAATACAAGCAGGCTACGTGATGCCGGAACCTTCAATTGATGACCCCAACAAACGAGTCAAGGCGCCTCTGAACCCAACCGCGCATACTTGGACGCATTGTGAGATTCATCCTAGTATGATTCTGGGGATTTGTGCAAGCATTATCCCCTTTCCAGATCACAATCAGGTATTGTTCACTCTCGCTCAATTCGGTGCAGTGCTAACAA 'Lobarina scrobiculata RS_44' CAACGTGGTCGTCATCGGCCATGTCGACTCTGGCAAGTCGACCACTACTGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAACTCCACTCACAAATAGCAGGCCATTTGATCTATAAATGCGGAGGTATTGACCGTCGTACCATCGAGAAATTTGAGAAGGTATGAGCATACTCTCTCAAGTTTTTCCACCGAAATTTTCACGCTGTAGCCTTGGTGGGGCAAATTTCCCCGCGCTTACTATCGCACCAATTT-CTTATCCGCAAAATTACCGGGCAATTCTCGGACCCCC-AACATATTCGTCCAATTTGCCGGAAACGCGACAAGCCACCATGTTGACAATCTTTACAGGAAGCCGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAGCTAAAGGCTGAGCGCGAGCGTGGCATCACCATCGATATCGCGCTATGGAAGTTCGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTCGAGAACCTGTTTTGATTAGTTAATTATACTTATGTTCAATACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGAGGC-TCGGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCTGTGCGCATCCAACCCGTGTTGCTTTGACGGCATTCA--CGCCGTCCAAGACCATCAAA--CTCGGCATCA-GTGTCGTCGGAGCCATCT--AATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCG-ACGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGGCGTGG-CTTCAAGCGCAGTAGACGCTTGGGAGCCATCTCGGGTCC-CGCCAGTCAACCCA---CTCCAACCGGGGCTCGTGAAAAATCTGGCATTGATGTGCTACATCACTGTGGGTACACCCAGTGAACCCATCATCGATTTCATGATACAGAGAAATATGGAAGTACTTGAAGAGTATGAACCGCTCCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGTCTCTGCGAAGACGGCATTGGATTTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGGGAATTCAAAATCTTCACCGACGCTGGGAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAGAGTCCGAATCGTGGGAATCTCGTGTTGACAAAGGAACATGTCAACAAACTCGAAGACGACAAGGAACTTGGACCTGACGTGGACCCCGAAGGGCGAGAA------GACAAATTCAGAGGCTGGAAAGGCTTAGTCAACCAAGGGGTCGTAGAGTATGTGGATGCTGAGGAAGAAGAAACTGTCATGATTGTCATGACGCCAGAAGATCTCGAGATTTCCCGGCAAATACAAGCAGGCTACGTGATGCCGGAACCTTCAATTGATGACCCCAACAAACGAGTCAAGGCGCCTCTGAACCCAACCGCGCATACTTGGACGCATTGTGAGATTCATCCTAGTATGATTCTGGGGATTTGTGCAAGCATTATCCCCTTTCCAGATCACAATCAGGTATTGTTCACTCTCGCTCAATTCGGTGCAGTGCTAACAA Lobarina_scrobiculata_X62 CAACGTGGTCGTCATCGGCCATGTCGACTCTGGCAAGTCGACCACTACTGGTAGGCCCGCCACGCACCACAGCCTTCCTCAAAACTCCACTCACAAATAGCAGGCCATTTGATCTATAAATGCGGAGGTATTGACCGTCGTACCATCGAGAAATTTGAGAAGGTATGAGCATACTCTCTCAAGTTTTTCCACCGAAATTTTCACGCTGTAGCCTTGGTGGGGCAAATTTCCCCGCGCTTACTATCGCACCAATTT-CTTATCCGCAAAATTACCGGGCAATTCTCGGACCCCC-AACATATTCGTCCAATTTGCCGGAAACGCGACAAGCCACCATGTTGACAATCTTTACAGGAAGCCGCCGAGATGGGCAAGGGCTCTTTCAAATACGCATGGGTTCTCGACAAGCTAAAGGCTGAGCGCGAGCGTGGCATCACCATCGATATCGCGCTATGGAAGTTCGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTCGAGAACCTGTTTTGATTAGTTAATTATACTTATGTTCAATACTAGACGCTCCTGGTCATCGTGACTTCATCAAGAGAGAGAGGC-TCGGCCTCGGGGGCTTCGGCCCCCAACTCTTCACCCTGTGCGCATCCAACCCGTGTTGCTTTGACGGCATTCA--CGCCGTCCAAGACCATCAAA--CTCGGCATCA-GTGTCGTCGGAGCCATCT--AATAACTACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATACCTGTTCGAGCGTCATTACACCCCTCAAGCTTGGCTTGGTGTTGGGCG-ACGTCCCCGGGACGGGCCCGAATGGCAGTGGCGGTCCGGCGTGG-CTTCAAGCGCAGTAGACGCTTGGGAGCCATCTCGGGTCC-CGCCAGTCAACCCA---CTCCAACCGGGGCTCGTGAAAAATCTGGCATTGATGTGCTACATCACTGTGGGTACACCCAGTGAACCCATCATCGATTTCATGATACAGAGAAATATGGAAGTACTTGAAGAGTATGAACCGCTCCGCTCTCCGAATGCAACGAAAGTCTTTGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCACCTTGTCAGCACGGTACAGTCTCTGCGAAGACGGCATTGGATTTCTCATGAAGTCAGTCTGGTGCGAGATATTCGTGATCGGGAATTCAAAATCTTCACCGACGCTGGGAGAGTCTGTCGACCGCTGTTCGTGATTGATAACGATCCCAAGAGTCCGAATCGTGGGAATCTCGTGTTGACAAAGGAACATGTCAACAAACTCGAAGACGACAAGGAACTTGGACCTGACGTGGACCCCGAAGGGCGAGAA------GACAAATTCAGAGGCTGGAAAGGCTTAGTCAACCAAGGGGTCGTAGAGTATGTGGATGCTGAGGAAGAAGAAACTGTCATGATTGTCATGACGCCAGAAGATCTCGAGATTTCCCGGCAAATACAAGCAGGCTACGTGATGCCGGAACCTTCAATTGATGACCCCAACAAACGAGTCAAGGCGCCTCTGAACCCAACCGCGCATACTTGGACGCATTGTGAGATTCATCCTAGTATGATTCTGGGGATTTGTGCAAGCATTATCCCCTTTCCAGATCACAATCAGGTATTGTTCACTCTCGCTCAATTCGGTGCAGTGCTAACAA 'Ricasolia amplissima TUY_15b' CAACGTGGTCGTCATCGGGCACGTCGACTCTGGCAAGTCGACCACTACTGGTAAGCAGGCCACCCACCACAACTGTCCTCGCGTTTTCACTCACAAACAGCAGGTCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACTATCGAGAAGTTTGAGAAGGTACGGGCATATTTTGTCGACTTTTTCA--CACAATTTTCATCTTGTAGCCTTGGTGGGGCAAACTTCCCCGCGCTTAC-GTCGCACTAATTTTCTTATCCGCAAAATCACCGGGT----------TCTCCCAATACATTCGTCCAAATCGCTGGAAACGCGACAAGTCACCATGCTGACAATCTT-ACAGGAAGCCGCCGAGATGGGCAAGGGCTCTTTCAAATATGCATGGGTTCTCGACAAGCTAAAGGCTGAGCGTGAGCGTGGTATCACCATCGATATCGCGTTATGGAAGTTCGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTTTGAACCCCGTTTGGATTAGTGAACGATGTTAATGTTCGATCCTAGACGCTCCTGGTCATCGTGACTTCATCAAGGAACGAGGCGTCCCGCCTCGGGGGCTCCGGCCCCCACCTCTTCACCCAATGGGTACCCAG-CAGCGTTTCTTTGGCGGCTCGCA--CGCCGCCCGAGGCCCCCCAAACTCCAGTGATCCATGTCGTCGGAGCCATATCGAATACGCACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCATTACACCCGTCAAGCGCGGCTTGGTGTTGGGCCGGCGTCCCCGGGACGGGTCCGAATGGCAGTGGCGGTCCGGTGT-GACTTCGAGCGCAGTAGACGCTCGGGAGGCACGCCCGGGTCCGGCCAGTCAACCGCAAACCCCATCATGGGCTCGTGAAAAACCTGGCGTTGATGTGCTACATCACGGTTGGTACACCCAGCGAACCTATCATCGATTTTATGATACAGAGGAATATGGAAGTACTGGAAGAGTATGAACCGCTCCGCTCCCCGAATGCAACCAAAGTCTTCGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCATCTTGTCAGCACGGTACAGTCTCTGCGAAGACGGCATTGGATCTCTCATGAAGTCAGTCTTGTGCGAGATATTCGTGATCGAGAATTCAAAATCTTCACCGACGCTGGGAGAGTCTGTCGACCGCTATTCGTGATTGATAATGATCCCAAGAGTCCGAATCGGGGTAATCTCGTGCTGACAAAGGAGCATGTCAACAAACTCGAAGATGACAAGGAGCTTGGACCCGACACGGACCCTGAAGGACGAGAA------GACAAATTCCGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTGGAGTATGTTGATGCAGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGATCTCGAGATTTCGCGGCAAATACAAGCCGGCTATGTGATGCCGGAACCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGCGAAATTCATCCCAGTATGATCTTAGGGATATGCGCAAGCATAATTCCCTTTCCGGATCACAATCAGGTAATATTCACCCTCGCTCCATGCGGTACAGTGCTAATAA Ricasolia_amplissima_X60 CAACGTGGTCGTCATCGGCCACGTCGACTCTGGCAAGTCGACCACTACTGGTAAGCAGGCCACCCACCACAACTGTCCTCGCGTTTTCACTCACAAACAGCAGGTCATTTGATCTACAAATGCGGAGGTATTGATCGTCGTACTATCGAGAAGTTTGAGAAGGTACGGGCATATTTTGTCGACTTTTTCA--CACAATTTTCATCTTGTAGCCTTGGTGGGGCAAACTTCCCCGCGCTTAC-GTCGCACTAATTTTCTTATCCGCAAAATCACCGGGT----------TCTCCCAATACATTCGTCCAAATCGCTGGAAACGCGACAAGTCACCATGCTGACAATCTT-ACAGGAAGCCGCCGAGATGGGCAAGGGCTCTTTCAAATATGCATGGGTTCTCGACAAGCTAAAGGCTGAGCGTGAGCGTGGTATCACCATCGATATCGCGTTATGGAAGTTCGAGACTCCAAAATACTATGTTACTGTTATCGGTGAGTTTGAACCCCGTTTGGATTAGTGAACGATGTTAATGTTCGATCCTAGACGCTCCTGGTCATCGTGACTTCATCAAGGAACGAGGCGCCCCGCCTCGGGG-CTCCGGCCCCCACCTCTTCACCCGATGGGTACCCAG-CAGCGTTTCTTTGGCGGCTCGCA--CGCCGCCCGAGGCCCCCCAAACTCCAGTGATCCATGTCGTCGGAGCCATATCGAATACGCACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCATTACACCCGTCAAGCGCGGCTTGGTGTTGGGCCGGCGTCCCCGGGACGGGTCCGAATGGCAGTGGCGGTCCGGCGT-GACTTCGAGCGCAGTAGACGCTCGGGAGGCACGCCCGGGTCCGGCCAGTCAACCGCAAACCCCATCATGGGCTCGTGAAAAACCTGGCGTTGATGTGCTACATCACGGTTGGTACACCCAGCGAACCTATCATCGATTTTATGATACAGAGGAATATGGAAGTACTGGAAGAGTATGAACCGCTCCGCTCCCCGAATGCAACCAAAGTCTTCGTCAATGGCGTGTGGGTCGGGGTCCATCGGGATCCGGCTCATCTTGTCAGCACGGTACAGTCTCTGCGAAGACGGCATTGGATCTCTCATGAAGTCAGTCTTGTGCGAGATATTCGTGATCGAGAATTCAAAATCTTCACCGACGCTGGGAGAGTCTGTCGACCGCTATTCGTGATTGATAATGATCCCAAGAGTCCGAATCGGGGTAATCTCGTGCTGACAAAGGAGCATGTCAACAAACTCGAAGATGACAAGGAGCTTGGACCCGACACGGACCCTGAAGGACGAGAA------GACAAATTCCGAGGCTGGAAAGGCTTGGTCAACCAAGGTGTCGTGGAGTATGTTGATGCAGAGGAGGAAGAAACTGTCATGATTGTCATGACACCAGAAGATCTCGAGATTTCGCGGCAAATACAAGCCGGCTATGTGATGCCGGAACCTTCAATTGATGATCCCAACAAACGAGTCAAGGCGCCTCTGAATCCAACCGCGCATACTTGGACGCATTGCGAAATTCATCCCAGTATGATCTTAGGGATATGCGCAAGCATAATTCCCTTTCCGGATCACAATCAGGTAATATTCACCCTCGCTCCATGCGGTACAGTGCTAATAA ; END; BEGIN TREES; TITLE Cornejo; LINK TAXA = Taxa1; TRANSLATE 1 'Lobaria species 388_1', 2 'Lobaria species RS_84', 3 'Lobaria orientalis RS_83', 4 'Lobaria orientalis RS_58a', 5 'Lobaria isidiophora TW3_01_10', 6 'Lobaria chinensis CT3_02a', 7 'Lobaria isidiophora CT3_01b', 8 'Lobaria species TW2_03_6', 9 'Lobaria species TW2_02_22', 10 'Lobaria pindarensis NE23_02d', 11 'Lobaria pindarensis NE23_02a', 12 'Lobaria species TW2_02_20', 13 'Lobaria species TW2_03_5', 14 'Lobaria spathulata RS_75', 15 'Lobaria spathulata RS_96g', 16 'Lobaria spathulata RS_153', 17 'Lobaria species CT11_02a', 18 'Lobaria species CT12_04a', 19 'Lobaria species CT10_04a', 20 'Lobaria species 377_2', 21 'Lobaria species 381_1', 22 'Lobaria sachalinensis RS_100', 23 'Lobaria sachalinensis RS_121', 24 'Lobaria sachalinensis RS_113a', 25 'Lobaria kazawaensis RS_104', 26 Lobaria_immixta_X3, 27 'Lobaria immixta SH1_02g', 28 'Lobaria immixta ST2_01g', 29 'Lobaria immixta SG3_01a', 30 'Lobaria immixta SP3_10a', 31 'Lobaria macaronesica PM12_13c', 32 'Lobaria macaronesica PM16_14b', 33 'Lobaria macaronesica PS_19a', 34 'Lobaria macaronesica G_38', 35 'Lobaria tuberculata RS_62a', 36 'Lobaria tuberculata RS_67', 37 'Lobaria tuberculata RS_95', 38 'Lobaria pulmonaria PS_22a', 39 'Lobaria pulmonaria SH1_02a', 40 'Lobaria pulmonaria TK_01a', 41 'Lobaria yunnanensis TW2_02_14', 42 'Lobaria yunnanensis CT10_02a', 43 'Lobaria retigera CB_05', 44 'Lobaria kurokawae CY_18', 45 'Lobaria pseudopulmonaria CY_53', 46 'Lobaria pseudopulmonaria CY_20', 47 Lobaria_anomala_X107, 48 'Lobaria anomala CY_08', 49 Lobaria_linita_X122, 50 Lobaria_linita_CH, 51 'Lobaria linita RS_63', 52 'Lobarina scrobiculata CB_02', 53 'Lobarina scrobiculata RS_44', 54 'Lobarina scrobiculata CY_06', 55 Lobarina_scrobiculata_X62, 56 'Ricasolia amplissima TUY_15b', 57 Ricasolia_amplissima_X60; TREE tree_1 = [&R] ((56:0.00418814,57:1.6E-7):0.100199885,((54:2.0E-8,(55:2.0E-8,(52:2.0E-8,53:2.0E-8):2.0E-8):2.0E-8):0.10649698,((51:0.01557519,(49:2.0E-8,50:2.0E-8):0.01221092):0.051875,(((47:0.00207417,48:5.0E-8):0.04629537,((43:0.01309223,44:0.00802717):0.01615389,(45:0.00206447,46:0.00619825):0.01818394):0.01622396):0.00264519,(((35:0.00102954,(36:7.0E-8,37:0.00102951):7.0E-8):0.01388843,((38:2.0E-8,(39:2.0E-8,40:0.00409403):2.0E-8):0.01141173,(((31:2.0E-8,32:0.00102272):0.00204588,(33:0.00101954,34:2.0E-8):0.00103134):0.01142512,(27:0.00102034,(30:0.0030668,(29:2.0E-8,(26:2.0E-8,28:2.0E-8):0.00101968):2.0E-8):0.00102072):0.00895929):0.01139917):0.00610509):0.01238813,(((41:2.0E-8,42:7.0E-8):0.04278611,(25:0.00971,(22:2.0E-8,(23:2.0E-8,24:2.0E-8):2.0E-8):0.0030103):0.01581021):0.00676809,((20:0.00102871,21:0.00305673):0.01228398,((10:0.00204601,11:0.00101767):0.00308102,(((12:0.00297781,13:0.00112115):0.00831896,(6:0.00101876,(5:0.00101742,7:0.00410475):0.00102203):0.00823113):0.003175,((16:0.00102136,(14:7.0E-8,15:2.0E-8):2.0E-8):0.01341359,((19:0.00520141,(17:2.0E-8,18:0.00305818):9.3723E-4):0.01153788,((1:0.00102799,2:2.0E-8):0.00308254,(4:2.0E-8,(3:0.00205373,(8:0.00412046,9:0.00307311):0.01099463):0.00108237):7.0E-8):0.00789194):8.1074E-4):0.00220673):5.0E-8):0.0198053):5.5832E-4):0.00407915):0.01995385):0.01200549):0.09731184):0.100199885); END;