#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 26, 2020; 21:06 GMT TreeBASE (cc) 1994-2008 Study reference: Castellanos C., Steeves R.A., Bruneau A., & Lewis G.P. 2016. A settled sub-family for the Orphan tree: The phylogenetic position of the endemic Colombian genus Orphanodendron in the Leguminosae. Brittonia, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S18227] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=79; TAXLABELS Ammodendron_bifolium Amphiodon_effusa Anarthrophyllum_cumingii Anarthrophyllum_desideratum Baptisia_australis Bolusanthus_speciosus Bowdichia_nitida Bowdichia_virgilioides Brongniartia_alamosana Brongniartia_peninsularis Cadia_purpurea Calpurnia_aurea Camoensia_brevicalyx Camoensia_scandens Clathrotropis_macrocarpa Clathrotropis_nitida Crotalaria_incana Cyclolobium_brasiliense Cytisus_scoparius Dicraeopetalum_capuronianum Dicraeopetalum_stipulare Diplotropis_brasiliensis Diplotropis_ferruginea Diplotropis_incexis Diplotropis_martiusii Diplotropis_purpurea Diplotropis_triloba Genista_monspessulana Guianodendron_praeclarum Harpalyce_arborescens Harpalyce_brasiliana Harpalyce_formosa Hovea_purpurea Lamprolobium_fruticosum Leptolobium_bijugum Leptolobium_brachystachyum Leptolobium_dasycarpum Leptolobium_elegans Leptolobium_nitens Leptolobium_panamense Leptolobium_parvifolium Leptolobium_tenuifolium Lupinus_argenteus Maackia_amurensis Ormosia_amazonica Ormosia_arborea Ormosia_bahiensis Ormosia_colombiana Ormosia_costulata Ormosia_coutinhoi Ormosia_excelsa Ormosia_fastigiata Ormosia_formosana Ormosia_holerythra Ormosia_limae Ormosia_minor Ormosia_nitida Ormosia_paraensis Ormosia_smithii Ormosia_sp Ormosia_stipularis Ormosia_timboensis Orphanodendron_bernalii Orphanodendron_grandiflorum Panurea_longifolia Piptanthus_nepalensis Poecilanthe_falcata Poecilanthe_parviflora Poecilanthe_subcordata Sophora_davidii Spartium_junceum Spirotropis_longifolia Staminodianthus_duckei Staminodianthus_racemosa Tabaroa_caatingicola Templetonia_hookeri Templetonia_retusa Thermopsis_rhombifolia Ulex_europaeus ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=674; TAXLABELS Abrus_precatorius_AF142705 Acacia_cochliacantha_AF274133 Acacia_myrtifolia_AF274160 Acosmium_cardenasii_JX124425 Acosmium_diffusissimum_JX124415 Acosmium_lentiscifolium_JX124417 Acrocarpus_fraxinifolius_EU36184 Adenanthera_pavonina_AF521808 Adenolobus_garipensis_EU361844 Adesmia_lanata_AF270863 Aeschynomene_indica_AF272084 Aeschynomene_purpusii_AF270870 Afzelia_bella_EU361846 Aganope_thyrsiflora_JX506602 Airyantha_schweinfurthii_JX29589 Albizia_versicolor_AF274210 Aldina_heterophylla_JX295956 Aldina_insignis_JN168674 Aldina_latifolia_JX295861 Alexa_bauhiniiflora_JX295931 Alexa_canaracunensis_JQ669613 Alexa_grandiflora_JF491262 Alexa_grandiflora_JX295968 Alexa_wachenheimii_JQ626338 Alhagi_sparsifolia_AY177669 Alistilus_jumellei_JN008191 Alysicarpus_vaginalis_JQ587510 Amblygonocarpus_andongens_AF5218 Amburana_acreana_JX295866 Amburana_cearensis_AY553712 Amburana_cearensis_JX846614 Amherstia_nobilis_EU361849 Amicia_glandulosa_AF203583 Ammodendron_argenteum_AY386957 Ammopiptanthus_mongolicus_JQ8201 Ammopiptanthus_nanus_JQ820170 Amorpha_apiculata_AY391784 Amorpha_fruticosa_AY391785 Amphicarpaea_bracteata_AY582971 Amphimas_pterocarpoides_JX295894 Amphiodon_effusus_JX295892 Anarthrophyllum_desideratum_AY38 Ancistrotropis_peduncularis_JN00 Andira_carvalhoi_JX295958 Andira_galeottiana_AF142681 Andira_humilis_JX295960 Andira_inermis_JF501102 Andira_legalis_JX295893 Andira_marauensis_JX295899 Andira_ormosioides_JX295962 Andira_sp_JX295896 Angylocalyx_sp_AY553715 Angylocalyx_talbotii_JQ669611 Anthyllis_vulneraria_AF543845 Aotus_ericoides_AY386884 Aphanocalyx_cynometroides_EU3618 Apios_americana_AY386926 Apoplanesia_paniculata_AF270860 Apuleia_leiocarpa_EU361858 Apurimacia_dolichocarpa_FJ968527 Arachis_pintoi_AF203596 Arapatiella_psilophylla_EU361859 Archidendron_hirsutum_EU361860 Arcoa_gonavensis_EU361861 Argyrolobium_velutinum_JQ412199 Aspalathus_pinguis_JQ412203 Astragalus_canadensis_AY386875 Ateleia_arsenii_GU220019 Ateleia_glazioveana_GU220020 Ateleia_guaraya_JX295883 Ateleia_herbertsmithii_AY386953 Ateleia_mcvaughii_GU220021 Ateleia_popenoei_GU220022 Ateleia_pterocarpa_GU220023 Austrosteenisia_blackii_AF142707 Baphia_leptobotrys_EU361865 Baphia_madagascariensis_AY553718 Baphia_massaiensis_AF142683 Baphia_nitida_EU361867 Baphiopsis_parviflora_JX295895 Baptisia_australis_AY386900 Barnebydendron_riedelii_EU361868 Barnebyella_calycina_JQ669593 Batesia_floribunda_EU361869 Bauhinia_galpinii_EU361875 Berlinia_congolensis_EU361881 Bionia_bella_Torres12 Bionia_coriacea_LPQ13611 Bituminaria_bituminosa_JF501107 Bobgunnia_fistuloides_EU361885 Bobgunnia_madagascariensis_AY386 Bocoa_prouacensis_FJ037904 Bocoa_prouacensis_JQ626415 Bolusanthus_speciosus_AF142685 Bolusia_amboensis_JQ040984 Bossiaea_cordigera_AY386888 Bowdichia_nitida_JX124395 Bowdichia_virgiloides_AY386937 Brachypterum_robustum_AF142716 Brandzeia_filicifolia_EU361870 Brodriguesia_santosii_EU361890 Brongniartia_alamosana_AF142688 Brongniartia_peninsularis_GQ2461 Brownea_coccinea_EU361891 Brya_ebenus_AF270876 Bryaspis_lupulina_AF272068 Butea_monosperma_JN008175 Cadia_purpurea_JX295932 Caesalpinia_pulcherrima_EU361906 Cajanus_cajan_EU717414 Callerya_reticulata_JQ619954 Calliandra_juzepczukii_EU812063 Calophaca_pskemica_JQ669603 Calopogonium_sp_JQ669608 Calpurnia_aurea_AY386951 Camoensia_brevicalyx_JX295946 Camoensia_scandens_JX295919 Camptosema_ellipticum_LPQ14073 Camptosema_spectabile_LPQ7088 Campylotropis_macrocarpa_AY38687 Canavalia_parviflora_HQ707539 Candolleodendron_brachystachyum Candolleodendron_brachystachyum2 Caragana_arborescens_AF142737 Carmichaelia_williamsii_AY386873 Cascaronia_astragalina_AF272072 Cassia_grandis_EU361909 Castanospermum_australe_JX295891 Centrolobium_robustum_EU401414 Centrosema_sagittatum_JQ587552 Ceratonia_siliqua_EU361911 Cercis_canadensis_AY386908 Cercis_gigantea_AY386948 Cercis_occidentalis_AY386853 Chaetocalyx_scandens_AF270865 Chamaecrista_nictitans_EU361914 Chapmannia_gracilis_AF203592 Chesneya_elegans_JQ619958 Chloroleucon_manganse_AY386921 Cicer_canariense_AF522079 Cladrastis_delavayi_AY386861 Cladrastis_lutea_AF142694 Cladrastis_platycarpa_AY386935 Clathrotropis_macrocarpa_JX29593 Clathrotropis_nitida_JX295951 Cleobulia_multiflora_Jesus13 Clianthus_puniceus_AY386914 Clitoria_ternatea_EU717427 Cochliasanthus_caracalla_JN00827 Cojoba_catenata_AY944554 Collaea_stenophylla_LPQ12460 Cologania_pallida_JQ619980 Colophospermum_mopane_EU361915 Colutea_arborescens_AY386874 Condylostylis_candida_JN008260 Conzattia_multiflora_AY386918 Copaifera_officinalis_EU361918 Cordeauxia_edulis_EU361920 Cordyla_africana_JF270724 Cordyla_africana_JX295923 Coronilla_coronata_JQ619970 Coursetia_glandulosa_AF543852 Cranocarpus_martii_AF270875 Craspedolobium_schochii_JF953573 Cratylia_mollis_LPQ8024 Crotalaria_incana_GQ246141 Crotalaria_juncea_JQ619982 Crotalaria_pumila_AY386867 Crotalaria_saltiana_JQ619981 Crudia_choussyana_EU361921 Cullen_tenax_EF550004 Cyamopsis_senegalensis_AF142698 Cyathostegia_matthewsii_HM347482 Cyathostegia_matthewsii_HM347483 Cyathostegia_matthewsii_HM347486 Cyclocarpa_stellaris_AF272067 Cyclolobium_brasiliense_GQ246152 Cyclolobium_nutans_AF142686 Cymbosema_roseum_DC2868 Cytisus_scoparius_AY386902 Dalbergia_congestiflora_AF142696 Dalbergiella_nyasae_AF142706 Dalea_brachystachya_EU025886 Dalea_cliffortiana_AY391787 Dalea_hospes_AY391789 Dalea_lanata_AY391790 Dalea_lumholtzii_AY391791 Dalea_mollissima_AY391794 Dalea_neomexicana_AY391795 Dalea_pogonathera_AY391796 Dalea_pulchra_AY386860 Dalea_purpurea_AY391798 Dalea_scandens_AY391800 Daniellia_klainei_EU361927 Daviesia_latifolia_AY386887 Decorsea_schlechteri_AY582975 Deguelia_dasycalyx_LPQ14503 Delonix_elata_EU361928 Dermatophyllum_arizonicum_AY3868 Dermatophyllum_secundiflorum_AF1 Derris_laxiflora_AF142715 Desmanthus_cooleyi_AY386916 Desmodium_barbatum_EU717420 Detarium_macrocarpum_EU361929 Dialium_guianense_EU361930 Dichilus_lebeckioides_GQ246143 Dichrostachys_richardiana_AF5218 Dicraeopetalum_stipulare_GQ24614 Dicymbe_altsonii_EU361932 Dimorphandra_conjugata_EU361934 Dinizia_excelsa_JX295860 Dioclea_grandiflora_JX295862 Dioclea_lasiophylla_DC2324 Diphysa_floribunda_AF203575 Diplotropis_brasiliensis_AY38693 Diplotropis_ferruginea_JX124397 Diplotropis_incexis_JX124401 Diplotropis_martiusii_AY386938 Diplotropis_purpurea_JX124418 Diplotropis_triloba_JX124398 Dipogon_lignosus_AY582988 Dipteryx_alata_AY553717 Dipteryx_magnifica_JX295871 Dipteryx_odorata_JX295898 Dipteryx_oleifera_JX295933 Dipteryx_polyphylla_JX295870 Dipteryx_punctata_JX295869 Dipteryx_rosea_JF491268 Diptychandra_aurantiaca_EU361935 Discolobium_psoraleifolium_AF270 Distemonanthus_benthamianus_EU36 Disynstemon_paullenoides_GU95167 Dolichopsis_paraguariensis_AY509 Dolichos_trilobus_AY582976 Dorycnium_pentaphyllum_JQ619968 Duparquetia_orchidacea_EU361937 Duparquetia_orchidacea_RADS Dussia_lanata_JX295925 Dussia_lehmannii_JX295924 Dussia_macroprophyllata_AY386903 Ebenopsis_ebano_AF274123 Ebenus_cretica_JQ619960 Endertia_spectabilis_EU361943 Entada_abyssinica_AF521829 Enterolobium_cyclocarpum_AY65027 Eperua_rubiginosa_EU361947 Eremosparton_flaccidum_JQ619964 Eriosema_diffusum_JQ587629 Errazurizia_benthamii_AY391803 Errazurizia_megacarpa_AY391804 Erythrina_cristagalli_AY386869 Erythrophleum_suaveolens_EU36194 Etaballia_guianensis_AF272074 Euchlora_hirsuta_JQ041113 Eurypetalum_tessmannii_EU361950 Exostyles_aff_venusta_JX152591 Exostyles_godoyensis_JX152589 Exostyles_venusta_JX152590 Eysenhardtia_orthocarpa_AY386909 Eysenhardtia_polystachya_EU02590 Eysenhardtia_texana_AY391807 Faidherbia_albida_AF274129 Fiebrigiella_gracilis_AF203590 Fissicalyx_fendleri_AF272063 Fordia_splendidissima_AF142718 Gagnebina_commersoniana_AF521836 Galactia_martii_LPQ7583 Galactia_striata_AF142704 Galega_orientalis_AF522083 Gastrolobium_punctatum_AY386885 Genista_monspessulana_AY386862 Genistidium_dumosum_AF543858 Geoffroea_spinosa_AF270879 Gilletiodendron_pierreanum_EU361 Gleditsia_sinensis_AY386930 Gleditsia_triacanthos_AY386849 Gliricidia_brenningii_AF547199 Glycine_max_AF142700 Glycyrrhiza_lepidota_AY386883 Gompholobium_minus_AY386891 Goniorrhachis_marginata_EU361959 Gossweilerodendron_balsamiferum Grazielodendron_riodocense_AF270 Gueldenstaedtia_stenophylla_JQ66 Guianodendron_praeclarum_JX12440 Guianodendron_praeclarum2_JX1244 Guilfoylia_monostylis_EU604031 Gymnocladus_chinensis_AY386928 Halimodendron_halodendron_JQ6199 Hammatolobium_kremerianum_JQ6199 Hardenbergia_violacea_EU717425 Harleyodendron_unifoliolatum_JX1 Harpalyce_arborescens_AF142689 Harpalyce_brasiliana_GQ246153 Harpalyce_formosa_GQ246154 Havardia_alibicans_AF523085 Hebestigma_cubense_AF543850 Hedysarum_boreale_AY386892 Helicotropis_linearis_JN008258 Hippocrepis_unisiliquosa_JQ61998 Hoffmannseggia_glauca_EU361969 Hoita_orbicularis_EF549962 Holocalyx_balansae_AY553714 Holocalyx_balansae_JX152593 Hovea_purpurea_AY386889 Humularia_corbisieri_AF272069 Hybosema_ehrenbergii_AF547195 Hymenaea_courbaril_AY386906 Hymenaea_verrucosa_EU361974 Hymenolobium_alagoanum_JX295906 Hymenolobium_grazielanum_JX29590 Hymenolobium_heringerianum_JX295 Hymenolobium_heterocarpum_JX2959 Hymenolobium_heterocarpum2_JX295 Hymenolobium_janeirense_JX295904 Hymenolobium_mesoamericanum_AY38 Hymenolobium_petraeum_JX295909 Hymenolobium_sericeum_JX275933 Hypocalyptus_coluteoides_AY38688 Indigofera_suffruticosa_AF142697 Inga_edulis_AF523078 Inocarpus_fagifer_AF270878 Intsia_bijuga_EU361981 Isotropis_foliosa_AY386890 Kennedia_nigricans_EU717424 Koompassia_excelsa_EU361988 Kotschya_ochreata_AF272065 Kummerowia_stipulacea_EU717417 Kunstleria_ridleyi_JX506598 Labichea_punctata_EU361989 Lablab_purpureus_AY582989 Laburnum_anagyroides_HE967423 Lackeya_multiflora_AL Ladeania_juncea_EF549986 Lamprolobium_fruiticosum_GQ24615 Lathyrus_sativus_AF522086 Lebeckia_sericea_GQ246144 Lecointea_hatschbachii_JX152594 Lecointea_peruviana_EU361990 Lecointea_peruviana_JX295927 Lennea_modesta_AF543851 Lens_culinaris_AF522089 Leonardoxa_africana_EU361992 Leptoderris_brachyptera_JX506611 Leptolobium_bijugum_JX124404 Leptolobium_brachystachyum_JX124 Leptolobium_dasycarpum_JX124408 Leptolobium_elegans_JX124410 Leptolobium_nitens_JX124409 Leptolobium_panamense_AF142684 Leptolobium_parvifolium_JX124411 Leptolobium_tenuifolium_JX124413 Leptospron_adenanthum_AY582983 Lespedeza_cuneata_EU717416 Lessertia_herbacea_AY920453 Leucaena_leucocephala_AF523094 Leucomphalos_brachycarpus_JX2958 Leucomphalos_mildbraedii_JX29586 Libidibia_ferrea_EU361901 Lonchocarpus_lanceolatus_AF14271 Lotus_purshianus_AF142729 Luetzelburgia_amazonica_JX152622 Luetzelburgia_andina_JX152624 Luetzelburgia_andradelimae_JX152 Luetzelburgia_auriculata_JX15263 Luetzelburgia_bahiensis_JX152634 Luetzelburgia_guaissara_JX152636 Luetzelburgia_guianensis_JX15263 Luetzelburgia_harleyi_JX152642 Luetzelburgia_neurocarpa_JX15264 Luetzelburgia_praecox_JX152646 Luetzelburgia_purpurea_JX152648 Luetzelburgia_sotoi_JX152652 Luetzelburgia_trialata_JX152617 Lupinus_argenteus_AY386956 Lupinus_cosentinii_AY386943 Lupinus_odoratus_EU025914 Lupinus_sparsiflorus_JQ619990 Lupinus_texensis_JQ619989 Lysidice_rhodostegia_EU361995 Lysiloma_acapulcensis_AF274126 Lysiphyllum_gilvum_EU361876 Maackia_amurensis_AY386944 Machaerium_falciforme_AF142692 Macroptilium_longipedunculatum_A Macrotyloma_stenophyllum_JN00818 Maraniona_lavinii_AY247263 Marina_parryi_AY386859 Marina_scopa_AY391811 Mariosousa_dolichostachya_EU8120 Martiodendron_parviflorum_EU3619 Medicago_sativa_AY386881 Melanoxylon_brauna_EU362000 Melilotus_albus_AF142738 Mendoravia_dumaziana_EU362001 Mezoneuron_angolense_EU361897 Microcharis_karinensis_AY650279 Microlobium_foetidus_AF523095 Millettia_grandis_AF142724 Millettia_thonningii_AF142723 Mimosa_tenuiflora_AF274120 Mimozyganthus_carinatus_AY944557 Moldenhawera_brasiliensis_EU3620 Monnina_phytolaccifolia_EU596519 Monopteryx_inpae_JX295875 Monopteryx_inpae_JX295876 Mora_gonggrijpii_EU362005 Mucuna_pruriens_AB627857 Muellera_campestris_DC2320 Mundulea_sericea_AF142713 Myrocarpus_emarginatus_JQ669614 Myrocarpus_emarginatus_JX295863 Myrocarpus_fastigiatus_JX295966 Myrocarpus_frondosus_AY386925 Myrospermum_frutescens_AF142679 Myrospermum_frutescens_JQ587794 Myrospermum_frutescens_JQ587796 Myrospermum_sousanum_AY386959 Myrospermum_sousanum_JX295922 Myrospermum_sousanum_JX295938 Myroxylon_balsamum_FJ151488 Myroxylon_balsamum_JX295912 Myroxylon_balsamum_JX295935 Myroxylon_balsamum_JX295936 Myroxylon_balsamum_JX295937 Myroxylon_peruiferum_JX295911 Mysanthus_uleanus_AY509941 Neochevalierodendron_stephanii_E Neodunnia_richardiana_AF142726 Neonotonia_wightii_EU717402 Neorautanenia_mitis_JN008178 Neptunia_monosperma_AF523090 Nesphostylis_holosericea_AY58297 Nissolia_hirsuta_AF270868 Olneya_tesota_AF543857 Onobrychis_montana_AY386879 Ononis_natrix_AF522114 Ophrestia_radicosa_EU717430 Orbexilum_lupinellum_EF549995 Ormocarpopsis_itremoensis_AF2035 Ormocarpum_keniense_AF203602 Ormosia_aff_bahiensis_JX295944 Ormosia_aff_fastigiata_JX295885 Ormosia_arborea_JX295939 Ormosia_bahiensis_JX295886 Ormosia_coccinea_GQ982055 Ormosia_colombiana_AY386960 Ormosia_costulata_JX295887 Ormosia_coutinhoi_JX295880 Ormosia_excelsa_JX295884 Ormosia_fastigiata_JX295941 Ormosia_fordiana_HQ415278 Ormosia_formosana_AF142682 Ormosia_glaberrima_HQ415279 Ormosia_henryi_HM049514 Ormosia_krugii_HM446725 Ormosia_limae_JX295879 Ormosia_macrocalyx_GQ982056 Ormosia_nitida_JX295881 Ormosia_paraensis_JX295888 Ormosia_semicastrata_HQ415280 Ormosia_smithii_JX295954 Ormosia_sp_nov_JX295877 Ormosia_sp_nov_JX295945 Ormosia_stipularis_JX295882 Ormosia_timboensis_JX295878 Ornithopus_compressus_AF142727 Orphanodendron_bernalii_12796_KT718816 Orphanodendron_bernalii_701_KT718814 Orphanodendron_bernalii_703_KT718815 Orphanodendron_grandiflorum_451_KT718817 Orphanodendron_grandiflorum_750_KT718818 Ostryocarpus_riparius_JX506599 Otholobium_bracteolatum_EF550005 Otoptera_burchellii_JN008176 Oxyrhynchus_volubilis_AY509935 Oxystigma_oxyphyllum_EU362012 Oxytropis_lambertii_AY386915 Pachyrhizus_erosus_EU717401 Panurea_longifolia_JX295947 Paraderris_elliptica_AF142714 Paramachaerium_schomburgkii_AF27 Parapiptadenia_pterosperma_DQ790 Pararchidendron_pruinosum_AF2741 Paraserianthes_lophantha_AF27412 Parkia_multijuga_EU362018 Parkinsonia_aculeata_AY386917 Parochetus_communis_AF522115 Parryella_filifolia_AY391812 Pediomelum_pentaphyllum_EF549992 Peltogyne_floribunda_EU362022 Peltophorum_dubium_AY386846 Pentaclethra_macroloba_AY386904 Petalostylis_labicheoides_AY3868 Peteria_thompsonae_AF47190 Phanera_outimouta_EU361877 Phaseolus_vulgaris_AY582987 Philenoptera_eriocalyx_AF142720 Phyllodium_pulchellum_HM049524 Phylloxylon_spinosa_AY650280 Physostigma_venenosum_JN008195 Pickeringia_montana_var_montana Pickeringia_montana_var_tomentos Pictetia_marginata_AF203578 Piptadenia_adiantoides_DQ790611 Piptadenia_viridiflora_AF521856 Piptadeniastrum_africanum_AF5218 Piptadeniopsis_lomentifera_AY944 Piptanthus_nepalensis_AY386924 Piscidia_piscipula_AF142710 Pisum_sativum_AY386961 Plagiocarpus_axillaris_GQ246160 Platycyamus_regnellii_AF142709 Platymiscium_stipulare_AF270872 Platypodium_elegans_AF270877 Poecilanthe_falcata_GQ246155 Poecilanthe_parviflora_AF142687 Poecilanthe_subcordata_GQ246156 Poeppigia_procera_AY386907 Poiretia_angustifolia_AF270864 Poissonia_hypoleuca_AF547193 Poitea_glyciphylla_AY650278 Polygala_californica_AY386842 Pongamiopsis_amygdalina_AF142711 Prioria_copaifera_EU362030 Prosopidastrum_mexicanum_AY38691 Prosopis_glandulosa_AY386851 Pseudarthria_hookeri_JF270902 Pseudoprosopis_gilletii_AF521861 Pseudovigna_argentea_JN008179 Psophocarpus_lancifolius_JN00817 Psoralea_cinerea_AF142699 Psorothamnus_arborescens_AY39181 Psorothamnus_emoryi_AY391815 Psorothamnus_fremontii_AY391817 Psorothamnus_polydenius_AY391819 Psorothamnus_scoparius_AY391821 Psorothamnus_spinosus_AY391822 Pterocarpus_indicus_AF142691 Pterodon_abruptus_JX295873 Pterodon_emarginatus_JX295874 Pterodon_pubescens_AF272095 Pterogyne_nitens_EU362031 Ptycholobium_biflorum_JQ669619 Pueraria_montana_AY582972 Quillaja_saponaria_AY386843 Rafnia_angulata_JQ412281 Ramirezella_strobilophora_AY5099 Ramorinoa_girolae_AF270881 Rhodopsis_planisiliqua_AAC1765 Rhynchosia_edulis_JQ587827 Riedeliella_graciliflora_AH00991 Robinia_pseudoacacia_AF142728 Rupertia_physodes_AY386868 Samanea_saman_AF523073 Saraca_indica_EU362034 Schizolobium_parahyba_EU362036 Securigera_varia_AF543846 Senna_alata_EU362042 Senna_covesii_AY386850 Sesbania_tomentosa_JX295926 Shuteria_vestita_EU717423 Sigmoidotropis_speciosa_DQ443466 Sindora_klaineana_EU362045 Smirnowia_turkestana_JQ669579 Smithia_ciliata_AF272066 Soemmeringia_semperflorens_AF272 Sophora_davidii_AY386958 Sophora_macrocarpa_JQ619975 Sophora_microphylla_JQ619976 Sophora_nuttalliana_AY386865 Sophora_stenophylla_JQ669580 Spartium_junceum_AY386901 Spathionema_kilimandscharicum_JN Sphaerophysa_salsula_JQ669581 Sphenostylis_angustifolia_AY5829 Sphinctospermum_constrictum_AF54 Spirotropis_longifolia_JX295948 Spirotropis_longifolia_JX295949 Spirotropis_longifolia_JX295950 Staminodianthus_duckei_JX124405 Staminodianthus_racemosus_JX1244 Staminodianthus_rosae_JX124396 Steinbachiella_leptoclada_JQ7106 Storckiella_australiensis_EU3620 Strophostyles_helvola_AY509949 Stryphnodendron_rotundifolium_DQ Stylobasium_spathulatum_EU604032 Stylosanthes_capitata_AF203595 Styphnolobium_affine_JQ619972 Styphnolobium_burseroides_JQ6199 Styphnolobium_conzattii_JQ619939 Styphnolobium_japonicum_AY386962 Styphnolobium_monteviridis_JQ619 Suriana_maritima_AY386950 Sutherlandia_frutescens_AY386913 Swainsona_pterostylis_AF142735 Swartzia_apetala_JX295908 Swartzia_arborescens_JX295964 Swartzia_canescens_JQ626472 Swartzia_cardiosperma_EU362053 Swartzia_cubensis_JQ587869 Swartzia_flaemingii_AY386941 Swartzia_jorori_AY386942 Swartzia_pickelii_JX295905 Swartzia_pinheiroana_JX295914 Swartzia_polita_JX295913 Swartzia_simplex_AF142678 Sweetia_fruticosa_AY386911 Sweetia_fruticosa_JX152619 Sweetia_fruticosa_JX152620 Sweetia_fruticosa_JX152621 Tabaroa_caatingicola_GQ246161 Tabaroa_caatingicola_GQ246162 Tadehagi_triquetrum_JN407128 Talbotiella_gentii_EU362055 Taralea_cordata_JX295872 Taralea_oppositifolia_JX295900 Taralea_rigida_JX295934 Taverniera_glauca_JQ669601 Templetonia_hookeri_GQ246157 Templetonia_retusa_GQ246158 Tephrosia_heckmanniana_AF142712 Teramnus_uncinatus_EU717400 Tetraberlinia_bifoliolata_EU3620 Thermopsis_alpina_JQ669594 Thermopsis_lanceolata_JQ669595 Thermopsis_rhombifolia_AY386866 Tibetia_yunnanensis_JQ669583 Tipuana_tipu_AF270882 Trifolium_repens_AF522131 Trigonella_cretica_AF522146 Trischidium_alternum_JX295928 Trischidium_decipiens_JX295867 Trischidium_molle_JX295868 Ulex_europaeus_JQ669586 Umtiza_listeriana_EU362062 Uraria_crinita_JN407138 Uribea_tamarindoides_AY553719 Vachellia_farnesiana_HM020715 Vatairea_erythrocarpa_JX152597 Vatairea_fusca_JX152599 Vatairea_guianensis_JX152600 Vatairea_heteroptera_JX152603 Vatairea_lundellii_JX152605 Vatairea_macrocarpa_JX152609 Vatairea_paraensis_JX152611 Vatairea_sericea_JX152612 Vatairea_sp_nov_AF270859 Vataireopsis_araroba_JX152613 Vataireopsis_speciosa_JX152615 Vataireopsis_surinamensis_JX1526 Vatovaea_pseudolablab_AY583017 Vauquelinia_californica_AY386949 Vicia_faba_AY386899 Vigna_unguiculata_AY589510 Vouacapoua_macropetala_EU362063 Wajira_danissana_AY583008 Weberbauerella_brongniartioides Wisteria_frutescens_AF142731 Xanthocercis_zambesiaca_JF270996 Xerocladia_viridiramis_EU000438 Xeroderris_stuhlmannii_AF142708 Zenia_insignis_EU362065 Zollernia_aff_glabra_JX295916 Zollernia_glabra_JX295915 Zollernia_glaziovii_JX295952 Zollernia_ilicifolia_JX152654 Zollernia_latifolia_JX295918 Zollernia_magnifica_JX152595 Zollernia_modesta_JX295917 Zornia_sp_AF203584 Zygia_lathetica_AY944566 Zygocarpum_yemenense_AF203573 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=94; TAXLABELS Ammodendron_conollyi_EF457705 Ammothamnus_lehmannii_EF457706 Anagyris_foetida_AF330637 Baptisia_australis_AY091572 Bolusanthus_speciosus_EF457708 Bowdichia_nitida_JX124477 Bowdichia_nitida_JX124478 Bowdichia_nitida_JX124479 Bowdichia_virgilioides_EF457709 Bowdichia_virgilioides_JX124475 Bowdichia_virgilioides_JX124476 Brongniartia_magnibracteata_AF287638 Cadia_purpurea_EF457710 Camoensia_brevicalyx_KT718820 Camoensia_scandens_KT718821 Camoensia_scandens_KT718822 Cyclolobium_brasiliense_AF287637 Cyclolobium_nutans_AF467041 Dicraeopetalum_mahafaliense_EF457716 Diplotropis_aff__JX124487 Diplotropis_ferruginea_JX124482 Diplotropis_incexis_JX124480 Diplotropis_incexis_JX124485 Diplotropis_incexis_JX124486 Diplotropis_martiusii_AY553711 Diplotropis_martiusii_JX124481 Diplotropis_martiusii_JX124484 Diplotropis_martiusii_JX124506 Diplotropis_purpurea_JX124507 Diplotropis_triloba_JX124483 Genista_monspessulana_JF338495 Guianodendron_praeclarum_JX124488 Guianodendron_praeclarum_JX124489 Hovea_elliptica_AF287640 Leptolobium_bijugum_JX124490 Leptolobium_bijugum_JX124491 Leptolobium_bijugum_JX124492 Leptolobium_brachystachyum_JX124493 Leptolobium_brachystachyum_JX124494 Leptolobium_brachystachyum_JX124495 Leptolobium_brachystachyum_JX124497 Leptolobium_dasycarpum_JX124496 Leptolobium_dasycarpum_JX124504 Leptolobium_dasycarpum_JX124512 Leptolobium_dasycarpum_JX124514 Leptolobium_dasycarpum_JX124515 Leptolobium_dasycarpum_JX124516 Leptolobium_dasycarpum_JX124517 Leptolobium_dasycarpum_JX124518 Leptolobium_dasycarpum_JX124519 Leptolobium_elegans_JX124505 Leptolobium_elegans_JX124509 Leptolobium_elegans_JX124510 Leptolobium_nitens_JX124511 Leptolobium_nitens_JX124513 Leptolobium_panamense_JX124498 Leptolobium_parvifolium_JX124499 Leptolobium_sp__JX124500 Leptolobium_sp__JX124501 Leptolobium_tenuifolium_JX124502 Leptolobium_tenuifolium_JX124503 Lupinus_argenteus_DQ524197 Maackia_chinensis_EF457721 Neoharmsia_madagascariensis_EF457723 Neoharmsia_sp__EF457722 Ormosia_amazonica_EF457724 Orphanodendron_bernalii_KT718823 Orphanodendron_bernalii_KT718824 Pericopsis_sp__EF457725 Piptanthus_leiocarpus_AY091569 Piptanthus_tomentosus_AY091570 Platycelyphium_voense_EF457726 Poecilanthe_falcata_AF467492 Poecilanthe_parviflora_AF187089 Sophora_davidii_AF467496 Sophora_flavescens_AF123452 Sophora_prostrata_AJ409922 Sophora_raivavaeensis_AY056080 Sophora_toromiro_AJ409921 Staminodianthus_duckei_JX124508 Templetonia_retusa_AF287636 Templetonia_sulcata_AF287635 Thermopsis_alpina_AF123447 Thermopsis_chinensis_AF123443 Thermopsis_divaricarpa_AY091575 Thermopsis_fabacea_AY091573 Thermopsis_inflata_AF123451 Thermopsis_licentiana_AF123449 Thermopsis_macrophylla_AF123450 Thermopsis_montana_AF007468 Thermopsis_montana_AY091574 Thermopsis_smithiana_AF123445 Thermopsis_turkestanica_AF123446 Thermopsis_villosa_AF123444 ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=674; TAXLABELS Abrus_precatorius_AF142705 Acacia_cochliacantha_AF274133 Acacia_myrtifolia_AF274160 Acosmium_cardenasii_JX124425 Acosmium_diffusissimum_JX124415 Acosmium_lentiscifolium_JX124417 Acrocarpus_fraxinifolius_EU36184 Adenanthera_pavonina_AF521808 Adenolobus_garipensis_EU361844 Adesmia_lanata_AF270863 Aeschynomene_indica_AF272084 Aeschynomene_purpusii_AF270870 Afzelia_bella_EU361846 Aganope_thyrsiflora_JX506602 Airyantha_schweinfurthii_JX29589 Albizia_versicolor_AF274210 Aldina_heterophylla_JX295956 Aldina_insignis_JN168674 Aldina_latifolia_JX295861 Alexa_bauhiniiflora_JX295931 Alexa_canaracunensis_JQ669613 Alexa_grandiflora_JF491262 Alexa_grandiflora_JX295968 Alexa_wachenheimii_JQ626338 Alhagi_sparsifolia_AY177669 Alistilus_jumellei_JN008191 Alysicarpus_vaginalis_JQ587510 Amblygonocarpus_andongens_AF5218 Amburana_acreana_JX295866 Amburana_cearensis_AY553712 Amburana_cearensis_JX846614 Amherstia_nobilis_EU361849 Amicia_glandulosa_AF203583 Ammodendron_argenteum_AY386957 Ammopiptanthus_mongolicus_JQ8201 Ammopiptanthus_nanus_JQ820170 Amorpha_apiculata_AY391784 Amorpha_fruticosa_AY391785 Amphicarpaea_bracteata_AY582971 Amphimas_pterocarpoides_JX295894 Amphiodon_effusus_JX295892 Anarthrophyllum_desideratum_AY38 Ancistrotropis_peduncularis_JN00 Andira_carvalhoi_JX295958 Andira_galeottiana_AF142681 Andira_humilis_JX295960 Andira_inermis_JF501102 Andira_legalis_JX295893 Andira_marauensis_JX295899 Andira_ormosioides_JX295962 Andira_sp_JX295896 Angylocalyx_sp_AY553715 Angylocalyx_talbotii_JQ669611 Anthyllis_vulneraria_AF543845 Aotus_ericoides_AY386884 Aphanocalyx_cynometroides_EU3618 Apios_americana_AY386926 Apoplanesia_paniculata_AF270860 Apuleia_leiocarpa_EU361858 Apurimacia_dolichocarpa_FJ968527 Arachis_pintoi_AF203596 Arapatiella_psilophylla_EU361859 Archidendron_hirsutum_EU361860 Arcoa_gonavensis_EU361861 Argyrolobium_velutinum_JQ412199 Aspalathus_pinguis_JQ412203 Astragalus_canadensis_AY386875 Ateleia_arsenii_GU220019 Ateleia_glazioveana_GU220020 Ateleia_guaraya_JX295883 Ateleia_herbertsmithii_AY386953 Ateleia_mcvaughii_GU220021 Ateleia_popenoei_GU220022 Ateleia_pterocarpa_GU220023 Austrosteenisia_blackii_AF142707 Baphia_leptobotrys_EU361865 Baphia_madagascariensis_AY553718 Baphia_massaiensis_AF142683 Baphia_nitida_EU361867 Baphiopsis_parviflora_JX295895 Baptisia_australis_AY386900 Barnebydendron_riedelii_EU361868 Barnebyella_calycina_JQ669593 Batesia_floribunda_EU361869 Bauhinia_galpinii_EU361875 Berlinia_congolensis_EU361881 Bionia_bella_Torres12 Bionia_coriacea_LPQ13611 Bituminaria_bituminosa_JF501107 Bobgunnia_fistuloides_EU361885 Bobgunnia_madagascariensis_AY386 Bocoa_prouacensis_FJ037904 Bocoa_prouacensis_JQ626415 Bolusanthus_speciosus_AF142685 Bolusia_amboensis_JQ040984 Bossiaea_cordigera_AY386888 Bowdichia_nitida_JX124395 Bowdichia_virgiloides_AY386937 Brachypterum_robustum_AF142716 Brandzeia_filicifolia_EU361870 Brodriguesia_santosii_EU361890 Brongniartia_alamosana_AF142688 Brongniartia_peninsularis_GQ2461 Brownea_coccinea_EU361891 Brya_ebenus_AF270876 Bryaspis_lupulina_AF272068 Butea_monosperma_JN008175 Cadia_purpurea_JX295932 Caesalpinia_pulcherrima_EU361906 Cajanus_cajan_EU717414 Callerya_reticulata_JQ619954 Calliandra_juzepczukii_EU812063 Calophaca_pskemica_JQ669603 Calopogonium_sp_JQ669608 Calpurnia_aurea_AY386951 Camoensia_brevicalyx_JX295946 Camoensia_scandens_JX295919 Camptosema_ellipticum_LPQ14073 Camptosema_spectabile_LPQ7088 Campylotropis_macrocarpa_AY38687 Canavalia_parviflora_HQ707539 Candolleodendron_brachystachyum Candolleodendron_brachystachyum2 Caragana_arborescens_AF142737 Carmichaelia_williamsii_AY386873 Cascaronia_astragalina_AF272072 Cassia_grandis_EU361909 Castanospermum_australe_JX295891 Centrolobium_robustum_EU401414 Centrosema_sagittatum_JQ587552 Ceratonia_siliqua_EU361911 Cercis_canadensis_AY386908 Cercis_gigantea_AY386948 Cercis_occidentalis_AY386853 Chaetocalyx_scandens_AF270865 Chamaecrista_nictitans_EU361914 Chapmannia_gracilis_AF203592 Chesneya_elegans_JQ619958 Chloroleucon_manganse_AY386921 Cicer_canariense_AF522079 Cladrastis_delavayi_AY386861 Cladrastis_lutea_AF142694 Cladrastis_platycarpa_AY386935 Clathrotropis_macrocarpa_JX29593 Clathrotropis_nitida_JX295951 Cleobulia_multiflora_Jesus13 Clianthus_puniceus_AY386914 Clitoria_ternatea_EU717427 Cochliasanthus_caracalla_JN00827 Cojoba_catenata_AY944554 Collaea_stenophylla_LPQ12460 Cologania_pallida_JQ619980 Colophospermum_mopane_EU361915 Colutea_arborescens_AY386874 Condylostylis_candida_JN008260 Conzattia_multiflora_AY386918 Copaifera_officinalis_EU361918 Cordeauxia_edulis_EU361920 Cordyla_africana_JF270724 Cordyla_africana_JX295923 Coronilla_coronata_JQ619970 Coursetia_glandulosa_AF543852 Cranocarpus_martii_AF270875 Craspedolobium_schochii_JF953573 Cratylia_mollis_LPQ8024 Crotalaria_incana_GQ246141 Crotalaria_juncea_JQ619982 Crotalaria_pumila_AY386867 Crotalaria_saltiana_JQ619981 Crudia_choussyana_EU361921 Cullen_tenax_EF550004 Cyamopsis_senegalensis_AF142698 Cyathostegia_matthewsii_HM347482 Cyathostegia_matthewsii_HM347483 Cyathostegia_matthewsii_HM347486 Cyclocarpa_stellaris_AF272067 Cyclolobium_brasiliense_GQ246152 Cyclolobium_nutans_AF142686 Cymbosema_roseum_DC2868 Cytisus_scoparius_AY386902 Dalbergia_congestiflora_AF142696 Dalbergiella_nyasae_AF142706 Dalea_brachystachya_EU025886 Dalea_cliffortiana_AY391787 Dalea_hospes_AY391789 Dalea_lanata_AY391790 Dalea_lumholtzii_AY391791 Dalea_mollissima_AY391794 Dalea_neomexicana_AY391795 Dalea_pogonathera_AY391796 Dalea_pulchra_AY386860 Dalea_purpurea_AY391798 Dalea_scandens_AY391800 Daniellia_klainei_EU361927 Daviesia_latifolia_AY386887 Decorsea_schlechteri_AY582975 Deguelia_dasycalyx_LPQ14503 Delonix_elata_EU361928 Dermatophyllum_arizonicum_AY3868 Dermatophyllum_secundiflorum_AF1 Derris_laxiflora_AF142715 Desmanthus_cooleyi_AY386916 Desmodium_barbatum_EU717420 Detarium_macrocarpum_EU361929 Dialium_guianense_EU361930 Dichilus_lebeckioides_GQ246143 Dichrostachys_richardiana_AF5218 Dicraeopetalum_stipulare_GQ24614 Dicymbe_altsonii_EU361932 Dimorphandra_conjugata_EU361934 Dinizia_excelsa_JX295860 Dioclea_grandiflora_JX295862 Dioclea_lasiophylla_DC2324 Diphysa_floribunda_AF203575 Diplotropis_brasiliensis_AY38693 Diplotropis_ferruginea_JX124397 Diplotropis_incexis_JX124401 Diplotropis_martiusii_AY386938 Diplotropis_purpurea_JX124418 Diplotropis_triloba_JX124398 Dipogon_lignosus_AY582988 Dipteryx_alata_AY553717 Dipteryx_magnifica_JX295871 Dipteryx_odorata_JX295898 Dipteryx_oleifera_JX295933 Dipteryx_polyphylla_JX295870 Dipteryx_punctata_JX295869 Dipteryx_rosea_JF491268 Diptychandra_aurantiaca_EU361935 Discolobium_psoraleifolium_AF270 Distemonanthus_benthamianus_EU36 Disynstemon_paullenoides_GU95167 Dolichopsis_paraguariensis_AY509 Dolichos_trilobus_AY582976 Dorycnium_pentaphyllum_JQ619968 Duparquetia_orchidacea_EU361937 Duparquetia_orchidacea_RADS Dussia_lanata_JX295925 Dussia_lehmannii_JX295924 Dussia_macroprophyllata_AY386903 Ebenopsis_ebano_AF274123 Ebenus_cretica_JQ619960 Endertia_spectabilis_EU361943 Entada_abyssinica_AF521829 Enterolobium_cyclocarpum_AY65027 Eperua_rubiginosa_EU361947 Eremosparton_flaccidum_JQ619964 Eriosema_diffusum_JQ587629 Errazurizia_benthamii_AY391803 Errazurizia_megacarpa_AY391804 Erythrina_cristagalli_AY386869 Erythrophleum_suaveolens_EU36194 Etaballia_guianensis_AF272074 Euchlora_hirsuta_JQ041113 Eurypetalum_tessmannii_EU361950 Exostyles_aff_venusta_JX152591 Exostyles_godoyensis_JX152589 Exostyles_venusta_JX152590 Eysenhardtia_orthocarpa_AY386909 Eysenhardtia_polystachya_EU02590 Eysenhardtia_texana_AY391807 Faidherbia_albida_AF274129 Fiebrigiella_gracilis_AF203590 Fissicalyx_fendleri_AF272063 Fordia_splendidissima_AF142718 Gagnebina_commersoniana_AF521836 Galactia_martii_LPQ7583 Galactia_striata_AF142704 Galega_orientalis_AF522083 Gastrolobium_punctatum_AY386885 Genista_monspessulana_AY386862 Genistidium_dumosum_AF543858 Geoffroea_spinosa_AF270879 Gilletiodendron_pierreanum_EU361 Gleditsia_sinensis_AY386930 Gleditsia_triacanthos_AY386849 Gliricidia_brenningii_AF547199 Glycine_max_AF142700 Glycyrrhiza_lepidota_AY386883 Gompholobium_minus_AY386891 Goniorrhachis_marginata_EU361959 Gossweilerodendron_balsamiferum Grazielodendron_riodocense_AF270 Gueldenstaedtia_stenophylla_JQ66 Guianodendron_praeclarum_JX12440 Guianodendron_praeclarum2_JX1244 Guilfoylia_monostylis_EU604031 Gymnocladus_chinensis_AY386928 Halimodendron_halodendron_JQ6199 Hammatolobium_kremerianum_JQ6199 Hardenbergia_violacea_EU717425 Harleyodendron_unifoliolatum_JX1 Harpalyce_arborescens_AF142689 Harpalyce_brasiliana_GQ246153 Harpalyce_formosa_GQ246154 Havardia_alibicans_AF523085 Hebestigma_cubense_AF543850 Hedysarum_boreale_AY386892 Helicotropis_linearis_JN008258 Hippocrepis_unisiliquosa_JQ61998 Hoffmannseggia_glauca_EU361969 Hoita_orbicularis_EF549962 Holocalyx_balansae_AY553714 Holocalyx_balansae_JX152593 Hovea_purpurea_AY386889 Humularia_corbisieri_AF272069 Hybosema_ehrenbergii_AF547195 Hymenaea_courbaril_AY386906 Hymenaea_verrucosa_EU361974 Hymenolobium_alagoanum_JX295906 Hymenolobium_grazielanum_JX29590 Hymenolobium_heringerianum_JX295 Hymenolobium_heterocarpum_JX2959 Hymenolobium_heterocarpum2_JX295 Hymenolobium_janeirense_JX295904 Hymenolobium_mesoamericanum_AY38 Hymenolobium_petraeum_JX295909 Hymenolobium_sericeum_JX275933 Hypocalyptus_coluteoides_AY38688 Indigofera_suffruticosa_AF142697 Inga_edulis_AF523078 Inocarpus_fagifer_AF270878 Intsia_bijuga_EU361981 Isotropis_foliosa_AY386890 Kennedia_nigricans_EU717424 Koompassia_excelsa_EU361988 Kotschya_ochreata_AF272065 Kummerowia_stipulacea_EU717417 Kunstleria_ridleyi_JX506598 Labichea_punctata_EU361989 Lablab_purpureus_AY582989 Laburnum_anagyroides_HE967423 Lackeya_multiflora_AL Ladeania_juncea_EF549986 Lamprolobium_fruiticosum_GQ24615 Lathyrus_sativus_AF522086 Lebeckia_sericea_GQ246144 Lecointea_hatschbachii_JX152594 Lecointea_peruviana_EU361990 Lecointea_peruviana_JX295927 Lennea_modesta_AF543851 Lens_culinaris_AF522089 Leonardoxa_africana_EU361992 Leptoderris_brachyptera_JX506611 Leptolobium_bijugum_JX124404 Leptolobium_brachystachyum_JX124 Leptolobium_dasycarpum_JX124408 Leptolobium_elegans_JX124410 Leptolobium_nitens_JX124409 Leptolobium_panamense_AF142684 Leptolobium_parvifolium_JX124411 Leptolobium_tenuifolium_JX124413 Leptospron_adenanthum_AY582983 Lespedeza_cuneata_EU717416 Lessertia_herbacea_AY920453 Leucaena_leucocephala_AF523094 Leucomphalos_brachycarpus_JX2958 Leucomphalos_mildbraedii_JX29586 Libidibia_ferrea_EU361901 Lonchocarpus_lanceolatus_AF14271 Lotus_purshianus_AF142729 Luetzelburgia_amazonica_JX152622 Luetzelburgia_andina_JX152624 Luetzelburgia_andradelimae_JX152 Luetzelburgia_auriculata_JX15263 Luetzelburgia_bahiensis_JX152634 Luetzelburgia_guaissara_JX152636 Luetzelburgia_guianensis_JX15263 Luetzelburgia_harleyi_JX152642 Luetzelburgia_neurocarpa_JX15264 Luetzelburgia_praecox_JX152646 Luetzelburgia_purpurea_JX152648 Luetzelburgia_sotoi_JX152652 Luetzelburgia_trialata_JX152617 Lupinus_argenteus_AY386956 Lupinus_cosentinii_AY386943 Lupinus_odoratus_EU025914 Lupinus_sparsiflorus_JQ619990 Lupinus_texensis_JQ619989 Lysidice_rhodostegia_EU361995 Lysiloma_acapulcensis_AF274126 Lysiphyllum_gilvum_EU361876 Maackia_amurensis_AY386944 Machaerium_falciforme_AF142692 Macroptilium_longipedunculatum_A Macrotyloma_stenophyllum_JN00818 Maraniona_lavinii_AY247263 Marina_parryi_AY386859 Marina_scopa_AY391811 Mariosousa_dolichostachya_EU8120 Martiodendron_parviflorum_EU3619 Medicago_sativa_AY386881 Melanoxylon_brauna_EU362000 Melilotus_albus_AF142738 Mendoravia_dumaziana_EU362001 Mezoneuron_angolense_EU361897 Microcharis_karinensis_AY650279 Microlobium_foetidus_AF523095 Millettia_grandis_AF142724 Millettia_thonningii_AF142723 Mimosa_tenuiflora_AF274120 Mimozyganthus_carinatus_AY944557 Moldenhawera_brasiliensis_EU3620 Monnina_phytolaccifolia_EU596519 Monopteryx_inpae_JX295875 Monopteryx_inpae_JX295876 Mora_gonggrijpii_EU362005 Mucuna_pruriens_AB627857 Muellera_campestris_DC2320 Mundulea_sericea_AF142713 Myrocarpus_emarginatus_JQ669614 Myrocarpus_emarginatus_JX295863 Myrocarpus_fastigiatus_JX295966 Myrocarpus_frondosus_AY386925 Myrospermum_frutescens_AF142679 Myrospermum_frutescens_JQ587794 Myrospermum_frutescens_JQ587796 Myrospermum_sousanum_AY386959 Myrospermum_sousanum_JX295922 Myrospermum_sousanum_JX295938 Myroxylon_balsamum_FJ151488 Myroxylon_balsamum_JX295912 Myroxylon_balsamum_JX295935 Myroxylon_balsamum_JX295936 Myroxylon_balsamum_JX295937 Myroxylon_peruiferum_JX295911 Mysanthus_uleanus_AY509941 Neochevalierodendron_stephanii_E Neodunnia_richardiana_AF142726 Neonotonia_wightii_EU717402 Neorautanenia_mitis_JN008178 Neptunia_monosperma_AF523090 Nesphostylis_holosericea_AY58297 Nissolia_hirsuta_AF270868 Olneya_tesota_AF543857 Onobrychis_montana_AY386879 Ononis_natrix_AF522114 Ophrestia_radicosa_EU717430 Orbexilum_lupinellum_EF549995 Ormocarpopsis_itremoensis_AF2035 Ormocarpum_keniense_AF203602 Ormosia_aff_bahiensis_JX295944 Ormosia_aff_fastigiata_JX295885 Ormosia_arborea_JX295939 Ormosia_bahiensis_JX295886 Ormosia_coccinea_GQ982055 Ormosia_colombiana_AY386960 Ormosia_costulata_JX295887 Ormosia_coutinhoi_JX295880 Ormosia_excelsa_JX295884 Ormosia_fastigiata_JX295941 Ormosia_fordiana_HQ415278 Ormosia_formosana_AF142682 Ormosia_glaberrima_HQ415279 Ormosia_henryi_HM049514 Ormosia_krugii_HM446725 Ormosia_limae_JX295879 Ormosia_macrocalyx_GQ982056 Ormosia_nitida_JX295881 Ormosia_paraensis_JX295888 Ormosia_semicastrata_HQ415280 Ormosia_smithii_JX295954 Ormosia_sp_nov_JX295877 Ormosia_sp_nov_JX295945 Ormosia_stipularis_JX295882 Ormosia_timboensis_JX295878 Ornithopus_compressus_AF142727 Orphanodendron_bernalii_12796_KT718816 Orphanodendron_bernalii_701_KT718814 Orphanodendron_bernalii_703_KT718815 Orphanodendron_grandiflorum_451_KT718817 Orphanodendron_grandiflorum_750_KT718818 Ostryocarpus_riparius_JX506599 Otholobium_bracteolatum_EF550005 Otoptera_burchellii_JN008176 Oxyrhynchus_volubilis_AY509935 Oxystigma_oxyphyllum_EU362012 Oxytropis_lambertii_AY386915 Pachyrhizus_erosus_EU717401 Panurea_longifolia_JX295947 Paraderris_elliptica_AF142714 Paramachaerium_schomburgkii_AF27 Parapiptadenia_pterosperma_DQ790 Pararchidendron_pruinosum_AF2741 Paraserianthes_lophantha_AF27412 Parkia_multijuga_EU362018 Parkinsonia_aculeata_AY386917 Parochetus_communis_AF522115 Parryella_filifolia_AY391812 Pediomelum_pentaphyllum_EF549992 Peltogyne_floribunda_EU362022 Peltophorum_dubium_AY386846 Pentaclethra_macroloba_AY386904 Petalostylis_labicheoides_AY3868 Peteria_thompsonae_AF47190 Phanera_outimouta_EU361877 Phaseolus_vulgaris_AY582987 Philenoptera_eriocalyx_AF142720 Phyllodium_pulchellum_HM049524 Phylloxylon_spinosa_AY650280 Physostigma_venenosum_JN008195 Pickeringia_montana_var_montana Pickeringia_montana_var_tomentos Pictetia_marginata_AF203578 Piptadenia_adiantoides_DQ790611 Piptadenia_viridiflora_AF521856 Piptadeniastrum_africanum_AF5218 Piptadeniopsis_lomentifera_AY944 Piptanthus_nepalensis_AY386924 Piscidia_piscipula_AF142710 Pisum_sativum_AY386961 Plagiocarpus_axillaris_GQ246160 Platycyamus_regnellii_AF142709 Platymiscium_stipulare_AF270872 Platypodium_elegans_AF270877 Poecilanthe_falcata_GQ246155 Poecilanthe_parviflora_AF142687 Poecilanthe_subcordata_GQ246156 Poeppigia_procera_AY386907 Poiretia_angustifolia_AF270864 Poissonia_hypoleuca_AF547193 Poitea_glyciphylla_AY650278 Polygala_californica_AY386842 Pongamiopsis_amygdalina_AF142711 Prioria_copaifera_EU362030 Prosopidastrum_mexicanum_AY38691 Prosopis_glandulosa_AY386851 Pseudarthria_hookeri_JF270902 Pseudoprosopis_gilletii_AF521861 Pseudovigna_argentea_JN008179 Psophocarpus_lancifolius_JN00817 Psoralea_cinerea_AF142699 Psorothamnus_arborescens_AY39181 Psorothamnus_emoryi_AY391815 Psorothamnus_fremontii_AY391817 Psorothamnus_polydenius_AY391819 Psorothamnus_scoparius_AY391821 Psorothamnus_spinosus_AY391822 Pterocarpus_indicus_AF142691 Pterodon_abruptus_JX295873 Pterodon_emarginatus_JX295874 Pterodon_pubescens_AF272095 Pterogyne_nitens_EU362031 Ptycholobium_biflorum_JQ669619 Pueraria_montana_AY582972 Quillaja_saponaria_AY386843 Rafnia_angulata_JQ412281 Ramirezella_strobilophora_AY5099 Ramorinoa_girolae_AF270881 Rhodopsis_planisiliqua_AAC1765 Rhynchosia_edulis_JQ587827 Riedeliella_graciliflora_AH00991 Robinia_pseudoacacia_AF142728 Rupertia_physodes_AY386868 Samanea_saman_AF523073 Saraca_indica_EU362034 Schizolobium_parahyba_EU362036 Securigera_varia_AF543846 Senna_alata_EU362042 Senna_covesii_AY386850 Sesbania_tomentosa_JX295926 Shuteria_vestita_EU717423 Sigmoidotropis_speciosa_DQ443466 Sindora_klaineana_EU362045 Smirnowia_turkestana_JQ669579 Smithia_ciliata_AF272066 Soemmeringia_semperflorens_AF272 Sophora_davidii_AY386958 Sophora_macrocarpa_JQ619975 Sophora_microphylla_JQ619976 Sophora_nuttalliana_AY386865 Sophora_stenophylla_JQ669580 Spartium_junceum_AY386901 Spathionema_kilimandscharicum_JN Sphaerophysa_salsula_JQ669581 Sphenostylis_angustifolia_AY5829 Sphinctospermum_constrictum_AF54 Spirotropis_longifolia_JX295948 Spirotropis_longifolia_JX295949 Spirotropis_longifolia_JX295950 Staminodianthus_duckei_JX124405 Staminodianthus_racemosus_JX1244 Staminodianthus_rosae_JX124396 Steinbachiella_leptoclada_JQ7106 Storckiella_australiensis_EU3620 Strophostyles_helvola_AY509949 Stryphnodendron_rotundifolium_DQ Stylobasium_spathulatum_EU604032 Stylosanthes_capitata_AF203595 Styphnolobium_affine_JQ619972 Styphnolobium_burseroides_JQ6199 Styphnolobium_conzattii_JQ619939 Styphnolobium_japonicum_AY386962 Styphnolobium_monteviridis_JQ619 Suriana_maritima_AY386950 Sutherlandia_frutescens_AY386913 Swainsona_pterostylis_AF142735 Swartzia_apetala_JX295908 Swartzia_arborescens_JX295964 Swartzia_canescens_JQ626472 Swartzia_cardiosperma_EU362053 Swartzia_cubensis_JQ587869 Swartzia_flaemingii_AY386941 Swartzia_jorori_AY386942 Swartzia_pickelii_JX295905 Swartzia_pinheiroana_JX295914 Swartzia_polita_JX295913 Swartzia_simplex_AF142678 Sweetia_fruticosa_AY386911 Sweetia_fruticosa_JX152619 Sweetia_fruticosa_JX152620 Sweetia_fruticosa_JX152621 Tabaroa_caatingicola_GQ246161 Tabaroa_caatingicola_GQ246162 Tadehagi_triquetrum_JN407128 Talbotiella_gentii_EU362055 Taralea_cordata_JX295872 Taralea_oppositifolia_JX295900 Taralea_rigida_JX295934 Taverniera_glauca_JQ669601 Templetonia_hookeri_GQ246157 Templetonia_retusa_GQ246158 Tephrosia_heckmanniana_AF142712 Teramnus_uncinatus_EU717400 Tetraberlinia_bifoliolata_EU3620 Thermopsis_alpina_JQ669594 Thermopsis_lanceolata_JQ669595 Thermopsis_rhombifolia_AY386866 Tibetia_yunnanensis_JQ669583 Tipuana_tipu_AF270882 Trifolium_repens_AF522131 Trigonella_cretica_AF522146 Trischidium_alternum_JX295928 Trischidium_decipiens_JX295867 Trischidium_molle_JX295868 Ulex_europaeus_JQ669586 Umtiza_listeriana_EU362062 Uraria_crinita_JN407138 Uribea_tamarindoides_AY553719 Vachellia_farnesiana_HM020715 Vatairea_erythrocarpa_JX152597 Vatairea_fusca_JX152599 Vatairea_guianensis_JX152600 Vatairea_heteroptera_JX152603 Vatairea_lundellii_JX152605 Vatairea_macrocarpa_JX152609 Vatairea_paraensis_JX152611 Vatairea_sericea_JX152612 Vatairea_sp_nov_AF270859 Vataireopsis_araroba_JX152613 Vataireopsis_speciosa_JX152615 Vataireopsis_surinamensis_JX1526 Vatovaea_pseudolablab_AY583017 Vauquelinia_californica_AY386949 Vicia_faba_AY386899 Vigna_unguiculata_AY589510 Vouacapoua_macropetala_EU362063 Wajira_danissana_AY583008 Weberbauerella_brongniartioides Wisteria_frutescens_AF142731 Xanthocercis_zambesiaca_JF270996 Xerocladia_viridiramis_EU000438 Xeroderris_stuhlmannii_AF142708 Zenia_insignis_EU362065 Zollernia_aff_glabra_JX295916 Zollernia_glabra_JX295915 Zollernia_glaziovii_JX295952 Zollernia_ilicifolia_JX152654 Zollernia_latifolia_JX295918 Zollernia_magnifica_JX152595 Zollernia_modesta_JX295917 Zornia_sp_AF203584 Zygia_lathetica_AY944566 Zygocarpum_yemenense_AF203573 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M35543] TITLE 'Orphanodendron matK-trnL Character Matrix'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2393; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ammodendron_bifolium ATGGAGGAATATCAAGTAGATTTAGAACTAGATATACCGCGCCAACAGGACTTCTTATACC------CACTTATTTTTCGTGAATATATTTATGGACTTGCTTATGGTCATGATTT------TAATGGATCCATTTTTACAGAAAATGTAGATTATGACAATAAATCTAGTTTACTGATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAACAAAAA------TCAATTTTGGGGTTATAACAAGAATTTATATTCTCAAATAATATCAGAAGGTTTTACCACCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTTCTCCTTAGA------GGGGGCAGAAGTCATAAAATATTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTGACATATTTAAATTATGTGTCAGATGTACGAATCCCCTATCCTATCCATCTGGAAATTTTGGTTC????????????????????????????CCCCTTTCTTCATTTATTAAGGTTGTTTCTTTATGAGTGTT------G---------------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTATTCCTATATCATTTTTATGTATGTGAATATGAATCGATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAATGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGGTTTTGTCGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTTTTCACAGATACTTTAATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAATGATCCAAATAAACAAATTCTCCGAACATTCATTTCACATTTTG------GGCTATTTTTCAAGTGTGCGGTTAAATCTTTCAGCAGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATATATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTCCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAAAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGTAACGATCTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Amphiodon_effusa ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCACCAACAGGACTTCCTATACC------CACTTCTTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATAGATCCAATCTTGTGGAAAATGTCGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAAAAAAA------TCCATTTTGGGGGTATAACAAGGATTTGTACTCTCAAATGATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCGAAAATCATAAAATCCTATCATAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTAAATATTTAAATTATGCGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAGGATGTCCCCTTTTTTCATTTATTAAGGTTGTTTTTTTATGAGTATT------GTAATTGCAA------------TAGTAATAGTCTTATTACTCCAAAAGAA---TCGATTTCTACTTTTTCAAAAAAGAATCCAGGATTCTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTATCTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCATCTTGTAGAAGTCTTTGCTAAAGATTTTTCGTATACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGCTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATTTCATTTTGATCTTTGGTCTCAACCAGGAATGACCCAGATAAATCAATTCTCCGAGCATCCATTTCACTTTTTG------GACTATTTTTCAAATGTGCGGTTAAATATTTCAGTGGTACGTAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTTTGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAGTTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTCTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATAAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------CGAGCTTCTTCTATTTTGCAGAGG------TTCTATAGAGGTCGGATTTGGTATTTGGATATTTTTTTCAGCAACGATCTAGTCAA---------------TTATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Anarthrophyllum_cumingii ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAC-CTTTCAAATTCAGAGAAACCCTGGAATTGACAATGGG-TAATCCTGAGCCAAATCCCGTTTTT-----CGCAAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA------------AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCGCGTTGGGT-----TAGTAAAGGAATCCTTTCGT----CGAAATTGCGGAAA-------------------------------------GGATCAAGAATAA---------------------------ACGTATATACATATATA----------------------------------------CCTATATGGAGTGAAATATTATTTCAATTGATTAATAAA----------GACTTAAAATCTCTATTT---------------------------------------------------------------------------------GTTGAAGC------AGGAATTGAATATTCATTGATCAAATCATTCATTCCATGATAATCTGA----------TAGATCTTTTTAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGG?????????????????????????????? Anarthrophyllum_desideratum ATGGAGGAATATCAAGTATATTTAGAACTAGATATATCTCGCCAACAGCACTTCCTATACC------CACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTT------TAATGGATCTATTTTTTCGGAAAATGTCGATTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCGGCTAATTATTCTAAAAAAAA------TCAATTTTTGGGGTATAATAAGAATTTGTATTCTGAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTAAACTCTTCCTCAGA------AGGGACAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTTCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCCATCCATCTCGAAATCTTGGTTCAAGTCTTTCGATATTGGGCGAAAGATGCCCCTTTGTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------GTAATTGGAA------------------TAATCTTATTACTCCAAAAAAA---TCGATTTCTATTTTTTCAAAAAGTAATCTAAGAGTTTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACATTTTATAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGAGCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCACAGAATGCGTCCCTTTTGATGTATAAATGGAAAAACTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAACCAATTCTCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCAGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATCAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTCGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTTTTTGATCTTTCAA------AGGGCTTCTTCTACTTTGAAGGGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Baptisia_australis ATGGAGGAATATCAAGTATATTTAGAACTAGATATATCTCGCCAACAGGACTTCTTATACC------CACTTATTTTTCGTGAGTATATTTATGGACTCGTTTATGGTCATGATTT------TAATGGATCTATTTTTGCGGAAAATGCAGATTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTCATGATTCTAAAAAAAA------TCAATTTTGGGGTTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCCTCCTTAGA------GGGGGTAGAAATCATAAAATATTATAATAATTTGCGATCAATTCACTCTATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCGATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTTAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTCTGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCGCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGATTTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTACAGATCCTTTCATTCATTATGTTAGATATCACGGAAAATACATTTTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAACCAATTCTCCGAACATTCATTTCACCTTTGG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCGGCAGTACGGAGTCAAATGTTAGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCGATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTACGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAACTTCTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAGAGGCAGAGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA???????????----GCATTGGTATGGAAACTTACCGTGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGATAAAACAAA---------GAAAAGTGTTCATAAAGCGAGCA------TAAAGCGAGA-ATAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAATTAACG------ACATTTCCTTTCGCA----------------------------------------TTAAGGAAG-------------------------------------GTATCAAGGATAA---------------------------ACGTATATATATA--------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACCTAAAATATCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-GATGTGAATCCAATCTCTT---CCAA----GTTGAAGAGAGAGAAAGAATTTAATATTCATTGATCAAATCATTGATTCCATCATAGTCTGA----------TCGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Bolusanthus_speciosus ATGGAGGAATATCAAGTAGATTTAGAACTAGATATATCTCGCCAACAGGACTTCCTATATC------CACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATGGATCCATTTTTGCAGAAAATGTAGATTATGACAATAAATCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAAAAAAA------TCAATTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTGAGCTCTTCCTTAGA------AGAGGCAGAAATCATAAAATATTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGGGTTAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTATGAGTATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAATATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGATTTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATACTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTAATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAACCAATTCTCTGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGCTAGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTACTGTACGTGCTTTTTTAAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAATTTCAAAGAACTTCTTCGACTTTGCAGAGG------TTGTATAGGGGCGGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGATCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGGTAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGCGAAAACAAA-----AAAAGAAAAGT--TCATAAAGCGAGAC------GAGAA-------TAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACGTTGACGACATTTCCTTTCGCATTAGGA----------AAGGAATCCTTCTATCCATCGAAATTTCGGAAA-------------------------------------GGATCAAGGATAA---------------------------ACGTATATATATATAT------------------------------------------GTATATGTACTGAAATATTATTTCAATTGATTAAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACTGACAAC-AATGAAATTTATAGTAAGAGG?????????????????????????????? Bowdichia_nitida GTGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCGTGATTT------TAATAGATCAATCTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATTATTTGATTATTTCTGCTAATGATTCTAAAAAAAAAAA---GAAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAGGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATCTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCCCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTCTTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA----------AAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAACGGAGTTGACG------ACATTCCCTTTCGCATTAGGA----------AAGGAATCCTTCTAT----CGAAATTCCGGAAA--------------------------------AGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATAAAA-GATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCATTCCATCAGAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Bowdichia_virgilioides GTGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCGTGATTT------TAAGAGATCAATCTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATTATTTGATTATTTCTGCTAATGATTCTAAAAAAAAAAA---GAAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAATATTGTAATTGTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAGGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACTTTA------TCATTCTTTAAGGATCCTTTCATTCATTATCTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCCCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTCTTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA???????????----???????????GGAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA----------AAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAACGGAGTTGACG------ACATTCCCTTTCGCATTAGGA----------AAGGAATCCTTCTAT----CGAAATTCCGGAAA--------------------------------AGA---------------------------------------------TATATATA----------------------------------------------CGTATATGTACTGAAATATTATT-CA{AC}TTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATAAAA-GATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAA{AC}TCATTCATTCCATCAGAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATC{AC}TACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGA????????????????????????????? Brongniartia_alamosana ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTAGCCAACAGGACTTCCTATACC------CACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTT------GAATAGATCCAATTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAA------TCCATTTTGGGGGTCTAACAAGGATTTGTATTCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCTTTAGA------GGAGGCGAAAATCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTGAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATATCCCCTTCTTTCATTTATTAAGGTTATTTTTTTATGAGTATT------GGAATTGCAA------------------TACTCTTATTACTCCAAAAGAA---TCGATTTCTACTTTTTCAAAAAGGAATCCAGGATTCTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACATCTTGTAGAAGTCTTTGGTAAAGATTTTTCGTATACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGGCCCATATAAATCAATTCTCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGGTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGAATTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAGTAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGATATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTATTTTACACAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTCTTTTCAGCAACGATCTAGTCAA---------------TTATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Brongniartia_peninsularis ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTAGCCAACAGGACTTCCTATACC------CACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTT------GAATAGATCCAATTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAA------TCCATTTTGGGGGTCTAACAAGGATTTGTATTCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCTTTAGA------GGAGGCGAAAATCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATATCCCCTTCTTTCATTTATTAAGGTTATTTTTTTATGAGTATT------GGAATTGCAA------------------TACTCTTATTACTCCAAAAGAA---TCGATTTCTACTTTTTCAAAAAGGAATCCAAGATTTTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACATCTTGTAGAAGTCTTTGGTAAAGATTTTTCGTATACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGGCCCATATAAATCAATTCTCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAGTAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGATATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTATTTTACAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTCTTTTCAGAAACGATCTAGTCAA---------------TTATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cadia_purpurea ATGGAGGAATATCAAGTATATTTAGAACTAGATATATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATGGATACATTTTTGCGGAAAGTGTAGATTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTACTGATTCTAAAAAAAA------TCAATTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAAGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAAACGTAAAATATTATAATAAATTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTGCGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------CTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCTTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAACAAATCCTCTCATTTACGATTAATATCTTTTAACATTCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAACATTTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTTTGGCAATGTCATTTTGATGTTTGGTCTCAGCCAGGAACGATCAAAATAAACCAATTCCCCGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGAAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAATGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA???????????----????AGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGCGAAAACAAA---------GAAAAGT--TCATAAAGCGAGAA------TAAAA------------AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAAAAAA------------------------------------------------------------------------TTGCGGAAA-------------------------------------GGATCAAGGATAT---------------------------ACGTATA--------------------------------------------------TGTATATGTACTCAAATAGTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTTTTTATATTT-----ATATCA--------------------CAAACGAAA-GATGTGAATAAAATCATTTTTTCCAAATAAATGGAAGA------AAGAATGGAATATTCATTGAGCAAATCATTCATTCCATCATAGTCTGA----------TAGATCTTTTGAAGAACTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Calpurnia_aurea ATGGAGGAATATCAAGTATATTTAGAACTAGATATATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATGGATCCATTTTTGCGGAAAATGTAGATTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAAAAAAA------TCAATTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATATTATAATAAATTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGACGTGCGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACC???????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------CTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACCTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAAGAAATCCTCTTATTTACGATTAATATCTTTTAACGTTCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAACATTTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTGCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATCTCATTTTGATGTTTGGTCTCAGCCAGGAACGATCCAAATAAACCAATTCCCCGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGAAGTCAAATGCTGGAAAATTCATTTCTAATTGAAATTGTTATGAAAAAGCTTGATAC?ATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACACCCCATTAGTAAGCTGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAATGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTGTACTTTACAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGCGAAAACAAA---------GAAAAGT--TCATAAAGCGAGAA------TAAAA------------AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTTACG------ACATTTCCTTTCGCATTAGGA----ATAGGAAAGGAATCCTTTTAT----CAAAATTGCGGAAA-------------------------------------GGATCAAGGATAA---------------------------ACGTATATATATATA------CGTATA------------------------------TGTATATGTACTGAAATAGTATTTCAATTGATTAATGAA----------GACTCAAAATCTCTATTTTTTTATATTT-----ATATCA--------------------CAAATGAAA-GATGTGAATCAAATCATTTTTTCCAA----ATTGAAGA------AAGAATGGAATATTCATTGAGCAAATCATTCATTCCATCATAGTCTGA----------TAGATCTTTTGAAGAACTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATAGCGACAAC-AATGAAATTTATAGTAAGAGG?????????????????????????????? Camoensia_brevicalyx ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTCATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATCT------TAATGGATCAATTCTTGTGGAAAATGTAGGTTATGAAAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTGTAAAAAAGA------TCAATTTTGGGGATATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCAATCAATTCATTCAATTTTTCCGTTTTTTGAGGATAAATTTACATATTTAAGTTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATAAGTATT------TTAATTGGAA------------------TAGTCTTATTACTCCAAAGAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTTGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTATGGCTTCAAAGAGTGCGCCCCTTTTGATGAATAAATGGAAATACTATTTTCTCCATTTATGGCAATGTGATTTTGATGTTTGGTCTCAACCAGAAACCATCCATATAAACCAATTCTCCGAACATTCATTTCACTTTTTG------GGTTATTTTTCAAATGTGCGGTTAAATCTCTCGGTGGTACGGAGTCAAATGCTGGAGAATTCATTTCTAATCGAGATTGTTATGAAAAAGTTTGATACAATAGTTCCAATTATTCGTCTAATTAGATCATTGGCTAAAGCAAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAACCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGGCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCCCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAGATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTAATTTGCAGAGG------TTATATAAAGGTCGGATTTGGCATTTGGATATTATTTTCAGCAACGATCTGATCAA---------------TCATCAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAATAATGGGGCAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA----------AAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATCTCCTTTCGCATTAAGA----------AGGGGATCCTTCCAT----CGAAATTCCGCAAA-------------------------------------AGATCAAGGATAA---------------------------ACATATATATATATA------------------------------------------C-TATATGTACTGAAATACTCTTTCAATTGATTAATGAA----------GACTGAGAATCTCCATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-GATGTGAATCAAATAATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTTATTCCATCATAGTCTGACATAGTCTGATAGATCTTTTGAACAGTTGATTAATCAGCCGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Camoensia_scandens ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTCATTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATCT------TAATGGATCAATTCTTGTGGAAAATGTAGGTTATGAAAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTGTAAAAAAGA------TCAATTTTGGGGATATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAGTTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATAAGTATT------TTAATTGGAA------------------TAGTCTTATTACTCCAAAGAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCGTTGCTAAGGATTTTTTGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTATGGCTTCAAAGAGTGCGCCCCTTTTGATGAATAAATGGAAATACTATTTTCTCCATTTATGGCAATGTGATTTTGATGTTTGGTCTCAACCAGAAACCATCCATATAAACCAATTCTCCGAACATTCATTTCACTTTTTG------GGTTATTTTTCAAATGTGCGGTTAAATCTCTCAGTGGTACGGAGTCAAATGTTGGAGAATTCATTTCTAATCGAGATTGTTATGAAAAAGTTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGGCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCCCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAGATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTAATTTGCAGAGG------TTATATAAAGGTCGGATTTGGCATTTGGATATTATTTTCAGCAACGATCTGATCAA---------------TCATCAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAATAATGGGGCAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA----------AAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATCTCCTTTCGCATTAAGA----------AAGGGATCCTTCCAT----CGAAATTCCGCAAA-------------------------------------AGATCAAGGATAA---------------------------ACATATGTA------------------------------------------------C-TATATGTACTGAAATACTATTTCAATTGATTAATGAA----------GACTGAGAATCTCCATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-GATGTGAATCAAATAATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTTATTCCATCATAGTCTGACATAGTCTGATAGATCTTTTGAACAGTTGATTAATCAGCCGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Clathrotropis_macrocarpa ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAATATATTTATGGACTCGCTTATGGTCATGATTT------AAATAGATCAATTTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAAAAAAA------TCAATTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTTTTCCCACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATCAATTTACATATTTAAATTATGCGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------GTAATTTGAA------------------TAGTCTTATTACTCTAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTCTATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACAATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTTGTCTACCTTA------TCATTCTTCAGGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCTCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTGCAGAGGAAAAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTCCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATTCATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTTT-------CGAAAACAAA---------GAAAATT--TCAGAAAGCGAGAA------TAAAA----------AAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------GCATTTCCTTTCGCATTAGGA----------AAGGAATCCTTCCAT----CAAAATTCCGGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATAAAA-GATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCGAATCATTCATTCCATCATAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Clathrotropis_nitida ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCATGATTT------AAATAGATCCTTTTGGGTGGAAAATGGGGGTTATAACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTCCTAATGATTCTAACAAAAA------TCAATTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCTGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAAGACCTTGTAGAAGTCTTGGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTAACATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGTCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATCCGAACATTCATTCCTCTT{AT}ATG------GG{AT}TATTTTTCAAATGTGCGGTT{AT}AATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTAGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTAGTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGGTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGCCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACGATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA--------AAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATAAA----------------------------------CATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTTTATTTGTGAATATTTTATTTATATCA--------------------CAAATGAAA-GATGTGAATCAAATCAATT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCACTCCATCAGAGTCTGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAGAGTCCCATTCCACATGTCAATACCGACAAC-AATGAAATTTAGAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Crotalaria_incana ATGGAGGAATATCAAGTATATTTAGAACTAGGTATATCTCGCCAACTGGACTTCCTATACC------CCCTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATGGATCCTTTTTTGCAGAACATGTAAATTATGACAATAAATCGAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTCTTTCTACTAATGATTCTAAAAAAAA------TCAATTTTGGGGGTATAACAAAAATTTGTACTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATATTATAAAAATTTGCGATCAGTTCATTCCATTTTTCCGTTTTTCGAGGATAAATTGACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCGTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTTTTTCCTTCACTTATTAAGGTTGTTTCTTTATGAGTATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTAAGTAATAAATCGTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGAGAATCTATTTCTATGAAAAAATAGAACATTTTGTAGAAGTCTTTGTTAAGGATTTTTTGTCTACCTTA------TCATTCTTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCTTTTTGGCTTCAAGGAATGCGCTCCTTTTGATGAATAAATGGAAAAATTATCTTATCCATTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCAGGAATGATCAAAATAAGCCAATTCTCCGAGCATTCATTTCATCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTCGATACACTAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGGACCCCATTAGTAAGCCAGCCTGGGCTCATTCATCCGATTTTGATATTATTGACCGATTTTTGCGCATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACATAAAAGTACTGTACGTGCTTTTGTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAGGAGATTCTTTCGTTGATCTTTCAA------AGAACTTCTTCTACTTTGCGGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTTCAGCAACGATCTAGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cyclolobium_brasiliense ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGATTTCCTATACC------CACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATAGTCATGATTT------TAATAGATCCAATTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTCTAAAAAAAA------TCCATTTTTGGGGTATAAAAAAGATTTGTATTCTCAAATAATAGCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGTCGAAAATCATAAGATCCTATAAGAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAGGATGTCCCCTTCTTTCATTTCTTAAGGTGGTTTTTTTATGAGTATT------GGAATTGCAA------------------TAGTCTTATTACTAC------------------------TTCAAAAAGGAATCTAAGATTTTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTCTATGAAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAAGATTTTTCGTATACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATCTCATTTTTATGTTTGGTCTCAACCAGGAACGACCCATATAAATCAATTCTCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAATTGCTGGAAAATTCATTTCTAATCGAGATTGTTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------GGAGCTTCTTCTATTTTGCAGAGG------TTATATAGAGGTCGAATTTGGTATTTGGATATTCTTTTCAGCAACGATCTAGTCAA---------------TTATGAATGA???????????----????????ATGGAA-CTTA-CAA-TGATA--CTTTCAATT-CAGAGAAACCC-GGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCAAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAATA----------AAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAGATGGAGTTGATG------ACAACTCCTTTCGCATTAGGA----------AAGGAATCCTTCCCT----CGAAATTCCAGAAA-------------------------------------GGATCAAGGATAACCATATAACCATATATAATAATAGAATACATATATA------------------------------------------------CATATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAGATCTCTATTTGTGAATATTT-----A-----------------------------------GGTGTGAATCAAATCATTT---CCAA----GTTGAAGG------AAGGATTGAATATTCATTGATCAAATCATTCATTCCATCATAGTCTGA----------TAGATCTTTTGAAGAACTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATAACGACAAC-AATGAAATTGATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Cytisus_scoparius ATGGAGGAATATCAAGTATATTTAGAACTAGATATATCTCGCCAACAGCACTTCCTATACC------CACTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATGGATCTATTTTTTCGGAAAATGTAGATTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAAAAAAA------TCAATTTTGGGGTTATAATAAAAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTAAACTCTTCCTCAGA------GGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCGAAAGATGCCCCTTTGTTTCACTTATTAAGGTTGTTTCTTTATGAGTATT------GTAATTGGAA------------------TAATCTGATTACTCCAAAAAAA---TTGATTTCTACTTTTTCAAAAAGTAATCTAAGAGTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACAATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACATTTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGAGCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGTCTCTTTTGATGAATAAATGGAAAAACTATCTTATCCATTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAACCAATTCTCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTCGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTAGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGGTATTTCAA------AGGGCTTCTTCTACTTTGCAGGGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCATCAACGATTTGATCAA---------------TCATGAATGAAATTGCATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTGACAATGGG-CAATCCTGAGCCAAATCCCATTTTT-----CGCAAAAACAAA---------GAAAAGT--TCAGAAAGCAAAAA------TAAAA------------AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAACGGAATTGACG------ACATTTCCTTTCGCGTTGGGT-----TAGGAAAGGAATCCTTTCGT----CGAAATTGTGGAAA-------------------------------------GGATCAAGAATAA---------------------------ACGTATATACATATATATA--------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATAAA----------GACTGAAAATCTCTATTT---------------------------------------------------------------------------------GTTGAAGG------AGGAATTGAATATTCATTGATCAAATCATTCATTCCATGATAATCTGA----------TAGATCTTTTTAAGAGCTGATTAATTAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACCAATGAAATTTATAGTAAGAGGA????????????????????????????? Dicraeopetalum_capuronianum ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AATTGGATTGA----GCCTTGGTATGGAAACTTACCCAGTGGTAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGCGAAAACAAAAAAAAAAAAGAAAAGT--TCATAAAGCGAGAT------GAGAA-------TAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACGTTGACGACATTTCCTTTCGCATTAGGA----------AAGGAATCTTTCTATTCATCGAAATTTCGGAAA-------------------------------------GGATCAAGGATAA---------------------------ACGTATATATATATATAT----------------------------------------GTATATGTACTGAAATATTATTTCAATTGATTAAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAA??????????????????????????? Dicraeopetalum_stipulare ATGGAGGAATATCAAGTAGATTTAGAACTAGATATATCTCGCCAACAGGACTTCCTATATC------CACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGTTCATGATTT------TAATGGATCCATTTTTGCGGAAAATGTAGATTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAAAAAAA------TCAATTTTGGGGATATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTGAGCTCTTCCTTAGA------AGAGGCAGAAATCGTAAAATATTATAATAATTTGCGATCAATTCATTCTATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATTCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTATGAGTATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAACAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAATATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGATTTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGCCATTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAACCAATTCTCTGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGCTAGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCGTTAGTAAATCGGTCTGGGCCGATTTATCCGATTTTGATATTATTGACCGATTTTTGCGGATATATAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCGTATTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTTCTTTTTTAAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAATTTCAAAGAACTTCTTCGACTTTGCAGAGG------TTGTATAAGGGCGGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGATCAA---------------TCATGAATGA???????????----????????ATGGAAA-TTACCC-GTGGTAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGCGAAAACAAAAAAAAAAAAGAAAAGT--TCATAAAGCGAGAT------AAGAA-------TAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTT{CT}TAACAAATGGAGTTGACGTTGACGACATTTC{CT}TTTCGCATTAGGA----------AAGGAATCTTTCTATCCATCGAAATTTCGGAAA-------------------------------------GGATCAAGGATAA---------------------------ACGTATATATATATATATATA------------------------------------TGTATATGTACTGAAATATTATTTCAATTGATTAAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGA{AG}G?????????????????????????????? Diplotropis_brasiliensis GTGGAGGAATATCAAGTCTATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------AAATAGATCAATTTTTGTGGAAAATGTAGGTTATGACAAAAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAATTCTTGGGGTATAACAATAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCTCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Diplotropis_ferruginea GTGGAGGAATATCAAGTCTATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------AAATAGATCAATTTTTGTGGAAAATGTAGGTTATGACAAAAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAATTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGG??????????????????????????????GGGTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCTCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Diplotropis_incexis GTGGAGGAATATCAAGTCTATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------AAATAGATCAATTTTTGTGGAAAATGTAGGTTATGACAAAAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAATTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCTCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA???????????----??????????????????????????????-??????????????????CCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCGCATTAGGA----------AAGGAATCCTTCCAT----CGAAATTCCGGAAA--------------------------------AGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATAAAA-GATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCATTCTATCAGAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Diplotropis_martiusii GTGGAGGAATATCAAGTCTATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------AAATAGATCCATTTTTGTGGAAAATGTAGGTTATGACAAAAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAATTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCTCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCTCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCGCATTAGGA----------AAGGAATCCTTCCAT----CGAAATTCCGGAAA--------------------------------AGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATAAAA-GATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCATTCTATCAGAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Diplotropis_purpurea GTGGAGGAATATCAAGTCTATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------AAATAGATCAATTTTTGTGGAAAATGTAGGTTATGACAAAAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAATTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCTCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Diplotropis_triloba GTGGAGGAATATCAAGTCTATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------AAATAGATC?ATTTTTGTGGAAAATGTAGGTTATGACAAAAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAAGAAATTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCTCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Genista_monspessulana ATGGAGGAATATCAAGTATATTTAGAACTAGATATATCTCGCCAACAGCACTTCCTATACC------CACTAATTTTTCGGGAATATATTTATGGACTCGCTTATGGTCATGATTT------TAATGGATCTATTTTTTCGGAAAATGTAGATTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTTTTTCGGCTAATGATTCTAACAAAAA------TCAATTATGGGGTTATAATAAAAATTTGTACTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTAAACTCTTCCTCAGA------GGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCGAAAGATGCCCCTTTGTTTCACTTATTAAGGTTGTTTCTTTATGAGTATT------GTAATTGGAA------------------TAACCTGATTACTCCAAAAAAA---TTGATTTCTACTTTTTCGAAAAGTCATCTAAGAGTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTACTTTTTCTACGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATAGAAAAATAGAACATTTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTATCATTATCATTCTTCAAGGAGCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGTCTCTTTTGATGAATAAATGGAAAAACTATCTTATCCATTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAACCAATTCTCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATCAGTAAGCCGCTTTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGTCTCGTAAACACAAAAGTACTATACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGGTATTTCAA------AGGGCTTCTTCTACTTTGCAGGGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGCGATAA-TTTTCAAATTCAGAGAAACCCTGGAATTGACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CCCAAAAACAAA---------GAAAAGT--TCAGAAATCGAAAA------TAAAA------------AGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAATGGAATTGACG------ACATTTCCTTTCGCGTTGGGT-----TAGGAAAGTAATCCTTTCGT----CGAAATTGCGGAAA-------------------------------------GGATCAAGAATAA---------------------------ACGTATATACATATATATA--------------------------------------CGTATATGTACTGAAATACTATTTCAATTGATTAATAAAAATAAA----GACTGAAAATCTCTATTT---------------------------------------------------------------------------------GTTGAAGG------AGGAATTGAATATTCATTGATCAAATCATTCATTCCATGAAAATCTGA----------TAGATCTTTTTAAGAGCTGACTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGATAAC-AATGAAATTTATAGTAAGAGGA????????????????????????????? Guianodendron_praeclarum GTGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------AAATAGATCCATTTTTGTGGAAAATGGAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAA---TAAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATCCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGCTACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGGTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGTGATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTACCAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAACAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCTCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGATTAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAG-----------CGAGAA------TAAAA---------AAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCGCATTAGGA----------AAGGAATCCTTCCAT----CGAAATTCCGGAAA--------------------------------AGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATAAAA-GATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCATTCCATCAGAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTAAATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Harpalyce_arborescens ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCACCAACAGGACTTCCTATACC------CACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATCT------TAATGGATCCAATTTTGTGGAAAATGGGGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTATTTTTTCTAATGATTCTAAAAAAAA------TCCATTTTTGGGATATAACAAGGATTTGTATTCTCAAATAATAGCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCGAAAATCATAAAATCCTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCTTAGTTCAAGTCCTTCGATACTGGGTGAAGGATGTCCCCCTTTTTCATTTATTAAGGTTGTTTTTTTATGAGTATT------GTAATTGCAA------CAGTAATAGTAATAAGATTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGGAATCCAGGATTTTTTTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCCATCTTCCTGTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTATCTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCATCTTGTAGAAGTCTTTGCTAAAGATTTTTCGTATACCTTA------TCATTCTTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGGTTCAAAGAATGTGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATCTCATTTTGATGTTTGGTCTCAACCAGGAATGACCCATATAAATCAATTCTCCAAGCATCCATTTCTCTTTTTG------GGCTATTATTCAAATGTGCGATTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTTTGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATACACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------CGAGCTTCTTCTATTTTGCAGAAG------TTATATAGAGGTCGGATTTGGTATTTGGATATTCTTTTCAGGAACGATCTAGTCAA---------------TTATGAATAA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Harpalyce_brasiliana ATGGAGGAATATCAAGTATATTTAGAACTAAATAGATCTCACCAACAGGACTTCCTATACC------CACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATGAATCCAATCTTGTGGAAAATGTGGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTTTTATTTTTTCTAATGATTCTAAAAAAAA------TCCATTTTTGGGATATAACAAGGATTTGTATTCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCGAAAATCATAAAATCCTATAATAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCCTAGTTCAAATCCTTCGATACTGGGTGAAGGATGTCCCCCTTTTTCATTTATTAAGGTTGTTTTTTTATGAGTATT------GTAATTGCAACAGTAACAGTAATAGTAATAATCTTATTACTCCCCAAAAA---TGGATTTCTACTTTTTCAAAAAGGAATCCAGGATTCTTTTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCCATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTATCTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCATCTTGCAGAAGTGTTTGCTAAAAATTTTTCGTATACCTTA------TCATTCTTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGCTTCAAAGAATGTGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATCTCATTTTGATGTTTGGTCTCAACCAGGAATGACCCATATAAATCAATTCTCCGAGCATCCATTTCTCTTTTTG------GGCTATTATTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTTTGAAAAATTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------CGAGCTTCTTCTATTTTGCAGAAG------TTATATAGAGGTCGGATTTGGTATTTGGATATTCTTTTCAGGAACGATCTAGTCAA---------------TTATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Harpalyce_formosa ATGAAGGAATATCAAGTATATTTAGAACTAGATAGATCTCACCAACAGGACTTCCTATACC------CACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATCT------TAATGGATCCAATTTTGTGGAAAATGGGGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTATTTTTTCTAATGATTCTAAAAAAAA------TCCATTTTTGGGATATAACAAGGATTTGTATTCTCAAATAATAGCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAAAAATCATAAAATCCTATAATAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAGGATGTCCCCCTTTTTCATTTATTAAGGTTGTTTTTTTATGAGTATT------GTAATTGCAACAGTAACAGTAATAGTAATAAGATTCTTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGGAATCCGGGATTTTTTTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCCATCTTCCTGTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTATCTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCATCTTGTAGAAGTCTTTGCTAAAGATTTTTCGTATACCTTA------TCATTCTTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGGTTCAAAGAATGTGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATCTCATTTTGATGTTTGGTCTCAACCAGGAATGACCCATATAAATCAATTCTCCGAGCATCCATTTCTCTTTTTG------GGCTATTATTCAAATGTGCGATTAAATCTTTCAATGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTTTGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------CGAGCTTCTTCTATTTTGCAGAAG------TTATATAGAGGTCGGATTTGGTATTTGGATATTCTTTTCAGGAACGATCTAGTCAA---------------TTATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Hovea_purpurea ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATAGATCCAATTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAAAAAAA------TCCATTTTGGGGGTATAACAAGGATTTGTATTCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCTTTAGATTTAGAGGAGGCGAAAATCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCCTTCTTTCATTTATTAAGGTTATTTTTTTATGAGTATT------GGAATTGCAA------------------TACTCTTATTACTCCCAAAAAA---TCGATTTCTACTTTTTCAAAAAGGAATCCAGGATTTTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACATCTTGTAGAAGTCTTTGGTAAAGATTTTTCGTATACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAAGCAGGAACGACCCATAGAAATCAATTCTCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCTAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTGGATACAATAGCTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTACAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAAAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCCATTTTACACCGG------TTATATAGAGGTCGAATTTGGTATTTGGATATTCTTTTCAGCAACGATCTAGTCAA---------------TTATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Lamprolobium_fruticosum ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGAGAGTATATTTATGGACTTGCTTATGGTCATGATTT------TAATAGATCCAATTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTCAAAAAAA------TCTATTTTGGGGGTATAACAGGGATTTGTATTCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTAGAAATTCCATTTTCCCTACAATTAAGCTCTTCTTTAGA------GGAGGCGAAAATAATAAAATACTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCCTTCTTTCATTTATTAAGGTTATTTTTTTATGAGTATT------GGAATTGCAA------------------TACTCTTATTACTCCAAAAGAA---TCGATTTCTACTTTTTCAAAAAGGAATCCAGGATTTTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACATCTTGTAGAAGTCTTTGGTAAAGATTTTTCGTATCCTTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGTTTCAAAGAATGTGCCCCTTTTGATGAAGAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGACCCATATAAATCAATTCTCCAAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATTTTTTAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTGGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTATTTTACACAGG------TTATATAGAGGTCAGATTTGGTATTTGGATATTCTTTTCAGCAGTGATCTAGTTAA---------------TTATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Leptolobium_bijugum GTGGAGGAATATCAAGTCTATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTT------TAATAGATCAATCTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAAAAAAAAAA---TAAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTCCAAGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCCCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAAAGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA----------AAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCGCATTAGGA----------AAGGAATCCTTCCAT----CGAAATTCCGGAAA--------------------------------AGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCAATTTGTGAATATTTATATCACAAATAAAA-GATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCATTCCATCAGAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Leptolobium_brachystachyum GTGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTT------TAATAGATCAATCTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA?AAAAAAAAAATAAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCCCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTTTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAAAGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTA------AGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA----------AAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCGCATTAGGA----------AAGGAATCCTTCCAT----CGAAATTCCGGAAAGGAAAGGAATCCTTCCATCGAAATTCCGGAAAAGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATAAAA-GATGTGAGTCAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCATTCCATCAGAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Leptolobium_dasycarpum GTGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACC------CACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTT------TAATAGATCAATCTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAAAAAAAAAA---TAAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCAACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCCCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATTCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA----------AAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCGCATTAGGA----------AAGGAATCCTTCCAT----CGAAATTCCGGAAA--------------------------------AGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATAAAA-GATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCATTCCATCAGAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Leptolobium_elegans GTGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACC------CACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTT------TAATAGATCAATCTTTGTGGAAAATGTGGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAAAAAAAAAA---TAAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTGGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCCCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATTCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Leptolobium_nitens GTGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACC------CACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATTGTCATGATTT------TAATAGATCAATCTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAAAAAAAAAA---TAAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCCCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATTCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Leptolobium_panamense GTGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACC------CACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTT------TAATAGATCAATCTTTGTGGAAAATGTAGGTTATG?CAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAAAAAAAAAA---TAAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAA?????????????????????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCCCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA----------AAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCGCATTAGGA----------AAGGAATCCTTCCAT----CGAAATTCCGGAAA--------------------------------AGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATAAAA-GATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCATTCCATCAGAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGG? Leptolobium_parvifolium GTGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACC------CACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTT------TAATAGATCAATCTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCGAATGATTCTAAAAAAAAAAA---TAAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCCCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Leptolobium_tenuifolium GTGGAGGAATATCAAGTCTATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACC------CACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTT------TAATAGATCAATCTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAAAAAAAAAA---TAAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGG?????????????????CTTTCATTTATTAAGGTTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCCCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATTCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Lupinus_argenteus ATGGAGGAATATCAAGTATATTTAGAACTAGATATCTCTCGCCAACAGCACTTACTATACC------CACTCATTTTTCGGGAGTATATTTATGGACTCGTTTATGGTCATGATTT------TAATGGATCTATTTTTTTGGAAAATCTAGATTATGATAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGGATCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAAAAAAA------TCAATTTTTGAGTTATAATAAAAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTAAACTCTTCCTCAGA------GGAGTCAAAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCT??????????????????????????????????????????CCCTTTGTTTCACTTATTAAGGTTGTTTTTTTATGAATATT------GTAATTGGAA------------------TAATCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCTAAGAGTTTTCTTGTTCCTATATAATTTTTATGTATGTCAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTATCGTTCTTTTTGAACGGATCTATTTCTATGGAAAAATAGAACATTTTTTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTT------------CTTCAAGGAGCTTTTCATTCATTATGTTAGATATCAAGAAAAATATATTTTGGCTTCAAAGAATGCGTCTCTTTTGATGAATAAATGGAAAAATTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCACGAACCATCCAAATAAACCAATTTTCCGAGGGTTCATTTCGCCTTTTG------GGATATTTTTCAAATGTGCGGTTGAATCGTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTCTTAGGACACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCAGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAAGAAGAAGAGATTCTTTCTTTGGTCTTTCAA------AGGGTTTCTTCTACTTTGCAGGGG------TTATATAGAGGTAGGGTTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCTTGGAATTGACAATGGG-CAATCCTGAGCCAAATCCCGTTTTTT----CGCAAAAACAAA---------GAAAAGT--TCAGAAAGCGAAAA------TAAAA------------AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAACGGAGTTGACA------ACATTTACTTTCGCGTTGAGT-----TAGGAAAGGAATCCTTTCAT----CGAAATTTTGTAAA-------------------------------------GGATAAAGAATAA---------------------------ACGTATATACATATATA----------------------------------------CGTATATTTACTTAAATATTATTTCAATTGATTAATAAA----------GACTGAAAATCTCTATTT---------------------------------------------------------------------------------ATTGAAGA------AGTAGTTGAATATTGATTGATCAAATCATTCATTCCATGATAATCTGA----------TAGATCTTTTTAAGAGATGATTAATCAGACCAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTAGAGTAAGAGGAAAATCC??????????????????????? Maackia_amurensis ATGGAGGAATATCAAGTAGATTTAGAACTAGATATATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATGGATCCATTTTTGCGGAAAATGTAGATTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTAATCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAAAAAAA------TCAATTTTGGGGTTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTTGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCCTAGA------GGGGGCAGAAATCATAAAATATTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------GTAGTTGGAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGATTTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTTTTCACAGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAACGCGCCCCATTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAACCCATTCTCCGAACACTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAAACTTTCAGCAGTACGGAGTCAAATGGTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGCTTGGGCCAATTCATCTGATTTTGATATTATTGACCGATTTTTGCGTATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAACAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAGAGA------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TTACGAATGA???????????----???????????????CTTACCAAATGATAACTCTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTTTTTTTTCGCGAAAATAAA---------GAAAGGT--TCATAAAGGGAGCA------TAAAGCGAGA-ATAAAAAGGATAGGTGCAGAGACTCAATGGAAGTTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCGCA----------------------------------------TTAAGGAAG--------------------------------------------GGATA-----------------------------------TACATATA------------------------------------------TGTATATGTACTGAAATATTATTTCAGTTGATTAATGAA----------GACCGAA-ATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATGGAAAGATGTGAATCAAATCATTT---CCAA----ATTGAAGAGA----AAGAATTGAATATTCATTGATCAAATCATTCATTCCATCATAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCAACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTA-AAATCGTGAGGG Ormosia_amazonica ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????----?????GGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCCGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCCATTGATTATTGAG----------GACTGAAAATTTCTATTTGGGAATATTT-----ATATCA--------------------CAAATGAAA-AATATGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATCGAATATTCATTCATCAAATCATTCACTCCATCATAGTCGGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTGCATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTG???????????????????? Ormosia_arborea ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCCATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TAAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCCGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATATCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAA---TCAATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGGGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Ormosia_bahiensis ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TCAATTT---GGGTATAAGAATAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCTTTATTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTTTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTGCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------AGATTTCCCTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-AATGGGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCTGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAAT???????? Ormosia_colombiana ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCCATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TAAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAA???????????????????????????????????????????????????????????????????------??????????------------------??????????????????????---?????????????????AAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGGGATCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Ormosia_costulata ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCCATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TAAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATC?????????????????????????????????????CTTTCTTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAA---TCAATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTAATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAA??????????????????????????????????????????????????????????????????????????????????????????????????????------????????????????????????------????????????????????????????????????????????????????????---------------??????????AATTGGATTGA----GCCTTGGTATGGAAACTTACTAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATATCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-AATGTGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCGGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAAT???????? Ormosia_coutinhoi ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCC?ACAGGACTTCCTATACC------CACTT?TTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TCAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGTAA------------------TACTTTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTTTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAATGTGCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCGCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAAAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAAAAACTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-AATGTGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCTGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_excelsa ATGGAAGAATATCAAGTCTATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCCATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TAAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATATCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAA---TCAATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTGAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGGGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATAATAAA---------------------------------CATATATATACGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATATCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-AATGTGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCGGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_fastigiata ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCCATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TAAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCCGAGGTTTTTGCCGTCGTCGTGGAAATTCAATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATATCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAA---TCAATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGGGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATATCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-AATGTGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCGGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAAT???????? Ormosia_formosana ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAGCAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTATTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAACAAAAA------TCAATTT---GGGTATAAGAAGAATTTTTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAC---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCTTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTGCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATATTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Ormosia_holerythra ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------AGATTTCCCTTCGCGTTAGGA----------AGT-AGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-AATGGGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCTGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTA????????????? Ormosia_limae ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TCAATTT---GGGTATAAGAATAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCTTTATTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTTTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTGCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTTTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------AGATTTCCCTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-AATGGGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCTGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_minor ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTACTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGTTATGACAATAAATCAAGTTTACTAATCATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TAAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGGTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACATACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCCGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGA???????????----?CCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAAAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATATCTATTTGCGAATATTT-----ATATCA--------------------CAAATGAAA-AATGTGAATCAAATCA--------------------------------------------------------TTCACTCCATCATAGTCGGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_nitida ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TCAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCACTTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTTATCTGGAAATCTTGGTTCAAACCCTTCGCTACTGGGTGAAAGATG?????????????TTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCACTCTTCAAGGATCCTTTCATCCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTTAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTGCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------????????????????????????------????????????????????????????????????????????????????????---------------??????????AATTGGATTGA----GCCTTGGTATGTAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA-------------------------------------GGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-AATGTGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCTGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_paraensis ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTACTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGTTATGACAATAAATCAAGTTTACTAATCGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TAAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTATAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAAGAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAACCAAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAATTGACG------ATATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GGCTGAGAATATCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-AATGTGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTTATTGATCAAATCATTCACTCCATCATAGTCTGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGT????? Ormosia_smithii ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCCATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TAAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAAT?????????????????????????????????????????????????????????????????????????????------??????????------------------??????????????????????---?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------????????????????????????------????????????????????????????????????????????????????????---------------?????????????????????----???????TATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATATCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-AATGTGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCGGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_sp ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TAAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTCCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAAATGTACGAATACCCTATTCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAA---TCAATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCCCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGCTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTCTATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAATAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAAAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATATA--------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATATCTATTTGCGAATATTT-----ATATCA--------------------CAAATGAAA-AATGTGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCGGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_stipularis ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGCTCCATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TAAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGCTACTGG??????????????????????ATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAA---TCAATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAATGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGGGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTTAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGTAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATATCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-AATGTGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCGGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_timboensis ATGGAAGAATATCAAGTCTATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAACAAAAA------TAAATTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAAATGTACGAATACCCTATTCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GTAATTGGAA------------------TACTTTTATTACTCCAAAAAAA---TCAATTTCTACTTTTTCAAAAAATAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTCTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAAAAACCGAGAA------TAAAA-----------AAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGACG------ATATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCCGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CATATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATATCTATTTGCGAATATTT-----ATATCA--------------------CAAATGAAA-AATGTGAATCAAATCAATT---CCAA----GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCGGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Orphanodendron_bernalii ?????????????????????????????????????????????????????????????------?????????????????????????????????????????????????------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------ATAATTGGAA------------------TAGTCTTATTACTCCAAGAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTTTGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACAATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAAATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCACCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCTCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAGAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGGATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAGATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTCTATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA???????????----???????????????????????GTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA---------AAGAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCCTAATGCGA----------AAGGAATCCTTCCAT----CGAAATTCCGGAAA--------------------------------GGAAAGGATAAA----------------------------------CATATATATA----------------------------------------------CGTATATGTACTGAAATCTTATTTC----------TGAA----------GACTGAAAATCTCTATTTGTGAATAGTT-----ATATCA--------------------CAAATGAAA-GATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATGGAATATTGATTGATCAAATCATTCATTCCATCATAG------------------ATCTTTTGAAGAGCTGATTAATCAGACGAGGATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Orphanodendron_grandiflorum ?????????????????????????????????????????????????????????????------?????????????????????????????????????????????????------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------??????????------------------??????????????????????---?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------??????????????????????????????????????????????????????????????????????????????????TGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGGATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAGATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTCTATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA???????????----???????????????????????GTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA---------AAGAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCCTAATGCGA----------AAGGAATCCTTCCAT----CGAAATTCCGGAAA--------------------------------GGAAAGGATAAA----------------------------------CATATATATA----------------------------------------------CGTATATGTACTGAAATCTTATTTC----------TGAA----------GACTGAAAATCTCTATTTGTGAATAGTT-----ATATCA--------------------CAAATGAAA-GATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATGGAATATTGATTGATCAAATCATTCATTCCATCATAG------------------ATCTTTTGAAGAGCTGATTAATCAGACGAGGATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Panurea_longifolia ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------AAATAGATCCATTTTGGTGGAAAATGTGGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTGCCAATGATTCTAACAAAAA------TCAATTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCTGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGATTGTTTCTTTATGAGTATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATATGAATTTATCTCCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTGGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAAGATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGGTTCTTCTACTTTGCAGAGC------TTATATAGAGGTCGGATTTGGTATTTGGATATTCTTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA---------CAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATCAAGGATAA---------------------------ACATATATATATA--------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATCAA----------GACTGAAAAT------TTGTGAATATTTTATTTATATCA--------------------CAAATGAAA-GATGTGAATCAAATCAATT---CCAA----GTTGAAGA------AAAAATGGAATATTCATTGATCAAATTATTCACTCTATCATAGTCTGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAGAGTCCCATTCCACATGTCAATATCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Piptanthus_nepalensis ATGGAGGAATATCAAGTAGATTTAGAACTAGATATATCTCGCCAACAAGACTTCCTATATC------CACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATGGATCCATTTTTGCGGAAAATGTAGATTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCGACTAATGATTCTAAAAAAAA------TCAATTTTGGGGTTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGGGGCAGAAATCATAAAATATTATAATAATTTGCGATCGATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTTAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAA---TCTATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGATTTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCACAGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGCCCCTTTTGATGAGTAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAACCAATTATCCGAACATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCTGTTAAATCTTTCAGCAGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTAATACAATAGTTCCGATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGGACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Poecilanthe_falcata ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATAGATCCAATTTTGTGGAAAATGTAGGTTATGACAAAAAATCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTACTAAAAAAAA---TCCATTTTTGGGGTATAACAAGGATTTGTATTCTCAAAGAATATCAGAGGGTTTTACCATCGTCGTAGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGTGAAAATAATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAGGATGTCCCTTTCTTTCATTTATTAAGGTCGTTTCTTTATGAGTATT------GTAATTGCAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGGAATCCAGGATTTTTTTTGTTCCTATATAATCTTTATGTATGTGAATACGAATCTATCTTCCTCTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTCTTTGAGCGAATCTATTTCTATGCAAAAAAAGAACATCTTGTAGAAGTCTTCGCTAAAGATTTCTCGTATACCTTA------TCATTCTTCAAGGATCCTTTTATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGCCAATTTCATTTTGATGTTTGGTGTCAGCCAGGAACGACCCCCATAAATCAATTCTCCGAGCATCCATCTCACTTTTTG------GGCTATTTTTCAAATGTGTGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTTGATACAATAGTTCCAATTCTTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAATAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAATTATATACTTCGATTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTTAAAAGATTGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AAAACTTCTTCTATTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTAGATATTCTTTTCAACAACGATCTAGTCAA---------------TTATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Poecilanthe_parviflora ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CGCTCATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATAGATCCAATTTTGTGGAAAATGTAGGTTATGACAAAAAATCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTACTAAAAAAAA---TCCATTTTTGGGGTATAACAAGGATTTTTATTCTCAAAGAATATCAGAGGGTTTTACCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCGAAAATAATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTGTGTGTCAGATGTACGAATACTCTATCCTATCCATCTGGAAATCTTAGTTCAAATC???????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGGGTATT------GTAATTGCAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGGAATCCGGGATTTTTTTTGTTCCTATATAATCTTTATGTATGTGAATACGAATCTATCTTCCTCTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTCTTTGAGCGAATCTATTTCTATGCAAAAAAAGAACATCTTGTAGAAGTCTTCGCTAAAGATTTCTCGTATACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCTATTTATGCCAATTTCATTTTGATGTTTGGTCTCAGCCAGGAACGACCCCTAGAAATCAATTCTCCGAGCATCCATCTCATTTTTTG------AGCTATTTTTCAAATGTACGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTTGATACAATAGTTCCAATTCTTCCTCTAATTAGATCATTGACTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGCCCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAATTTGTATCAAATAAATTATATACTTCGATTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACATGCTTTTTTAAAAAGATTGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AGAACTTCTTCTATTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTAGATATTATTTTCAACAACGATCTAGTCAA---------------TTATGAGTGAAATTGGATTGATTGAGCCTTGGTATGGAAACTTACTAAGTGATAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCAAAAACAAA---------GAAAAGT--TCAGAAAGCGAAAAAAATAGTAAAAGGAATAATAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAGATGGAGTTGATG------ACATCTCCTTTCGCATTAGGA----------AAGGAATCCTTCTCT----CGAAATTCCAGA-------------------------------------------------------------------------------------------------------------------------------------------------------ATATTCTTTCAATTTATTAATGAA----------GACTGAAGATCTCTATTTGTTAATATTT-----ATATCA--------------------CAAATGAAA-GGTGTGAATTAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCATTTCATCATAGTCTGA----------TAGATCTTTTGAAGAACTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATAACGACAAC-AATGAAATTGATAGTAAAAGGAAAATCCGTCGACTTTAGAAATCGT????? Poecilanthe_subcordata ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATAGATCCAATTTTGTGGAAAATGTAGGTTATGACAAAAAATCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTACTAAAAAAAA---TCCATTTTTGGGGTATAACAAGGATTTGTATTCTCAAAGAATATCAGAGGGTTTTACCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCGAAAATAATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAGGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------GTAATTGCAA------------------TAGTCTTATTACTCCAAAAAAA---TCAATTTCTACTTTTTCAAAAAGGAATCCAGGATTTTTTTTGTTCCTATATAATCTTTATGTATGTGAATACGAATCTATCTTCCTCTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTCTTTGAGCGAATCTATTTCTATGCAAAAAAAGAACATCTTGTAGAAGTCTTCACTAAAGATTTCTCGTATATCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCTATTTATGCCAATTTAATTTTGATGTTTGGTCTCAGCCAGGAACGACCCCTAGAAATCAATTCTCCGAGCATCCATCTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTTGATACAATAGTTCCAATTCTTCCTCTAATTAGATCGTTGATTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAATTTCTATCAAATAAATTATATACTTCGATTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTAAAAAGATTGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AGAACTTCTTCTATTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTAGATATTATTTTCAACAACGATCTAGTCAA---------------TTATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Sophora_davidii ATGGAGGAATATCAAGTAGATTTAGAACTAGATATACCGCACCAACAGGACTTCTTATACC------CACTTCTTTTTCGTGAGTATATTTATGGACTTGCTTATGGTCATGATTT------TAATGGATCCATTTTTGCAGAAAATGTAGATTATGACAATAAATCTAGTTTACTGATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAAAAAAA------TCAATTTTGGGGTTATAACAAGAATTTATATTCTCAAATAATATCAGAAGGTTTTACCATCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTTCTCCTTAGA------GGGGGCAGAAATCATAAAATATTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAACTTGACATATTTAAATTATGTGTCAGATGTACGAATCCCCTATCCTATCCATCTGGAAATTTTGGTTCAAA?????????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTATTCCTATATCATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGTGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGGTTTTGTCGAAATCTTTACTAAGGATTTTTCGTCTACCTTA------TCATTCTTCACAGATACTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGCCCCTTTTTATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAATGATCCAAATAAACAAATTCTCCGAACATTCATTTCACCTTTTG------GGCTATTTTTCAAGTGTGCGGTTAAATCTTTCAGCAGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTCCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACGGTACGTGCTTTTTTGAAAAGATTAGGTTCAAAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAATAATGGG-CAATCCTGAGCCAAATCCTATTTTT-----CGCGAAACCGAA---------GAAAAGT--TCATAAAGCGAGAA------TAAAA------------AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCGCATTAGA-----------------------------------TTGGGGAGG-------------------------------------GGATCAAAGATAA---------------------------ATATATATATATATAA---------------------TATATCTATA----------TGTATATGTACTGAAATATTATTTCAATTGATTGATTAA------TGAAGACCGAAAATCTCTATTTGTGAATATTT-----ATCTCA--------------------CAAATGAAAAGATGTGAAGCAAATCATTT---CCAA----GTTGAAGAAA----AAGAATTCAATATTCATTGATCAAATCATTCATTCCATCACAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATTGACAAC-AAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Spartium_junceum ATGGAGGAATATCAAGTATATTTAGAACTAGATATATCTCGCCAACAGCACTTCCTATACC------CACTCATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATTATTT------TAATGGATCTATTTTTTCGGAAAATGTAGATTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAAAAAAA------TCAATTTTGGGGTTATAATAAAAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTAAACTCTTCCTCAGA------GGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCGAAAGATGCCCCTTTGTTTCACTTATTAAGGTTGTTTCTTTATGAGTATT------GGAATTGGAA------------------TAATCTGATTACTCCAAAAAAA---TTGATTTCTACTTTTTCAAAAAGTCATCTAAGAGTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTCTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCCTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACATTTTGTAGAAGTCTTTGTTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGAGCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGTCTCTTTTGATGAATAAATGGAAAAACTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAACTAAACCAATTCTCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGATACGGAGTCAAATGCTGGAAAATGCATTTCTAATCAAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGCTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATATTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGGTATTTCAA------AGGGCTTCTTCTACTTTGCAGGGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTGACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGCAAAAACAAA---------GAAAAGT--TGAGAAAGCGAAAA------TAAAA------------AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAATTGACG------ATATTTCCTTTTGCGTTGGGT-----TAGAAAAGGAATCCTTTCGT----CGAAATTGTGGAAA-------------------------------------GGATCAAGAATAA---------------------------ACGTATATACATATATA----CGTATATACATATATA--------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATAAA----------GACTGAAAATCTCTATTT---------------------------------------------------------------------------------GTTGAAGA------ATGAATTGAATATTCATTGATCAAATCATTCATTCCATGAAAATCTGA----------TAGATCTTTTTAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCC??????????????????????? Spirotropis_longifolia ATGGAAGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCATGATTT------AAATAGATCCTTTTTGGTGGAAAATGGGGGTTATAACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTCCTAATGATTCTAACAAAAA------TCAATTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCTGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAAGACCTTGTAGAAGTCTTGGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAATGTGTCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTATCCGAACATTCATTTCACTTTTTG------GGTTATTTTTCAAATGTTCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCCTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAAAAGTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGGTTCTTCTACGTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGCCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACGATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TGAAA---------AAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------AGATTTCCTTTCGCGTTAGGA----------AAGGAGTCCTTCCAT----CGAAATTCCAGAAA--------------------------------GGAAAGGATAAA----------------------------------CATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTTTATTTGTGAATATTTTATTTATATCA--------------------CAAATGAAA-GATGTGAATCAAATCAATT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCACTCCATCATAGTCTGA----------TAGATCTTTTGAAGAGCTAATTAATCAGACGAGAATAAAGATAGAGTCCCATTCCACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Staminodianthus_duckei GTGGGGGAATATCAAGTCTATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTT------AAATAAATCCATTTTTGTAGAAAATGTAGGTTATGGCAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTGCTGCTAATGATTCTAAAAAAAAAAA---TCAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTTAATTATGTGTCAGATATACAAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGGTGTTTCTTTATGAATATT------GGAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCCTTCAAGAAGTGATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTATCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCTCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTCTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCACGTAAACACAAAAGTACTGTACGTTCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-TTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA----------AAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCGCATTAGGAAAGG------GATGAATCCTTCCAT----CGAAATTCCGGAAA--------------------------------AGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATAAAA-CATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCATTCCATCAGAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTAAATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTCGAAATCGTGAGGG Staminodianthus_racemosa GTGGGGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------AAATAAATCCATTTTTGTGGAAAATGTGGGTTATGGCAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAA---TCAATTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTAAGCTCTTCCTTAGA------GGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTGAATTATGTGTCAGATATCCAAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGCTACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGGTGTTTCTTTATGAATATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAAAAATCGATTTCTACCCTTTCAAGAAGTGATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTATCTTA------TCATTCTTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCCCTTTTGATAAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACCAATTCTCCGAGCATTCATTTCACTTTTTGTTTTTGGGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------????????????????????????------????????????????????????????????????????????????????????---------------??????????AATTGGATTGA----GCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACAAA---------GAAAAGT--TCAGAAAGCGAGAA------TAAAA---------AAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACG------ACATTTCCTTTCGCATTAGGAAAGG------GATGAATCCTTCCAT----CGAAATTCCGGAAA--------------------------------AGAAAGGATCAAGGATAA---------------------------ACATATATATA----------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GACTGAAAATCTCTATTTGTGAATATTT-----ATATCA--------------------CAAATAAAA-CATGTGAATCAAATCATTT---CCAA----GTTGAAGA------AAGAATTGAATATTCATTGATCAAATCATTCATTCCATCAGAGTCTGA----------TAGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTAAATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTCGAAATCGTGAGGG Tabaroa_caatingicola ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCACCAACAGGACTTCCTATACC------CACTTATTTTTCGAGAGTATATTTATGTACTCGCTTATGGTCATGATTT------TACTAGATCCAATTTTGTGGAAAATGTCGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCGAAAAAAAA------TCCATTTTTGGGGTATAACAAGGATTTGTACTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGTTCTTCCTTAGA------GGAGGCGAAAATCATAAAATCCTATAATAATCTGCGATCAATTCATTCAATTTTTCCATTTTTCGAAGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCTTAGTTCAAGTGCTTCGATACTGGGTCAAGGATGTCCCCCTTTTTCATTTATTAAGGTTGTTTTTTTATGAGTATT------GTAATTGCAA------------TAGTAAGAGTCTTATTACTCTAAAAAAA---TCGATTTATACTTTTTCAAAAAGGAATCCAGGATTTTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTATCTTTGAGCGAATCTATTTCTATGCAAAAATACAGCATCTTGGAGAAGTCTTTGCTAAAGATTTTTCGTATACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGCTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATTTCATTTTTATGTTTGGTCTCAACCAGGAATGACCCAGATAAATCAATTCTCCGAGCATCCATTTCCCTTTTTG------GGCTATTTTTCAAATGTGCGATTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTTTGAAAAAATTTGATACAATAGTTCCCATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATATTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATAAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAGTTATTGGAAAAATTCTTTATAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------CGAGCTTCTTCTATTTTGCAGAGG------TTCTATAGAGGTCGGATTTGGTATTTGGATATTCTTTTCAGCAACGATCTAGTCAA---------------TTATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Templetonia_hookeri ATGGAGGAATATCCAGTATATTTAGAACTAGCTAGATCTCGCCAACAGGACTTCCTATACC------CACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TCATAGATCCAATTTTGTAGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAAAAAAA------TCCATTTTGGGGGTATAACAAGGATTTGTATTTTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCTTTAGA------GGAGGCGAAAATCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGATAAAAGATGTCCCCTTCTTTCATTTATTAAGGTTATTTTTTTATGAGTATT------GGAATTGCAA------------------TACTCTTATTACTCCAAAAGAA---TCGATTTCTACTTTTTCAAAAAGGAATCCAGGATTTTTTTTGTTCCTATATAATTATTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACAATTAACTTCTTTTAGTGTTCTCTTTGAACGAATCTATTTTTATGAAAAAATAGAACATCTTGTAGAAGTCTTTGGTAAAGATTTTTCGTATACCTTA------TCATTCTTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAATGTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGACCCATATAAATCAATTCTCCGAACATCCATTTCAATTTTTG------GGCTATTTTTCAAATGTACGGTTAAATCTTTCAGTGGTACGAAGTCAAATGCTAGAAAATTCATTTCTAATCGCAATTGTTATGAAAAAATTGGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGCAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTCTTGCGAATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTACTTTTTTGAAAAGATTGGGTTCAAAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTATTTTACACAGG------TTCTATAGAGGTCGGATTTGGTATTTGGATATTCTTTTCAGCAACGATCTAGTCAA---------------TTATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Templetonia_retusa ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACC------CACTTATATTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTT------GAATAGATCCAATTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTTTTAATGATTCTAAAAAAAA------TCCATTTTGGGGGTATAACAAGGATTTGTATTCTCAAATAATATCAAATGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCTTCTTTAGA------GGAGGCGAAAACCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTCTGTGTTAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGTCCCCTTCTTTCATTTATTAAGGTTCTTTCTTTATGAGTATT------GGAATTGCAA------------------TACTCTTATTACTCCAAACGAA---TCGATTTATACTTTTTCAAAAAGGAATCCAGGATTTTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGGAACAAATCCTCTCATTTACAATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACATCTTGTAGAAGTCTTTGATAAAGAATTTTCGTATACCTTA------TCATTCTTCCAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAATGTGCCCCTTTTCATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGACCCATATAAATCAATTCTCCGATCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTGGATACAATAATTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTCTTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAACGATTGGGTTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGATATTATTTCTTTGATCTTTCCA------AAAGCTTTTTCTATTTTACACAGG------TTCTATAGAGGTCGGATTTGGTATTTGGATATTCTTTTCAGCAACGATCGAGTCAA---------------TTATGAATGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Thermopsis_rhombifolia ATGGAGGAATATCAAGTATATTTAGAACTAGATATATCTCGCCAACAGGACTTCTTATACC------CACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATGGATCTATTTTTGCGGAAAATGCAGATTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTCATGATTCTAAAAAAAA------TCAATTTTGGGGTTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTAAGCTCCTCCTTAGA------GGGGGTAGAAATCATAAAATATTATAATAATTTGCGATCAATTCATTCTATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCGATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTTAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTATGAGTATT------GTAATTGGAA------------------TAGTCTTATTACTCCAAAAAAA---TCGATTTCTACTTTTTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTCTGTGAATACGAATCTATATTCCTTTTTCTACGTAACAAATCCTCGCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGATTTTGTAGAAGTCTTTGCTAAGGATTTTTCGTCTACCTTA------TCATTCTTCACAGATCCTTTCATTCATTATGTTAGATATCACGGAAAATCCATTTTGGCTTCAAAGAATGCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCAAAATAAACCAATTCTCCGAACATTCATTTCACCTTTGG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCGGCAGTACGGAGTCAAATGTTAGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCGATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTACGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAACTTCTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAGAGG------TTATATAGAGGTCGGATTTGGTATTTTGATATTATTTTCAGCAACGATCTGGTCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGTATGGAAACTTACCGAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGATAAAACAAA---------GAAAAGTGTTCATAAAGCGAGCA------TAAAGCGAGA-ATAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTAACG------ACATTTCCTTTCGCA----------------------------------------TTAAGGAAG-------------------------------------GGATCAAGGATAA---------------------------ACGTATATATATA--------------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATGAA----------GAC-TAAAATATCTATTTGTGAATATTT-----ATATCA--------------------CAAATGAAA-GATGTGAATCAAATCTCTT---CCAA----GTTGAAGAGAGAGAAAGAATTTAATATTCATTGATCAAATCATTGATTCCATCATAGTCTGA----------TCGATCTTTTGAAGAGCTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTATAGTAAGAGG?????????????????????????????? Ulex_europaeus ATGGAGGAATATCAAGTATATTTAGAACTAGATATATCTCGCCAACAGCACTTCCTATACC------CACTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTT------TAATGGATCTATTTTTTCGGAAAATGTAGATTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCGCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAAAAAAA------TCAATTTTGGGGTTATAATAAAAATTTGTATTCTCAAAAAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTAAACTCTTCCTCAGA------GGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCAAAAGATGTCCCTTTGTTTCACTTATTAAGGTTGTTTCTTTATGAATATT------------GGAA------------------TAATCTGATTACTCCAAAAAAA---TTGATTTCTACTTTTTCAAAAAGTCATCTAAGAGTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACATTTTGTAGAAGTCTTTGCTAAGGATTTTTTGTCTACCCTA------TCATTCTTCAAGGAGCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAATGCGTCTCTTTTGATGAATAAATGGAAAAACTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAACCAATTCTCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATCAGTAAGCCGCTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATATAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAATACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTAGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGGTATTTCAA------AGGGCTTCTTCTACTTTGCGGGCG------TTATATAGAGGTCGGATTTGGTATTTGGATATTATTTTCAGCAACGATTTGATCAA---------------TCATGAATGAAATTGGATTGA----GCCTTGGGATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTGACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGTAAAAACAAA---------GAAAAGT--TCAGAAAGAGAAAA------TAAAA------------AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAATTGACG------ACATTTCCTTTCGT------------------------------------CGAAATTGCGGAAA-------------------------------------GGATCAAGAATAA---------------------------ACTTATATACATATATA----------------------------------------CGTATATGTACTGAAATATTATTTCAATTGATTAATAAA----------GACTGAAAATCTCTATTT---------------------------------------------------------------------------------GTTGAAGG------AGGAATTGAATATTCATTGATCAAATCATTCATTCCATGAAAATCTGA----------TAGATCTTTTTAAGAGCTGATTAAGCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAC-AATGAAATTTAGAGTAAGAGG?????????????????????????????? ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M35544] TITLE Orphanodendron_ITS_94_taxa_Character_Matrix; LINK TAXA = Taxa3; DIMENSIONS NCHAR=773; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Ammodendron_conollyi_EF457705 TCGAATC--CACACA--GAGC-AGGGG-GACCC-GTGAATTCGTT-TGT-CCGCTTG----GGTGTGGCTCGAGG---TG-----CATGTCGCC-TCGGTCCCC----C-CG---GTGTCGGGAGGT-----GCCCA----CCTCGTGTGG-GCCCC---TCCGGGCCT-----G---TTAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCGAGATCGTCTGGCAAG---CCCGCGTCGGC-CCGC--ACGGTG-CCTACG--TGG-TGGCG--TCGTGACGT-GTGTA----------TCC-AAAAGACTCTCGGCAACGGATATCTCGGCTCT{CT}GCAT{CT}GATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGCCTCG----GCCCTGTT-----GCCAGGCGTGGCGAG-GGGG-CGAATGGTGGCCTCCCGCGAGCGA-AGCCTCACGGCTGGCTGAAAA-TCGAGCCCG--TGGTGG--AGGGCG--CCGCGATGGATGGTGGTT----GAGT------ACAAGCTCGAGACC--GATCGTGCGTGCCAC---CCCTACCAGGTTC---GGGACTCCT--CGACCCAC---GAGCGG-CT-GTCGGCCGC--CCACGACGG??????????????????????????????? Ammothamnus_lehmannii_EF457706 TCGAATC--CACACACCAAGC-AGTGC-GACCC-GTGAATCCGTT-TGT-CTACTTG----GGTGTGGCTTGAGG---TG-----CACTTCGCCCTCGGTCCCC----C-CG---GTGTCGGGAGGT-----GCCCA----CCTCGTGTGG-GCCCC---TCCGGGCCC-----G---TTAACAAAA-CCCCGGCGTCGAATGCGCCAAGGAA-ATCGAGACCGTCCAGCATG---CCCCCGTCGGC-CCGGAGACGGTG-CCCACG--TGG-TGGCG--TTGTGACAC-GTGTA----------TCC-AAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGCCTTG----GCCTTGTTT----GCTAGGCACGGCAAGAAGGGGCGAACGTTGGCTTCCCGCGAGCGA-TGCCTCACGGTTGGCTGAAAA-TCGAGCCCG--TGGTGG--AGTGCG--CCGCGACGGAAGGTGGTT----GAGC------AGAAGCTCGAGACC--GGTCGTGTGTGTCAC---CCCTACCCGATGT---GGGACTCTT--TGACCCAT---GGGTGG-CT-GTTGGCCGC--CCACGACGG??????????????????????????????? Anagyris_foetida_AF330637 TCGAAGC--CTAACA--AAGC-AGTGC-GACCC-GCGAATTTGTT-TGA-CTACTCA----GGGGAGGCCAGAGG---TG-----CTTGGCACC-TCGGTCCCC----TCTT---GTGTCGG-AGGT-----GCCCC---TCCTTGTGTGGGTCTCC---TCCTGGCCT-----A---ACAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCAAGATTGTCTAGTCCGT--C-CCCGTTGGCACCGGAGACGGTG-TCGGTG--CGGGCGGCG--TTGTGACAC-ACATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGACGCCATCAGGTCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCC-AATTCCTCA----GC-CTCGT-----GCTAGGCTTTGAGCG---GGGCGAATGTTGGCTTCCCGCGAGCAA-GGTCTCACGGTTGGTTGAAAAATTGAGTCCC--TGGTGG--AGGGCG--CCGCGATGGATGGTGGTT----GAGT------AGAAGCTCGAGACC--GATCGTGCGCGTCAC--TCG-TGCCGAATTT---GGGACCTTG--TGACCCAT---GGGCGT-CTTGTTGGTCGC--CCATGACGGG-A???????????????????????????? Baptisia_australis_AY091572 TCGAAGC--CTAACG--ACGC-AGTGC-GACCC-GCGAATTTGTT-TGA-CTACTAA----GGGGTGGCTAGTGG---TG-----TTCGGCACC-TCGGTCCCC----CATT---GTGTCAG-AGGA-----GCCCG---TCCTTGCGCGG-TCTCC---TCCTGGCCT-----T---ATAACAAAA-CCCCGGCGCCGAACGCGCCAAGGAA-ATCAATATTGTCTAGTGCGT--C-CCCGTTGGCACCGGAGACGGTG-CCGCTG--CGGGTGGCG--CTGTGACAC-GCATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCTCG----GC-CTTGT-----GCCAGGCTTCGAGCG--GGG-CGAATGTTGGCTTCCCGCGAGCTA-TGTCTCACGGTTGGTTGAAAA-TTGAGTCCG--TGGTGG--AGGGTG--CCGCGATGCATGGTGGTT----GAGT------AAAAGCTCGAGATC--GATCGTGCGCGTCAC--CCC-TATCGGATTT---GGGCCTCTG--TGACCCAT---GAGCGC-CT-GTTGGATGC--CCATGACGGG-AC??????????????????????????? Bolusanthus_speciosus_EF457708 CCGAAGC--CTCACG---AGC-AGCGC-GACCC-GCGAACTTGTT-TGA-CCACTCA----GGGGTGGCCGGAGG---TG-----TTCGGCACC-CCGGCCCCC----C-TC---GCGTCGGGAGGC-----GGCCA--TCCCTCGTGCGG-CCTCCCC-TCCCGGCCG-----A---ATAACAAAA-CCCCGGCGCTGGATGCGCCAAGGAA-ATCGAAATCGTTGAGTGCGC--CCCC-GTCGGC-CCGGAGACGGTG-CCCGTG--CGGGCGGCG--TCGCGACAC-ACGCGT--------ATCCAAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACG{CT}AGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCGGAGGGCACGCCTGCCTGGGTGTCGCGCATCGTTGC--CCCC-A-CGCCTTG----GC-CTCGT-----GCTAGGCATCGAGCG--GGG-CGAACGCTGGCTTCCCGCGAGCAA-CGTCTCACGGTTGGTTGGAAA-TCGAGTCCG--TGGCGG--GGGATG--CCGCGATGGATGGTGGTT----GAGT------CCGAGCTCGAGACC--GATCGTGCGGGTGTCA-CCCCTACCGTCCTC---GGGACTCCG--TGACCCAT---GAGCGCGCCCGTTGGTCGC--CCATGACGG??????????????????????????????? Bowdichia_nitida_JX124477 TCGAAGC--CTCACG---AGC-AGCGC-GACCC-GCGAATCCGTT-CGA--CGGCCG---GGGG--------------TG--------TGC----CCGGCCCC-----TCGCTC-GGGCTGGGGAGG----CGCCCG----CCTCGCGCG-GTCTCCT--CCTTGGCCGAGCAGAA-ACTAAAAAGAACCCCGGCGCCGAATGCGCCAAGGAA-TCCGAAATCGTTCTGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GCGAATGA----AAATCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACCAGGCTGAGGGCACGCCTGCCTGGGCGTCGCACATCGTTGC--CCCA-GATGCCCGT-GCCCCCCGCGCC----GAGGGGGGCACCCGGCGGGG-CGAGCGCTGGCCTCCCGTGAGGAA-CGCCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGCG---GGG-CGCACCGCGAGGGATGGTGGTT----GAGTG-----AG-AGCTCGAGACCA-G-TCGTGCGTGTCGG----CCCTCCGGCCTC---GGGACTCCG--TGACCC---ACGTGCGGCCGTGTTGGCCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Bowdichia_nitida_JX124478 TCGAAGC--CTCACG---AGC-AGCGC-GACCC-GCGAATCCGTT-CGA--CGGCCG---GGGG--------------TG--------TGC----CCGGCCCC-----TCGCTC-GGGCTGGGGAGG----CGCCCG----CCTCGCGCG-GTCTCCT--CCTTGGCCGAGCAGAA-ACTAAAAAGAACCCCGGCGCCGAATGCGCCAAGGAA-TCCGAAATCGTTCTGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GCGAATGA----AAATCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACCAGGCTGAGGGCACGCCTGCCTGGGCGTCGCACATCGTTGC--CCCA-GATGCCCGT-GCCCCCCGCGCC----GAGGGGGGCACCCGGCGGGG-CGAGCGCTGGCCTCCCGTGAGGAA-CGCCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGCG---GGG-CGCACCGCGA{AG}GGATGGTGGTT----GAGTG-----AG-AGCTCGAGACCA-G-TCGCGCGTGTCGGT---CCCTCCGGCCTC---GGGACTCCG--TGACCC---ACGTGCGGCCGTGTTGGCCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGC??? Bowdichia_nitida_JX124479 TCGAAGC--CTCACG---AGC-AGCGC-GACCC-GCGAATCCGTT-CGA--CGGCCG---GGGG--------------TG--------TGC----CCGGCCCC-----TCGCTC-GGGCTGGGGAGG----CGCCCG----CCTCGCGCG-GTCTCCT--CCTTGGCCGAGCAGAA-ACTAAAAAGAACCCCGGCGCCGAATGCGCCAAGGAA-TCCGAAATCGTTCTGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GCGAATGA----AAATCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACCAGGCTGAGGGCACGCCTGCCTGGGCGTCGCACATCGTTGC--CCCA-GATGCCCGT-GCCCCCCGCGCC----GAGGGGGGCACCCGGCGGGG-CGAGCGCTGGCCTCCCGTGAGGAA-CGCCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGCG---GGG-CGCACCGCGAAGGATGGTGGTT----GAGTG-----AG-AGCTCGAGACCA-G-TCGCGCGTGTCGGT---CCCTCCGGCCTC---GGGACTCCG--TGACCC---ACGTGCGGCCGTGTTGGCCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Bowdichia_virgilioides_EF457709 TCGAAGC--CTCACG---AGC-AGCGC-GACCC-GCGAATCCGTT-CGA--CGGCCG---GGGG--------------TG--------TGC----CCGGCCCC-----TCGCTC-GGGCTGGGGAGG----CGCCCG----CCTCGCGCG-GTCTCCT--CCTTGGCCGAGCAGAA-ACTAAAAAGAACCCCGGCGCCGAATGCGCCAAGGAA-TCCGAAATCGTTCTGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GCGAATGA----AAATCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACCAGGC{CT}GAGGGCACGCCTGCCTGGGCGTCGCACATCGTTGC--CCCA-GATGCCCGT-GCCCCCCGCGCC----GAGGGGGGCACCCGGCGGGG-CGAGCGCTGGCCTCCCGTGAGGAA-CGCCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGCG---GGC-CGCACCGCGAGGGATGGTGGTT----GAGTG-----AG-AGCTCGAGACCA-G-TCGTGCGTGTCGG----CCCTCCGGCCTC---GGGACTCCG--TGACCC---ACGTGCGGCCGTGTTGGCCGC--CCACAACGGG?????????????????????????????? Bowdichia_virgilioides_JX124475 TCGAAGC--CTCACG---AGC-AGCGC-GACCC-GCGAATCCGTT-CGA--CGGCCG---GGGG--------------TG--------TGC----CCGGCCCC-----TCGCTC-GGGCTGGGGAGG----CGCCCG----CCTCGCGCG-GTCTCCT--CCTTGGCCGAGCAGAA-ACTAAAAAGAACCCCGGCGCCGAATGCGCCAAGGAA-TCCGAAATCGTTCTGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GCGAATGA----AAATCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACCAGGCCGAGGGCACGCCTGCCTGGGCGTCGCACATCGTTGC--CCCG-GATGCCCGT-GCCCCCCGCGCC----GAGGGGGGCACCCGGCGGGG-CGAGCGCTGGCCTCCCGTGAGGAA-CGCCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGCG---GGG-CGCACCGCGAGGGATGGTGGTT----GAGTG-----AG-AGCTCGAGACCA-G-TCGTGCGTGTCGG----CCCTCCGGCCTC---GGGACTCCG--TGACCC---ACGTGCGGCCGTGTTGGCCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Bowdichia_virgilioides_JX124476 TCGTAGC--CTCACG---AGC-AGCGC-GACCC-GCGAATCCGTT-CGA--CGGCCG---GGGG--------------TG--------TGC----CCGGCCCC-----TCGCTC-GGGCTGGGGAGG----CGCCCG----CCTCGCGCG-GTCTCCT--CCTTGGCCGAGCAGAA-ACTAAAAAGAACCCCGGCGCCGAATGCGCCAAGGAA-TCCGAAATCGTTCTGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GCGAATGA----AAATCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACCAGGCTGAGGGCACGCCTGCCTGGGCGTCGCACATCGTTGC--CCCA-GATGCCCGT-GCCCCCCGCGCC----GAGGGGGGCACCCGGCGGGG-CGAGCGCTGGCCTCCCGTGAGGAA-CGCCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGCG---GGG-CGCACCGCGAAGGATGGTGGTT----GAGTG-----AG-AGCTCGAGACCA-G-TCGTGCGTGTCGG----CCCTCCGGCCTC---GGGACTCCG--TGACCC---ACGTGCGGCCGTGTTGGCCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Brongniartia_magnibracteata_AF287638 TCGATGC--CTCACA---TGC-AGTGC-GACTC-GCGAATTTGTT-TGA-CTTGATT----GGGGCGGCCAGGGG---TGC----TC-GACGCC-TCGTCCCCC----CCG----GTGCTGGGAGGC-----GCTTG----CCTAGTGCGG-TCTCCT--CCC-GGCCGA---AA---ACATCCAAA-CCCCGGCGCCGAATGCGCCAAGGAA-CAAGAAATCGTTCGGTTACG--CCCCTGTCGGC-CCGAAGACGGTG-CCTGTG---CGGGGGCG--TTGCGACA-CGCGAATT----GTAATCCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCC--ATTCTCGGT----GC-CTCGTT----GC-AGGCGCCG---GGCGTGGCGAATGCTGGCTTCCCGGGAGCAC-CGTCTCGCGGTTGGCTGAAAG-TCGAGCCCG--TGGTGG--AGTGCA--CCGCGACGGATGGTGGTT----GAGGT-----AA--ACTCGAGACC--AGTCGCGCGCGTCGG---CCTCCC-TATCTC---GGGACTCTG--TGACCCAC---GAGCGG--CATCCGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGG-CTACCCGT--G Cadia_purpurea_EF457710 TCGAAGC--CTCAC---GAGC-AGAGC-GACCC-GCGAATACGTT-TGA-CTACTCG----GGGGCGGCTAGAGG---CGTG---TTCCACACC-TCGGTCCCC----C-TT---GTGTCGGGAGGC-----GCCGC---TGCACGGCCGT-G-TCG---TCCTGACC-G----A---ATAACAAAA-CCCCGGCGCCGAACGCGCCAAGGAA-ATCGAAATCGTTTAGTGCGC--CACCCGTCGGC-TCGGGGACGGTG-CTCGTG--CGGGTGGTG--TCGCGACAC-TAGTATC------TATCCAAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCGGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCC-CGCGCCTTG----GC-CTCGT-----GCTAGGCGCTGAGCG--GGG-TGAATGTTGGCTTCCCGCGAGCAA-AGCCTCGCGGTTGGTTGAAAGTTTGAGTCCG--AGGTGG--AGGGCG--CCGCGATGGATGGTGGTT----GAGT------AAATTCTCGAGACC--GATCGTGTGTGACAC--CCC-CACTGGGTTT---GGGACTTTG--TGACCCGT---GAGCGC-CC-ATTGGCCGC--GCATGACGG??????????????????????????????? Camoensia_brevicalyx_KT718820 TCGA{AG}GC--CTCAC{AC}---AGC-AGTGC-GACCC-GTGAATCTGTT-TGA-TC{GT}CTCG---GGGGGCGTCCCGTGG---TGC-----TCGGCGCC-TCGG--------GTCCCCTCGTGCCGGGAGG----GTCCCCAC----CTCGTGTG-GCCGCC---TCTCGGACGAACAAC---------AAAACCCCGGCGCCAGATGCGCCAAGGAA-CTCGGAACCGTTAGGCGCG---CCCCCGTCGGC-CCGGACACGGTG-CCCGTGCGAGGGCGGCG--CGACGACGC-GTGA--------AAATCCATAACGACTCT{CT}GGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTCT---CCCCA-ACGCCTTG---GGCTCGTGCC-----CGGGGC--AACGTGCGGGG-TGAATGCTGGCTTCCCGTGAGCGC-TGCCTCGCGGTTGGTTGAAAAGCGGAGTCCG--TGGCGG--AGGGCGTGCCGCGATGGATGGTGGTT----GAGCCGAAGAGAGAGCTCGAGGCC--GATCGCGTGCGTGTGATCCCCCACCCGGTCT---GGGACTCCG--TGACCCCA--CGTGTGCGCCCGTCGGTCGC--CCACAGCGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Camoensia_scandens_KT718821 TCGAAGC--CTCACA---AGC-AGTGC-GACCC-GTGAATCTGTT-TGA-TCTCTCG---GGGGGCGTCCCGTGG---TGC-----TCGGCGCC-TCGG--------CTCCCCTCGTGCCGGGAGG----GT{CG}CCCA------------------CC---TCCCGGACGAACAAC---------AAAACCCCGGCGCCAGATGCGCCAAGGAA-CTCGGAATCGTTAGGCGCG---CCCTCGTCGGC-CCGGACACGGTG-CTCGTGCGAGGGCGACG--CGACGACGC-TCGA--------AAATCCATAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTCT---CCCCA-ATGCCTTG---GGCTCTTGCC------TGGGC--AACGTGCGGGG-TGAATGCTGGCTTCCCGTGAGCGC-TGCCTCACGGTTGGTTGAAAAGCGGAGTCCG--TGGCGG--AGGGCGTGCTGCGATCGATGGTGGTT----GAGCTGAAGAGAGAGCTCGAGGCC--GATCGCGTGCGTGTGATCGCCCACCCGGTTT---GGGACTCCG--TGACCCTA--CGTGTGCACCTGTCGGTCGC--CCACAGCGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Camoensia_scandens_KT718822 ???????--??????---?????????-?????-???????????-???-???????---???????????????---??-----??????????????????-----???????????????????-----?????------------------??---???????????????---------?????????????????????????????-?????????????????????-????????????????????????-??????--?????????--?????????-????----------????????????????????????????????????????????????????????????????????????????????????????????????????????????????ACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTCT---CCCCA-ATGCCTTG---GGCTCTTGCC------TGGGC--AACGTGCGGGG-TGAATGCTGGCTTCCCGTGAGCGC-TGCCTCACGGTTGGTTGAAAAGCGGAGTCCG--TGGCGG--AGGGCGTGCTGCGATCGATGGTGGTT----GAGCTGAAGAGAGAGCTCGAGGCC--GATCGCGTGCGTGTGATCGCCCACCCGGTTT---GGGACTCCG--TGACCCTA--CGTGTGCACCTGTCGGTCGC--CCACAGCGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Cyclolobium_brasiliense_AF287637 ???????--????????????-?????-?????-???????????-???-???????----??????????????---???----????????C-TCGGCCCCC----CCG----GTCTTGGGGGGA-----GCCCG----CCTCGCGCGG-TCTCCG--CCC-GGCTCG---AA---ACAACCAAA-CCCCGGCGCCAGACGCGCCAAGGAA-CTAGAAATCGTTCGGTGCGC--CCCCTCTCGGC-CCG{AG}AGACGGTG-CCTGTG---CGGGGGCG--TCGCGACA-CGCGAA------GAAATCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACGTCGTTGC--CCAC-A{AG}AGACGGT----GC-CTCATC----GC-GGGCGCCG---GTCGGGGCGAAGGTTGGCTTCCCGGGAGCAT-CGTCTCGCGGTTGGCTGAAAG-TCGAGCCCG--CGGCGG--AGAGCGCATCGCGACGGATGGTGGTT----GAGGA-----AAA-TCCCGAGACC--GGTCGT-TGTGTCGC---CTTCCC-CGCTGCTTCGGGACTCTG--TGACCCAG---GG?CGT--CCGTCGGTCGC--CCACAACGGG-ACCTCAG?????????????????????? Cyclolobium_nutans_AF467041 TCGAAGC--CTGCCG---AGC-AGCGC-GACAC-GCGAACTCGTT-TGA-CTCT-TG----GGGGTGGCCGGGGC---TGC----T-------C-TCGGCCCCC----CGG----TGCCTGGGGGGA------CCCG----CCTCGCGCGG-TCTCCG--CCC-GGC------AA---ACAACCAA--CCCCGGCGCCAGACGCGCCAAGGAA-CTAGAAATCGTTCGGCGCGC--CCCC-CTCGGC-CCGGAGACGGTG-CCTGCG---CGGGGGCG--TCGCGACA-CGCGA-----------TCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCGCACGTCGTTGC--CCA--AAAGACGGT----GC-CTCATC----GC-GGGCGCCG---GTCGGGGCGAAGGTTGGCTTCCCGGGAGCAT-CGTCTCGCGGTTGGCTGAAAG-TCGAGCCCG--CGGCGG--AGAGCG--TCGCGACGGATGGTGGTT----GAGGA-----A---TCCCGAGACC--GGTCGT-TGTGTCGC---CTTCCC-TGCTTC----GGACTCTG--TGACCCAG---GGGCGG--C-GTCGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGG????????????? Dicraeopetalum_mahafaliense_EF457716 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GTGAACTCGTT-TGA-CCACTCA----GGGGTGGCCAGAGG---TG-----CTCGGCGCC-TCGGCCCCC----C-TC---GCGTCGGGAGGC-----GCCCG--CGCTCTGTGCGA-CCTCC---TCCCGACCG-----A---ATAACAAAA-CCCCGGCGCTGGATGCGCCAAGGAA-ATCGAAATCGTTCACTGCGC--CCCC-GTCGGC-CCGGAGACGGTG-CTCGTG--CGGGCGGCG--TCGCGACAC-GCGCGT--------ATCGAAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCGCATCGTTGC--CCC--AACGCCCTG----GC-CTCGT-----GCCGGGCATCGGGCG--GGG-CGAATGTTGGCTTCCCGCGAGCAA-CGTCTCACGGTTGGTTGAAAA-TCGAGTCCG--TGGTGG--AGGATG--CCGCGATGGATGGTGGTT----GAGT------TTAAGCTCGAGGCC--GATCGTGCGCGTCAC--CCCCCACCGTGTAC---GGGACTCCG--TGACCCAT---GAGCGT--CCGTTGGTCGC--CCATGACGG??????????????????????????????? Diplotropis_aff__JX124487 TCGAAGCCTCTCACA---AGC-AATGC-GACCC-GCGAACCTGTC-TGG-CTATCCG---GGGG-CGTCAAGGGG---TG-----TTCTGCACC-TTGGCCCC-----TCGCTC-GTGCCGGGAAGGG---CACCTG----CCTCGCGCG-GACTCC---TCCTGGCCGAGCAAA------CCTGAAACCCCGGCGCCGAATGCGCCAAGGAA-ATCGAAATCGTTTAGCGCGCC---CCCGTCGGC-CCGGAGACGGTG-CAGGTG--CGGGCGGCGCGTCGCGACGC-GCGA----------ATCCAATATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGCCGGT---GCCTCGCGCT----GAGGGGGCCATCGAGCGGGG-CGAGCGTTGGCTTCCCGTGAGCGT-CGTCTCGCGGTTGGTCGAAAA-TCGAGCCCG--TGGTG--TGGAGCGCACCGCGATAGACGGTGGTT----GAGCA-----AAGG-CTCGAGACCA-G-TCGTGCGTGTCA----GCCCACCGGCCTC---GGGACTCTG--TTACCC---ACGAGCGCCG--ATAGGTCGC--CCATAACGGG-ACCTCAGGTCAGGCGGGGCCACCCGCTGA Diplotropis_ferruginea_JX124482 TCGAAGCCTCTCACA---AGC-AATGC-GACCC-GCGAACCTGTC-TGG-CTATCCG---GGGG-CGTCAAGGGG---TG-----TTCTGCACC-TTGGCCCC-----TCGCTC-GTGCCGGGAAGGG---CACCTG----CCTCGCGCG-GACTCC---TCCTGGCCGAGCAA-------CCTGAAACCCCGGCGCCGAATGCGCCAAGGAA-ATCGAAATCGTTTAGCGCGCC---CCCGTCGGC-CCGGAGACGGTG-CAGGTG--CGGGCGGCGCGTCGCGACGC-GCGA----------ATCCAATATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGCCGGT---GCCTCGCGCT----GAGGGG-CCATCGAGCGGGG-CGAGCGTTGGCTTCCCGTGAGCGT-CGTCTCGCGGTTGGTCGAAAA-TCGAGCCCG--TGGTG--TGGAGCGCACCGCGATAGACGGTGGTT----GAGCA-----AAGG-CTCGAGACCA-G-TCGTGCGTGTCA----GCCCACCGGCCTC---GGGACTCTG--TTACCC---ACGAGCGCCG--ATAGGTCGC--CCATAACGGG-ACCTCAGGTCAGGCGGGGCCACCCGCTGA Diplotropis_incexis_JX124480 TCGAAGCCTCTCACA---AGC-AATGC-GACCC-GCGAACCTGTC-TGG-CTATCCG---GGGG-CGTCAAGGGG---TG-----TTCTGCACC-TTGGCCCC-----TCGCTC-GTGCCGGGAAGGG---CACCTG----CCTCGCGCG-GACTCC---TCCTGGCCGAGCAA-------CCTGAAACCCCGGCGCCGAATGCGCCAAGGAA-ATCGAAATCGTTTAGCGCGCC---CCCGTCGGC-CCGGAGACGGTG-CAGGTG--CGGGCGGCGCGTCGCGACGC-GCGA----------ATCCAATATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGCCGGT---GCCTCGCGCT----GAGGGGGCCATCGAGCGGGG-CGAGCGTTGGCTTCCCGTGAGCGT-CGTCTCGCGGTTGGTCGAAAA-TCGAGCCCG--TGGTG--TGGAGCGCACCGCGATAGACGGTGGTT----GAGCA-----AAGG-CTCGAGACCA-G-TCGTGCGTGTCA----GCCCACCGGCCTC---GGGACTCTG--TTACCC---ACGAGCGCCG--ATAGGTCGC--CCATAACGGG-ACCTCAGGTCAGGCGGGGCCACCCGCTGA Diplotropis_incexis_JX124485 TCGAAGCCTCTCACA---AGC-AATGC-GACCC-GCGAACCTGTC-TGG-CTATCCG---GGGG-CGTCAAGGGG---TG-----TTCTGCACC-TTGGCCCC-----TCGCTC-GTGCCGGGAAGGG---CACCTG----CCTCGCGCG-GACTCC---TCCTGGCCGAGCAA-------CCTGAAACCCCGGCGCCGAATGCGCCAAGGAA-ATCGAAATCGTTTAGCGCGCC---CCCGTCGGC-CCGGAGACGGTG-CAGGTG--CGGGCGGCGCGTCGCGACGC-GCGA----------ATCCAATATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGCCGGT---GCCTCGCGCT----GAGGGG-CCATCGAGCGGGG-CGAGCGTTGGCTTCCCGTGAGCGT-CGTCTCGCGGTTGGTCGAAAA-TCGAGCCCG--TGGTG--TGGAGCGCACCGCGATAGACGGTGGTT----GAGCA-----AAGG-CTCGAGACCA-G-TCGTGCGTGTCA----GCCCACCGGCCTC---GGGACTCTG--TTACCC---ACGAGCGCCG--ATAGGTCGC--CCATAACGGG-ACCTCAGGTCAGGCGGGGCCACCCGCTGA Diplotropis_incexis_JX124486 TCGAAGCCTCTCACA---AGC-AATGC-GACCC-GCGAACCTGTC-TGG-CTATCCG---GGGG-CGTCAAGGGG---TG-----TTCTGCACC-TTGGCCCC-----TCGCTC-GTGCCGGGAAGGG---CACCTG----CCTCGCGCG-GACTCC---TCCTGGCCGAGCAA-------CCTGAAACCCCGGCGCCGAATGCGCCAAGGAA-ATCGAAATCGTTTAGCGCGCC---CCCGTCGGC-CCGGAGACGGTG-CAGGTG--CGGGCGGCGCGTCGCGACGC-GCGA----------ATCCAATATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGCCGGT---GCCTCGCGCT----GAGGGG-CCATCGAGCGGGG-CGAGCGTTGGCTTCCCGTGAGCGT-CGTCTCGCGGTTGGTCGAAAA-TCGAGCCCG--TGGTG--TGGAGCGCACCGCGATAGACGGTGGTT----GAGCA-----AAGG-CTCGAGACCA-G-TCGTGCGTGTCA----GCCCACCGGCCTC---GGGACTCTG--TTACCC---ACGAGCGCCG--ATAGGTCGC--CCATAACGGG-ACCTCAGGTCAGGCGGGGCCACCCGCTGA Diplotropis_martiusii_AY553711 CCGAAGCCTCTCACA---AGC-AACGC-GACTC-GTGAATCTGTT-TGA-CTGCCTG---GGGG-CGTCAGGGGG---TG-----TTCTGCACC-ATGGCCCC-----TCGCTC-GTGCTGGGAGG-----CACCCG----CCTCGCGCG-GACTCC---TCCTGGCCGAGCAAC------TTGAAAACCCCGGCGCCGAATGCGCCAAGGAA-ATCGAAATCGTTTAGCGCGCC---CACGTCGGC-CCGGAGACGGTG-CGGGTG----------GCGC-GT----C-GCGA----------ATCCAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATTGTTGC--CCCA--ATGCCGGT---GCCTCGCGCT----GAGGGG-GCATCGAGCGGGG-CGAGCGTTGGCTTCCCGTGAGCGT-CGTCTCGCGGTTGGTTGAAAAATCGAGCCCG--TGGTG--CGGAGCGCACCGCGATAGACGGTGGTT----GAGCA-----AAAAGCTCGAGACCA-G-TCGTGCGTGTCA----GCCCACCGACCTC---GGGACTCTG--TTACCC---ACGAGCGCCG--ATTGGTCGCGCCCTTA??????????????????????????????????? Diplotropis_martiusii_JX124481 CTGAAGC-TCTCACA---AGC-AACGC-GACTC-GTGAATCTGTT-GGA-CTGCCGG---GGGG-CGTCAGGGGG---TG-----TTCTGCACC-ATGGCCCC-----TCGCTC-GTGCTGGGAGG-----CACCCG----CCTCGCGCG-GATTCT---TCTTGGCCGAGCAAC------TTGAAAACCCCGGCGCCGAATGCGCCAAGGAA-ATCGAAATCGTTTAGCGCGCC---CACGTCGCC-CCGGAGACGGTG-CGGGTG----------GCGCTGT----C-GCGA----------ATCCAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCC?GAAGCCATTAGGCTGAGGGCACCCCTGCCTGGGTGTCGCACATTGTTGC--CCCA--ATGCCGGT---GCCTCGCGCT----GAGGGG-GCATCGAGCGGGG-CGAGCGTTGGCTTCCCGTGAGCGT-CGTCTCGCGGTTGGTTGAAAAATCGAGCCCG--TGGTG--CGGAGCGCACCGCGATAGACGGTGGTT----GAGCA-----AAAAGCTCGAGACCA-G-TCGTGCGTGTCA----GCCCACCGACCTC---GGGACTCTG--TTACCC---ACGAGCGCCG--ATTGGTCGCGCCCTTAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Diplotropis_martiusii_JX124484 CCGAAGCCTCTCACA---AGC-AACGC-GACTC-GTGAATCTGTT-TGA-CTGCCTG---GGGG-CGTCAGGGGG---TG-----TTCTGCACC-ATGGCCCC-----TCGCTC-GTGCTGGGAGG-----CACCCG----CCTCGCGCG-GACTCC---TCCTGGCCGAGCAAC------TTGAAAACCCCGGCGCCGAATGCGCCAAGGAA-ATCGAAATCGTTTAGCGCGCC---CACGTCGGC-CCGGAGACGGTG-CGGGTG----------GCGC-GT----C-GCGA----------ATCCAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATTGTTGC--CCCA--ATGCCGGT---GCCTCGCGCT----GAGGGG-GCATCGAGCGGGG-CGAGCGTTGGCTTCCCGTGAGCGT-CGTCTCGCGGTTGGTTGAAAAATCGAGCCCG--TGGTG--CGGAGCGCACCGCGATAGACGGTGGTT----GAGCA-----AAAAGCTCGAGACCA-G-TCGTGCGTGTCA----GCCCACCGACCTC---GGGACTCTG--TTACCC---ACGAGCGCCG--ATTGGTCGCGCCCTTAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Diplotropis_martiusii_JX124506 ???????--??????---???-?????-?????-???????????-???-??????G---GGGG-CGTCAAGGGG---TG-----TTCTGCACC-TTGGCCCC-----TCGCTC-GTGCTGGGAAGG----CACCCG----CCTTGCGCG-AACTCC---TCCTGGCCGAGCAA-------CCTGAAACCCCGGCGCCGAATGCGCCAAGGAA-ATCGAAATCGTTTAGCGCGCC---CCCGTCGGCACCGGAGACGGTG-CAGGCG--CGGGTGGCGCGTCGCGACGC-GCGA----------ATCCAATATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGTCGGT---GCCTCGCGCT----GAGGGG--CATCGAGCGGGG-CGAGCGTTGGCTTCCCGTGAGCGT-CGTCTCGCGGTTGGCCGAAAA-TTGAGCCCG--TGGTGCGTGGAGCGCACGGCGACAGACGGTGGTT----GAGCA-----AAG--CTCGAGACCA-G-TCGTGCGTGTCA----GCCCACCGGCCTC---GGGACTCTG--TTACCC---AC-AGCGCCG--ATTGGTCGC--CCATAACGGG-ACCTCAGGTCAGGCGGGGCCACCCG???? Diplotropis_purpurea_JX124507 TCGAAGCCTCTCACA---AGC-AATGC-GACCA-GCGAATCTGTC-CGA-CTATCCG---GGGG-CGTCAAGGGG---TG-----TTCTGCACC-TTGGCCCC-----TCGCTC-GTGCTGGGGAGG----CACCTG----CCTCGCGCGGAATCCC---TCCTGGCCGAGCAA-------CCCGAAACCCCGGCGCCGAATGCGCCAAGGAA-ATCGAAATCGTTTAGCGCGCC---CCCGTCGGC-CCGGAGACGGTG-CAGGTG--CGGGCGGCGCGTCGCGACGC-GCGA----------ATCCAATATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGTCGGT---GCCTCGCGCT----GAGGGG-GCATCGACCGGGG-CGAGCGTTGGCTTCCCGTGAGCGT-CGTCTCGCGGTTGGTCGAAAA-TCGAGCCCG--TGGTG--TGGGGCGCACCGCGATAGACGGTGGTT----GAGCA-----AAG--CTCGAGACCA-G-TCGTGCGTGTCA----GCCCACCGGCCTC---GGGACTCTG--TTACCC---ACGAGCGCCG--ATTGGTCGC--CCATAACGGG-ACCTCAGGTCAGGCGGGGCCACCCGCTGA Diplotropis_triloba_JX124483 TCGAAGCCTCTCACA---AGC-AATGC-GACCC-GCGAATCTGTT-TGA-CTACCCG---GGGG-CGTCAAGGGG---TG-----TTCTGCACC-TTGGCCCC-----TCGCTC-GTGCTGGGAAGG----CACCCG----ACTTGCGCG-AACTCC---TCCTGGCCGAGCAA-------CCTGAAACCCCGGCGCCGAATGCGCCAAGGAA-ATCGAAATCGTTTAGCGCGCC---CCCGTCGGCACCGGAGACGGTG-CAGGCG--CGGGTGGCGCGTCGCGACGC-GCGA----------ATCCAATATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGTCGGT---GCCTCGCGCT----GAGGGG--CATCGAGCGGGG-CGAGCGTTGGCTTCCCGTGAGCGT-CGTCTCGCGGTTGGTCGAAAA-TCGAGCCCG--TGGTGCGTGGAGCGCACGGCGACAGACGGTGGTT----GAGCA-----AAG--CTCGAGACCA-G-TCGTGCGTGTCA----GCCCACCGGCCTC---GGGACTCTG--TTACCC---AC-AGCGCCG--ATTGGTCGC--CCATAACGGG-ACCTCAGGTCAGGCGGGGCCACCCGCTGA Genista_monspessulana_JF338495 TCGAAGC--CTCACA---AGC-AGTGC-GACCC-GTGAATTTGTT-TGA-CTACTCA----GGGGTGGCTAGAGG---TG-----TTTTGCACC-TCGGCCCCC----C-TC---GTGTCGGGAGGT-----GCTCC---ACTTCGTGTGG-TCTCC---TCTCGGCCT-----A---ATAACAAA--CCCCGGCGCCGAACGCGCCAAGGAA-ATTGAAATCGTTTAGTGCTC--C-CCCGTCGGC-CCGGAGACGGTG-CC--TG--CGGGTGGCG--TCACGACAC-GCGTA----------TCCAAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGC--CCT---GTGCCTTG----GC-CACGT-----GCTAGGCACCGA--GCGGGG-CGAATGTTGGCTTCCCGCGAGTAG-CGTCTCACGGTTGGTTGAAAA-CTGAGTCCG--CGGTGG--AGGGCA--CCGTGATGGATGGTGGCT----GAGT------TAAAGCTCGAGACC--GATCGTGTGTGTCAC--CTC-CACCAGCTTT---GCGACTCTG--TGACCCAT---GGGGGT-CT-GTTGACCGC--CCAAGACGGG-A???????????????????????????? Guianodendron_praeclarum_JX124488 TCGATGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-TGA-TCGCCCG---GGGGGCGCCCTGGGG---TG-----CCTGGCACC-TCGGCCCCC----TCGCTC-GTGCAGGGAAGG----CGCCCG----CCTGGCGCG-GTCTCC---TCCTTGCCGGGCAAC------CTAAAAACCCCGGCGCCGAACGCGCCAAGGAG-CTCGAAATCGTTTAGTGCGCC---CCCGTCGGC-CCGGAGACGGTGCCTCGCG--CGGGTG--GCGTCGCGACAC-GCGA----------ATCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGCTAGGCTGAGGGCACGCCTGCCTGGGCGTCGCGCATCGTTGC--CCCA--ATGCCGGT---GCCCAGCGCT----GAGGGG--CGCCGGGCGGGG-CGAGCGTTGGCTTCCCGCGAGCAT-CGCCTCGCGGTTGGTCGAAAA-TTGAGTCCG--TGGTG----GAGCGCACCGCGATAGATGGTGGTT----GAGTA-----AGA-GCTCGAGACCA-G-TCGCGCGTGCTAA---GCCCACCGGCCTC---GGGACTCCG--TGACCC---ACGAGCGCCT--ATTGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Guianodendron_praeclarum_JX124489 TCGATGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-TGA-TCGCCCG---GGGGGCGCCCTGGGG---TG-----CCTGGCACC-TCGGCCCCC----TCGCTC-GTGCAGGGAAGG----CGCCCG----CCTGGCGCG-GTCTCC---TCCTTGCCGGGCAAC------CTAAAAACCCCGGCGCCGAACGCGCCAAGGAG-CTCGAAATCGTTTAGTGCGCC---CCCGCCGGC-CCGGAGACGGTGCCTCGCG--CGGGTG--GCGTCGCGACAC-GCGA----------ATCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGCTAGGCTGAGGGCACGCCTGCCTGGGCGTCGCGCATCGTTGC--CCCA--ATGCCGGT---GCCCAGCGCT----GAGGGG--CGCCGGGCGGGG-CGAGCGTTGGCTTCCCGCGAGCAT-CGCCTCGCGGTTGGTCGAAAA-TTGAGTCCG--CGGTG----GAGCGCACCGCGATAGATGGTGGTT----GAGTA-----AGA-GCTCGAGACCA-G-TCGCGCGTGCTA----GCCCACCGGCCTC---GGGACTCCG--TGACCC---ACGAGCGCCT--ATTGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Hovea_elliptica_AF287640 TCGAAGC--CTCACA---AGC-AGTGC-GACTC-GCGAATTTGTT-TGA-CTTGATT----GGGGCGGGCAGGGG---TGC----TC-GACGCC-TCGGCCCCC----CCTCCCCGGTCTGGGAGGA-----GCCCG----CCTAGTGCGG-TCTCCG--GCC-GGCCGA---AA---ACAACCAAA-CCCCGGCGCCAAATGCGCCAAGGAA-CTAGAAATTGTTCGGTGCG---CCCCCGTCGGC-CCGGAGACGGTG-CTCGTG---CGGGGGCG--TCGCGACA-CGCGAATT----AAAATCCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCC--ATTCCCGGT----GC-CTCGTC----GC-AGGCGCCG---GGCGTGGCGAATGCTGGCTTCCCGGGAGCAC-CGTCTCGCGGTTGGCTGAAAG-TCGGGCCCG--TGGTGG--AGTGCA--CCGCGACGGATGGTGGAT----GAGGG-----AA--ACTCGAGACC--AGTCGCGCGCGT-GG---CCTCCC-CTTTTC---GGCACTCTG--TGACCCAC---GAGCGG--CATTCGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCT-G Leptolobium_bijugum_JX124490 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-TGA-CCGCCCG---GGGG--------------TG-----CCCGGCACG-CCGGCCCC-----TCGCTC-GGGCTGGGAAGG----CGCCCG----CCTCGTGCG-GTCTCCC--TCCCGGCCGAGCAAA--CCCAAAAA-AACCCCGGCGCCGAATGCGCCAAGGAA-TACGAAATCGTTCCGTGCGCC---CCCGTCGGCACCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGACGC-GCGAAT------AAATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCTGAGGGCACGCCTGCCTGGGCGTCGCACATCGTTGC--CCCA-AATGCCCGT---GCCTCGCGCT----GAGGGGG-CGACGGGCGGGG-CGAGCGTTGGCCTCCCGTGAGGAA-CGTCTCGCGGCTGGCCGAAAA-TCGAGTCCG--TGGTG---GAG-CGCACCGCGAAGGATGGTGGCT----GAGTG-----AT-GGCTCGAGACCA-G-TCGTGCGTGTCAG----CCCACCGGCCTC---GGGACTCCG--TGACCC---ACGAGCGACCGTGTCGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_bijugum_JX124491 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-TGA-CCGCCCG---GGGG--------------TG-----CCCGGCACG-CCGGCCCC-----TCGCTC-GGGCTGGGAAGG----CGCCCG----CCTCGTGCG-GTCTCCC--TCCCGGCCGAGCAAA--CCCAAAAA-AACCCCGGCGCCGAATGCGCCAAGGAA-TACGAAATCGTTCCGTGCGCC---CCCGTCGGCACCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGACGC-GCGAAT------AAATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCTGAGGGCACGCCTGCCTGGGCGTCGCACATCGTTGC--CCCA-AATGCCCGT---GCCTCGCGCT----GAGGGGG-CGACGGGCGGGG-CGAGCGTTGGCCTCCCGTGAGGAA-CGTCTCGCGGCTGGCCGAAAA-TCGAGTCCG--TGGTG---GAG-CGCACCGCGAAGGATGGTGGCT----GAGTG-----AT-GGCTCGAGACCA-G-TCGTGCGTGTCAG----CCCACCGGCCTC---GGGACTCCG--TGACCC---ACGAGCGACCGTGTCGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_bijugum_JX124492 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-TGA-CCGCCCG---GGGG--------------TG-----CCCGGCACG-CCGGCCCC-----TCGCTC-GGGCTGGGAAGG----CGCCCG----CCTCGTGCG-GTCTCCC--TCCCGGCCGAGCAAA--CCCAAAAA-AACCCCGGCGCCGAATGCGCCAAGGAA-TACGAAATCGTTCCGTGCGCC---CCCGTCGGCACCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGACGC-GCGAAT------AAATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCTGAGGGCACGCCTGCCTGGGCGTCGCACATCGTTGC--CCCA-AATGCCCGT---GCCTCGCGCT----GAGGGGG-CGACGGGCGGGG-CGAGCGTTGGCCTCCCGTGAGGAA-CGTCTCGCGGCTGGCCGAAAA-TCGAGTCCG--TGGTG---GAG-CGCACCGCGAAGGATGGTGGCT----GAGTG-----AT-GGCTCGAGACCA-G-TCGTGCGTGTCAG----CCCACCGGCCTC---GGGACTCCG--TGACCC---ACGAGCGGCCGTGTCGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_brachystachyum_JX124493 TCGGAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-CGA-ACGCCCG---GGGG--------------TG-----CCCGGCGCC-TCGGCCCC-----TCGCTC-GGGCTGGGAAGG----TGCCCG----CCTCGCGCG-GTCTCC---TCCTGGCCGAGCAAAA-CCTAAAAA-AACCCCGGCGCCGAATGCGCCAAGGAAATCCGAAATCGTTCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGACGC-GCGAAT------AAATCTAGAATGACTCCCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCCGT---GCCTCGCGCT----GAGGGGG-CGACGGGCGGGG-CGAGCGTTGGCCTCCCGTGAGGAA-CGTCTCGCGGCTGGCCGAAAA-TCGAGTCCG--TGGTG---GAG-CGCACCGCGAGGGATGGTGGTT----GAGTA-----AT-GGCTCGAGACCA-G-TCGTGCGTGTCAG----CCCACCGGCCTC---GGGACTCCG--TGACCC---ACGAGCGACCGTGTCGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_brachystachyum_JX124494 TCGGAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-CGA-ACGCCCG---GGGG--------------TG-----CCCGGCGCC-TCGGCCCC-----TCGCTC-GGGCTGGGAAGG----TGCCCG----CCTCGCGCG-GTCTCC---TCCTGGCCGAGCAAAA-CCTAAAAA-AACCCCGGCGCCGAATGCGCCAAGGAAATCCGAAATCGTTCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGACGC-GCGAAT------AAATCTAGAATGACTCCCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCCGT---GCCTCGCGCT----GAGGGGG-CGACGGGCGGGG-CGAGCGTTGGCCTCCCGTGAGGAA-CGTCTCGCGGCTGGCCGAAAA-TCGAGTCCG--TGGTG---GAG-CGCACCGCGAGGGATGGTGGTT----GAGTA-----AT-GGCTCGAGACCA-G-TCGTGCGTGTCAG----CCCACCGGCCTC---GGGACTCCG--TGACCC---ACGAGCGACCGTGTCGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_brachystachyum_JX124495 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-CGA-ACGCCCG---GGGG--------------CG-----CCCGGCGCC-TCGGCCCC-----TCGCTC-GGGCTGGGAAGG----TGCCCG----CCTCGCGCG-GTCTTC---TCCTGGCCGAGCAAA--CCTAAAAA-AACCCCGGCGCCGAATGCGCCAAGGAAATCCGAAATCGTTCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGACGC-GCGAAT------AAATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCCGTCGTGCCTCGCGCT----GAGGGGG-CGACGGGCGGGG-CGAGCGTTGGCCTCCCGTGAGGAA-CGTCTCGCGGCTGGCCGAAAA-TCGAGTCCG--TGGTG---GAG-CGCACCGCGAAGGATGGTGGTT----GAGTA-----AT-GGCTCGAGACCA-G-TCGTGCGTGTCAG----CCCACCGGCCTC---GGGACTCCG--TGACCC---ACGAGCGGCCGTGTCGGTCGC--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_brachystachyum_JX124497 TCGGAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-CGA-ACGCCCG---GGGG--------------TG-----CCCGGCGCC-TCGGCCCC-----TCGCTC-GGGCTGGGAAGG----TGCCCG----CCTCGCGCG-GTCTCC---TCCTGGCCGAGCAAAA-CCTAAAAA-AACCCCGGCGCCGAATGCGCCAAGGAAATCCGAAATCGTTCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGACGC-GCGAAT------AAATCTAGAATGACTCCCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCCGT---GCCTCGCGCT----GAGGGGG-CGACGGGCGGGG-CGAGCGTTGGCCTCCCGTGAGGAA-CGTCTCGCGGCTGGCCGAAAA-TCGAGTCCG--TGGTG---GAG-CGCACCGCGAGGGATGGTGGTT----GAGTA-----AT-GGCTCGAGACCA-G-TCGTGCGTGTCAG----CCCACCGGCCTC---GGGACTCCG--TGACCC---ACGAGCGACCGTGTCGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_dasycarpum_JX124496 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-CGA-TCGCCCG---GGGG--------------TG-----CCCGGCACC-CCGGCCCC-----TCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GTCTCACCGCCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GACGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CTAGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGAAGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_dasycarpum_JX124504 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-CGA-TCGCCCG---GGGG--------------TG-----CCCGGCACC-CCGGCCCC-----TCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GTCTCACCGCCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GACGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CT{AG}GCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGAAGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_dasycarpum_JX124512 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-CGA-TCGCCCG---GGGG--------------TG-----CCCGGCACC-CCGGCCCC-----TCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GTCTCACCGCCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GACGTCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CTAGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGAAGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_dasycarpum_JX124514 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-TGA-ACGCCCG---GGGG--------------TG-----CCCGGC---------CCC-----TCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GTCTCACCGCCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GACGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CTGGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGAAGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_dasycarpum_JX124515 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-TGA-CCGCCCG---GGGG--------------TG-----CCCGGC---------CCC-----TCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GTCTCACCGTCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GA{CT}GCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CTAGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGA{AG}GGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_dasycarpum_JX124516 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-TGA-ACGCCCG---GGGG--------------TG-----CCCGGC---------CCC-----TCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GTCTCACCGCCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GACGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CTGGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGAAGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_dasycarpum_JX124517 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-TGA-ACGCCCG---GGGG--------------TG-----CCCGGC---------CCC-----TCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GTCTCACCGCCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GACGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CTGGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGAAGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_dasycarpum_JX124518 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-CGA-TCGCCCG---GGGG--------------TG-----CCCGGCACC-CCGGCCCC-----TCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GTCTCACCGCCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GACGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CTAGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGAAGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_dasycarpum_JX124519 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-CGA-TCGCCCG---GGGG--------------TG-----CCCGGCACC-CCGGCCCC-----TCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GTCTCACCGCCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GACGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CT{AG}GCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGAAGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_elegans_JX124505 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-TGA-CCGCCCG---GGGG--------------TG-----CCCGGC---------CCC-----CCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GCCTCCCCGTCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGCCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GATGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CTAGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGAGGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_elegans_JX124509 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCCGTT-TGA-CCGCCCG---GGGG--------------TG-----CCCGGC---------CCC-----CCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GCCTCCCCGTCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGC{CT}GGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGCCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GATGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CTAGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGAGGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_elegans_JX124510 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-TGA-CCGCCCG---GGGG--------------TG-----CCCGGC---------CCC-----CCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GCCTCCCCGTCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGCCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GATGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CTAGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGAGGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_nitens_JX124511 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-CGA-CTGCC-----GGGC--------------AC-----CCCGGC---------CCC-----CCGCTC-GTGCCGGAAGGG----CGAATG----GCCCGCGCG-GCCTCCCCGGCACGGCCGAGCAAA---CTTAAAAAAATCCCGGCGCTGAATGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GCGAATAA----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GATGCCCGC---GCCTCGCGCA----GAGGGGG-CGACGGGCGGGG-CGAGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGCCCG--TGGTG---GGG-CGCACCGCGAGGGATGGTGGTT----GAGTA-----AA-GGCTCGAGACCA-G-TCGTGCGTGTGAG----CCCACCGGCCTC---GGGACTCCG--TGACCCCA-TCGGGCGCCCGTGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_nitens_JX124513 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-CGA-CTGCC-----GGGC--------------AC-----CCCGGC---------CCC-----CCGCTC-GTGCCGGAAGGG----CGAATG----GCCCGCGCG-GCCTCCCCGGCACGGCCGAGCAAA---CTTAAAAAAATCCCGGCGCTGAATGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GCGAATAA----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GATGCCCGC---GCCTCGCGCA----GAGGGGG-CGACGGGCGGGG-CGAGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGCCCG--TGGTG---GGG-CGCACCGCGAGGGATGGTGGTT----GAGTA-----AA-GGCTCGAGACCA-G-TCGTGCGTGTGAG----CCCACCGGCCTC---GGGACTCCG--TGACCCCA-TCGGGCGCCCGTGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_panamense_JX124498 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-TGA-CTGCCCG---GGGG--------------TG-----CCCGGCACC-CCGGCCCC-----TCGCCC-GTGCCGGGAGGG----TGAAAG----GCCCGCGCG-GTCTCCCCGGCACGGCCGAGCAAA---CTTAAACGAATCCCGGCGCCGAACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGCCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCGC-TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCG-GATGCCCGC---GCCCCGCGCT----GAGGGGGGCGACGGGCGGGG-CTGGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAAATCGAGTCCG--TGGTG---GGGGCGCGCCGCGAAGGATGGTGGTT----GAGTG-----AAAGGCTCGAGACCA-G-TCGCGCGCGCGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_parvifolium_JX124499 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTC-TGA-CCGCCCG---GGGG--------------TG-----CTCGGC---------CCC-----TCGCTC-GTGCCGGGAGGG----TGAATG----GCCCGCGCG-GTCTCACCGCCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGCG--TCGCGAAGC-GAGAACAG----AGATCTAGAATGACTCTCGGCAACGGATATCTCGGCTCCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GACGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CTGGCGCTGGCCTCCCGCGAGGAA-CGTCTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGT-CGCGCCGCGAAGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGCGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_sp__JX124500 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-TGA-CCGCCCG---GGGG--------------TG-----CCCGGCACC-CCGGCCCC-----TCGCTC-GTGCCGG------------------------------TCTCCCCGGCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGGCG-TCGCGAAGC-GAGAATAG----AGATCTAGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GATGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CCAGCGCTGGCCTCCCGCGAGGAA-CGTGTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGG-CGCGCCGCGAAGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGTGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_sp__JX124501 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-TGA-CCGCCCG---GGGG--------------TG-----CCCGGCACC-CCGGCCCC-----TCGCTC-GTGCCGG------------------------------TCTCCCCGGCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGGCG-TCGCGAAGC-GAGAATAG----AGATCTAGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GATGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CCAGCGCTGGCCTCCCGCGAGGAA-CGTGTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGG-CGCGCCGCGAAGGATGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGTGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCC????? Leptolobium_tenuifolium_JX124502 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-TGA-CCGCCCG---GGGG--------------TG-----CCCGGCACC-CCGGCCCC-----TCGCTC-GTGCCGG------------------------------TCTCCCCGGCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGGCG-TCGCGAAGC-GAGAATAG----AGATCTAGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GATGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CCAGCGCTGGCCTCCCGCGAGGAA-CGTGTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGG-CGCGCCGCGAAGGACGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGTGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Leptolobium_tenuifolium_JX124503 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-TGA-CCGCCCG---GGGG--------------TG-----CCCGGCACC-CCGGCCCC-----TCGCTC-GTGCCGG------------------------------TCTCCCCGGCACGGCCGAGCAAA---CTCAAAAGAATCCCGGCGCCGGACGCGCCAAGGAA-TCCGAAATCGTCCCGTGCGCC---CCCGTCGGC-CCGGGGACGGTG-CCCGTG--CGGGTGGGCG-TCGCGAAGC-GAGAATAG----AGATCTAGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-GATGCCCGC---GCCCCGCGCT----GAGGGGG-CGACGGGCGGGG-CCAGCGCTGGCCTCCCGCGAGGAA-CGTGTCGCGGCTGGCTGAAAA-TCGAGTCCG--TGGTG---GGG-CGCGCCGCGAAGGACGGTGGTT----GAGTG-----AA-GGCTCGAGACCA-G-TCGTGCGTGTGAG----CCCACCGGCCCT---GGGACTCCG--TGACCC-A-TCGGGCGCCCGCGTCGGTCGT--CCACGACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Lupinus_argenteus_DQ524197 TCGAAGC--CTCACA---AGC-AGTGC-GACCCCGTGAATTTGTT-TTA-CTACTCA----GGGGTGGCTAGAGG---TG-----TTTGGCACC-TCGGTCCCC----C-TC---GTGTCAGGAGGC-----GCCAC---ATCCTGTGCGG-TCTCC---TCCTGGCCT-----A---ATAACAAAA-CCCCGGCGCCGAACGCGCCAAGGAA-ATTGAAATCGTTTAGTTCGC--C-CCCGTCGGCACCGGAGACGGTG-CTCGTG--CGGGCGGCG--TTGCGACAC-GCTTA----------TCCTAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGC--CCCC--GTGCCTTG----GC-CACGT-----GCCAGGCACCAA--GCGGGG-CGAATGTTGGCTTCCCGCGAGCAA-TGTCTCACGGTTGGTTGAAAA-CTGAGTCCG--CGGTGG--AGGGCG--CCGTGATGGATGGTGGCT----GAGT------TAAAGCTCGAGACC--GATCGTGCGTGTCAC--CCC-CACCAGCTTT---GCGACTCTT--TGACCCAT---GGGGGT-CT-GTTGGCCTT--CTAATACGGGAACCTCAGG-???????????????????? Maackia_chinensis_EF457721 TCGAAGC--CTCACA--GAGC-AGCGC-GACCC-GCGAATTTGTT-TGA-CCCCTCG----GGG-CGGCGAGAGG---CG-----TTTCGCGTC-TCGGTCCCC----C-TA---GTGTCGGGAGGC-----GCCCG---TTCTCGTGCGG-GCTCC---TCTTGGCCTA----A---ATAACAAAA-CCCCGGCGTTGAATGCGCCAAGGAA-ATCGAGATCGTCTAGTGCGC--C-CCCGTCGGC-CCGGGGACGGTG-CTTGTG--CGGGGGACG--TCGTGACAC-GCGTA----------TCCAAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTCGAAGCCATTAGGCCTAGGGCACGCCTGCCTGGGTGTCGCACACCGTTGC--CCCAATATGCCCGA----GC-CTCGT-----GT{CT}GGGCACCGA--GCAGGG-CGAATGTTGGCTTCCCGGGAGCAA-GGTCTCACGGTTGGTTGAAAATT-GAGCCTG--CGGTGG--AGGACG--CCGCAATGGACGGTGGTTT---GATT------TAAATCTCGAGACC--G-TTGTGCGCGTCAC--CCC-TACCGGATTT---GGGACTCTG--TGACCCAT---GTGAGC-GG-CCGTGCCGC--CCAAGAAGG??????????????????????????????? Neoharmsia_madagascariensis_EF457723 TCGAAGC--CTCACA---AGC-AGTGC-GACCC-GTGAACTCGTT-TGA-CCACTCA----GGGGAGGCCAGAGG---TG-----CTCGGCACC-TCGGCCCCC----C-TC---GCGTCGGGAGGC-----GCCCGTCCTCTCCGTGCGG-CCTCC---TCCCGACCG-----A---ATAACAAAA-CCCCGGCGCTGGACGCGCCAAGGAA-ATCGAAATCGTTCACAGCGC--CCCCCGTCGGC-CCGGAGACGGTG-CTCGTG--CGGGCGGCG--TCGCGACAC-ACGCGT--------ATCCAAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCGCATCGTTGC--CCCC-AACGCCTTG----GC-CTCGT-----GCCGGGCATCGGGCG---GGGCGAATGTTGGCTTCCCGCGAGCAA-CGTCTCGCGGTTGGTTGAAAAATCGAGTCCG--TGGTGG--AGGATG--CCGCGATGGATGGTGGTT----GAGT------TTAAGCTCGAGACC--GATCGTGCGCGTCAC--CCCC-ACCGTGTAC---GGGACTCCG--TGACCCGT---GAGCGT--CCGTTGGTCGC--CCATGACGG??????????????????????????????? Neoharmsia_sp__EF457722 CCGAAGC--CTCACA---AGC-AGTGC-GACCC-GCGAACTCGTT-TGA-CCACTCACTCAGGGGAGGCCAGAGG---TG-----CTCGGCACC-TCGGCCCCC----C-TC---GCGTCGGGAGGC-----GCCCGTCCTCTCCGTGCGG-CCTCC---TCCCGACCG-----A---ATAACAAAA-CCCCGGCGCTGGACGCGCCAAGGAA-ATCGAAATCGTTCACAGCGC--CCCCCGCCGGC-CCGGAGACGGTG-CTCGTG--CGGGCGGCG--TCGCGACAC-ACGCGT--------ATCCAAAA-GACTCTCGGCAACGGATATCTCGGCT{CT}TTGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCGCATCGTTGC--CCCC-AACGCCTTG----GC-CTCGT-----GCCGGGCATCGGGCG---GGGCGAATGTTGGCTTCCCGCGAGCAA-CGTCTCGCGGTTGGTTGAAAA-TCGAGTCCG--TGGTGG--AGGATG--CCGCGATGGATGGTGGTT----GAGT------TTAAGCTCGAGACC--GATCGTGCGCGTCAC--CCCCCACCGTCTAC---GGGACTCCG--TGACCCGT---GAGCGT--CCGTTGGTCGC--CCATGACGG??????????????????????????????? Ormosia_amazonica_EF457724 TCGATGC--CTCACG--A-GC-AGTGC-GACCC-GCGAATTTGTT-TGA-CCACCAA----GGGGTGGCTCGTGG---TG-----CTTAACGCC-TCGGCCCCC----T------GCGTCGGGAGGT-----GCCCA----CCTGGTGCGG-CCTCC---TCCTGGCCG-----A---ACAACAAAACCCCCGGCGCCGAATGCGCCAAGGAA-CCCGAAATAGTCCAGTGCGC--C-CCCGTCGAC-CTGGAGACGGTG-CTCGTG--GGGGTGGTG--TTGCGACAC-GTGAA----------TCCAAAATGACTCTCGGCAACGGATATCTCGGCCCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCCTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCT-TACGCCAGT----GC-CTCGT-----GCTAGGCACCGAGCG---GGGTGGATGCTGGCTTCCCGTGAGCATCGGTCTCGCGGTTGGTTGAAAG-CTGGGTCCG--TGGCGG--AGGGCA--CCACGACGGAGGGTGGTT----GAGT------AAAAGCTCGAGACC--GGTCGTGTGTGTCTC--TCT--ACCTGCTCC---GGTACTCTG--TGACCCAT---GAGCGC--CAGTGGATCGC--CCATAACGG??????????????????????????????? Orphanodendron_bernalii_KT718823 TCGAAGC--CTCACG---AGC-AGCGC-GACCC-GCGAATCTGTT-TGA-CTACTTC----GGGGCGGCCAGGGG---TGCCGT--CCGGCGCCTCTG-----------CCCCTCGCGCCGGGGG-----GCGCCCG----CCTCGCGCG-GTCTCC---TCCCGGCCGAACAACC--------AAAACCCCGGCGCGGAATGCGCCAAGGAA-CTCGAAAACGTTCGGTGCG---CCCCCGCCGTC-CCGGAGACGGTG-CTCGTGC--GGGCGGCG--TCGCGACAC-GCGA--------AAATCCGAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTG---CCCCG-ACGCCGGT---GCCTCGCGC-------CAGGC--ACCGAGCGGGG-CGTGCGTTGGCCTCCCGCGAGCAT-CGTCCCGCGGCTGGCTGAAAA-TCGAGTCCG--CGGTGG--AGCGC--GCCGCGACGGATGGTGGTT----GAGT-------GAAGCTCGAGGCCCCAGTCGCGCGCGT----CGCCCCGGCCGTCTC--GGGGGCTCTG--TGACCCA---TGGGCG----------TCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Orphanodendron_bernalii_KT718824 ???????--??????---?????????-?????-???????????-???-???????---???????????????---??-----??????????????????-----???????????????????-----?????----????????????????---???CGGCCGAACAACC--------AAAACCCCGGCGCGGAATGCGCCAAGGAA-CTCGAAAACGTTCGGTGCG---CCCCCGCCGTC-CCGGAGACGGTG-CTCGTGC--GGGCGGCG--TCGCGACAC-GCGA--------AAATCCGAAACGACTTTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGT{CT}TTTGAAC{CG}CAAGTTGC{CG}CCCGAAGCCGCTAGGCTGAGGGC{AC}CGCCTGCCTGGGTGTC{CG}CA{AC}ATCGTTG---CCCCA-ACGCCGGT---{CG}CCTCGCGC-------CAGGC--GTC{AG}AG{CG}GGGG-CGTGCGTTGGCTTCCCGCGAGCAT-CGTCCCGCGGTTGGCTGAAAA-TCGAGTCCG--CGGTGG--AGCGC--GCCGCGACGGACGGTGGTT----GAGT-------GAAGCTCGAGGCCCCAGTCGCGCGCGT---CGGCCCTGCCGTCTCG---GGGGCTCTG--TGACCCA---TGGGCG----------TCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Pericopsis_sp__EF457725 TCGAAGC--CTCACG---AGC-AGCGC-GACCC-GCGGATCCGTTCTGA-CTGCCCC----GGGGGGG{AG}CGGGGG---TG-----CTCGGCACC-TCGGCCCCC----C-TC---GTGTCGGGAGGC-----GCCCC--CGCCTCGTGCGG-TCTCGCC-TCCCGGCCGAACAAC---ACAACAAAA-CCCCGGCGCGGAACGCGCCAAGGAA-CCAGAAATCGTTCGGTGCGCGCCCCCCCTCGGC-CCGGAGACGGTG-TCGGTG--CGGGCGGCG--TCGCGACGC-GTGAATGAGATAACATCCGAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATTGTTGTTGCCCCCGACGCCCCG----GC-CTCGT-----GCCGGGCACCGCGCG---GGGAGAAGGTTGGCCTCCCGTGAGCAT-CGCGTCACGGCCGGCTGAAAA-TCGAGCCCGT-GGCGGG--GGGGCG--CCGCGATGGATGGTGGTTGATTGAGTC-----GAGAGCTCGAGACCC-GGTCGCGCGCGCCAC--CCC-TGTCGGCTTC---GGGACTCCG--TGACCCATCGAGCGAGCGTCCGTCGGTCGC--CCACAACGG??????????????????????????????? Piptanthus_leiocarpus_AY091569 TCGAAGC--CTAACA--AAGC-AGTGC-GACCC-GCGAATATGTT-TGA-CTACTCA----GGGGTGGCTAGAGG---TG-----CTTGGCACC-TCGGTCCCC----TCTT---GTGTCGG-AGGT-----GCCCC---TCCTTGTGTGGGTCTCC---TCCTGGCCT-----A---ACAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATAAAGATTGTCTAGTGCGC--C-CTCGTTGGCACCGGAGACGGTG-TCGGTG--CGGGCGGCG--TTGTGACAC-ACATA----------TCCTAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGACGCCATCAGGTCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCC-AATGCCTTA----GC-CTTGT-----GCTAGGCTTTGAGTG--GGG-CGAATGTTGGCTTCCCGCGAGCAA-GGTCTCACGGTTGGTTGAAAAATTGAGTCC---TGGTGG--AGGGCG--CCGCGATGGATGGTGGTT----GAGT------AAAAGCTCGAGATC--GATCGTGCGCGTCAC--TCG-TGCCGGATTT---GGGACTTTG--TGACCCAT---GGGCGT-CTTGTTGGTCGC--CCATGACGGG-AC??????????????????????????? Piptanthus_tomentosus_AY091570 TCGAA-C--CTAACA--AAGC-AGTGC-GACCC-GCGAATATGTT-TGA-CTACTCA----GGGGTGGCTAGAGG---TG-----CTTGGCACC-TCGGTCCCC----TCTT---GTGTCGG-AGGT-----GCCCC---TCCTTGTGTGGGTCTCC---TCCTGGCCT-----A---ACAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATAAAGATTGTCTAGTGCGC--C-CTCGTTGGCACCGGAGACGGTG-TCGGTG--CGGGCGGCG--TTGTGACAC-ACATA----------TCCTAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGACGCCATCAGGTCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCC-AATGCCTTA----GC-CTTGT-----GCTAGGCTTTGAGTG--GGG-CGAATGTTGGCTTCCCGCGAGCAA-GGTCTCACGGTTGGTTGAAAAATTGAGTCCCC-TGGTGG--AGGGCG--CCGCGATGGATGGTGGTT----GAGT------AAAAGCTCGAGATC--GATCGTGCGCGTCAC--TCG-TGCCGGATCT---GGGACTTTG--TGACCCAT---GGGCGT-CTTGTTGGTCGC--CCATGACGGG-AC??????????????????????????? Platycelyphium_voense_EF457726 TCGAAGC--CTCACG---AGC-AGTGC-GACCC-GCGAACCCGTT-TGA-CCCCTCG---GGGG--------------CG-----CCCGG-----------CG-----CCCCCC-GTGTCGGG-GGG----CCCCTC----CTCGGTGGG-GCGTCAC--CCCCGGCCGAATAAC--------AAAAACCCCGGCGCTGGATGCGCCAAGGAAAATCGAGATCGTTCGGCGCGCC---CCCGTCGGC-CCGGAGACGGTG-CCCGTG--CGGGCGGCG--CCGCGACGC-ACGCGT--------ATCCAAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCGCGCATCGTTGC--CCCG-GCGCCCCGG----CCTCGTGCC----GGGG----CGTCGAGCGGGGGCGAATGCTGGCCTCCCGCGAGCGA-CGTCTCGCGGTTGGTTGAAAA-CCGAGCCCG--TGGTG---GAG-GGCGCCGCGACGGATGGTGGTT----GAGTT-----CC-GGCTCGAGACCC-GATCGTGCGCGTCCCGCCCCCCACCGTCCAC---GGGGCTCCG--TGACCC---GTGGGCGTCC--GTTGGTCGC--CCGTGACGG??????????????????????????????? Poecilanthe_falcata_AF467492 TCGAAGC--CTCGAA---AGC-AGCGC-GACAC-GTGAATTTGTT-TGA-CTGCATG----TGGGTGGCCAGGGG---TGC----TT-GACGCC-CCGGCCCCT----CGG-----TGCTGGGGGGG-----CCCTG----CCCTGCGCGG-TCTCCT--CCC--GGC-----AA---ACAACCAA--CCCCGGCGCTGTATGCGCCAAGGAA-CTCGAAATCGTTCAGTACGC--CCCCTAA-GGC-CCGGAGACGGTG-CTCGCG---GGGCGGCG--CCACGACG-CTTGGA-----------TCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCC----------T----AC-GCCGGT----GC-AGG------------GG-CGAATGTTGGCTTCCTGTGAGCAC-TGTCTCGCGGTTGGCTGAAAG-TCGAACCTG--TGGTGG--AGTGCA--CCGCGACGGATGGCGGTT-------GA-----AGGAACTCGAGACC--AGTCGCGCGTGTCGC---CCTCC-GTGCTTC---G-GACTCTG--TGACCCAC---GAGCGA---TGCCAGTCGC--CCACAACGGG-ACCTCAGGTCTCGCGG????????????? Poecilanthe_parviflora_AF187089 TCGAAGC--CTCACG---AGC-AGCGT-GACAC-GCGAACATGTT-TGA-CTGCATG----AGGGTGGCCAGGGG---TGC----TTTGACGCC-TCGGCCCCT----CGG-----TGCTGGGGGGGT---GCGCTG----CCCTACGCGG-TCTCCT--CCCCGGCC-----AG---ACAACCAAA-CCCCGGCGCTGAATGCGCCAAGGAA-CTCGAAATTGTTCGGTGCGC--ACCCCGCTGGC-CCGGAGACGGTG-CTCACG---GG-TGGTG--CCACGACGGCTTGGA--------AGATCATAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCTGTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCC----------T----GT-CCTGGT----GC-AGG-------------GGCGAACGTTGGCTTCCCGTGAGCAC-TGTCTCATGGTTGGCTGAAAG-TCGAGCTTG--TGGTGG--AGTGCA--CCGTGACGGATGGTGGTT----GAGGA-----AGGAGCTCGAGACC--AGTTGCGCGTGTCGC---CCTCCCGTGCTTC---GAGACTCTG--TGACCCAC---GAGCGA--CTGCCAGTTGC--CCACAACGGG-ACCTCTAGTCAGGCGG????????????? Sophora_davidii_AF467496 TCGAATC--CTCGAA---AGC-AGTGC-GACCC-GCGAATTTGTT-CGA-CCGCCTG----GGTGCGGCTCGAGG---TG-----CGTGGCGCC-TCGGTCCCC----C-TA---GTGCCGGGCGGT-----GCCCT----CCTCGTGAGG-GCCCC---TCCCGGC-------A---TTTAACAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ACAGAGATTGTCCGGCACG---CCCTCGTCGGC-CCGGAGACGGTG--CCGTG--CGG-TGGCG--TTGCGACAC---GCG----------TTCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGCCTC-----GCCCTGTT-----GCAAGGCATGGAAAG--GGG-CGAATGTTGGCTTCCCGCGAGCGA-TGCCTCACGGTTGGCTGAAAA-TCGAGTCCG--TGGTGG--AGTGTG--CCGCGATGGATGGTGGTT----GAGT------A--AGCTCGAGACC--GATCGTGTGTGTCGC---CCCTA--GGATTT---GG-ACTCCA--TGACCCAC---GA-CGG-CC-GTTGGCCGC--CCACGACGGG-ACCTCAGGTCAGGCGG????????????? Sophora_flavescens_AF123452 TCGAATC--CTCACG--AAGC-AGTGC-GACCC-GTGAATTTGTT-TGA-CTCCTTG----GGTGCGGCTTGAGG---TG-----ATCGGTGCC-TCGGTCCCC----C-AA---GTGTTGGGAGGT-----GCCCT----CCTCGTGCGG-GCCCA---TCCTGGCC------A---TTAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCGAGATTGTCTAGTGCGT--CCCCCGTCGGCACCGGAGACGGTG-CCCGTG--TGGGTGGCG--TTGCGACACAGTGTA----------TCC-AAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGCCTCA----GCCCTGTT-----GCTAGGCATAGTAAA-GGGG-TGAATGTTGGCTTCCCGCGAGCGA-TGCCTCGCGGTTGGCTGAAAAATTGAGTCCG--TGGTGG--AGTGCG--CCGCGATGGATGGTGGTT----GAGT------AAGAGCTCGAGATC--GATCGTGCGCGTCAC---TCGTGCCGGATTT---GGGACTTTG--TGACCCAT---GGGCGT-CCTGTTGGTCGC--CCACGAC????????????????????????????????? Sophora_prostrata_AJ409922 TCGAATC--CTCACA--ATGACAGTGCCGACCC-GTGAATTTGTT-TGA-CTCCTCG----GGTGTGGCTTGAGG---TG-----AATGGCGCC-TCGGTCCCC----C-TA---GTGTTGGGAGGT-----GCCCT----CCTCGTGCGG-GCCCC---TCCTGGCCC-----A---TTAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCGAGATTGTCTAGCACG---CCCCCGTCGGC-TCGGAGACGATG-ACTGTG--TGG-TGGCG--TTGCGACAC-GTGTA----------TCCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGCCTCA----CCCCTGTT-----GCTAGGCTTAGTAAA-GGGG-TGAATGTTGGCTTCCCGTGAGCGA-TGCCTCACGGGTGGCTGAAAA-TTGAGTCCG--TGGTGG--AGTGC---CCGCGATGGATGGTGGTT----GAGT------AAAAGCTCGAGACC--GATCGTGTGTGTCAC---CCCTACCGGATTT---GGGACTCTT--TGACCCAT---GAGCG--CC-GTTG-CTGC--CC?????????????????????????????????????? Sophora_raivavaeensis_AY056080 TCGAATC--CTCACA--AAGC-AGTGC-GACCC-GTGAATTTGTT-TGA-CTCCTCG----GGTGTGGCTTGAGG---TG-----CATGGCGCC-TCGGTCCCC----C-TA---GTGTTGGGAGGT-----GCCCT----CCTCGTGCGG-GCCCC---TCCTGGCCC-----A---TTAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCGAGATTGTCTAGCACG---CCCCCGTCGGC-TCGGAGACGATG-ACTGTG--TGG-TGGCG--TTGCGACAC-GTGTA----------TCC-AAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGCCTCA----GCCCTGTT-----GCTAGGCTTAGTAAA-GGGG-TGAATGTTGGCTTCCCGTGAGCGA-TGCCTCACGGTTGGCTGAAAA-TTGAGTCCG--TGGTGG--AGTGCG--CCGCGATGGATGGTGGTT----GAGT------AAAAGCTCGAGACC--GATCGTGTGTGTCAC---CCCTACCGGATTT---GGGACTCTT--TGACCCAT---GAGCGG-CC-GTTGGCTGC--CCAAGACGGG-A???????????????????????????? Sophora_toromiro_AJ409921 TCGAATC--CTCACA--AAGA-AGTGC-GACCC-GTGAATTTGTT-TGA-CTCCTCG----GGTGTGGCTTGAGG---TG-----CATGGCGCC-TCGGTCCCC----C-TA---GTGTTGGGAGGT-----GCCCT----CCTCGTGCGG-GCCCC---TCCTGGCCC-----A---TTAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCGAGATTGTCTAGCACG---CCCCCGTCGGC-TCGGAGACGATG-ACTGTG--TGG-TGGCG--TTGCGACAC-GTGTA----------TCC-AAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA--ATGCCTCA----GCCCTGTT-----GCTAGGCTTAGTAAA-GGGG-TGAATGTTGGCTTCCCGTGAGCGA-TGCCTCACGGTTGGCTGAAAA-TTGAGTCCG--TGGTGG--AGTGCG--CCGCGATGGATGGTGGTT----GAGT------AAAAGCTCGAGACC--GATCGTGTGTGTCAC---CCCTACCGGATTT---GGGACTCTT--TGACCCAT---GAGCGG-CC-GTTGGCTGC--CC?????????????????????????????????????? Staminodianthus_duckei_JX124508 TCGATGC--CTCACG---AGC-AGTGC-GACCC-GCGAATCTGTT-TGA-CCACCCG---GGGGGCGCCCTGGGG---TG-----CCTGGCACC-TCGGCCCC-----TCGCTC-GTGCAGGGAAGGG---CACTCG----CCTCGCGCG-GTCCCC---TCCTTGCCGAACAAC------CTAAAA-CCCCGGCGCCGAACGCGCCAAGGAG-CTCGAAATCGTTTAGTGCGCC---CCCGCCGGC-CCGGAGACGGTGACCCGCG--CGGGTG--GCGTCGCGACAC-GCGA----------ATCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGCGTCGCGCATCGTCGC--CCCA--ATCCCGGT---GCCCAGCGCT----GAGGGG--CGCCGGGCGGGG-CGAGCGTTGGCTTCCCGTGAGCGT-CGCCTCGCGGTTGGTTGAAAA-TCGAGTCCG--TGGTG----GAGCGCACCGCGATGGATGGTGGTT----GAGTA-----AAAAGCTCGAGACCA-G-TCGTGCGTGCCG----GCCCGCCAGCCTC---GGGACTTCG--CGACCC---ACGGGCGCCT--ATTGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTGA Templetonia_retusa_AF287636 ???????--?TCACA---AGC-AGCGC-GACTC-GCGAATTTGTT-TGA-CTTGATT----GGGACGGGCAGGGG---TGC----TC-GACGCC-TCGGCCCCC----CCG----GTGCTGGAAGGT-----GCCTG----CCTCGTGCGG-TCTCCG--CCC-GGCCGA---AA---ATAACCAAA-CCCCGGCGCCGAATGCGCCAAGGAA-CTCGAAATCGTTCGGTGCG---TCCCCGTCGGC-CCGGAGACGGTG-CCCGCG---CGGGGGTG--TCGCGACA-CGCGAATT----AAAATCCAAAACGACTCTCGGCAACGGATATCTCGGCTCCCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCC--ATTCCCGGT----GC-CTCGTC----GC-AGGCGCCGTGGGATGTGGCGAATGCTGGCTTCCCGGGAGCAC-CGTCTCGCGGTTGGCTGAAAG-TCGAGCCCG--TGGTGG--AGTGCA--CCGCGACGGATGGTGGTT----GAGGG-----TA--ACTCGAGACC--AGTCGCGCGCGTCGG---CCTCCC-CGTTTC---GGGACTCTG--TGACCCAC---GAGCGG--CATTCGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCT-G Templetonia_sulcata_AF287635 ???????--????????????-?????-????C-GCGAATTTGTT-TGA-CTTGATT----GGGGCGGGCAGGGG---CGC----TT-GACGCC-TCGGCCCCC----CCG----GTGCTGGGAGGC-----GCTCG----CCTAGTGCGG-TCTCCG--CCC-GGCCGA---AA---ACAACCAAA-CCCCGGCGCCGAATGCGCCAAGGAA-CTAGAAATCGTTCGGCGCGT--CCCCCGTCGGC-CCGGAGACGGTG-CTCGCG---CGGGGGCG--TCGCGACA-CGCGAATT----AAAATCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCC--ATTCCCGGT----GC-CTCGTC----GC-AGGCGTCG---GGCGTGGCGAATGCTGGCTTCCCGGGAGCAC-CGTCTCGCGGTTGGCTGAAAG-TTGAGCCCG--TGGTGG--AGTGCA--CCGCGACGGATGGTGGTT----GAGGG-----AA--ACTCGAGACC--AGTCGCGCGCGTCGG---CCTCCC-CGTTTC---GGGACTCTG--TGACCCAC---GAGCGG--CATTCGGTCGC--CCACAACGGG-ACCTCAGGTCAGGCGGGGCTACCCGCTTG Thermopsis_alpina_AF123447 TCGAAGC--CTAACA--AAGC-AGTGT-GACCC-GTGAATTTGTA-TGA-CTACTCA----GGGGTGGCTAGAGG---TG-----CTTGGCACC-TTGGTCCCC----TCTT---GTGTCGG-AGGT-----GCCCC---TCCTTGTGTGGGTCTCC---TCCTGGCCT-----A---ACAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCAAGATTGTCTAGTCCGC--C-CCAGTTGGCACCGGAGACGGTG-TCGGTG--CGGGCGGCG--TTGTGACAC-ACATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGACGCCATCAGGTCGAGGGCACGCCTGCCTGGGCGTCGCACATCGTTGC--CCCC-AATTCCTCA----GC-CTTGT-----GCTAGGCTTTGAGTG--GGG-CGAATGTTGGCTTCCCGCGAGCAA-GGTCTCACGGTTGGTTGAAAAATTGAGTCCG--TGGTGG--AGGGCG--CCGCGATTGATGGTGGTT----GAGT------AAAAGCTCGAGATT--GATTGTGCGCGTCAC--TCG-TGCCGGATTT---GGGACTTTG--TGACCCAT---GGGCGT-CTTGTTCGTCGC--CCATGAC????????????????????????????????? Thermopsis_chinensis_AF123443 TCAAAGC--CTAACA--ATGC-AGTGC-GACCC-GCGAATCTGTT-TGA-CCACTAA----GGGGTGGCTAGAGG---TG-----TTCGGCACC-TCGGTCCCC----CATT---GTGTCAG-ATGA-----GCCCG---TCCTTGTGCGG-TCTCC---TCCTGGCCT-----T---ATAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCAAGATTGTCTAGTGCGT--C-CCCGTTGGCACCGGAGACGGTG-CCGCTG--CGGGTGGCG--TTGTGACAC-GCATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCTCA----GC-CTTGT-----GCTAGGCATCGAGCG--GGG-CGAGTGTTGGCTTCCCGCGAGCTA-TGTCTCGCGGTTGGTTGAAAA-TTGAGTCCG--TGGTG---AGGGTG--CCGCGATGCGTGGTGGTT----GAGT------AAAAGCTCGAGATC--GATCGTGCGCGTCAC--CCC-TATCGGATTT---GGGACTCTG--TGACCCAT---GAGCGC-CT-GTTGGTTGC--CCATGAC????????????????????????????????? Thermopsis_divaricarpa_AY091575 TCGAAGC--CTAACA--ATGC-AGTGC-GACCC-GCGAATTTGTT-TGA-CTACTAA----GGGGTGGCCAGAGG---TG-----TTCGGCACC-TCGGTACCC----CATT---GTGTCAG-AAGA-----GCCCG---TCCTTGTGCGG-TCTAC---TCCTGGCCT-----T---ATAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCAAGATTGTCTAGTGCGT--C-CCTGTTGGCACCGGAGACGGTG-CCGTTG--CGGGTGGCG--TTGTGACAC-GCATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCTCA----GC-CTTGT-----GCTAGGCTTCGAGCG--GGG-CGAATGTTGGCTTCCCGCGAGCTA-TGTCTCACGGTTGGTTGAAAA-TTGAGTCCG--TGGTGG--AGGGTG--CCGCGATGCATGGTGGTT----GAGT------AAAAGCTCGAGTTC--GATCGTGCGCGTCAC--CCC-TATCGGATTT---GGGACTCTG--TGACCCAT---GAGCGT-CT-GTTGGTTGC--CCATGACGGG-AC??????????????????????????? Thermopsis_fabacea_AY091573 TCGAAGC--CTAACA--ATGC-AGTGC-GACCC-GCGAATTTGTT-TGA-CTACTAA----GGGGTGGCTAGAGG---TG-----TTTGGCACC-TCGGTACCC----CATT---GTGTCAG-AGGA-----GCCCG---TCCTTGTGTGG-TCTCC---TCCTGGCCT-----T---ATAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCAAGATTGTCTAGTGCGT--C-CCCGTTGGCACCGGAGACGGTG-CCGCTG--CGGGTGGCG--TTGTGACAC-GCATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCTCA----GC-CTTGT-----GCTAGGCTTCGAGCG--GGG-CGAATGTTGGCTTCCCGCGAGCTA-TGTCTCACGGTTGGTTGAAAA-TTGAGTCCG--TGGTGG--AGGGTG--CCGCGATGCATGGTGGTT----GAGT------AAAAGCTCGAGTTC--GATCGTGCGCGTCAC--CCC-TATCGGATTT---GGGACTCTG--TGACCCAT---GAGCGT-CT-GTTGGGTGC--CCATGACGGG-AC??????????????????????????? Thermopsis_inflata_AF123451 TCGAAGC--CTAACA--AAGC-AGTGC-GACCC-GCGAATTTGTT-TGA-CTACTCA----GGGGTGGCCAGAGG---TG-----ATCGGCACC-TCGGTCCCC----TCTT---GTGTCGG-AGGT-----GCCCC---TCCTTGTGTGGGTATCC---TCCCGGCCT-----A---ACAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCAAGATTGTCTAGTGCGC--C-CCCGTTGGCATCGGAGACGGTG-CCGCTGT-CGGGTGGCG--TTGTGACAC-ACATA----------TCCCAAA-GACTCTCGGCAACGGATATCTTGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGACGCCATCAGGTCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCTCA----GC-CTTGT-----GCTAGGCTTTGAGCA--GGG-CGAATGTTGGCTTCCCGCGAGCAA-GGTCTCACGGTTGGTTGAAAAATTGAGTCCG--TGGTGG--AGGGCG--CCGCGATGGATGGTGGTT----GAGT------TAAAGCTCGAGATC--GATCGTGCGCGTCAC--TCG-TGCCGGATTT---GGGACTTTG--TGACCCAT---GGGCGT-CCTGTTGGTCGC--CCACGAG????????????????????????????????? Thermopsis_licentiana_AF123449 TCGAAGC--CTAACA--AAGC-AGTGC-GACCC-GCGAATTTGTT-TGA-CTACTCA----GGGGTGGCTAGAGG---TG-----CTTGGCACC-TCGGTCCCC----TCTT---GTGTCGG-AGGT-----GCCCC---TCCTTGTGTGGGTCTCC---TCCTGGCCT-----A---ACAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATAAAGATTGTCTAGTGCGC--C-CCCGTTGGCACCGGAGACGGTG-TCGGTG--CGGGTGGCG--TTGTGACAC-ACATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGACGCCATCAGGTCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCC-AATGCCTCA----GGGCCTGT-----GCTCGGCTTTGAGTG--GGG-CGAATGTTGGCTTCCCGCGAGCAA-GGTCTCACGGTTGGTTGAAAA-TCGAGTCCG--TGGTGG--AGGGCG--CCGCGATGGATGGTGGTT----GAGT------AAAAGCTCGAGATC--GATCGTGCGCGTCAC--TCG-TGCCGGATTT---GGGACTTTG--TGACCCAT---GGGCGT-CTTGTTAGTCGC--CCATGAC????????????????????????????????? Thermopsis_macrophylla_AF123450 TCGAAGC--CTAACA--ATGC-AGTGC-GACCC-GCGAATTTGTT-TGA-CTACTAA----GGGGTGGCTAGAGG---TG-----TTCGGCACC-TCGGTACCC----CATT---GTGTCAG-AGGA-----GCCCG---TCCTTGTGCGG-TCTCC---TCCTGGCCT-----T---ATAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCAAGATTGTCTAGTGCGT--C-CCCCTTGGCACCGGAGACGGTG-TCGGTG--CGGGTGGCG--TTGTGACAC-GCATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCTCA----GC-CTTGT-----GCTAGGCTTCGAGTG--GGG-CGAATGTTGGCTTCCCGCGAGCTA-TGTCTCACGGTTGGTTGAAAA-TTGAGTCCG--TGGTGG--AGGGTG--CCGCGATGCATGGTGGTT----GAGT------GAAAGCTCGAGTTC--GATCGTGCGCGTCAC--CCCCTATCGGATTT---GGGACTCTG--TGACCCAT---GAGCGT-CT-GTTGGTTGC--CCATGAC????????????????????????????????? Thermopsis_montana_AF007468 TCGAAGC--CTAACA--ATGC-AGTGC-GACCC-GCGAATTTGTT-TGA-CTACTAA----GGGGTGGCTAGAGG---TG-----TTCGGCACC-TCGGTACCC----CATT---GT--CAG-AGGA-----GCCCG---TCCTTGTGTGG-TCTCC---TCCTGGCCT-----T---ATAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCAAGATTGTCTAGTGCGT--C-CCCGTTGGCACCGGAGACGGTG-CTGCTG--CGGGTGGCG--TTGTGACAC-GCATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCTCA----GC-CTTGT-----GCTAGCCTTCGAGCG--GGG-CGAATGTTGGCTTCCCGCGAGCTA-TGTCTCACGGTTGGTTGAAAA-TTGAGTCCG--TGGTGG--AGGGTG--CCGCGATGCATGGTGGTT----GAGT------AAAAGCTCGAGTTC--GATCGTGCGCGTCAC--CCC-TATCGGATTT---GGGACTCTG--TGACCCAT---GAGCGT-CT-GTTGGGTGC--CCATGACGGG-ACCTCAGG????????????????????? Thermopsis_montana_AY091574 TCGAAGC--CTAACA--ATGC-AGTGC-GACCC-GCGAATTTGTT-TGA-CTACTAA----GGGGTGGCTAGAGG---TG-----TTCGGCACC-TCGGTACCC----CATT---GTGTCAG-AGGA-----GCCCG---TCCTTGTGTGG-TCTCC---TCCTGGCCT-----T---ATAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCAAGATTGTCTAGTGCGT--C-CCCGTTGGCACCGGAGACGGTG-CCGCTG--CGGGTGGCG--TTGTGACAC-GCATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCTCA----GC-CTTGT-----GCTAGGCTTCGAGCG--GGG-CGAATGTTGGCTTCCCGCGAGCTA-TGTCTCACGGTTGGTTGAAAA-TTGAGTCCG--TGGTGG--AGGGTG--CCGCGATGCATGGTGGTT----GAGT------AAAAGCTCGAGTTC--GATCGTGCGCGTCAC--CCC-TATCGGATTT---GGGACTCTG--TGACCCAT---GAGCGT-CT-GTTGGGTGC--CCATGACGGG-AC??????????????????????????? Thermopsis_smithiana_AF123445 TCGAAGC--CTAACA--AAGC-AGTGC-GACCC-GCGAATTTGTT-TGA-CTACTCA----GGGGTGGCTAGAGG---TG-----CTTGGCTCC-TCGGTCCCC----TCTT---GTGTCGG-AGGT-----GCCCC---TCCTTGTGTGGGTCTCC---TCCTGGCCT-----A---ACAACAAAA-CCCCGGCGTCGAATGCGCCAAGGAA-ATCAAGATTGTCTAGTGCGC--C-CCCGTTGGCACCGGAGACGGTG-TCGGTG--CGGGCGGCG--TTGTGACAC-ACATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGACGCCATCAGGTCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCC-AATGCCTCA----GC-CTTGT-----GCTAGGCTTTGAGTG--GGG-CGAATGTTGGCTTCCCGCGAGCAA-GGTCTCACGGTTGGTTGAAAAATTGAGTCCG--TGGTGG--AGGGCG--CCGCGATGGATGGTGGTT----GAGT------AAAAGCTCGAGATC--GATCGTGCGCGTCAC--TCG-TGCCGGATTT---GGGACTTTG--TGACCCAT---GGGCGT-CCAGTTGGTCGC--CCATGAC????????????????????????????????? Thermopsis_turkestanica_AF123446 TCGAAGC--CTAACA--AAGC-AGTGT-GACCC-GTGAATTTGTA-TGA-CTACTCA----GGGGTGGCTAGAGG---TG-----CTTGGCACC-TTGGTCCCC----TCTT---GTGTCGG-AGGT-----GCCCC---TCCTTGTGTGGGTCTCC---TCCTGGCCT-----A---ACAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCAAGATTGTCTAGTCCGC--C-CCGGTTGGCACCGGAGACGGTG-TCGGTG--CGGGCGGCG--TTGTGACAC-ACATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGACGCCATCAGGTCGAGGGCACGCCTGCCTGGGCGTCGCACATCGTTGC--CCCC-AATTCCTCA----GC-CTTGT-----GCTAGGCCTTGAGTG--GGG-CGAATGTTGGCTTCCCGCGAGCAA-GGTCTCACGGTTGGTTGAAAAATTGAGTCCG--TGGTGG--AGGGCG--CCGCGATTGATGGTGGTT----GAGT------AAAAGCTCGAGATT--GATCGTGCGCGTCAC--TCG-TGCCGGATTT---GGGACTTTG--TGACCCAT---GGGCGT-CTTGTTCGTCGC--CCATGAC????????????????????????????????? Thermopsis_villosa_AF123444 TCGAAGC--CTAACA--ATGC-AGTGC-GACCC-GCGAATTTGTT-TGA-CTACTAA----GGGGTGGCCAGAGG---TG-----TTCGGCACC-TCGGTACCC----CATT---GTGTCAG-AAGA-----GCCCG---TCCTTGTGCGG-TCTCC---TCCTGGCCT-----T---ATAACAAAA-CCCCGGCGCCGAATGCGCCAAGGAA-ATCAAGATTGTCTAGTGCGT--C-CCTGTTGGCACCGGAGACGGTG-CCGTTG--CGGGTGGCG--TTGTGACAC-GCATA----------TCCCAAA-GACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGC--CCCA-AATGCCTCA----GC-CTTGT-----GCTAGGCTTCGAGCG--GGG-CGAATGTTGGCTTCCCGCGAGCTA-TGTCTCACGGTTGGTTGAAAA-TTGAGTCCG--TGGTGG--AGGGTG--CCGCGATGCATGGTGGTT----GAGT------AAAAGCTCGAGTTC--GATCGTGCGCGTCAC--CCT-TATCGGATTT---GGGACTCTG--TGACCCAT---GAGCGT-CT-GTAGGTTGC--CCATGAC????????????????????????????????? ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M37732] TITLE Orphanodendron_matk_674_taxa_Parsimony_Character_matrix; LINK TAXA = Taxa4; DIMENSIONS NCHAR=1803; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Abrus_precatorius_AF142705 ATGGAGGAATATCAAGTA---------TATTTAGAACTAAATAGATCTCGCCATCAGGAC------TTCCTATATCC------ACTTATTTTTCGGGAGTATATTTATGGACTCACTTATGGTCATGATTTA------AATAGATCCATTTTTATAGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAAAGTCAATTGATCATTTCTACGAATGATTCTAAC------AAAAATCTA------------TTTTGGGGGTATAACAATAATATTTAT---TCTCAAATAATATCAGAAGGTTTTGTTGTCGTCGTGGAAATTCCATTTTCCTTACAATTT------AGCTCTTCC---------TTAGAAGGGGCAGAAATCGTAAAATTTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTAATATATTTTAATTATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTCATTTATTAAGGTTTTTTTTTTTT------TACTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATTAATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTT------CTATATAATTTATATGTATGGGAACACGAATCTATCTTTCTTTTTCTACGGAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTTTTTTTGAACGAATTTTTTTCTATGCAAAAATAGAACAT------CTTGTACAAGTCATTGCT------AAGGATTTTTCATAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAGGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GATTATTTTTTAAATTTGCAACTAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAATGGAAATTGTTATGAAAAAGCTTGATACAAGAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCCTTAGTAAGTCGGTCTGGGCCGATTTATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGACATTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGAATTTGGTATTTGGATATTCTT---TTCAGCCATGATCCTGATCTAGTCAAC---------------CATTCA---------------------------TAA Acacia_cochliacantha_AF274133 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTGATTTTTCGGGAGTATATTTATGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATAATCAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTACCAAATCTTCTTATTTACGATTAACATCTTTTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTTTCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAGATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGTTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTAGTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTAGAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Acacia_myrtifolia_AF274160 ATGGAGGAATTTCCAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTNGGTGCAA---AATGTAGGT------TATGACAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAA------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATTCTAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCGGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATNGNAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTCCTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTCCTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAATTTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGGAGATATGCAGAGATCTCTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGAATATATTTTTTCTTTGATCTTCTCA------AGAACTTCTTCTACTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Acosmium_cardenasii_JX124425 ATGAAAGAATATCCAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAAC------TTCTTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAGTAAAAATCGATCCATTTTGGTGGAA---AATGTGGAT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCAGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCTTATCCTATCCATCTGGAAATCTTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTATACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTT------CTATATAACTTTTATGTATGTGAACACGAATCCATCCTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGAC---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTGACTTTTTTGGGGGGGGCTATCTTTCAAATGTGCGTCTAAATTCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAACCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGTAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTGGAAGAATTCTTT---ACAGACGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTA------------AATGGA---------------------------TAA Acosmium_diffusissimum_JX124415 ATGAAAGAATATCCAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAAC------TTCTTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAGTATAAATCGATCCATTTTGGTGGAA---AATGTGGAT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTCTGTTTGCTAACGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCAGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATCCCCTCTTCTTTCATTTATTAAGATTGTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTATACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTT------CTATATAACTTTTATGTATGTGAACACGAATCCATCCTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGAC---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTGACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGTCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAACCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTGGAAGAATTCTTT---ACAGACGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTA------------AATGGA---------------------------TAA Acosmium_lentiscifolium_JX124417 ATGAAAGAATATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAAC------TTCTTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAGTATAAATCGATCCATTTTGGTGGAA---AATGTGGAT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTTGTGGAAATTCCATTTTCCAGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATCCCCTCTTCTTTCATTTATTAAGATTGTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTATACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTT------CTATATAACTTTTATGTATGTGAACACGAATCCATCCTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTGCT------AAGAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGAC---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTGACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGTCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAACCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTGGAAGAATTCTTT---ACAGACGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTA------------AATGGA---------------------------TAA Acrocarpus_fraxinifolius_EU36184 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTGTACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGCGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATAAA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTTC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCCTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATTTTGGTTCAAATCCTTCGATCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGCAAAAGTGGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTGCCGTCC---ACCTTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCATTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTATCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGTAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGTTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTAGAAGAATTCTTT---ACAGAGGAGGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCCACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Adenanthera_pavonina_AF521808 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNATTGTAAANCGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ACCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAACTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTTATGTTTGGTCTCAACCAGGAAGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTAGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Adenolobus_garipensis_EU361844 ATGGAGGAATTTCAAGTA---------TATTTAGAAATATATAGATCTCGGCAACATGAC------TTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGGTTA------AATAGCTCCATTTTGGTGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATT------GCTAATGATTCTATC------AAAAATAAA------------TTTTGGGGGTACAACAAAAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTGTGGAAATTCCATTTTCCCTACAATTA------ATCTATTCC---------TTAAAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCACTTCACTCAATATTTCCTTTTTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATTTGGAAATTATGCTTAAAACCCTTCGCTATTGGTTGAAAGATGTCTCGTCTTTTCATTTATTAAGGATCTTTCTTCAC------AAATATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCC------------------AAAAGGATTCCAAGATTA------------------------TTTTTGTTC------CTATATAATTTGCATGTCTTCGAATATGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCGTTTACGATTAACAACCTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAAGACTTTCTGTTG---ACCCTATGGTTT------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGACT------ACGTCTCTTTTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAGAATCCATATAAAC---CAATTA---TCTGAGCATTCATTCTACTTTTTGTTTTTGGGCTATTTTTCAAGTGTGCGGCTAAATCCTTCAGTGGTACGGAGTCGAATGCTGGAAAATTCATTTATAATAGAAAATGTTAGGAAAAAGCTTAATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAACGTATTAGGTCATCCTATTAGTAATCCGGTCTGGGCCGATTCATCGGATTTTGATATTATTGACCGATTTGTGCGGATATGCAGAAATTTTTCTCACTATTACAATGGATCCTCAAAAAAAAATAATTTGTATCGAGTAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCCTTTTTTAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---TACGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------CGAGGTCGAATTTGGTATTTGGATATTATT---TGCATCAAT------GATTCGGTCAAT---------------CATTCA---------------------------TGA Adesmia_lanata_AF270863 ATGGAGGAATATCAAATA---------TATTTAGAAATCGATGGATCTTGCCAAGAAAAC------TTCCTATACCC------ACTTAGTTTTCAGGAGTATATTTATGGACTTGCCTATGGTCATGATTTAAATAGAAAAGTATCCATTTTGGTGGAA---AATGTGGAT------TCTGATAAG------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGCTTCTTTTTGCTAATGATTCTAAA------AAAAATCTA------------TTTTTGGGGTATAACAAGAATTTTTAT---TCTCAAATAATATCAGATGCTTTTGCCGTCATTGTGGAAATTCCATTTTCCCGACAATTC------ATTTCTTCC---------TTAGAGGACGCGGAAACCATAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTCTAATTGGAAT------------ACTTTTATTACTCAA------------AAAAAACGTATTTCTACCTTATCA------------------AAAAGTAATCCAAGATTT------------------------TATATATTC------CTATATAATTTTTATGTATGTGAACATGAATCCATCTTCCTTTTTCTACGTAAAAACTCCTCTCATTTGCGATTAAATTCCTTTAGCCTTCTTTTTGAGCGAATACATTTCTATGCAAAACTAGAACAT------CTTGTCGAAGTCTTTGCT------AAGGATTTTTCATGT---ACCTTAGCATTC------TTCAAGGAT---CCTATGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGCTGAATAAATGGAAATACTATCTCATCTATTTATGGCAATGTCATTTTGATGTTTGGTCTCAAGAAGGAACGATCCGTATAAAA---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATATTTCAAATGTACGGCTAAATTTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCCAATCGAAATTGGTATGAAAAGGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATATTTCTCATTATTACAAAGGATCCTCAAAAAAAAAAGGTTTATATCGAATAAAATATATACTACGGCTTTCTTGTATTAAAACCTTGGCTCGTAAACATAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTGGAAGAATTTTTG---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCTTCTTCCACTTTGCAG------AGTTTATAT------AGAGATCAGATTTGGTATTTGGATATTCTT---TTCAGCCAT------GATCTGTTCAAT---------------TACGAA---------------------------TGA Aeschynomene_indica_AF272084 ATGGAGGAATATCAAATC---------TATTTAGAACTAAATGGATCTCGCCAACATAAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCACCTATGGTCATGATTTAAATATAAATCGATCCTTTTTGGTGGAA---CATATGGAT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAACGATTCTAAC------AAAAACCCA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCTATTTTCCCGACAATTT------CCTTCCGCT---------TTAGAGGAGTCAGAAATAATTCAATCTTTGAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAGGATAAATTGACATATTTGAATTTTGTTTCAGATGTACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAAGTCTTCGATACTGGGTGAAAGATCCCCCCCTCGTTCATTTATTAAGATTATTTCTTTTT------GAATATTGTAATTGGACT------------AGTCTTATTACTAAA------------AAAAAACGTATTTCGACTATCTCA------------------AAAAATAATCCAAGAATT------------------------TTTTTGTTC------CTATATAATTTTTATGTATGGGAACACGAATCCATCTTCCTTTTTCTACGTAAGAAATCCTCTCCTTTACGATTTCACTCTTTTAGCGTTCTTTTTGAGAGAATCTATTTCTATGCAAAAATCGAACAT------CTTGCGGAACTCTTTTCT------AAGAATTTTAGGTTT---CCCTTCTCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------ACGCCTCTGTTGCTGAATAAATGGAAACACTATCTCATCTATTTCTGGCAATGTAATTTTTATGTTTGGTCTCAACCGGGAACGATCCAGATAAAC---CAATTATTATCCGAGCATTTATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAATCAAATGCTAGAAAATTCATTTCTACTCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCGAATTATTCCTTTAATTAGATCTTTAGCTAAAGCGAAATTTTGTAATATCTTAGGGCATCCCATTAGTAAGCCTGTTTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTATAATGGATCTTCAAAAAAAAAAGGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTCTTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCCTTGATTTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAC------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAG------GATCTCGTCAATGTA------------AATGGA---------------------------TAA Aeschynomene_purpusii_AF270870 ATGGAGGCCTATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTACGGTCATGATTTAAATATAAATCGATCCATTTTAGTGGAA---AATGAGGAT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGATAATGATTCTAAA------AAAAAACCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTTCATTTTCCCGACAATTACAATTCCGTTCTTTT---------TTAGAGGAGTCGGAAATCGTAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATGTGAATCTTATTTCAGATGTACAAATACCCTATCCTATTCATCTGGAAATCTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCTTTCATTTATTAAGATTGTTTATTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAACTTATTTCTACTTTTTCA------------------AAAAGTCATCCAAGAATT------------------------CTCTTGTTC------CTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAAGAAATCCTCTTATTTACGATTAAACTCTTTTATCGTTATTTTTGAGCGAATCTATTTCTATGCAAAAATCCAACAT------CTTGTGGAAGTCTTTTCT------AATAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAAACCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATCTCATCTATTTCTGGCAATCTAATTTTGATGTTTGGTCTCAACCTAAAACGATCCATATAAAC---CCATTATTATCTGAGCATTCATTTCATTTTTTTTTGGGGGGTTATTTTTCAAATGTCCGGCTAAATTTTTCAGTGGTNCGGAATCAAATGCTAGAAAATTCATTTCTAATTGAAATTTTTATGAAAAAGCTTGATACAATAGTTCCAATTGTTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCTGTTTGGGCCGATTCATCCGATTTTGATATTATTAACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCACTTTTTTGAACAGA------TTCTATTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTA------------AATGGA---------------------------TAA Afzelia_bella_EU361846 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGCCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGAAAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCG{AT}TACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAAAATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ATCTTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTCTTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGACGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGA---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Aganope_thyrsiflora_JX506602 ATGGAGAAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCATCAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATATAGGT------TATGACAAT------AAA------TCTAGTTTACAAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCTA------------TTTTGGGGGTATAACAATAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGTTGTCATCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGAGTCAGATATACTAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGATGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------TACTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAT------------------AGTAATCTAAGATTT------------------------TTCTTGTTC------GTATATAATTTTTATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTCGCGTTTTTTTTGAACGAATTTTTTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCTTTCAGTAGTACGGAGTCAAATGTTGCAAAATTCATTTCTAATTGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGTATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGATTTTTTCTTTGATCTTTCCA------AAAACTTCTTCCACTTTACAG------AGGTTATAT------AGAGGCCGGATTTGGTATTTGGATATTCTT---TTCAGCAAG------GATCTGGTCAAT---------------CATTCA---------------------------TAA Airyantha_schweinfurthii_JX29589 ATGGAGGAATATCAAGCA---------TATTTAGAACTAGATAGATCTCACCAACCGGAC------TTCCTATACCC------ATTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGGGGAA---AATATAGGT---GGTTATGACAAT------AAA------TCTAGTTTACTAGTTGTAAAACGTTTAATTACTCGACTGTATCAACAGAATCATTTGATTATTTATGCTAATGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATGTGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCCCCGTTCTTTCATTTACTAAGGTTGTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTGATCCAAGATTT------------------------TTCTTGTTC------CTATATCATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------ATTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTTATTTTGATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATATCATTTTGAGGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTACAAAATTCATTTCTAATCGAAATTTTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCCTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTGAAATTTTTGACCGCTTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTCTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AAATCTTCTTCTACTTTGCAG------AGATTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Albizia_versicolor_AF274210 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGANAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAANTTTATATTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCCATTTCTATGCAAAAATCGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCNGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTCCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCAGATATGCAGAGATCTCTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATCTTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCCG------AAGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Aldina_heterophylla_JX295956 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATTTTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNN------------NNNNNNNNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNN------------------NNNNNNNNNNNNNNNNNN------------------------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNN---NNNNNNNNNNNN------NNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNN---NNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAT------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Aldina_insignis_JN168674 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGAAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATTTTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGGGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCATTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGACTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Aldina_latifolia_JX295861 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTAGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATTTTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGGGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCATTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGACTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Alexa_bauhiniiflora_JX295931 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTGTCCTTTTTTCGAGGATAAATTTACCAATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTATACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTTTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGCGTTTCTTCTCCTTTGCAG------AAGTTATAT------AGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Alexa_canaracunensis_JQ669613 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTTTTATTTATGTTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACCAATTTCAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTTTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGCGTTTCTTCTCCTTTGCAG------AAGTTATAT------AGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Alexa_grandiflora_JF491262 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAAAATAAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACCAATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATTCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTTTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTCCTTTGCAG------AGGTTATAT------AGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Alexa_grandiflora_JX295968 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTTTTATTTATGTTAATGATTCTAAC------AAAAATNAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACCAATTTCAATTATGTGTCAGATGTACGAATACCCTATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATTCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTTTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTCCTTTGCAG------AGGTTATAT------AGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Alexa_wachenheimii_JQ626338 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCATTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATTCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATCGACCGATTTGGGCGGATATGCAGAAATCTTTCTCATCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Alhagi_sparsifolia_AY177669 ATGAAGGAATATCAAGTA---------TATTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCCATTTTTGTAGAA---AATTTTGGT------TATGAGAAT------AAA------TTTAGTTTACTAATGGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGTTAATGATTCGAAC------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTAT---TCTCAATTAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGTCGAAATCGTAAAATGTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCGATCCATCTGGAAATCTTAATTCAAATCCTTCGATACTGGGTAAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTTTTATTACTCCA------------AAA---------TCTATTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTGTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAAAAAAGCCTCTCATTTACGATTAAAATCTTTTAGCATTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTCT---ACCTTAACATTC------TTTAAGGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATATTTGGTCTCAACCAGGAACGATCCATATAAAC---CCATTA---TCCGAACATTCATTTCACCTTTTA------GGCTATTTTTCAAATGTTCGGCTAAATCGTTCCGTGGTACGGAGTCAAATGCTAGAAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTGGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TCAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAGGAAGAGATTCTTTCTTTGATTTTTCCA------AGAACTTCTTCTACGTTGCAG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Alistilus_jumellei_JN008191 ATGGAGCAATATCAAGCA---------TATTTAGAACTCCGTAGATCTCGATACCAGGAC------ATCCTATACCC------ACTTTTTTTTCGGGAATCTATTTATGGACTAGCTTATGGTCATGAG---------------TCCATTTTTATAGAA---AATGTAGAT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAAGTACTCGAATGTATCAACAGACTAATTTCATTATTTTTGCTAACGATTCTAAC------AAAAATATT------------TTTGTGGGTTATAACTATAATTTGGTT---TCTCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCTCTACAATCC---CTTAACTCTTCC---------TTAAGGGGATTCGAAATCGTAAAATCTTATAAAAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTTATCTATTTCAATCATAAGTCAGATATACGAGTACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTAATAAGGTTGTTTTTTTAT------TACTATTATAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAATTGATTTCTACTTTTTTT---------------TCAAAAAGGAATCTAAGAATT------------------------TTCTTGTTC------CTATATAATTTCTATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAATAAATCCTCTCAGTTACAGTTAAAACATTTTCGCGTTTTTTTTGAGCGGATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTACT------AAGAATTGTTCATAT---ACCTTATCATTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAAGAAATGCAAATACTATTTTATCTATTTATGGCAATATCATTTTGATATTTGGGCTGGACCAGGAACGATCCCTATCAAC---CAATTA---TCTCAGTATTCTTTTCATTTTTTA------GGCTATTTTTTAAGTATTCCACTCAATATTTCAGTAGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCAAAATTGTTATCAAAAAGCTTGATACAATAGTTCCCATTATTCCTCTAATGAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGATATTCTTGACCGGTTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTTTTTCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAAA------TTAAGTTCAGAAAAATTATTGGAAGAATTTTTT---ACA---GAAGAAGATATTTTTTCTTTGATTTTTCCA------AGAACTTCTTTTACTTTGCAG------AGGTTTTAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTC---------------------------TAA Alysicarpus_vaginalis_JQ587510 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---------------NNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTAT------TACTATTCTGACTGGAAT------------AGTCTTTTTACTCCA------------AAAAAATCGATTTCTACTTTTTTT---------------TTTAAAAGTAATTCAAGATTT------------------------TTCTTACTA------CTATTTAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCCGTTACGATTAAAATATTTTCGTGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGCAGAAATATTTGTT------AAGAATTTTTCGTAT---ACTTTATTATCC------TCTAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAAGCAATTCTGGTTTCAAAGAAT------CCGCCCCTTTTGATAAATAAATGGAAATACTATTTTATTTATTTATGGCAATGTCATTTTGATATTTGGTCTGAACCAGGAACGATCGATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------AGTTATTTTTTAAATATTAGGCTAAATCTTTCAGTGGTACGAAGTCAAATGTTACAAAATTCATCTTTAATTAAAATTGTTATGAAAAAGCTTGATACAATAGTTCTAATTATTCCTCTAATTAGATTATTGGCTAAAGCAAAATTTTGTAATGTATGGGGTCATCCCATTAGTAAGCCGATTTGGGCCAATTTATCTGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGACTTTGTATCAAATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Amblygonocarpus_andongens_AF5218 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNATTGTAAANCGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ACCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAACTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAGAAT------ACGCCTTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTTATGTTTGGTCTCAACCAGGAAGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTAGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAAAAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGTATTTGGTATTTGGATATTTTTGATTTT---------------------------------------CATCAAAGATCTGGTCAATCA------------TGA Amburana_acreana_JX295866 ATGGAGGAATATCAAGTA---------CATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAA---AATGGAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCCCTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTAT------GAGTACTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTATTGTTC------CTATATAATTTTTATGTATATGAATACGAATCTATTTTCCTTTTTCTCCGTAATAAATCCTATCATTTACGATTACCATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCAACATCTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTTATTC------TTCAAGGAT---CCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATTTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAGCGATTCATATAACC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATGCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Amburana_cearensis_AY553712 ATGGAGGAATATCAAGTA---------CATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAA---AATGGAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCCCTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTAGTAAGGTTGTTTCTTTAT------GAGTACTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTATTGTTC------CTATATAATTTTTATGTATATGAATACGAATCTATTTTCCTTTTTCTCCGTAATAAATCCTCTCATTTACGATTACCATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCAACATCTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTTATTC------TTCAAGGAT---CCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATTTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAGCGATTCATATAACC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATGCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Amburana_cearensis_JX846614 ATGGAGGAATATCAAGTA---------CATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAA---AATGGAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCCCTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTAGTAAGGTTGTTTCTTTAT------GAGTACTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTATTGTTC------CTATATAATTTTTATGTATATGAATACGAATCTATTTTCCTTTTTCTCCGTAATAAATCCTCTCATTTACGATTACCATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCAACATCTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTTATTC------TTCAAGGAT---CCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATTTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAGCGATTCATATAACC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATGCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Amherstia_nobilis_EU361849 ATGGAGGAATTGGAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTT------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATCAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTGAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGATTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAATTCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATATAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTCTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAATACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTGACTTTGCAGAGA---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGGA---------------------------TAA Amicia_glandulosa_AF203583 ATGGAGGAATATCAAATC---------TATTTAGAACTAGATGGATCTTGCCACCGGAAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGTCTATGGTCATGATTTAACTAAAAATAGATCTATTTTGGTGGAA---AATGTGGAT------TATGATAAG------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGCTTCTTTTTGCTAATAATTCTAAA------AAAAATATA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTTGGGGAAATTCCATTTTCCCGACAATTG------AGTTCCTCC---------TTAGAGGAGGTCGAAATCGTAAAATCTTTTCAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTTTCAAATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCTTTCATTTTTTAAGATTGTTTCTTTAT------GAGTATGACTATTCGAAT------TGGAATAGTCTTATTACTAAA------------AAAAAACTTATTTCTACTTTATCA------------------AGAAGTAATCCAAGATTT------------------------TTCTTATTC------CTATATAATTTTTTTGTATGTGAACACGAATCCATCTTTCTTTTTCTACGTAATAACTCCTCTCATTTACGATTAAATTCTTTTAGCCTTCTTTTTGAGCGAATCCAATTATATTCAAAAATTGAACAT------CTTGTCGAAGTCTTTGTT------AAGGATTTTTCATCT---ACTTTATTATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGCTCAATAAATGGCAATACTATCTCATCTATTTCTGGCAATGTCATTTTAATGTTTGGTCTCAAGCAGGAACGATCCATATAAAA---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTACGGCTCAATTTTTCACTGGTACGGAGTCAAATGTTAGAAAATTCATTTCCAATCGAAATAGGTAGGAAAAGGCTTGATACAATAGTTCCTATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCTATTAGTAAGCCCGTTTGGACTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAGGTTTGTATCAACTAAAATATATACTTCGGCTTTCTTGCATTAAAACATTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCCGAAGAATTATTGGACGAATTCTTT---ACAGAAGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCCACTTTGCAT------AGGTTATAT------AGGGGTCGGATTTGGTATTTGGATATTATT---TTCAGTAAC------GATCTAGTCAAT---------------CAGGAA---------------------------TGA Ammodendron_argenteum_AY386957 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATACCGCGCCAACAGGAC------TTCTTATACCC------ACTTATTTTTCGTGAATATATTTATGGACTTGCTTATGGTCATGATTTT------AATGGATCCATTTTTACAGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTGATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGTTATAACAAGAATTTATAT---TCTCAAATAATATCAGAAGGTTTTACCACCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTTCTCC---------TTAGAGGGGGCAGAAGTCATAAAATATTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTGACATATTTAAATTATGTGTCAGATGTACGAATCCCCTATCCTATCCATCTGGAAATTTTGGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCTTTCTTCATTTATTAAGGTTGTTTCTTTAT------GAGTGTTGT---------------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTATTC------CTATATCATTTTTATGTATGTGAATATGAATCGATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAATGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGGT------TTTGTCGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTT------TTCACAGAT---ACTTTAATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAATGATCCAAATAAAC---AAATTC---TCCGAACATTCATTTCACATTTTG------GGCTATTTTTCAAGTGTGCGGTTAAATCTTTCAGCAGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATATATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTCCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAAAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGTAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Ammopiptanthus_mongolicus_JQ8201 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGTGAGTATATTTATGGACTTGCTTATGGTCATGATTTT------AATAGATCCATTTTTGCGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTGATTGTAAAACGTTTAATTCCTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGTTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA---ATAAGCTCCTCC---------TTAGAGGGGGCAGAAATCATAAAATATTATAATAATTTGCGATCGATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTACCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AATGATTTTTCGTCT---ACCTTATCATTC------TTCACGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CAATTC---TCCGAACATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCGTTCAGCAGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCTATTATTCCTCTAATTAGATCATTCGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGTTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Ammopiptanthus_nanus_JQ820170 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGTGAGTATATTTATGGACTTGCTTATGGTCATGATTTT------AATAGATCCATTTTTGCGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTGATTGTAAAACGTTTAATTCCTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA------------TTTGGGGGTTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA---ATAAGCTCCTCC---------TTAGAGGGGGCAGAAATCATAAAATATTATAATAATTTGCGATCGATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTACCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AATGATTTTTCGTCT---ACCTTATCATTC------TTCACGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CAATTC---TCCGAACATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCGTTCAGCAGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCTATTATTCCTCTAATTAGATCATTCGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGTTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Amorpha_apiculata_AY391784 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTGGAT------TATGACAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCTATTTCTACTTTTTCA------------------AAAAATAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTGATG{AT}TTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTTGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGT{AT}ATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACANCGGATCCTCAAACAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTTTTT---TCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCG------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Amorpha_fruticosa_AY391785 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTGGAT------TATGACAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTNGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCTATTTCTACTTTTTCA------------------AAAAATAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGNACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATNCAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAANCAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAANTTTTT---TCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCG------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Amphicarpaea_bracteata_AY582971 ATGGAGGAATATCGAGCA---------TATTTAGAACTCCATAGATCTCGACACCAGGAC------ACCCTATACCC------ACTTTTTTTTCGGGAATATATTTATGGACTAGCTTGTGGTCATGGG---------------TCCATTTTGGTAGAA---AGTGTAGGT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTCATCATTTTTGCTAACGATTCTAAC------AAAAATCCT------------TTTAGGGGTTATAACAATCATTTTTAT---TCTCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAAATTCGATTTTCCCTACAATTA---TTTATCTCTTCC---------TTAAGGGAATTAGAAATCATCAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCTTGAGTCAGATATACGAATACCTTATCCTATCCATCTGGAAATTTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTTTTTCATTTATTAAGGTTGTTTTTTTCT------TACTATTATAATAGGAAT------------AATCTTTTTACTCCA------------AAAAAATGGATTTCTACTTTTTTT---------------TCAAAAAGTAATCCAAGCTTT------------------------TTCTTGTTC------CTATATAATTTATATGTACAGGAATATGAATCTATTTTTATTTTTCTACGTAACAAATCCTCTCAGTTACGGTTAAAATATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTGTT------AAGGATTGTTCATAT---ACCTTCTCATTC------TTTAAGGAT---ACTTTTATCCATTATGTTAGATATCAAGGAAAATCCATTCTGGTTTCAAAGAAT------ACTCCACTTTTTATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCGACCAGGAACGATCCATATAAAC---CAATTA---TCCCGGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCGGCTCAATTTTTCAGTGGTACGAAGTCAGATGTTGCAAAATTCATTTCTAATAAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTTCTCTAATTAGATCGTTGGCTAAAGCAAAATTTTGTAATGTATTTGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGATATTATTGACCGGTTTTTGCGGATATGCAGAAATTTTTATCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTGTATCAAATAAGATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGCACGCACTTTTTTAAAAAGA------TTAGGTTCGGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGATATTTTTTCTTTGATTTTTCCAATTCCAAAAACTTCTTTTACTGTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTA---------------------------TAA Amphimas_pterocarpoides_JX295894 ATGGAGGAATATCAAGTA---------TATTTAAAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGGTCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------ATAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGACAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTCTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCAAAAATTACTCCAAAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------CGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATAGGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATCATT---TTCAGCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Amphiodon_effusus_JX295892 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCACCAACAGGAC------TTCCTATACCC------ACTTCTTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCCAATCTTGTGGAA---AATGTCGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAA------AAAAATCCA------------TTTTGGGGGTATAACAAGGATTTGTAC---TCTCAAATGATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCGAAAATCATAAAATCCTATCATAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTAAATATTTAAATTATGCGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAGGATGTCCCCTTTTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGCAAT------AGTAATAGTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------------------AAAAAGAATCCAGGATTC------------------------TTTTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTATCTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCAT------CTTGTAGAAGTCTTTGCT------AAAGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATTTCATTTTGATCTTTGGTCTCAACCAGGAATGACCCAGATAAAT---CAATTC---TCCGAGCATCCATTTCACTTTTTG------GACTATTTTTCAAATGTGCGGTTAAATATTTCAGTGGTACGTAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTTTGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAGTTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTCTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATAAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------CGAGCTTCTTCTATTTTGCAG------AGGTTCTAT------AGAGGTCGGATTTGGTATTTGGATATTTTT---TTCAGCAAC------GATCTAGTCAAT---------------TATGAA---------------------------TGA Anarthrophyllum_desideratum_AY38 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGCAC------TTCCTATACCC------ACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAA---AATGTCGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCGGCTAATTATTCTAAA------AAAAATCAA------------TTTTTGGGGTATAATAAGAATTTGTAT---TCTGAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAAGGGACAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTTCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCCATCCATCTCGAAATCTTGGTTCAAGTCTTTCGATATTGGGCGAAAGATGCCCCTTTGTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AATCTTATTACTCCA------------AAAAAATCGATTTCTATTTTTTCA------------------AAAAGTAATCTAAGAGTT------------------------TTTTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTATAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAG---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCACAGAAT------GCGTCCCTTTTGATGTATAAATGGAAAAACTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCAGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATCAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTCGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTTTTTGATCTTTCAA------AGGGCTTCTTCTACTTTGAAG------GGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Ancistrotropis_peduncularis_JN00 ATGGAGAAATATCAAGCA---------TATTTAGAACTCCGTAGATCTAGATACCAGGAT------ATCCTATACCC------ACTTTTTTTTCGGGAATCTATTTATGGACTAGCTTATGGTCATGAG---------------TCCTTTTTTATAGAA---AATGTAGAT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAAGTACTCGAATGTATCAACAGACTCATTTCATTCTTTTTGCTAACGATTCTAAC------AAAAATACT------------TTTGTGGGTTATAACTATAATTTTGAT---TCTCAAATAATATTAGAAGGTTTTGGTGTCGTCGTGGAGATTTTATTTTCTCTACAATTC---TTTATCTCTTCC---------TTAAGGGGATTAGAAAGCGTAAAATTTTATCAAAATTTGCAATCAATTCATTCTATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATAAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATGGGATAAAAGATGTCTCTTTCTTTCATTTAATAAGGTTGTTTTTTTAT------TACTATTATAATTGGAAT------------AGTCTTTTTCCTCCA------------AAAAAATGGATTTCTACTTTTTTT---------------TCAAAAAGGAATCTAAGAATT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAAAAAATCCTCTCAGTTACAGTTAAAACATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAAGAAAACAT------CTTGTAGAAGTATCTACT------AAGAATTGTTCATAT---ACCTTATTCTTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTCGTTTTAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATATATTTATGGCAATGTCATTTTGATATTTGGGCTGGACCAGGAACGATCTATATAAAC---CAATTA---TCTCAGTATTCATTTCACTTTTTA------GGCTATTTTTTAAGTATTCCACAAAATCTTTCAGTAGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCAAAATTGTGATAAAAAAACTTGATACAATAGTTCCCATTATTCCTCTAATCAGATCATTGGCTAAAACAAAATTTTGTAATGTAATGGGTCATCCCATTAGGTAGCCGGTTTGGGCCAATTTATCTGATTTTTATATTCTTGACCGGTTTTTGCGCATATGCAGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTCTATCAAATAAAATATATACTTCGGTTTTCTGGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAAA------TTAAGTTCAGAAAAATTATTGGAAGAATTTTTT---ACA---GAAGAAGATCTTTTTTCTTTGATTTTTCCA------AGAACTTCTTTGACTTTGCGG------AGGTTTTAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTAGAATTTCAAATAGGTTATGATACTTTTTAA Andira_carvalhoi_JX295958 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAAAAAATTCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCT{CT}CCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCTTTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Andira_galeottiana_AF142681 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGGGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCNNNNNNNNNNNNNNNNNNNNNNNCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAAAAAAAAAAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTAAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCAT------AGTCAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Andira_humilis_JX295960 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAAAAAATTCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAANNNNNNNNN------NNNNNNNNNNNNNNN---NNNNNNNNNNNN------NNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNN---NNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Andira_inermis_JF501102 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTAATCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTTAAAGATGCCCCTTTCTCTCATTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTA---AAA---------------AAAAAAAATGAGAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCTTTCAGAGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTCTGCAG------AGGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Andira_legalis_JX295893 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAAAAAATTCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Andira_marauensis_JX295899 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGGAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAAAAAATTCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTCCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGTTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAATACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Andira_ormosioides_JX295962 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGGGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAAAAAAAAANNNNNNN------------------------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNN---NNNNNNNNNNNN------NNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNN---NNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTCAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Andira_sp_JX295896 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAAAAAATTCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCT{CT}CCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Angylocalyx_sp_AY553715 ATGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTCGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATACTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGCCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTTCTAGTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATGCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTAGTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGTATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCACTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Angylocalyx_talbotii_JQ669611 ATGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTCGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATACTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGCCCTTCGATACTGGGTGAAAGATACCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATGCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTAGTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGTATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCACTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Anthyllis_vulneraria_AF543845 ATGGAGGAATATCTGTTA---------TATTTGGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTGTTTTTCACGAATATATTTATGGACTCGCTTATAGTCATGATGTA------AATAGATCTATTTTTGTAGAA---AATATAGGT------TATGATAAT------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCAAATGTATCGACAGAATCATTTGATTATTTCGACTAAAGATTCTAAC------AAAAATAGA------------TTTTTGAGGTATAATAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCTATTTTCTTTACAATTA------AGCTCGTCC---------TTAGAGGAGGCAGAAATCATCAAATCTTATAAAAATCTGCGATCAATTCATTCTATTTTTCCCTTTTTTGAGGATAAAGTTACATATTTAAATTATATATCAGATATACGAGTCCCTTATCCTATCCATCTGGAAATCTTAGTCCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTGTTTCATTTATTAAGATTGTTTCTTTAT------GATTATTGTAATTGGAAT------------AGTATTATTATTCCC------------CAAAAATCTATTTCTAATTTTTCA------------------AAAAAGAATCCAAGATTT------------------------TTCTTCTTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTTTTTTTTCTACGTACCAAATCTTCTCATTTACGATTAAAATCTTTTAGAGTTTTTTTTGAGCGAATTTTTTTCTATGCAAAAAAAGGACAT------CTTGTAGAAGTATTTGTT------AAGGATTTTTTTTCT---ACCTTAACATTC------TTTAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCCAAGAAT------TTGCCTATTTTAATGAATAAATGGAAATACTATTTTATCCATCTATGGCAATGTTATTTTGATGTTTGGTCTCAACCGCGAACAATCCATATAAAC---CAATTA---TCCGAATATTCATTTCACTTTTTG------GGCTATTTTTTAAGGGTGGGGCTGAAGCATTCAGTGGTACGGGGTCAAACGCTGCAAAATGGATTTCTAATCAAAATTATTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCAATAATTAGATTATTGGCTAAATCGAAATTTTGTAATGTATTAGGGAATCCCCTTAGTAAGCCGTCTTGGGCCGACTTATCTGATTTTGAGATTATTGCCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTCCGGCTTTCGTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACCGTACGCGCTTTTTTGAAAAGA------TTAGGTTCTGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCG------AGAACTTCTTCTACTTTACAG------AGGTTACAT------AGAAATCGAATTTGGTATTTGGATATTCTT---TTTAGCAACAATAACGATCTAATCAAT---------------CATGAT---------------------------TGA Aotus_ericoides_AY386884 ATGGAGGAATACCCGGTA---------TATTTAGAATTTGATAGATCCCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATGTTTATGGAATCGCTTACGGACATGATTTA------AATAGATCCATTTTTGTAAAA---AATGTAGGT------TATGACAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCCTTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA------------TTTTTGGCGTATAACAAGGATTTAGAT---TCTCGAATAATATCCGGTGGATTTGCCGTCGTTGTGGAAATTCCATTTTCCCCGCAATTC------AGCTCTTTT---------TTAGAGGAGACACAAATAGTAAAATCGTATAACAATTTGCGATCAATTCATTCAACTTTTCCCTTTTTTGAGGATAAATTTACATATTTAAACTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATATGGGTTCAAACTCTTCGATACTGGTTGAAAGATACCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT---------AGTAGTCTTATTACTCCA------------GAAAAATTGATTTATACTTTTTCAAAA---------------AGTAATCATCCAAGATTT------------------------TTCTTGTTT------CTCTATAATTTTTATGTATGGGAATACGAATCTATCTTCCTTTTTCTACGTAATAAATCATCTTATTTACGATTAAAATCTTTTATCGTTCTTTTTGAACGAATCTATTTCTATGCAAAAATGGAACAT------CTTGTAGAAGTATTTTCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAAGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTACAAAGAAT------ACACCTCTTTTGATAAAAAAATGGAAATATTATTTTATACATTTCTGGCAATGTCATTTTGATGTTTGGTATCAACCGGAAATGATCCATATAAAC---CAATTC---TCCAAGCATTCATTTTATTTTTTG------GGCTATTTTTCAAACGTGCGGCTAAATCCTTCTGCAGTAAGGAGTCAAATGCTGCAAAGTTCATTTCTAATCGAAAATGTTACGAAAAAGCTTGATACAATAGTTCCAATTATTCGTCTAATTAAATCATTGGCGAAAGCGAAATTTTGTAATGGATTGGGGCATCCCATTAGTAAGTCGATCTGGGCTGATTCACCCGATTTTTTTATAATTGAGCGATTTTTGAAGATCTATAGAAATATTTCTCATTTTTACAAAGGATCCTCAAAAAAAAAAAATTTGTATCGAATAAAGTATATACTTAGGCTTTCTTGTGTGAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTCTTGAAAAGA------TTATCTTCGGGAGAATTTTTGGAAGAATTTGTT---ACAGAGGAAGAAGAGATTCTTCCTTTGATCTTTCCA------AAAACTTCTTGTACTTTGCAGTGG---GGTTTCTAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCACCAAC------GATCTGGTGAAT---------------CGTGAA---------------------------TAA Aphanocalyx_cynometroides_EU3618 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGTTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATAATTCTAAC------AAAAATCCA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCGTTC---------TTAGAGGAGACAAAAATTGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCCTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTGTATTCAAACCCTTCATTATTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTATCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATCGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACTCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGTTCGATATAAAGGAGAATCCATTCTGGTTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGACGGATCCATATAAGC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTCGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTCTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCCGAGA---AGGTTCTAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GCTCTGGTCAAT---------------GATGAA---------------------------TGA Apios_americana_AY386926 ATGGAGGAATATCGAGTC---------TATTTAGAACTCCATAGATCTCGCCACCAGGAC------ATCCTATACCC------ACTTTTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGGA---------------TCCATTTTTGTAGAA---AATGTAGGT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTTTGCTAATGATTCTAAC------AAAAATCCT------------TTTTGGGGTTATAACAATAATTTTTAC---CCTCCAATAATATTAGAGGGTTTTGTTGTCGTCGTGGAGATTCGATTTTCCCTACAATTA---TTTATCTCTTCC---------TTAGAGGAGTTAGAACTCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAAGATAAATTTATATGTTTAAATCGTGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTATTTCTTTCATTTATTAAGGTTGTTTTTTGAT------TACTATTGTAATTGGAAT------------ATTATTTTGACTCCA------------AAAAAATCGATTTCTACTTTTTTT---------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAAAATCTTTTCGTGTTTTTTTTGAGCGAATTTTTTTCTATGCAAAAATAGAACAT------CTTGTAGAAAAATTTGCT------AAGGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCCATTCTGGTTTCAAAGAAT------ACACCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCGGCTAAATCTTTCAGTGGTACGTAGTCAAATGTTGAAAAATTCATTTCTAATAAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCCATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATGAAATAAAATATATACTTAGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGCGCGCACTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGATCTTTTTTCTTTGATTTTTACA------GGAACTTCTTTGACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGAAAC------GATTTGGTCAAT---------------CATTCA---------------------------TAA Apoplanesia_paniculata_AF270860 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTGGAT------TATGACAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATCGA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTTGTAAAATCTTATAAGAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAATAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACACCGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTTTTT---TCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Apuleia_leiocarpa_EU361858 ATGGAGGAATCTCAAATA---------TATTTCGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATACACTTGCTTATGATCATGGTTTA------AATAGTTCAATTTTGGTAGAA---AATGTAGGT------TATGACAAA------AAA------TCTAGTTTACTAATTGTAAAACATTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCCGAGGGGTTTGCCGTCATTGTGGAAATTCCATTATCTTTACAATTA------------TCC---------TTAGAGGAGGCAAAAATCATAAAATCTTAT---AAATTACGATCAGTTCATTCAATATTTCCTTTCTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTCCGAATACCCTATCCTATCCATCTGGAAATATTGGTTCAAAGCCTTCGCTACTGGGTCAAAGATGCCTCTTCTTTTCATTTATTAAGACTCTTTCTTTAC------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAATTCA------------AAAAGTAATCCAAGATTT------------------------TTCTTGGTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCGTCTCATTTACGATTAACATCTTCTGGAGTTCTTTTTGAGCGAGTATATTTCTATGGAAAAAGAGAGCAT------CTTGTAGAAGTCTTTGCT------AATGATTTTCCGTCT---ACCCTATGGTTC------CTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATCCTGGCTTCAAAGAAT------ACGCCTCTTTTGATCAATAAATGGAAATACTATTTTATCAATTTATGGCAATGTCATTTTTGTGTTTGGTCTCAACCAGGAAGGATCCATATAAAC---CAATTC---TCCGAGCATTCGTTTTACTTTCTG------GGCTATTTTTCAAAAGTCCGGCTATATCCTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCGTTTATAATAGAAAATTTTATGAAAAAGCTCGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCGAAAGCGAAATTTTGTAACGTATTAGGGCACCCCATTAGTAAGCCAGTCTGGGCTGATTCATCAGATTTTTATATTATTTACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTCGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTACCA------AGAACTTCTTCTACTTGGCAG------AGGTTATAT------AGAAGTCGGATTTGGTATTTGGATATTATT---TGCATCACT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Apurimacia_dolichocarpa_FJ968527 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGANAGATCTCGCCACCATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATGATCATGATTTA------AATAAATCCATTTTTGTGGAA---AATATAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTATTCGAATGAGTCTAAC------AAAAATCCA------------TTTTGGGGATATAACAATAATTTTTAT---TCTCAAATAATATTCGAGGGTTTTGTTGTTGTCGTGGAAATTCCATTTTCCCTACAATTN------ANTTCTTCT---------TTAGGGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATTAT---------TATTGTAATTGGAAT------------AGTCTTCTTNATTCA------------AATAAATCAATTTCTATTTTTTCAAAT------------TCAAAAAGTNATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATATATNCTTTTTTTTCTNCGTAACAAATCCTCTCATTTNCGATTAGAATCTNTTTGCGTTCNTTTTGAACGAATTTATTTCTGTGCAAAAATAGAACAT------CTTGTACAAGTCGTTGAN------AAGAATTTTTCGTAT---ACNTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTNTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTNATTNATTTATGGCAATGTCATTTTGATGNNTGGTCTCAACCAGGAATGATCCATATAAAT---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGCTATTTTTTAAATATGCAGTTAAATCTTNCAGTGGTACGGAGTCAAATGTGCAAAAATTNNTTNCNAANNGAAATTGTNATGAAAANGCTTGAGACAATAGTTCCAATTATTCTTCTAATTAGATCATTGATTAAAGCGAAATTTTGTAATGTATTGGGGCATCCTATTAGTAAGTCGGTTTGGACCGATTCATCCGATTTTGATATTCTTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTATAACGGATCCTCAAAAAGAAGAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGATCCGAAAAATTATTGGAAGAGTTCTTT---ACAGAAGAAGAAGAGATTTTTTCTTTGATCTTTCAA------AGAACTTCTTCTCCTTTCCAG------AGATTACAT------AGAGGTCGAATTTGGTATTTAGATATTCTT---TTCGGCAAT------GATCTGATCAAT---------------CATTTA---------------------------TAA Arachis_pintoi_AF203596 ATGAAAGAATATCAAAGA---------TATTTAGAACTAGATAGATCTCCTCAACAGAAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTCTGGTCATGATTTTAATAGAAATCGATATATTTTGTCGGAA---AATGTGGAT------TATGATAAG------AAA------TCTAGCTTACTAATTGTAAAACGGTTAATTACTCGAATATATCAACAGAATCATTTGATTATTTTTGATAACGATTCAAGT------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCATTGTCATGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGAAATCATAAAATCTTTTAATAATTTGCAATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAAATTTTTTTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTTATTTTGACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTT------CTACATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAAAAATCCTCTTTTTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATGGAGCAT------CTTGTAGAAGTCTTTTCG------AATAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAGATACTATCTCATTTATTTCTGGCAATGTTATTTTGATATTTGGTCTCAACCCCGAATGATCCATATAAAC---GAATTA---TTTGAGAATTCATTTCATTTTTTTTGGGGGGGCTATCTTTCAAATGTACGGCTAAACTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATAGAAATTGGTATGAAAAAACTTGATACAATAGTCCCAATTATTCCCTTAATTAGATCTTTAGCTAAAGCGAAATTTTGTAATATATTAGGACATCCCATTAGTAAGCCCGTTTGGGCCGATTCATCTGATTTTGATATAATTGACCGGTTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAA---AGTTTGTATCGAATAAAATATATAATTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGGACTTTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTAAAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGATCTTCGTCTACTTTGCAG------AGGTTATAT------AGAAGTCGGATTTGGTATTTGGATATTCTT---TTCAGTAAC------GATCCAATCAATGTA------------AAT------------------------------TGA Arapatiella_psilophylla_EU361859 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAA---AATCTAGGT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAAGAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTACCAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAAGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATCTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAAATTTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACACGTTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Archidendron_hirsutum_EU361860 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGCAGGTATGCAGAGATCTCTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAATACTGTACGGGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Arcoa_gonavensis_EU361861 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCAATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCTTTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTCAAAGATGCCTCTTCTTTTCACTTATTAAGGCTCTTTCTTTAT------GAGTATTGGAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAATATCTTCTGGAGTCCTTTTTGAGCGATTCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCATTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCTTATAAAC---AAATTA---TCCGAGCATTCATTTGACTTTTTG------GGTTATTTTTTAAATGTGCGACTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATTGAAAATTTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAACGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGAGATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTCTAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Argyrolobium_velutinum_JQ412199 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTGTTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AATCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCTAAGAGTT------------------------TTCTTATTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCCTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTATAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAAGAG---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTTTGGCTTCAAAGAAT------GCGTCCCTTTTGATGAATAAATGGAAAAACTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAACGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Aspalathus_pinguis_JQ412203 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTCTTTCACTTATTAAGGTTGTTTCTTTCT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTTTTGTTT------TTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTAAGTAATAAATCCTCTTATTTACAATTAACATCTTTTAGCGTTCTTTTTGAGAGAATCTATTTCTATGGAAAAATAGAACAT------TTTTTAAAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATACCAAGGCAAATCCTTTTTTGCTTCAAGGAAT------GCGCCCCTTTCGATGAATAAATGGAAAAACTATCTTATCCGTTTATGGCAAGGTTATTTTAATGTTTGGTCTCAACCTGGAATGATCAAAATCAGC---CAATTC---TCCGAGCATTCATTTCATCTTTTG------GGTTATTTTTCAAATGTGCGGTTAAATCTTGCAGCGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCACTTATTCCTCTAATTAAATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATCAGTAAGCCGGCCTGGGCCCATTCATCCGATTTTGATATTATTGACCGATTTTTGCGTATATGTCGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Astragalus_canadensis_AY386875 ATGAAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATATCC------ACTTATTTTTAGGGAGTATGTTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCTACATTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TATAGTTTACTAATTGTAAAACGTTTAATCACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCGAATGATTCTAAG------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTT------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATTCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTTTTCTTACTCCA------------AAAAAATCGATTTCGACTTTTTCA------------------AAAAATAATCCGAGATTA------------------------TTCTTATTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTCT---ACCTTAACATTC------TTCAAGGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGGAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAA---CAATTA---TCCGAACATTCCTTTTACCTTTTA------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGGCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TCGGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCGTCTTCTACTTTGCAG------AAGTTACAT------GGAAATAGGATTTGGTATTTAGATATTCTT---TTCAGTAAT------GATTTGGTCAAT---------------CATGAA---------------------------TGA Ateleia_arsenii_GU220019 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTAGAA---AATGTAGGT------TATGGCAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTATTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTTGGGGTATAACAAAAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---TCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATCTTATCTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAAAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTTGGTTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Ateleia_glazioveana_GU220020 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATCGATCTCGCCAACAGGAT------TTTCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGGCAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTATTATTTCTGCTAATGATTCTACA------AAAAATCCA------------TTTTTGGGGTATAACAAAAATTTGTAT---TCGAAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTGATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---TCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTGTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTTTGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTTGGTTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Ateleia_guaraya_JX295883 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGGCAAA------AAA------TCGAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTGGGGGTATAACAAAAATTTGTAT---TCGCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTCAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---TCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTGTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTTGGTTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Ateleia_herbertsmithii_AY386953 ATGGAGGAATATAAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGGCAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTGGGGGTATAACAAAAATTTGTAT---TCGCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTCGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---TCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTGTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTCTGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAGAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTTGGTTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Ateleia_mcvaughii_GU220021 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTAGAA---AATGTAGGT------TATGGCAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTATTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTTGGGGTATAACAAAAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTTA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---TCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTTGGTTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Ateleia_popenoei_GU220022 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGGCAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAAATTTATTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTTGGGGTATAACAAAAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---TCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTTGGTTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTTATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Ateleia_pterocarpa_GU220023 ATGGAGGAATCTCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGGCAAA------AAA------TCGAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTGGGGGTATAACAAAAATTTGTAT---TCGCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTCAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---TCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTGTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTTGGTTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Austrosteenisia_blackii_AF142707 ATGGATGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTAACCATGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCGTTTTTGTAGAA---AATATAAGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTTATTTGATCATTTTTCCTAATGATTCTAAC------AAAAATCCT------------TTTTGGGGATATAACAACAATTTTTAT---TCTCAAATAATATCCGAGGGTTTTGTTATCGTCGTGGAAATTCCATTTTTCCTACAATTT------AGTTCTTCT---------TTAGAGGAGACAAAAATCGTAAAATATTATAAAAATTTGCGATCCATTCATTCTATTTTCCCTCTTTTCGAGGATAAATTTACATATTTAAATCATGAGTCCGATATACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGATCAAAGATGTACCTTTCTTGCATTTATTAAGATTGTTTTTTTAT------TACTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------CAAAAATCTATTTCTACTTTTTCA------------------AAAAATAATCCCCGATTT------------------------TTCTTGTTC------CTATTTAATTTTTATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAATAAATCCACTCATCTACGATTAAAATCTTTTCGTGTTCTTATTGAGAGAATTTCTTTCTATGCAAAAGTAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTAT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ATGCCTCTTTTGATGAATAAATGGAAATCTTATTTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCTAGAACTATTCATATAAAG---CAATTA---TCCAAGCATTCATTTTACTTTTTG------GGTTATTTTTTAAATGTACAACTAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAACAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTGGGACATCCCATTAGTAAACCGGTCTGGGCCGATTTATCTGATTTTGATATTATTGACCGATTTTTGTGGATATGCAGAAATTTTTCTCAGTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGTCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGATATTTTTTCTTTGATCTTTTCA------AAAACTTCTTCCACTTTACAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATCTTCTT---TTCAGCAAT------GATCTAATCAAT---------------TATTCA---------------------------TAA Baphia_leptobotrys_EU361865 ATGGAGGAATATCAAGTC---------TATTTCGAATTAGATAGATCTCACCAACCAGAC------TTCCTATACCC------ATTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTCGAA---AATATAGGT---GGTTATGACAAT------AAA------TCTAGTTTACTAGTTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAATAATTTTGAT---TCTCAAATAATATCAGAGGGTTTTGCCATTGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAAAGGAGGCAGAAATTGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTCTTCGAGGATAAATTTACATATTTGAATTATGTGTCCGATGTACGAATACCCTATCCTACCCATCTGGAAATCTTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCTATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATCATTTTTATGTATGTGAATACGAATCTATATTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------CTTGTAGAAGTCGTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---TCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGCTTCAAAGAAT------GCGCTGATTTTGATGAATAAATGGAGATACTATTTTACCCATTTCTGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---CCCGAACATTCATTTCACTTTTTG------GACTATTTTTCAAATGTACGTCTCAATTTTTCAGTGGTACGGAGTCAAATGCTACAAAATTCATTTATAATCGAAATTTTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCATTAGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGACTCATCCGATTTTGAGATTTTTGATCGATTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAACATAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTCTTCCAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGATTATAT------AAAGGTCGGATTTGGTATTTGGATATTCTT---TTCGGCAAC------AATCCGGTCAAT---------------CATTTA---------------------------TGA Baphia_madagascariensis_AY553718 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTGACCAACCGGAC------TTCCTATACCC------ATTACTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATGGATCCATTTTTTTGGGA---AATATAGGT---GGTTATGACAAT------AAA------TCTAGTTTATTAGTTATAAAACGTTTAATTATTCAAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAAAATAAA------------TTTTTGGGGTATAACAAGAATTCTTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAAAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCCATTCATTCAATTTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATATGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTTTTTATTTAT------AAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------------------AAAAGTGATCCAAGATTT------------------------TTCTTGTTC------CTATATCATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTTATTTTGATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATACATATAAAC---CAATTA---TCCAAACATTCATTTCACTCTTTG------GGCTATTTTTCAAATGTGCGTCTAAATCTTTCAGTGGTATGGAGTCAAATGCTACAAGATTCATTTCTAATCGAAATCTTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCATTGGTTAAAGCGAAATTTTGTAATGTATCAGGACATCCCATTAGTAAGCCGGTCTGGGCTGATTCATCCAATTTTGAAATTTTTGACCGATTCTTTCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAGAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAGACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTCTTGGAAGAATTCTTT---ACAGAGGAAGAAGAAATTCTTTCTCTGATCTTCCCA------AAAACTTCTTCTACTTTGCAG------AGATTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCGGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Baphia_massaiensis_AF142683 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCACCAACCGGAC------TTACTATACCC------ATTAATGTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAA---AATATAGGT---GGTTATGACAAT------AAA------TCTAGTTTACTAGTTATAAAACGTTTAATTATTCAAATGCATCAACAGAATCATTTGATTCTTTATGTTAATGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAAAATCTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTTGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAAAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCTATTCATTCAATCTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATGTGTCCGATGTACGAATGCCCTATCCTATCCATCTGGAAATATTGGTTCAAACCNNNNNNNNNNNNNNNNNNNNNNNCCCTTTCTTTCATTTATTAAGGTTTTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATCATTCTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAAAAT------CTTGTAGAAGCCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTTATTTTGATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATGT---TTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCAACCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTTCGTCTAAATCTTTCAGTGGTATGGAGTCAAATTCTACAAAATTCATTTCTAATTGAATTTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATNNNNNNAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAAATTTTTGACCGATTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAGAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTCTTCCAAGAATTCTTT---ACAGAGGAAGAAGAAATTCTTTCTTTAATCTTTCCA------AAAGTTTCTTCTACTTTACAG------AGATTATAT------AGAGGTCGGATTTGGCATTTGGATATTCTT---TTCGGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Baphia_nitida_EU361867 ATGGAGGAATATCAAGCA---------TATTTAGAACTAGATAGATCTCACCAACCGGAC------TTCCTATACCC------ATTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCCTTTTTTGTGGAA---AATATAGGT---GGTTATGACAAT------AAA------TCTAGTTTACTAGTTGTAAAACGTTTAATTACTCGGTTGTATCAACAGAATCATTTGATTTTTTATGCTAATGATTCTAAC------AAAAATCAA------------TCTTTGGGGTATAACAATAATTTGTAT---TCTCAAATAATATCCGAGGGTTTTGCAGTCGTCGTCGAAATTCCATTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTCTTCGAGGATCAATTTACATATTTAAATTATGTGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTGATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAGATCGATTTCCACTTTTTCA------------------AAAAGTGATCCAAGATTT------------------------TTCTTGTTC------CTATATCATTCTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACTTTCTCATTC------TTCAAGGAGGATACTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTTATTTTCATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATATTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGCCATTTTTCAAATGTGCGGCTCAATCTTTCAGTGGTACGGAGTCAAATGCTACAAAATTCATTTCTAATCGAGATTTTTATGAAAAAGCTTGATCCAATAGTTCCAATTATTCCTCTAATTAGAGCATTGGCTAAAGCTAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCAGTCTGGGCCGATTCATCCGATTTTGAGATTTTTGACCACTTTTTTCGGATATGCAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTTGGCTTTCGTGTATAAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAAGGATTCTTGGAAGAATTCTTT---ACAGAGGAAGAAGAAATTCTTTCTTTGATCTTTCCA------AAATCTTCTTCTACTTTGCAG------AGATTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTAATCAAT---------------CATTCA---------------------------TGA Baphiopsis_parviflora_JX295895 ATGGAGGAATATCAAGTA---TANTTTAATTTAGAACTAGATAGATCTCACCAACCGGAC------TTCCTATACCC------ATTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAA---AATATAGGT---GGTTATGACAAT------AAA------TCTAGTTTACTAGTTATAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAGAATCAA------------ATCTTGGGGTATAACAAGAATTCTTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAAAGGAGGCAAAAATCGTAAAATCTTATAAGAATTTGCGATCCATTCATTCCGTTTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATGTGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATATTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTTTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAGAATCGATTTCTATTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATCATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------ATTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCGAAGAAT------GCGCTTATTTTGATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAATGATCCATATAAAC---CAATTA---TCCAAACATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGTCTAAATCTTTCAGTGGTACGGAGTCAAATGCTACAAAATTCATTTCTAATCAATATTTTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCGTCTAATTAGAGCATTGGCTAAAGCAAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGCGATTTTTGACCGATTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCTAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTAGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTCTTGGAAGAATTCTTT---ACAGAGGAAGAAGAAATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGATTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCGGCAAC------GATCTGGTCAAT---------------AATGAA---------------------------TGA Baptisia_australis_AY386900 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGGAC------TTCTTATACCC------ACTTATTTTTCGTGAGTATATTTATGGACTCGTTTATGGTCATGATTTT------AATGGATCTATTTTTGCGGAA---AATGCAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTCATGATTCTAAA------AAAAATCAA------------TTTTGGGGTTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCCTCC---------TTAGAGGGGGTAGAAATCATAAAATATTATAATAATTTGCGATCAATTCACTCTATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCGATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTTAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTCTGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCGCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTACAGAT---CCTTTCATTCATTATGTTAGATATCACGGAAAATACATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CAATTC---TCCGAACATTCATTTCACCTTTGG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCGGCAGTACGGAGTCAAATGTTAGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCGATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTACGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAACTTCTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAGAGGCAGAGGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Barnebydendron_riedelii_EU361868 ATGGAGGAATTTCAAGTA---------TATTTAGAATTAAATAGGTTTCAGCAATATGAC------CTGCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACGGAATCATTTTATTATTTCTGCTAATGATTGTAAC------AAAAATCCA------------TTTAGTGGGTACAACAAGAATTTTTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGGCAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCATATATACGAATCCCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTGTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCTATTTCTACTTTTTCA------------------AACAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTTTCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATGTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATCGAATAT------CTTGTAAAAGTGTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTGT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTACAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCTAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTCTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAACATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTGTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Barnebyella_calycina_JQ669593 ATGAAGGAATATCAAGTA---------TTTTTAGAACGAAATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTAGGGAGTATGTTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCTACATTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TATAGTTTACTAATTGTAAAACGTTTAATCACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCGAATGATTCTAAG------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCATTGTGGAAATTCCATTTTTTCTACAATTT------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCGCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTTTTCTTACTCCA------------AAAAAATCGATTTCGACTTTTTCA------------------AAAAGTAATCCGAGATTA------------------------TTCTTATTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTCT---ACCTTAACATTC------TTCAAGGAT---CCTCTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCACTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGGAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAA---CAATTA---TCCGAACATTCATTTTACCTTTTA------AGCTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGGTGCAAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGGCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGAGCTTTTTTGAAAAGA------TCGGGTTCAGAAGAATTTTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCGTCTTCTACTTTGCAG------AAGTTACAT------GGAAATAGGATTTGGTATTTAGATATTCTT---TTCAGTAAT------GATTTGGTCAAT---------------CATGAA---------------------------TGA Batesia_floribunda_EU361869 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTTTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTT------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTAATCCA------------AAAAAATGGATTTCTGCTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCTATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATTGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGAGATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAACAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCATTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Bauhinia_galpinii_EU361875 ATGGAGGAATTTCAAGTA---------TATTTAGAAATATATAGATCTCGGAAACATGAC------TTCCTATACCC------ACTTATCTTTCGTGAATATATTTATACACTTGCTTATGATCGTGGTTTA------AATAACTCCATTTGGGTGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTTGGGGTACAACAAAAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAAGGAAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCACTCAATATTTCCTTTTTTCGAGGATCAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATTTGGAAATTCTGCTTCAAACCCTTCGCTATTGGTTGAAAGATGTTTCGTCTCTTCATTTATTAAGGATCTTTCTTCAC------CAATATTGTAATTGGAAT------------AGTCTTATTACTCTA------------AGAAAATCGATTTCTACTTTTTCC------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTGCATGTCTTCGAATATGAATCCATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCCTTTGGAGTCCTTTTTGAGCGAATATATTTCTATGGAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAAGATTTTCTGTCG---ACCTTATGGTTA------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCGATTCTGGCTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAGAATCCATATAAAC---CAATTA---TCTGAGCATTCATTCTACTTTTTGTTTTTGGGCTATTTTTCAAGTGTGCGACTAAATCCTTCAGTGGTACGGAGTCGAATGCTGGAAAATTCATTTATAATAGAAAATGTTAGGAAAAAGCTTAATACAATAGTTCCAATTATTCCTCTAATGAAATTATTGGCTAAAGCGAAATTTTGTAACGTATTAGGCCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTGTGCGGATATGCAGAAATTTTTATCATTATTACAATGGATCTTCAAAAAAAAAGAATTTGTATCGAGTAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCCTTTTTGAAAAGA------TTAGGTTCAGAA---TTATGGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCGA------AGAGCCTCTTCTACTTCGCAG------AGGTTATAT------AGAGGTCGAATTTGGTATTTAGATATTATT---TGCATCAAT------GATTTAGTCAAT---------------CATGAA---------------------------TGA Berlinia_congolensis_EU361881 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATAATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAAAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCGTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTGGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTGGGATTCAACCCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATAGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGACGGATCCATATAAGC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTCTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCCGAGA---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GCTCTGGTCAAT---------------GATGAA---------------------------TGA Bionia_bella_Torres12 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATGGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTGTTGAGTATAACAATAATTTTTAT---TCTCAATTAATATTAGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACGCTTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGCTACTGGGTGAAAGATGTCTCTTTCTTTTATTTATTTAGGTTGTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCAATTTCTACTTTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCCTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTA------GGCTATTTTTTAAGTGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAGATTTTGTAATGTATTGGGGCATCCCATTAGTAAATCGGTCTGGTCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAGGGGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTAGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAAAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAGGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Bionia_coriacea_LPQ13611 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTGTTGAGTATAACAATAATTTTTAT---TCTCAATTAATATTAGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGCTACTGGGTGAAAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---------NNNNATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCAATT------TTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATACAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTTATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAATCGGTCTGGTCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGGGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Bituminaria_bituminosa_JF501107 ATGGAGGAATATCGAGCA---------TATTTAGAACTCCATAGATCTCGACACCAGGAC------ACCCTATACCC------ACTTTTTTTTCGGGAATATATTTATGGACTAGCTTGTGGTTATGGG---------------TCCATTTTTGTAGAA---AATGTAGGT------TATAACAAA------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACCCATTTCATCATTTTTGCTAATGATTCTAAC------AAAAATCCT------------TTTAGGGGTTATAATAATCATTTTAAT---TCTCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTAGTTTCCCTACAATTA---TTTACC---------------TCAAGGGAATTAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTTTTTTTTTCT------TACTATTATAATAATAAT------TGGAATAGTTTTTTTACTCCA------------AAAAAAAGGATTTCTACTTTTTTT---------------TCAAAAAGTAATCCAAGCTTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTACCAAATCCTCTCAGTTACGGTTAAAATATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTGTT------AAGGATTGTTCATAT---ACCTTATCATTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCCATTCTGGTTTCAAAGAAT------ACTCCCCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCGACCAGAAACGATCCATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCAGCTCAATCTTTCAGTGGTACGAAGTCAGATGTTGCAAAATTCATTTCTAATCAAAATTATTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTCGATCTTTGGCTAAAGCAAAATTTTGTAATGTGTTTGGTCATCCTATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGATATTATTGACCGGTTTTTGCGGATATGCCGAAATTTTTCTCATTATTACAATGGATCCACAAAAAAAAAAAGTTTGTATCAAATAAGATATATACTTCGGCTTTCTTGTATAAAAACCTTGGCTCGTAAGCACAAAAGTACTGCGCGCACTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTTTTT---ACAGAAGAAGAAGATCTTTTTTCTTTGATTTTTCCA------AGAACTTCGGTTACTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTA---------------------------TAA Bobgunnia_fistuloides_EU361885 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTATTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGACAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAAGTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAGGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCCCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTATTGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCTTCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGGTTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGATCAAT---------------CATGAA---------------------------TGA Bobgunnia_madagascariensis_AY386 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTATTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGACAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAAGTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAAGCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAGGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCCCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCTTCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGGTTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGATCAAT---------------CATGAA---------------------------TGA Bocoa_prouacensis_FJ037904 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNTTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTTCTATTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACCT------ATTTTCGAAGTATTTGCT------AAGAATTTTTTGTCT---ACCTTATCATTC------TTCAGGGAT---CCCTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAATCAAAGATGATCCATATAAAC---CAATTA---TCCGGGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTAGAATTGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGTGGATATGTGGAAACCTTTCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Bocoa_prouacensis_JQ626415 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNTTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTTCTATTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACCT------ATTTTCGAAGTATTTGCT------AAGAATTTTTTGTCT---ACCTTATCATTC------TTCAGGGAT---CCCTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAATCAAAGATGATCCATATAAAC---CAATTA---TCCGGGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTAGAATTGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGTGGATATGTGGAAACCTTTCTCATTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Bolusanthus_speciosus_AF142685 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATATCTCGCCAACAGGAC------TTCCTATATCC------ACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCATTTTTGCAGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTG------AGCTCTTCC---------TTAGAAGAGGCAGAAATCATAAAATATTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGGGTTAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAATATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---ACTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTAATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CAATTC---TCTGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGCTAGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCGTTAGTAAATCGGTCTGGGCCGATTTATCCGATTTTGATATTTATGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCGNNTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTAAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAATTTCAAAGAACTTCTTCGACTTTGCAG------AGGTTGTAT------AGGGGCGGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGATCAAT---------------CATGAA---------------------------TGA Bolusia_amboensis_JQ040984 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTCCTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTAAGTAATAAATTGTCTCATTTACGATTAACATCTTTTAGTCTTCTTTTTGAGAGAATCTATTTCTATGGAAAAATTAAACAT------TTTGTAGAAGTCTTTGTT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCTTTTTGGTTTCAAGAAAT------GCGCCCCTTTTGATGAATAAATGGAAAAATTATCTTATCCATTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCAGGAATGATCCAAATAAGC---CAATTC---TCCGAGCATTCATTTTACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTCGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCAGCCTGGGCTCATTCATCCGATTTTGATATTATTGACCGATTTTTGCACATATATAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Bossiaea_cordigera_AY386888 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCCCGCCAACGGGAC------TTCCTATACCC------ACTTATTTTTCGGGAATATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATTCGTTTTTGCGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTGATTACTCGAATGTATCAACAGAATCCTTTTCTTTTTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTTTGGATATAACAAAAATTTAGAC---TCTCAAATAATATCCAGGGGATTACCCGTCGCCGGGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGATGGGGCAGAAATCGTAAAATCTTATAAGAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAACTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT---------AATAGTCTTATTACTCCA------------CAAAAATCGATTTATACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTTTTTTTC------CTATATAATTTTTATGTAGGGGAATACGAATATATCTTCTTTTTTCTACGTAACAAATCATCTAATTTACGATTCAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGAAAAAATAGAACAT------CTTGTAGACGTCTTTTCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAAGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGTCTTCAAAGAAT------CAACCTTTTTTGATGAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTTATTTTGATGTTTGGTCTCAAGCAGGAATGATCCATATAAAC---CAATTA---TCCAAGTATTCCTTTCACTTTTTA------GGCTATTTTTCAAATGTTCATCTAAATCTTTCCGCGTTAAGGAGTCAAACGCTACATAATTCATTTCTAATCAAAAATGTTACCAAAAAGTTTGATGCAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTATGGGCCGATTCAGCCGATTTTTATATTATTCACCGATTTTTGAGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAATAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCTTGTATTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGCACTTTTTTAAAAAGA------TTAGGTTCGGAAGAATTATTGGAAGAATTTTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATATTTCAA------AGAGCTTCTTCTACTTTGTGG------GGGTTAGAT------CGAAGTCGGATTTGGTATTTGGATATTCTT---TTTAGCAAC------GATCTGTTCAGT---------------CATGAA---------------------------TGA Bowdichia_nitida_JX124395 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCGTGATTTT------AATAGATCAATCTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATTATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAAGAAA------------TTCTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------GGAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATCTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Bowdichia_virgiloides_AY386937 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCGTGATTTT------AATAGATCAATCTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATTATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAAGAAA------------TTCTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------GGAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATCTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Brachypterum_robustum_AF142716 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCACCATGAC------TTCCTATACCC------ACTTCTTTTTCGGGAATATATTTATGGACTTGCTTATGATCATGATTTA------AATAGATCCATTTTTGTAGAA---AATATAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTATGCTAATGAGTCTAAC------AAAAATCCA------------TTTTGGGGATATAACAATCATTTTTAT---TCTCAAATAATATTAGAAGGTTTTGTTGTTGTCGTGGAAATTCCATTTTCACTACAATTT------CGTTTTTCT---------TTAGGGGGGGGAGAAATCATAAAATATTTTTCTAATTTGCGATCAATTCATTCCATTTTTCCCCTTTTCGAAGATAAATTTACATATTTCAATTATAAGTCAGATATACAAATACCCTATCCTATCCATCTGGAAATCTTGATTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTCATTTATTAAGATTGTTTTATTAT---------TATTGTAATTGGAAT------------AGTCTTATTAATTCA------------AAGAAATCAATTTCTATTTTTTCAAAT------------TCAAAAAGTAATCCAAGAATT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATATATCTTTTTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTGTGCAAAAATAGAACAT------ATTGTACAAGTCGTTGAT------AAGCATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCGAAGAAT------ACGCCTCTTTTGGTGAATAAATGGAAATACTATTTGATTTATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATCAAA---AAATTA---TCCGAACATTCATTTCACTTTTTG------GGCTATTTTTTAAATATGCAGTTAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAATTGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCTTCTAATTAGATCATTAATTAAAGCGAAATTTTGTAATTANT{GT}GGGGTATCCTATTAGTAAGTCGGTTTGGACCGATTCATCCGATTTTGATATTCTTGACCGATTTTTGCGGATATGCAGAAATTTTGTTCATTATTACA{AC}CGGATCCTCNAAAAGAAGGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGATCCGAAAAATTGTTGGAAGAATTCTTTTTTACAGAAGAAGAAGAGATTTTTTCTTTGATCTTTCAA------AGAACTTCTTCTTCTTTCCAG------AGATTACGT------AGAGGTCGAATTTGGTATTTAGATATTCTT---TTCAGCAAT------GATCTGATCAAT---------------CATTTA---------------------------TAA Brandzeia_filicifolia_EU361870 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAAATAGGTTTCAGCAATATGAT------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTGCTTCAC------GAGTATTGTAATTGGAAC------------ATTCGTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTCCT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTCAGGGGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGTAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATAT------AGAATCCGTATTTGGTATTTGGATATTTTT---TGCATCAAC------GATCTGGTCAAT---------------GATGAA---------------------------TGA Brodriguesia_santosii_EU361890 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGAAAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTATTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAAAATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ATCTTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACTCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTCTTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCCTTCGTGTATTAAAACTTTGGGTCGTAAACCCAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGACGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGA---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Brongniartia_alamosana_AF142688 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTAGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTG------AATAGATCCAATTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA------AAAAATCCA------------TTTTGGGGGTCTAACAAGGATTTGTAT---TCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCGAAAATCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTGAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATATCCCCTTCTTTCATTTATTAAGGTTATTTTTTTAT------GAGTATTGGAATTGCAAT------------ACTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------------------AAAAGGAATCCAGGATTC------------------------TTTTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGGT------AAAGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGGCCCATATAAAT---CAATTC---TCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGGTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGAATTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAGTAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTGGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTATTTTACAC------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTAGTCAAT---------------TATGAA---------------------------TGA Brongniartia_peninsularis_GQ2461 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTAGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTG------AATAGATCCAATTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA------AAAAATCCA------------TTTTGGGGGTCTAACAAGGATTTGTAT---TCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCGAAAATCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATATCCCCTTCTTTCATTTATTAAGGTTATTTTTTTAT------GAGTATTGGAATTGCAAT------------ACTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------------------AAAAGGAATCCAAGATTT------------------------TTTTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGGT------AAAGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGGCCCATATAAAT---CAATTC---TCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAGTAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTGGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTATTTTACAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATCTAGTCAAT---------------TATGAA---------------------------TGA Brownea_coccinea_EU361891 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGTTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------ACAAATAAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCATAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAAGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTGGATTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCCTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCAAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTCCT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGGCGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTCTGCGAATATGCAGAAATATTTCTCATTATTCCAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGA---AGTTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATATGGTCAAT---------------GATGAA---------------------------TGA Brya_ebenus_AF270876 ATGAAAGAATATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAAAAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATAGTCATGATTTCTATTTAAATCGATCCATTTTTGTCGAA---AATGTGGATGTGGATTATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTTCTAACGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAAAATTTGTAT---TCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTCCCCGAAAATTA------ACTTCTTCT---------TTAGAGAAGGTGGAAATCGTCAAATTTTTTAATAATTTGAGATCAATTCATTCCATTTTTTGCTTTTTCGAGGAAAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTCTACTTTTTTA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGCGAACACGAATCCATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAGCTCTTTTAGCATTCTTTTTGAACGAATCTATTTCTATGCGAAAATAGAACAT------CTTGTAAAAGTATTTTCT------AAGAATTTTTCGTCC---ACCTTATCCTTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTGATCTATTTTAGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCGGAGCATTCATTTCACTTTTTGGGGGGAGGCTATCTTTCAAATGTTCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAACTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGACATCCCATTAGTAAGCCCCTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTATAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAGAGTACTGTACGCACTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTGGAAGAATTCTTT---ACGGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGCATTTGGTATTTAGATATTCTT---TTCAGTAAC------GATTTGATCAATGTA------------AATGGA---------------------------TAA Bryaspis_lupulina_AF272068 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNN------------NNNNNNNNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNN------------------NNNNNNNNNNNNNNNNNN------------------------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNN---NNNNNNNNNNNN------NNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATTTTTCTCATTATTATAATGGATCCTCAAAAAAA---AGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCCTTGATTTTTCCA------AGAGTTTCTTCCACTTTGCAG------AGGTTATAC------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAG------GATCTGGTCAATGTA------------AATGGA---------------------------TAA Butea_monosperma_JN008175 ATGGAGGAATATCGAATA---------TATTTAGAACTCCATAGATCTCGCCACCAGGAC------ATCTTATACCC------GCTTTTTTTTCGGGAATATATTTATGGACTCGTTTATGGTCATGGG---------------TCCATTTTTGTAGAAAAAAATGTAGGT------TATAACAAA------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTTTGCTAATGATTCTAAC------AAAAATCCT------------TTTTGGGGTTATAATAATAATTTTTAT---TCTCAAATAATATTTGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCCCTACAATTA---TTTATACCTTCC---------TTAAAGGATTTAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAATTTATATATTTAAATCATAAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTTTCTTTCTTTCATTTATTAAGATTGTTTTTTTAT------TACTATTGTAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAATGGATTTCTACTTTTTTT---------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATTCCTATATAATTTATATATACGGGAATATGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCAGTTACTATTAAAATATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------ATTGTAGAAGTATTTGCT------AAGGATTTTTCCTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATTTATTTATGGCAATGTCATTTTGATATTTGGTCTCAACCAGTAACGATCCATAGAAAC---CAATTA---TACCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCGGCTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATAAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTGATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTGTTGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTATCTTATTTTGATATTATTGAACGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAACGTTTGTATCGAATCAGATACATACTTCGACTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGATATTTTTTCTTTGATTTTTCCA------AGAACTTCTTTTACTTTGCAG------AGGTTATAT------ATAGTTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTGATCAAT---------------CATTCA---------------------------TAA Cadia_purpurea_JX295932 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATACATTTTTGCGGAA---AGTGTAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTACTGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAAAGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAAACGTAAAATATTATAATAAATTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTGCGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTCTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------TTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAACAAATCCTCTCATTTACGATTAATATCTTTTAACATTCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTTTGGCAATGTCATTTTGATGTTTGGTCTCAGCCAGGAACGATCAAAATAAAC---CAATTC---CCCGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGAAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAATGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Caesalpinia_pulcherrima_EU361906 ATGGATAAATTTCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATACACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAA---AATCTAGGT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTTCTAATGATTCTAAC------AAAAATAAA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCTGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTACTTTTTTTGAGGAAAGATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTATACCTTTTCA------------------AAAATTAATCCAAGATTA------------------------TTCCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTCTCTTTCTTTTTCTCCGTAACAAATCGTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCAATTTCTATGCAAAAATAGAAGAT------TTTATAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCTTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATAAAGGAAAATTAATTTTGGCTTCAAAGAAT------ATGCCCTTTTTGATGACTAAATGGAAATACTATCTTATCCTTTTATGTCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATAGAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATTTCAAATACTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGTCTAAAGCGAGATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGAACGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGTCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTGGGCTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTCCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Cajanus_cajan_EU717414 ATGGAGGAATATCAAGCA---------TATTTAGAACTCCATAGATCTCGCTACCAGGAC------ATCTTATACCC------ACTTTTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGGG---------------TCCTTTTTTGTAGAA---AATTTAGGT------TATAACAAT------CCA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTGTCAACAGACTCATTTGATCATTTTTGCTAAAGATTCTAAC------CAAAATCCT------------TTGGGGTTTTATAACAATAATTTTTAT---TCTCAAATAATATTAGAAGGTTTTGTTGTCGTTGTGGAGATTCTATTTTCCCTACAATTA---TTTATCTCTTCC---------TTAAAGGAATTAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTCCCTTTTTAGAAGATAAATTTATATATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------TACTATTGTAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAATGGATTTCTACTTTTTTT---------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTC------TTATATAATTTATACGTCCGGGAATCAGAATCTATCTTTCTTTTTTTACGTAACAAATCCTCTCAGTTACGATTAAAATATTTTCACGTTTTTTTTGAGCGAATTTTGTTCTATGAAAAAATAGAATAT------CTTGTAGAAGTATTTACT------ACGGATTTTTCATAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCCATTCTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCAATCAGTAACGATTCATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCGGCTAAATATTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATAAAAATTGTTATAAAAAAGCTTGATACAATAGTTCCAATTTTTCCTCTAATTAGATCATTGGCAAAAGCAAAATTTTGTAATCTATTGGGTCATCCCATTAGTAAGTCGGTTTGGGCCAATTTATCTTATTTTGATATTATTGACCGATTTTTGCGTATATGTAGAAATTTTTCTCATTATTACAATGGATCTGCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAAA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGACGATATTTTTTATTTTATTTTTACA------AGAACTTCTTTTACTTTGCAG------AGGTTATAT------ATAGGTCCGATTTGGTATTTGGATATTCTT---TTCAAAAAC------GATTTGGTCAAT---------------AATTCA---------------------------TAA Callerya_reticulata_JQ619954 ATGAAGGAATATCAAGCA---------TATTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCCATTTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTAT---TCTCAAATAATATCAGACGGTTTTGCCGTCGTTGTGGAAATTCCATTTTTCCTACAATTA------AACTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATCATAATTTGCGATCAATTCATTCAATTTTTCCCTTTTTGGAGGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCTCTTTTTTTCATTTATTACGGTTTTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAATGTAATCCAAGATTA------------------------TTCTTGTTC------CTCTATAATTTTTATGTATGGGAATATGAATCTATCTTCCTTTTTCTACGTAACCAATCCTCTCATTTACGATTCAAATCTTTTAGCGTCTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTCTAAAAGTTTTTCCT------AAGGATTTTTCGTCT---ACCTTAACATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGAAAAATCCATTCTGGCATCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCGCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAAA------TCTGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCTTCTTCTACTTTGAAG------AGATTACAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Calliandra_juzepczukii_EU812063 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTC------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTGATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------CTCCTGTTC------CTATATAAATTTTATGTATGTGAATACGANTCCATCTNNCNTTTTCTCCGTACCAAATCTTCTTATTNACGATTAACATCTTNTGGAGTCTTTTTTGANCGAATCTATTTCTATGCAAAAATAGANCAT------TTTGTAGAAGTCTTTGAT------AAGNATTTNCCGTCC---ACCCTATGGTTC------TTCAAGGNC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCAGATATGCAGAGATCTCTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAGAGTACTGTACGGGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Calophaca_pskemica_JQ669603 ATGAAGGAATATCAAGTA---------TATTTAGAACGGGATAGATCTCGCCAACAGGAC------TCCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCCAGTTTTGTGGAA---AATGTGGGT------TATGACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATCAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTGCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------CATTTTTGTAATTGGAAT------------AGTTTTAGTACTCCA------------AAA---------TCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTCTATAATCTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTCAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTCT---ACCTTAACATTC------TTCAATGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GGGCCTCTTGTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATATTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACCTTTTA------GGCTATTTTTCAAATGTTCGGTTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAAGACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACCTTGGCTTGTAAACACAAAACCACTGTACGCGCTTTTTTGAAAAGA------TCGGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGATTCTTTCTTTTATTTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTACGG------AGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Calopogonium_sp_JQ669608 ATGGAGGAATATCGAGCA---------TATTTAGAACTCCATAGATCTCGACACCAGGAC------ATCCTATACCC------ACTTTTTTTTCGGGAATATATTTATGGACTACCTTATGGTCATGGG---------------TCCATTTTTGTAGAA---AATATGGGT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTCATCATTTTTGCTAACGATTCTAAC------ACAAATCCT------------TTTAGGGGTTATAACAATCATTTTGAT---TCTGAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCCCTACAATTA---TTTATCTCTTCC---------TTAAGGGAATTAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAAACTGATATATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTTTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------TACGATTATAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAACGGATTTCTACTTTTTTT---------------TCAAAAAGGAATCCAAGATTT------------------------TTATTGTTC------CTTTATAATTTATATGTACGGGAATATGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCAGTTACGGTTAAAAGATTTTCTTGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------TTTGTAAAAGTATCTGTT------AAGGATTGTTCATAT---ATCTTATCATTC------TTTAACGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAGTGTTATTTTATCTATTTATGGCAATATCATTTTGATATTTGGTCTCGACCAGGAACGATTCATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCGGCTAAATCTTTCAGTGGTACGAAGTCAGATGTTGCAAAATTCATTTCTAATAAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTAGTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTTGGTCATCCCATTAGTAAGCCGGTTTGGGCCAGTTTATCTGATTTTGATATTATTGACCGGTTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAATAGTTTGTATCAAATAAGATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGCGCGCACTTTTTTGAAAAAA------TTAGGTTCAGAAAAATTATTGGAAGATTTCTTT---ACAGAAGAAGAAGATATTTTTTCTTTGATTTTTCCA------AGAACTTCTTTTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGAATATTCTG---TTCAGAAAC------GATTTCGTCAAT---------------CATTTA---------------------------TAA Calpurnia_aurea_AY386951 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCATTTTTGCGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATATTATAATAAATTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGACGTGCGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCNNNNNNNNNNNNNNNNNNNNNNNCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTCTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACCTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAAGAAATCCTCTTATTTACGATTAATATCTTTTAACGTTCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTGCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATCTCATTTTGATGTTTGGTCTCAGCCAGGAACGATCCAAATAAAC---CAATTC---CCCGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGAAGTCAAATGCTGGAAAATTCATTTCTAATTGAAATTGTTATGAAAAAGCTTGATACNATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACACCCCATTAGTAAGCTGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAATGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTGTACTTTACAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Camoensia_brevicalyx_JX295946 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTCATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATCTT------AATGGATCAATTCTTGTGGAA---AATGTAGGT------TATGAAAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTGTAAA------AAAGATCAA------------TTTTGGGGATATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCAATCAATTCATTCAATTTTTCCGTTTTTTGAGGATAAATTTACATATTTAAGTTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTTTAATTGGAAT------------AGTCTTATTACTCCA------------AAGAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTATGGCTTCAAAGAGT------GCGCCCCTTTTGATGAATAAATGGAAATACTATTTTCTCCATTTATGGCAATGTGATTTTGATGTTTGGTCTCAACCAGAAACCATCCATATAAAC---CAATTC---TCCGAACATTCATTTCACTTTTTG------GGTTATTTTTCAAATGTGCGGTTAAATCTCTCGGTGGTACGGAGTCAAATGCTGGAGAATTCATTTCTAATCGAGATTGTTATGAAAAAGTTTGATACAATAGTTCCAATTATTCGTCTAATTAGATCATTGGCTAAAGCAAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAACCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGGCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCCCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAGATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTAATTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGCATTTGGATATTATT---TTCAGCAAC------GATCTGATCAAT---------------CATCAA---------------------------TGA Camoensia_scandens_JX295919 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTCATTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATCTT------AATGGATCAATTCTTGTGGAA---AATGTAGGT------TATGAAAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTGTAAA------AAAGATCAA------------TTTTGGGGATATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAGTTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTTTAATTGGAAT------------AGTCTTATTACTCCA------------AAGAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCGTTGCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTATGGCTTCAAAGAGT------GCGCCCCTTTTGATGAATAAATGGAAATACTATTTTCTCCATTTATGGCAATGTGATTTTGATGTTTGGTCTCAACCAGAAACCATCCATATAAAC---CAATTC---TCCGAACATTCATTTCACTTTTTG------GGTTATTTTTCAAATGTGCGGTTAAATCTCTCAGTGGTACGGAGTCAAATGTTGGAGAATTCATTTCTAATCGAGATTGTTATGAAAAAGTTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGGCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCCCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAGATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTAATTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGCATTTGGATATTATT---TTCAGCAAC------GATCTGATCAAT---------------CATCAA---------------------------TGA Camptosema_ellipticum_LPQ14073 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCTATTTTTGTAGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTGTTGAGTATAACAGTAATTTTTAT---TCTCAATTAATATTAGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTAGTTCAAATCCTTCGCTACTGGGTGAAAGATGTCTCTTTCTTTTATTTATTTAGGTTTTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCCATT------TTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTTTAATCGAAATTGTTATAAAAAAGTTTGATACAATAATTCCAATTATTCTTCTAATTCGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAATCGGTCTGGTCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGGGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGATTTTTTGAAAAGA------TTGGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Camptosema_spectabile_LPQ7088 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATGGATCCATTTTTGTAGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTGTTGAGTATAACCATAATTTTTAT---TCTCAATTAATATTAGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGCTACTGGGTGAAAGATGTCTCTTTCTTTTATTTATTTAGGTTGTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCAATT------TTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATACAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTTATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAATCGGTCTGGTCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAACGGATACTCAAAAAAAAAGGGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAACATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Campylotropis_macrocarpa_AY38687 ATGGAGGAATATCGCGTA---------TTTTTAGAACTCCATAGATCTCGCCACCGGGAC------ATCCTATACCC------GCTTTTTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCGTGGA---------------TCCATTTTTGTGGAA---AATGTAGGT------TATAATAAG------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTATTGTTAATGATTCTAAC------AAAAATCCT------------TTTTTGGGTTATAACAATAATTATTAT---TCTCAAATAATATTCGAAGGTTTTGTTGTCGTTCTAGAGATTCTATTTTCTCTACAATTA---TATATATCTTCC---------TTAAAAGAGTTAGAAATCGTAAAATCTTATCAAAATTTGGGATCAATTCATTCCATTTTTCCTTTTTTCGAAGATAAATTTATATATTTCAATCATAAGTCAGATATAAGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCTTTCGATATTGGATAAAAGATGTCTTTTTCTTTCACTTATTAAGGTTGTTTTTTTAT------TACTATTGTGACGAGAAC------------AGTTTTTTTACTCCC------------CAAAAATCGATTTCTACTTTTTTT---------------TTTAAAAGTAATCCAAGATTT------------------------TTCTTACTA------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAATAAATCCTCTCAGTTACGATTGAAATATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGCAGAAATATTTGTT------AAGAATTTCTCATAT---ACCTTATCATCC------TTCAGGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCAACCAAGAACGATTGATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------GGTTATTTTTTAAGTATTAGGCTAAATCTTTCAGTGGTACGAAGTCAAATGTTACAAAATTCATCTCTAATAAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCGATTATTCCTCTAATTAGATTATTGGCTAAAGCAAAATTTTGTAATGTATGGGGTCATCCTATTAGTAAGACGGTTTGGGCCAATTTATCTGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGACTTTGTATCAAATAAAATATATATTTCGGCTTTCTTGTATAAAAACTTTGGCCCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAGA------TTACGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAGGGTATTTTTTCTTTGATTTTTCCA------AGAACTTCTTTTACTTTGCAG------AAGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTGTT---TTCAGAAAT------GATTGGGTCAAT---------------CATTCA---------------------------TAA Canavalia_parviflora_HQ707539 ATGGGAGAGTATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGAGTATAACAATAATTTTTAT---TCTCAATTAATATTAGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGATACTGGATGAAAGATGCCTCTTTCTTTTATTTATTTAAGTTGTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCAATTTCTACTTTTTCAAAT------------TCAAAAAGGAATCTAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTTTTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTAAAATGTTGCAAAATTCATTTCTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGACATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTGTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTGTCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGATGTTTTTTCTTTGATCTTTCCA------AGAATTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Candolleodendron_brachystachyum NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTATTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACCT------CTTTTCGAAGTATTTGCT------AAGAATTTTTTGTCT---ACCTTATCATTC------TTCAGGGAT---CCCTTCATCCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGTAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACCAAAGATGATCCATATAAAC---CAATTA---TCCGGGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTAGAATTGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCGGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGATCAAT---------------CATGAT---------------------------TGA Candolleodendron_brachystachyum2 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATGGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATCTTAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTATTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACCT------CTTTTCGAAGTATTTGCT------AAGAATTTTTTGTCT---ACCTTATCATTC------TTCAGGGAT---CCCTTCATCCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGTAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACCAAAGATGATCCATATAAAC---CAATTA---TCCGGGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTAGAATTGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCGGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGATCAAT---------------CATGAT---------------------------TGA Caragana_arborescens_AF142737 ATGAAGGAATATCAAGTA---------TATTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCCAGTTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAATAANAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTA------AGCTCTTCC---------TTAGAGGAAGCAGAAATCGTAAAATCTTATCAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATTGGAAT------------AGTTTTAGTACTCCA------------AAA---------TCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTCT---ACCTTAACATTC------TTCAATGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GGGCCTCTTGTGATGAATAAATGGAAACACTATTGTATCCATTTATGGCAATGTTTTTTTGATATTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACCTTTTA------GGCTATTTTTCAAATGTTCGGTTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAAGGGATCCCATTAGTAAGCCGGTTTGGGGCGATTCATCCGATTTTGATATTATTGAACGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAACCACTGTACGCGCTTTTTTGAAAAGA------TCGGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGGGATTCTTTCTTTGATTTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Carmichaelia_williamsii_AY386873 ATGAAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTAGGGAGTATGTTTATGGACTTGCTTATAGTCATGATTTTAATTTTAAGAGATCTACATTTGTGGAA---AATTTAGGT------TATGACAAT------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTAT---TCTAAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTT------AGCTCTTCC---------TTAGGGGAGGCAGAAATCGTAAAATCTTCTAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAATTTTCCATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTTTTATTACTCAA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCGAGATTA------------------------TTCTTATTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTACTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTCCGTCT---ACCTTAACATTC------TTCAAGGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATTCATTTATGGGAATGTTTTTTTGACGTTTGGTCTCAACCAGGAACGATCCATATAAAA---CAATTA---TCCGAACATTCAATTTACCTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCCAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGGCGGTATGGGCCGATTCATCCGATTTTGATATTATTGACAGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TCTGGTTCAGAAGAATTATTGGCAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCGTCTTCGACTTTGCAG------AAGTTAAAT------GGAAATAGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATTTGGTCAAT---------------CATGAA---------------------------TGA Cascaronia_astragalina_AF272072 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTACGGTCATGATTTAAATATAAATCGATCCATTTTGGTGGAA---AATGTGGAT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAT------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTATTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAGATCACCCCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAGAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCCGGAACGATCCATATAAAC---CAATTATTATTCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTTCGGCTAAATTTCTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATTGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTATGTAATATATTAGGGCATCCCATNNNNNNNNCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAANGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTA------------AATGGA---------------------------TAA Cassia_grandis_EU361909 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAAATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------CAAAATACA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGACAGAAATCGTCAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAGATTTTCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTTTAATTGGAAT------AGGAATAGTCTTATTACTCCA------------AAAAATTGGATTTCTACTTTTTCA------------------AAAAGGAATCCAAGATTA------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCCTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATTGAAAATGTTATGAAAAAGCTTGATACAAAAATTCCAATTATTCCACTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGCGGAGATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAACAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Castanospermum_australe_JX295891 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATAAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACCAATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTTTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTTTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTCCTTTGCAG------AGGTTATAT------AGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Centrolobium_robustum_EU401414 ATGAAACAATATCAAATA---------TATTTAGAACTAGATGGATCTCGCCAACAGAGC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAATAGAAATCGATCCATTTTGGTGGAA---AATGTGGAT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAAAGAAGGCGGAAATCGTAAAATCTTTTCAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATACCCCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAACACGAATCCATTTTCCTTTTTCTACGTAATAAATCCTCTGATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATACATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTAAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATGCTCAAAAAAAAAANGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGATTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTA------------AATGGA---------------------------TAA Centrosema_sagittatum_JQ587552 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATTTCATTTATTAAGGTTGTTTTATTAT------TATTATTGTAATTGGAAT------------AGTCTTATTACTCCG---------------------ATTTCTACTTTTTCA------------------AAAAGTAATACAAGATTT------------------------TTGTTGTTT------CTATATAATTTTTATGTATGGGAATATGAATCTATCTTCCTTTTTCTACGTAAGAAATCTTCTCATTTACGATTAAAATCTTTTCGTGTTATTTTTGAGCGAATTTTTTTCTATGCAAAAATAGATTAT------CTTGTAGAAGTCTTTACT------AAGGATTTATTATAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCAATTCTGATTTCAAAGAAT------ACGTCTCTTTTGATCAATAAATGGAGATACTATTTTTTCTATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACTAGGAACGATCCATATAAAC---CAATTA---TTTGAACATTCATTTCACTTTTTG------GACTATTTTTTAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGTTACAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTNGATACAATAGTTCCCATTTTTCTTCTAATTCGATTATTGGGTAAAGCGAAATTTTGTAATGTCGTGGGGTACCCCATTAGTAAGTCCGGCTGGACCGATTCNCCCGATTTTGATATTATTGACCGATTTTTGCGGATATACAGAAATTTTTNTCATTATTACAACGGATCCTCNAAAAAAAAAAGTTTGTATCGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Ceratonia_siliqua_EU361911 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGCTAGATCTCGCCAACATGAC------TTCCTGTACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAAGAGA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAAGCAAAAATCATAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTATTTAT------GAGTATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCATTTTTTATGAATAAATGGAAATACTATCTTATACATTTATGGCAATGTAATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTACGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGTTAAATTTTGTAATGGATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTATTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCCACTTTGCAT------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Cercis_canadensis_AY386908 ATGGAGGAATTTCAAGTA---------TATTTAGAACTATATAGATCTCGGCAACACGAC------TTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGGTTA------AATAGCTCCATTTTTGTGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCCGCTAATGATTCTACC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTAT---TTTCAAATAATATCAGAAGGGTTTGCCGGCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAAAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCACTCAATATTTCCGTTTTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATTTGGAAATTCTGCTTCAAACCCTTCGCTATTGGTTGAAAGATGTCTCGTCTTTTCATTTATTAAGGATCTTTCTTCAC------AAATATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTTAAATTTA------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTGCATGTCTTCGAATATGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCCTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGGAAAAATAGAACAT------CTTGTAAAAGTCTTTGCT------AAAGATTTTCTGTCG---ACCCTATGGTTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAGAATCCATATAAAC---CAATTA---TCTGAGCATTCATTCTACTTTTTGTTTTTGGGCTATTTTTCAAGTGTTCGGCTAAATCCTTCAGTGGTACGGAGTCGAATGCTGGAAAATTCATTTATAATAGAAAATGTTAGGAAAAAGCTTAATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCTAAATTTTGTAACGTATTAGGTCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTGTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCGAGTAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCCTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAGGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTCCAG------AGGTTATAT------AGAGGTCGAATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Cercis_gigantea_AY386948 ATGGAGGAATTTCAAGTA---------TATTTAGAACTATATAGATCTCGGCAACACGAC------TTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGGTTA------AATAGCTCCATTTTTGTGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCCGCTAATGATTCTACC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTAT---TTTCAAATAATATCAGAAGGGTTTGCCGTCATTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAAAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCACTCAATATTTCCTTTTTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATTTGGAAATTCTGCTTCAAACCCTTCGCTATTGGTTGAAAGATGTCTCGTCTTTTCATTTATTAAGGATCTTTCTTCAC------AAATATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTTAAATTTA------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTGCATGTCTTCGAATATGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCCTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGGAAAAATAGAACAT------CTTGTAAAAGTCTTTGCT------AAAGATTTTCTGTCG---ACCCTATGGTTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAGAATCCATATAAAC---CAATTA---TCTGAGCATTCATTCTACTTTTTGTTTTTGGGCTATTTTTCAAGTGTTCGGCTAAATCCTTCAGTGGTACGGAGTCGAATGCTGGAAAATTCATTTATAATAGAAAATGTTAGGAAAAAGCTTAATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCTAAATTTTGTAACGTATTAGGTCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTGTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCGAGTAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAGCACAAAAGTACTGGACGCGCCTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAGGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGAATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Cercis_occidentalis_AY386853 ATGGAGGAATTTCAAGTA---------TATTTAGAACTATATAGATCTCGGCAACACGAC------TTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGGTTA------AATAGCTCCATTTTTGTGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCCGCTAATGATTCTACC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTAT---TTTCAAATAATATCAGAAGGGTTTGCCGTCATTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAAAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCACTCAATATTTCCTTTTTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATTTGGAAATTCTGCTTCAAACCCTTCGCTATTGGTTGAAAGATGTCTCGTCTTTTCATTTATTAAGGATCTTTCTTCAC------AAATATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTTAAATTTA------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTGCATGTCTTCGAATATGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCCTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGGAAAAATAGAACAT------CTTGTAAAAGTCTTTGCT------AAAGATTTTCTGTCG---ACCCTATGGTTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAGAATCCATATAAAC---CAATTA---TCTGAGCATTCATTCTACTTTTTGTTTTTGGGCTATTTTTCAAGTGTTCGGCTAAATCCTTCAGTGGGACGGAGTCGAATGCTGGAAAATTCATTTATAATAGAAAATGTTAGGAAAAAGCTTAATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCTAAATTTTGTAACGTATTAGGTCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTGTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCGAGTAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCCTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAGGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGAATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Chaetocalyx_scandens_AF270865 ATGGAGGAATATCAAATA---------TATTTAGAACTAGATGGATCTTGCCAACAGAAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATAGTCATGATTTAAATATAAATAGATCCATTTTGGTGGAA---AATTTGAAT------TATGATAAG------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGCTTCTTTTTGCTAATGATTCTAAA------AAAAATATA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTTGTGGAAATTCCATTTTCCCGACAATTT------AGTTCTTCC---------TTAGAGGAGGTCGAAATCCTAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACCTATTTAAAATTTTTTTTAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTAAAACCNNNNNNNNNNNNNNNNNNNNNNNNCCCATCTTTCATTTTTTAAGATTGTTTCTTTAT------GACTATTCTAATTGGAAT------------AGTCTTATTGCTAAA------------AAAAAACTTATGGATACTTTATCAAGA------------TCAAGAAGCAATCCAAGATTT------------------------TTCTTATTC------CTATATAATTTTTTTGTATGTGAACACGAATCCATCTTCCTTTTTCTATGTAATAAATCCTCTCATTTACGATTAGATTCTTTTAGCCTTTTTTTTGATCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTTCAAGTCTTTGCT------AAGGATTTTTCATCT---ACCCTACCATTC------TTCAAAGAT---CCTTTGATTAATTATGTTAGATATCAAGGAAAATTCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGCTGAATAAATGGAAATTTTATCTCATCTATTTCTGGCAATGTCATTTTTATGTTTGGTCTCAAGCAGGAACGATCCATATAAAA---CAATTATTATCCGAGCATTCATTTCACTTTTTTGGGGGGGGCTATCTTTCAAATGTACGGCTCAATTTTTCAGTGGTACGGAGTCAAATGTTAGAAAATTCATTTCCAATTGAAATTGGTATGAAAAAGCTTGATACAAAAGTTCCAATTATTAATCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGCTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACCCTGGCTCGTAAACATAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAACAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTATTTCTTTTATCTTTCCA------AGAGCTTCTTCCACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CACGAA---------------------------TGA Chamaecrista_nictitans_EU361914 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGCTAGATCTCGTCAATATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTT------AATAACTCCATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTATAAAACGTTTAATTACCCGAATGTATCAACAAAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTGCAAAAAGAATTTGTAT---TCTCAACTAATATCAGAGGGGTTTGCGGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCT---------TTAGAGGGGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTGCATATTTAACTTATGTGTCCGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTGTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGGAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCCACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAACGAATCAATTTTTATGCAAAAATAGAATAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCTGTCC---ACCCTATGGTTC------TTCAAGGAC---TCTTTCATTCATTATGGTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGACTAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCACATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATTGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCAGCCGATTTTGATATTATTGACTTATTTTTGCGGAGATGCAGAAATCTTTCTCATTATTACAATGGATCTTCAACAAAAAAGAGTTTGTATCGAATAAAACATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGC------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAAAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Chapmannia_gracilis_AF203592 ATGAAAGACTATCAAAGA---------TATTTCGAACTAGCTAGATCTCGTCAACAGAAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTCTGGTCATGATTTGACTAGAAATCGATATATTTTGGCGGAA---AATGTGGAT------TATGATAAG------AAA------TCTAGCTTACTAATTGTAAAACGTTTAATTACTCGAATATATCAACAGAATCATTTGATTCTTTTTGATAACGATTCAAAT------AAAAATAAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTTGCCATTGTCATGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGCAATCGTAAAATCGTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAAATTATTTTCCGATGTACGAATACCCTATCCTATCCATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCTCTATCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTTATTTTTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTCTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAAAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTTAT------AAAAATTTTGCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATCTCATTTATTTCTGGCAATGTTATTTTGATATTTGGTCTCAACCCCGAATGATCCATATAAAC---GAATTA---TTCGAGAATTCATTTCATTTTTTTTGGGGGGGCTATCTTTCAAATGTACGGCGAAACTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAACTTGATACAATAGTCCCAATTATTCCCGTAATTAGGTCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGACATCCCATTAGTAAGCCCGTTTGGACCGATTCATCTGATTTTGATATTATTGACCGGTATTTGCGGATATACAGAAATCTTTCTCATTATTATAATGGATCTTCAAAAAAA---AGTTTGTATCGAATAAAATATATAATTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGGACTTTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTAGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGATCTTCTTCTACTTTGCGG------AGGTTATAT------AGAAGTCGGATTTGGTATTTGGATATTCTT---TTCAGTAAC------GATCCAATCAATGTA------------AAT------------------------------TGA Chesneya_elegans_JQ619958 ATGAAGGAATATCAAGTA---------TATTTTGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCTATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------CAA------TCTAGTTTACTGATTGTAAAACGTTTAATTAATCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTCAC------AAAAATCCA------------TTTTTGGGATATAATAAGAATTTTTAT---TCTCAAATAATCTCAGAGGTTTTTGCCATCATCGCGGAAATTCCATTTTTCCGACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAAATTGACATATTTAAATTATGTGTCAGATATACGAATACCCTACCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTTTTCTTTCT---CATTTTTGTAATTGGAAT------------AGTTTTCTTACTCCA------------AAA---------TCGACTTTTTCA------------------AAAAGGAATCCAAGATTC------------------------TTCCTGTTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTACAATCTTTTAGCGTTTTTTTTGAACGAATCTTTTTTTATTCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTCT---ACCTTAACATTC------TTCAAGGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATATTTGGTCTCAGCCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACCTTTTA------GGCTATTTTTCAAATGTCAGGCTAAATCGTTCAGTGGTACGCAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTATCAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTCTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TCTGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCTTTTTCTACTTTGCAG------AGGTTACAT------CGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Chloroleucon_manganse_AY386921 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCTGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAGGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATACATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCTGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGCAGATATGCAGAGATCTCTCTCATTATTACAACGGATCCTCAAAAAGAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Cicer_canariense_AF522079 ATGAAGGAATATCCAGTA---------TATTTAGAACGAGCTAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCAAAATTGT------AATAGATCCAGTTTTGTGGAA---AATCTAGGT------TATGACAGT------AAA------TATAGTTTATTAATTGTAAAACGTTTAATTAGTCGAATGTATCAACAGAATCATTTGATCATTTCGGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAATCTGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATCCCATTTTTCCTACAATTT------AGCTCTTCC---------TTAAAGGAGTCAGAAAAAATAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAATTTACATATTTAAATTATGTGTCAGATATAAGAATACCCCATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCCTTTATTACGGTTGTTTCTATAT------AATTTTTGTAATTGGAAT------------AGTTTTATTACTACC------------AAAAAATCGATTTATACTTTTTCA------------------AAAAGTCATCCAAGATTA------------------------TTCTTGTTC------CTCTATAATTTTTATGTATGGGAATATGAATCTATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAAATCTTATAGCGTTTTTTTTGAGCGAATTTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGGTTTTGCT------AAGGATTTTCCATAT---ACTTTAACATTC------TTCAAGGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATATTTTTTTGATGTTTGGGCTCAACCAGGAACGATTAAGATAAAC---CAATTA---TCCCAACATTCATTTCACCTTTTA------GGCTATTTTTCAAATGTACGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTCTTAGCAAAAAACTGGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTGG{AG}TATTATTGACCGATTTTTGCGAATATGCCGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TCAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGATTCTTTTACTTTGCAG------AGGTTACAT------AGAAATCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Cladrastis_delavayi_AY386861 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTGCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTTGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCTCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCGTTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGGTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCTGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Cladrastis_lutea_AF142694 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTGCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCTCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCGCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGGTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCNAAAATTTGTAATGTATTAGGGCATCCCATTAGTAAGCCTGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Cladrastis_platycarpa_AY386935 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCGAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCTCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATATTTCAGTGGTACGGAGTCAAATGCTGAAAAATTCATTTATAATCAAAATTGGTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCTGTCTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Clathrotropis_macrocarpa_JX29593 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAATATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTTTTCCCACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATCAATTTACATATTTAAATTATGCGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTTGAAT------------AGTCTTATTACTCTA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTCTATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACAATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAGGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---GCAGAGGAAAAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTCCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Clathrotropis_nitida_JX295951 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCCTTTTGGGTGGAA---AATGGGGGT------TATAACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTCCTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCTGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAAGAC------CTTGTAGAAGTCTTGGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTAACATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGTCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTCCTCTT{AT}ATG------GG{AT}TATTTTTCAAATGTGCGGTT{AT}AATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTAGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTAGTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGGTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGCCAAT---------------CATGAA---------------------------TGA Cleobulia_multiflora_Jesus13 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGGTTATTTCTGCTAATGATTCTAAC------AAAAATCCATTT---------TTTTTTGAGTATAACAATAATTTTTAT---TCTCAATTAATATTAGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGGAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGCTACTGGGTGAAAGATGTCTCTTTCTTTTATTTATTTAGGTTGTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTTA------------AAGAAATCCATT------TTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATAAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTGAAACAAGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGTTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAATATATATACTTCGATTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Clianthus_puniceus_AY386914 ATGAAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTAGGGAGTATGTTTATGGACTTGCTTATAGTCATGATTTTAATTTTAATAGATCTACATTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTAT---TCTAAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCAACAATTT------AGCTCTTCC---------TTAGGGGAGGCAGAAATCGTAAAATCTTCTAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTTTTATTACTCAA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCGAGATTA------------------------TTCTTATTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTACTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTCCGTCT---ACCTTAACATTC------TTCAAGGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATTCATTTATGGGAATGTTTTTTTGACGTTTGGTCTCAACCAGGAACGATCCATATAAAA---CAATTA---TCCGAACATTCAATTTACCTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCCAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGGCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TCTGGTTCAGAAGAATTATTGGCAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCGTCTTCGACTTTGCAG------AAGTTAAAT------GGAAATAGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATTTGGTCAAT---------------CATGAA---------------------------TGA Clitoria_ternatea_EU717427 ATGAAGGAATATCAAGTA---------TATTTAGAACTCGATAGTTCTCACTACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGGGTCGCTTATGGTTATAATTTA------AATAGATTTATTTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAGTTGTAAAACGTTTAATTATTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCCAAC------AAATAT---------------ATATGGGGATATAACAATCAATTTTAT---TCTCAAATAATATCAGAGGGTTTTGTTATCATCGTTGAAATTCCATTTTCCCTACAATTT------CATTCTTCC---------TTAGAGGGGTCAAAAATCGTAAAATCTTGCAAAAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGAGTTAGATATACGAATACCCTGTCCTATCCATCTGGAAATTTGGATCCAAATCTTTCGATATTGGATGAAAGATGTCCCTGTCTTTCATTTATTAAGGTTATTTTTTTAT------TACTATTGTAATTGGAAT------------AGTTTTTTTACTCCA------------AAAATATTGATTTCTACTATTTTTTTG---------------AAAAGTAATCTAAGATTT------------------------TTCTTATTC------CTATATAATTTTTATGTATCGGAATACGAATCTATATTTCTTTTTCTACGTAACAAATCTTCTAATTTACGATTAAAGTCTTTTTGCCTTATTTTTGAACGAATTTTTTTCTATGCAAAAATAGAATAT------ATTGTAGAAATCTTTCCT------AAGGATTTTTTGTAT---ACCTTAACATTA------TTCAAGGAT---CCATTCATTCACTATGTTCGATATCAAGGAAAATTCATTTTGGTTTCAAAGAAT------ACATCGCTTTTGATGAATAAATGGAAATACTATTTTCTCTATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCGGAACATTCATTTCACTTTTTG------GGTTATTTTTTTAATATACGTGTAAATTTTTCAGTGTTACGGAATCAAATGTTACAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAATTCCAATTTTTCTTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTAATAGGTTATCCCATTAGTAAGCCGGTTTGGGCAGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATTGTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCCTGTATTAAAACTTTGGCTCATAAGCATAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTCCAAAAACTATTT---ACCGAAGAAGAGCATATTTTTTCTTTAATCTTTCCA------AGAACTTCTTCTACTTTGCGG------AGGTTTAAT------AGGGTTCGCATTTGGTATTTGGATATTCTT---TTCAATAAT------GATTTGATTAAT---------------CATTCA---------------------------TAA Cochliasanthus_caracalla_JN00827 ATGGAGAAATATCAAGCA---------TATTTAGAACTCCGTAGATCTCGATACCAGGAT------ATCCTATACCC------ACTTTTTTTTCGGGAATCTATTTATGGACTAGCTTATGGTCATGAG---------------TCCTTTTTTATAGAA---AATGTAGAT------TCTAACAAT------AAA------TTGAGTTTACTAATTGTAAAACGTTTAAGTACTCGAATGTATCAACAGACTCATTTCATTCTTTTTGCTAACGATTCTAAC------AAAAAGACT------------TTTGTGGGTTATAACTATAATTTTGAT---TCTCAAATAATATTAGAAGGTTTTGGTGTCGTCGTGGAGATTTTATTTTCTCTACAATTA---TTTCTCTCTTCC---------TTAAGGGGATTAGAAAGCGTAAAATCTTATCAAAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATAAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATAATGGATAAAAGATGTCTCTTTCTTTCATATAATAAGGTTGGTTTTTTAT------TACTATTCTAATTGGAAT------------AGTCTTTTTCCTCCA------------AAAAAATGGATTTCTACTTTTTTT---------------TCAAAAAGGAATCTAAGAATT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCAGTTACAGTTAAAACATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAAAACAT------CTTGTAGAAGTATCTACT------AAGAATTGTTCATAT---ACCTTATTCTTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTTAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATATATTTATGGCAATGTCATTTTGATATTTGGGCTGGACCAAGAACGATCTATATAAAC---CAATTA---TCTCAGTATTCATTTCACTTTTTA------GGCTATTTTTTAAGTATTCCACAAAATCTTTCAGTAGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCAAAATTGTTATCAAAAAACTTGATACAATAGTTCCCATTATTCTTCTAATCAGATCATTGGCTAAAACAAAATTTTGTAATGTAATGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTCTCTGATTTTGATATTCTTGACCGGTTTTTGCGCATATGCAGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTCTATCAAATAAAATATATACTTCGGTTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAAA------TTAAGTTCAGAAAAATTATTGGAAGAATTTTTT---ACA---GAAGAAGATCTTTTTTCTTTGATTTTTCCA------AGAACTTCTTTGACTTTGCGG------AGGTTTTAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTAGAANNNNNNNNNNNNNNNNNNNNNNNNNNN Cojoba_catenata_AY944554 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATCTAGGT------TATGACAAT------AAA------TCTAGN---------------CGTTTNATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAGAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGCCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAGATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAAGAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAAATTATTGAGCGATTTTTGCAGATATGCAGAGATCTTTCTCATTATTATAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Collaea_stenophylla_LPQ12460 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCTATTTTTGTAGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTGTTGAGTATAACAGTAATTTTTAT---TCTCAATTAATATTAGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGCTACTGGGTGAAAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCCATT------TTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGNCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTA------GGCTATTTTTTAAAT---------------TCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTTTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTCGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAATCGGTCTGGTCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGGGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Cologania_pallida_JQ619980 ATGGAGGAATATCGACCA---------TATTTAGAACTCCATAGATCTCGACACCAGGAC------ATCCTATACCC------ACTTTTTTTTCGGGAATATATTTATGGACTAGCTTATGGTCATGGG---------------TCTATTTTTGTAGAA---AATGTAGGT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCTTTTCATCATTTTTGCTAACGATTCTAAC------AAAAATCCT------------TTTGTGGGTTATAACAAGAATTTGGAT---TCTCAAATAATATTAGAAGGTTTTGTTGTTGTCGTGGAGATTCTATTTTCCCTACAATTA---GTTATCTCTTCC---------TTAAGGCAATTAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATCTATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGGTATTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------TATTATTCTAATAGGAAT------------AGTCTTTTTACTCCA------------AAAAAAGGGATTTCTACTTTTTTT---------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATATATATGTACGGGAATATGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCAGTTACGGTTAAAATATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTCTAGAAGTATCTGTT------AAGGATTGTTCATAT---ACCTTATCATTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCCATTCTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATATTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCGACCAGGAACGATCCATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCGGCTAAATCTTTCAGTGGTCCGAAGTCAAATGTTGCAAAATTCATTTCTAATCAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCATTGGCTAAAGCAAAATTTTGTAATGTATTTGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTCTCTGATTTTGATATTATTGACCGGTTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCTGCAAAAAAAAAGAGTTTATATCAAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGCGCGCACTTTTTTGAAAAGA------TTTGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGATATTTTTTATTTGATTTTTCCA------AGAACTTCTTTTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTA---------------------------TAA Colophospermum_mopane_EU361915 ATGGAGGAATTTCAAGTA---------CCTTTAGAACTAAAAAAGTTTCAACAATATGAC------CTCCTATATCC------ATTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATAAGGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAAGGGTTTGCCGTCATTTTGGAAATCCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAAACAAAAATAGTAAAATCTTCT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAAATTCCATATTTAAATTATGTGTCAGATATACGAATACCGTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGTCTCTTCTTTTCATTTTTTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTATACTTTTTCA------------------AACAGGAACCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTCCAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAGGTCTTTCCT------GAGGATTCTCTGTAT---ACTCTATGGTTT------TTCAAGGAT---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------AACCCTTTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATTCATATAAAC---CAATTA---TCCGAACATTCATTCTATTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAATGGTACGGAGTCAAATGCTGGAGAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTAGCTCGTAAACACAAAAATACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGAAAGAATTCTTT---ACCGAGGAAGACGAGATTCTTTCTTTGATTTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTCATAT------AGAAGT------TGGTATTTGGATATTTTT---TCCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Colutea_arborescens_AY386874 ATGAAGGAATATCAAGTA---------TTTTTCGAACGAGATAGATCTCGGCAACAGGAC------TTCCTATACCC------ACTTATTTTTAGGGAGTATGTTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCTACATTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTAT---TCTAAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTT------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAATTTCCACATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCCTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTTTTCTTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCGAGATTA------------------------TTCTTATTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAAAAACTCCTCTCATTTACGATTCAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------TTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTCT---ACCTTAACATTC------TTCAAGGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCTATTTATGGGAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAA---GAATTA---TCCGAACATTCATTTTACCTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGGCGGTCTGGGCCGATTCATCCGATTTTGAAATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TCAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCGTCTTCTACTTTGCAG------AAGTTAAAT------GGAAATCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATTTGGTCAAT---------------CATGAA---------------------------TGA Condylostylis_candida_JN008260 ATGGAGAAATATCAAGCA---------TATTTAGAACTCCGTAGATCTCGATACCAGGAT------ATCCTATACCC------ACTTTTTTTTCGGGAATCTATTTATGGACTAGCTTATGGTCATGAG---------------TCCTTTTTTATAGAA---AATGTAGAT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAAGTACTCGAATGTATCAACAGACTCATTTCATTCTTTTTGCTAACGATTCTAAC------AAAAATACT------------TTTGTGGGTTATAACTATAATTTGGAT---TCTCAAATAATATTAGAAGGTTTTGGTGTCGTCGTGGAGATTTTATTTTCTCTACAATTA---TTTATCTCTTCC---------TTAAGGGGATTAGAAAGCGTAAAATCTTATCAAAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATAAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATGGGATAAAAGATGTCTCTTTCTTTCATTTAATAAGGTTGTTTTTTTAT------TACTATTCTAATTGGAAT------------AGTCTTTTTCCTCCA------------AAAAAAGGGATTTCTACTTTTTTT---------------TCAAAAAGGAATCTAAGAATT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCAGTTACAGTTAAAAAATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAAAACAT------CTTGTAGAAGTATCTACT------AAGAATTGTTCATAT---ACCTTATTCTTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTTAAAGAAG------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTCTATATTTATGGCAATGTCATTTTGATATTTGGGCTGGACCAGGAACGATCTATATAAAC---CAATTC---TCTCAGTATTCATTTCACTTTTTA------GGCTATTTTTTAAGTATTCCGCAAAATCTTTCAGTAGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCAAAATTGTTATCAAAAAACTTGATACAATAGTTCCCATTATTCCTCTAATCAGATCATTGGCTAAAACGAAATTTTGTAATGTAATGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTCTCTGATTTTTATATTCTTGACCGGTTTTTGCGCATATGCAGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTCTATCAAATAAAATATATACTTCGGTTTTCTGGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAAA------TTAAGTTCAGAAAAATTATTGGAAGAATTTTTT---ACA---GAAGAAGATCTTTTTTCTTTGATTTTTCCA------AGAACTTGTTTGACTTTGCGG------AGGTTTTAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTAGAANNNNNNNNNNNNNNNNNNNNNNNNNNN Conzattia_multiflora_AY386918 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGTTGGAA---AATCTAGGT------TATGACAAT------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AACTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTCAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGGAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------TTTGTAGAAGTATTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGACCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATAGAGAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCTGATATGCAGAAACCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Copaifera_officinalis_EU361918 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAG------AAA------TCTAGTTTCTTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAAAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGTAGGCACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGGCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCGTATTACTTCA------------AAAAAATCCATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTGTTTTTGGATTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTGTAATAGAAAATGTTATCAAAAAACTTGATACAAAAGTTCCAATTATTCCTATAATTCGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCCGATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Cordeauxia_edulis_EU361920 ATGGAGGAATTTCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAA---AATCTAGGT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTACCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATTGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCCACTTTTTCA------------------AAAAGTAATCCAAGACTA------------------------TTCCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTTGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCTTATGGTTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATAGAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATTGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTTGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTGGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTCCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Cordyla_africana_JF270724 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTATTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATTCAAGATTA------------------------TTCTTGTTC------TTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTCCGTAACAAATCGTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTCATTC------TTCAAGGAT---CCTTTCATTCATTATATTCGATATCAAGGAAAATCCATTCTGGCTTCAAGGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CGATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAACATTCATTTATAATCGAAATTATTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCAGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Cordyla_africana_JX295923 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGATGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTCATCTTGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTATTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATTCAAGATTA------------------------TTCTTGTTC------TTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTCCGTAACAAATCGTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAGGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CGATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAACATTCATTTATAATCGAAATTATTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCAGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACCGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCGG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Coronilla_coronata_JQ619970 ATGGGGGAATATCAGTTA---------TATTTGGAACTAGATAGATCTCGTCAACAGGAT------TTCCTATACCC------ACTTGTTTTTCACGAATATGTTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCGATTTTTGTAGAA---AATATAGGT------TATGATAAT------AAA------TATAGTTTATTAATTGTAAAACGTTTAATTACTCGGATGTATCGACAGAATCATTTGATTATTTCGGCTAATGATTCTAAC------AAAAATCGA------------TTTTTGAGGTATAATAAGAATTTTGAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCTATTTTCATTACAATTA------AGCTCGTCC---------TTAGAGGAGGCAGAAATAATAAAATCTTATAAAAATCTGCGATCAATTCATTCCACTTTTCCCTTTTTCGAGGATAAAGTTACATATTTAAATTATATATCAGATATACAAGTCCCTTATCCTATCCATCTGGAAATCTTAGTCCAAACCCTTCGATACTGGGTGAAAGACGCCCCTTTCTTTCATTTATTAAGATTGTTTCTTTAT------GATTATTGCAATTGGAAT------------AGTATTATTATTCCAAAAAAAATTCCAAAAAAATCGATTTATACTTTTTCA------------------AAAAATAATACAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATATGAATCTATCTTTTTTTTTCTACGTACCAAATCTTCTCATTTACGATTAAAATCTTTTAGATTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAAAGGACAT------CTTGTAAAAGTCTTTGTT------AAGGATTTTTTTTCT---ACCTTAACATTC------TTTAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCCATTCTGGCGTCCAGGAAT------TTGCCTATTTTAATGAATAAATGGAAATACTATTTTATACATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCCGGAACAATCCATATAAAT---CAATTA---TCTGAATATTCATTTCACTTTTTG------GGCTATTTTTTAAAAGGGGGGCTAAAGCATTCGGTGGTACGGGGTCAAATGCTGCAAAAGGGATTTCTAATCAAAATTATTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCAATAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGAATCCCCTTAGTAAGCCTTCCTGGGCCGACTTATCTGATTTTGATATTATTGCCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCCTGTAAACACAAAAGTACCGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTCCTTCTACTTTACGT------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTTTT---TTTAGCAACGATAACGATCTAATCAAT---------------CATGAC---------------------------TGA Coursetia_glandulosa_AF543852 ATGGAGGAGCATCAAGTA---------TATTTAAAACTGGATAGATCTTGCCAACAGGAC------TTCCTATACCC------ACTTGTTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGATCCATTTTTGCGGAA---AATGTAGGT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATCTCTGCTAATGATTCTAAA------AAAAATCCA------------TTTTTGAGGTATAATAAGAATATTTAT---TCTCAAATAATCTCAGAAGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATAATAATTTGCAATCAATTCATTCCATTTTTGCATTTTTTGAGGATAAATTTACATATTTAAATTATTTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGATTCTTTCTTTAT------GATTATTGTAATTCGAAT------------AGTCTTATTACTCCG------------AAAAAATGGATTTCGACTTTTTCA------------------AAAAGGAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATATGAATCTATCTTCTATTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTACTGTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAGAAAACAT------CTTGTAGAAGCCGTTGCT------AAGGATTTTTTGTCT---ACCTTAACATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTAATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTGATCTTTGGGCTCAACCAGGAACGATCCACATAAAC---CTATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCGACTAAATCGTTCAGTGGTACGTAGTCAAATGCTGCAAAATGCATTTCTAATCGAAATTGTTATCAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTCGATCATTGGCTAAAGCGAATTTTTGTAATGTATTAGGGAATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCGGATTTTGATATTATTGACCGATTTTTACGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTGTTGGAAGAATTTTTT---ATAGAAGAACAAGAGATTGTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTTTTTTTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Cranocarpus_martii_AF270875 ATGAAAGAATATCAATTA---------TATTTAGAACTAGATAGATCTCGCCAACAAAAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATAGTCATGATTTATATTTAAATCGATCCATTTTTGTCGAA---AATGTGGATGTAGATTATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTGTTTCTAACGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAAAATTTGTAT---TCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTCCCCGAAAATTA------ACTTCTTCT---------TTAGAGAAGGTGGAAATCGTCAAATTTTTTAATAATTTGAGATCAATTCATTCCATTTTTTGCTTTTTCGAGGAAAAATTTACATATTTAAATTTTGTTTTAGATGTACGAATACCCTATCCTATCCATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAGATTGTTTCTTTAT------GAGTATTGTAATCGGAAT------------AGTCTTAGTACTCAA------------AAAAAACTGATTTATACTTTTTTA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTT------CTATATAATTTTTATGTATGCGAACACGAATCCATCTTCCTTTTTCTACGTAAAAAATCCTCTCAATTACGATTAAGCTCTTTTAGCATTCTTTTTGAACGAATCTATTTCTATGCGAAAATCGAACAT------CTTGTAAAAGTATTTTCT------AAGAATTTTTCGTCC---ACCTTATCCTTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTATTTTGATGAATAAATGGAAATATTATCTGATCTATTTCAGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCGAAGCATTCATTTCACTTTTTTGGGGGAGGCTATCTTTCAAATGTTCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAACTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGACATCCTATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAGAGTACTGTACGCACTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTGGAAGAATTCTTT---ACGGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGTAAC------GATCTGATCAATGTA------------AATGGA---------------------------TAA Craspedolobium_schochii_JF953573 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCATTTATTAAGGTTGTTTTTTTAT------TACTATTGTAATTGGAAT------------AGTTTTTTTGCTCCA------------AAAAAATCGATTTCTACTTTTTTTTTT------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGGAACAAATCCTCTCAGTTACAATTAAAATATTTTCGCGTTTTTTTTGAACGAATTTTTTTCTATGAAAAAATAGAACAT------CTTATAGAAATCTTTCTT------AAGGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTTAAAGAAT------ACGCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCAACCAGGAACGATCAATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------GATTATTTTTTAAGTATTCGGCTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATAAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTGGGTCATCCCATTAGTAACCCGGTTTGGGCCAATTTATCTGATTTTGATATTGTTGACCGATTTTTGCGAATATGCAGAAATTTTTCTCATTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Cratylia_mollis_LPQ8024 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTGTTGAGTATAACCATAATTTTTAT---TCTCAATTAATATTAGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGCTACTGGGTGAAAGATGNNNNNNNNNNNNNNNNNNNNAGGTTGTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCAATT------TTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATACAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTTATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAATCGGTCTGGTCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGGGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Crotalaria_incana_GQ246141 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGGTATATCTCGCCAACTGGAC------TTCCTATACCC------CCTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCTTTTTTGCAGAA---CATGTAAAT------TATGACAAT------AAA------TCGAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTCTTTCTACTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAAAATTTGTAC---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATATTATAAAAATTTGCGATCAGTTCATTCCATTTTTCCGTTTTTCGAGGATAAATTGACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCGTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTTTTTCCTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTAAGTAATAAATCGTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGAGAATCTATTTCTATGAAAAAATAGAACAT------TTTGTAGAAGTCTTTGTT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCTTTTTGGCTTCAAGGAAT------GCGCTCCTTTTGATGAATAAATGGAAAAATTATCTTATCCATTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCAGGAATGATCAAAATAAGC---CAATTC---TCCGAGCATTCATTTCATCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTCGATACACTAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGGACCCCATTAGTAAGCCAGCCTGGGCTCATTCATCCGATTTTGATATTATTGACCGATTTTTGCGCATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACATAAAAGTACTGTACGTGCTTTTGTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAGGAGATTCTTTCGTTGATCTTTCAA------AGAACTTCTTCTACTTTGCGG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTT---TTCAGCAAC------GATCTAGTCAAT---------------CATGAA---------------------------TGA Crotalaria_juncea_JQ619982 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGGTATATCTCGCCAACTGCAC------TTCCTATATCC------CCTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCTTTTTTGCAGAA---AATGTAGAT------TATGACAAT------AAA------TCGAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTCTTTCTACTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAAAATTTGTAC---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCCTCC---------TTAGAGGAGGCAGAAATCGTAAAATATTCTAAAAATTTGCGATCAGTTCATTCCATTTTTCCGTTTTTCGAGGATAAATTGACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCGTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTTTTTCCTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCGACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTAAGTAATAAATCGTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGAGAATCTATTTCTATGGAAAAATAGAACATTTTGTATTTGTAGAAGTCTTTGTT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCTTTTTGGCTTCGAGGAAT------GCCCCCCTTTTGATGAATAAATGGAAAAATTATCTTATCCATTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCAGGAATGATCCAAATAAGC---CAATTC---TCCGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGATACGGAGTCAAATGTTGGAAAATTCATTTCTAATCAAAATTGTTATGAAAAAGCTCGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGGACCCCATTAGTAAGCCAGCCTGGGCTCATTCATCCGATTTGTATATTATTGACCGATTTTTGCGCATATGTAGAAATATTTATCATTATTACAACGGATCCTCAAAAAAAAAAAGTCTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTGTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAGGAGATTCTTTCGTTGATCTTTCAA------AGAACTTCTTCTCCTTTGCGG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTT---TTCAGCAAC------GATCTAGTCAAT---------------CATGAA---------------------------TGA Crotalaria_pumila_AY386867 ATGGAGGAATATCAAGTA---------TATTTAGAATTAGGTATATCTCGCCAACTGGAC------TTCCTATATCC------CCTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCTTTTTTGCAGAA---AATGTAGAT------TATGACAAT------AAA------TCGAGTTTATTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTCTTTCTACTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAAAATTTGTAC---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATATTATAAAAATTTGCGATCAGTTCATTCCATTTTTCCGTTTTTCGAGGATAAATTGACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCGTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTTTTTCCTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCGACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTAAGTAATAAATCGTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGAGAATCTATTTCTATGGCAAAATAGAACAT------TTTGTAGAAGTCTTTGTT------AAGGATTTTTTGTCT---ACCTTATCATTT------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCTTTTTGGCTTCAAGGAAT------GCGCCCCTTTTGATTAATAAATGGAAAAATTATCTTATCCATTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCAGAAATGATCCAAATAAGC---CAATTC---TCCGAGCATTCATTTAACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGATACGGAGTCAAATGTTGGAAAATTCATTTCTAATCAAAATTGTTATGAAAAAGCTCGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGGACCCCATTAGTAAGCCAGCCTGGGCTCATTCATCCGATTTGGATATTATTGACCGATTTTTGCGCATATGTAGAAATATTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGTACTTTTGTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAGGAGATTCTTTCGTTGATCTTTCAA------AGAACTTCTTTGCCTTTGCGG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTT---TTCAGCAAC------GATCTAGCCAAT---------------CATGAA---------------------------TGA Crotalaria_saltiana_JQ619981 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGGTATATCTCGCCAACTGGAC------TTCCTATACCC------CCTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCTTTTTTGCAGAA---AATGTAGAT------TATGACAAT------AAA------TCGAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTCTTTCTACTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAAAATTTGTAC---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTGACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCGTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTTTTTCCTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCTAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTAAGTAATAAATCGTCTTATTTACGATTAACATCTTTTAACGTTCTTTTTGAGAGAATCTATTTCTATGGAAAAATAGAACAT------TTTGTAGAAGTCTTTGTT------AAGGATTTTTTGTCT---ACTTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATACTTTTTGGCTTCAAGGAAT------GCGCCCCTTTTGATGAATAAATGGAAAAATTATCTTATCCATTTATGGCAATGTTATTTTAATGTTTGGTCTCAACGAGGAATGATCCAAATAAGC---CAATTC---TCCCAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTCGATACAATAGTTCCAACTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGGACCCCATTAGTAAGCCAGCCTGGGCTCATTCATCGGATTTTGATATTATTGACCGATTTTTGCGCATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTGTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAGGAGATTCTTTCGTTGATCTTTCAA------AGAACTTCTTCTACTTTGCGG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTT---TTCAGCAAC------GCTCTAGTCAAT---------------CATGAA---------------------------TGA Crudia_choussyana_EU361921 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTGGCCATCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTTTGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTGGATTCAAATCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGAAATCCAAGATTG------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCGTTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AATAATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAGGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTTCAGTGTACGGCGAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTCTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAATTTCTTTTACTTTGCCGAGA---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GCTCTGGTCAAT---------------GATGAA---------------------------TGA Cullen_tenax_EF550004 ATGGAGGAATATCGAGCA---------TATTTAGAACTCCATAGATCTCGACACCAGGAC------ACCCTATACCC------ACTTTTTTTTCGGGAATATATTTATGGACTAGCTTGTGGTTATGGG---------------GCCATTTTTGTAGAA---AATGTAGGT------TATAACAAA------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACCCATTTCATCATTTTTGCTAACGATTCTAAC------AAAAATCCT------------TTTAGGGGTTATAATAATCATTTTAAT---TCTCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCCCTACAATTA---TTTACCTCTTCC---------TTAAGGGAATTAGAAATCGTAAAATCTTATAATAATTTACGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTTTTTTTTTCTTACTATTATAATAATAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAAAGGATTTCTACTTTTTTT---------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTACCAAATCCTCTCAGTTACGGTTAAAAGATTTTCGCTTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTGTT------AAGGATTGTTCATAT---ACCTTATCTTTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCGACCAGGAACGATCCATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCAGCTCAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAATCAAAATTATTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTCGATCTTTGGCTAAAGCAAAATTTTGTAATGTAGTTGGTCATCCTATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGATATTATTGACCGGTTTTTGCGGATATGCCGAAATTTTTCTCATTATTACAAAGGATCCACAAAAAAAAAAAGTTTGTATCAAATAAGATATATACTTCGGCTTTCTTGTATAAAAACCTTGGCTCGTAAGCACAAAAGTACTGCGCGCACTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGATATTTTTTCTTTGATTTTTCCA------AGAACTTCTGTTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTA---------------------------TAA Cyamopsis_senegalensis_AF142698 ATGGAGGAATATCAAGTA---------TATTTACAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATGTAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGAGCATTTCTACTAATGATTCTAAC------AAGAATCCA------------TTTTTGGGGTATAAAAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTATTTAT------TACTATTGTAATTGGAAT------------AGTCTTATTACTCCA---ATTACTCCAAAAAAATCGATTTCGACTTTTTCA------------------AAAAGTAATACAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTAATTTACGATTCAAATCTTTTAGCGTTCTTTTTGAGCGAATCTTTTTCTATGCAAAAATAGAACAT------CTTGGGGAAGTTTTTGCT------AAGGATTTTTCGTCA---ACCCTATTATTC------TTCAAGGAT---CCTTTCATTCATTATGTTCGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAGTTTCATTTTTATGTTTGGTCTCAACCA{GT}GAACCATCCATATAAAA------TTC---TCCGAACATTCATTTCACTATTTG------GGCTATTTTTCAAATGTGCGGCTAAATCGTTCAGTAGTACGGAGTCAAATGCTGCAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATGCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACATAAAAGTACTGTGCGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTG---TTCAGCAAT------GATATGGTCAAT---------------CATGAA---------------------------TGA Cyathostegia_matthewsii_HM347482 ATGGAGGAATATCAAGTA------GTCTATTTAGAACTAGATAGATCTCGTCAACAGGAT------TTTCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGGCAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTTGGGGTATAACAAAAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATCAAATCTTATAGTAATTTGCGATCAATTCATTCGATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTGATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAATAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATAT------AGAGATCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GACCTGGTCAAT---------------CATGAA---------------------------TGA Cyathostegia_matthewsii_HM347483 ATGGAGGAATATCAAGTA------GTCTATTTAGAACTAGATAGATCTCGTCAACAGGAT------TTTCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGGCAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTTGGGGTATAACAAAAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATCAAATCTTATAGTAATTTGCGATCAATTCATTCGATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTGATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAATAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATAT------AGAGATCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GACCTGGTCAAT---------------CATGAA---------------------------TGA Cyathostegia_matthewsii_HM347486 ATGGAGGAATATCAAGTA------GTCTATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGGCAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCAA------------TTTTGGGGGTATAACAAAAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAGTAATTTGCGATCAATTCATTCGATTTTTTCTTTTTTTGAGGATAAATTTACATATTTCAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAATAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGACTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGTCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATAT------AGAGATCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GACCTGGTCAAT---------------CATGAA---------------------------TGA Cyclocarpa_stellaris_AF272067 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNATTTATGGACTCACCCATGGTCATGATTTAAATAGAAATCGATCCATTTTGGTGGAA---AATGTGGAT------TATGATAAG------AAA------TATAGTTTCCTAATTGTAAAACGTTTAATTACTCGAATGTATGAACAGAATCATTTGATTATTTTTCCTAACGATTCTAAC------AAAAACCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCTAATAATATCAGAAGGTTTTGCCGTCGTCGTAGAAATTCAGGTTTCCCACCAATTC------CGTTCCTCT---------TTAGAAGAGTCAGAAAAAATTCACTTTTGGAATAATTTGCGATCAATTCATTGCATTTTTTCCTTTTTCGAGGATAAATTGACATATTTCAATTTCGTTTCAGATGTACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAAGTCTTCGATACTGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNN------------NNNNNNNNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNN------------------NNNNNNNNNNNNNNNNNN------------------------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNN---NNNNNNNNNNNN------NNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNNNNN------------NNNNNN---------------------------NNN Cyclolobium_brasiliense_GQ246152 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTCCTATACCC------ACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCCAATTTTGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAA------AAAAATCCA------------TTTTTGGGGTATAACAAGGATTTGTAT---TCTCAAATAATAGCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGTCGAAAATGATAAAATCCTATAAGAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTCATCTGGAAATCTTAGTTCAAATCNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCTTTCATTTCTTAAGGTTGTTTTTTTAT------GAGTATTGGAATTGCAAT------------AGTCTTATTACTCCT---------------------------------TCA------------------AAAAGGAATCCAAGATTT------------------------TTTTTGTTC------CTATCTAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAAGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATTTCATTTTGATGTTTGGTATCAACCAGGAATGACCCATATAAAT---CAATTC---TCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAGATTGTTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------GGAGCTTCTTCTATTTTGCAG------AGGTTATAT------AGAGGTCGAATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTAGTCAAT---------------TATGAA---------------------------TGA Cyclolobium_nutans_AF142686 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTCCTATACCC------ACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCCAATTTTGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAA------AAAAATCCA------------TTTTTGGGGTATAACAAGGATTTGTAT---TCTCAAATAATAGCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGTCGAAAATGATAAAATCCTATAAGAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTCATCTGGAAATCTTAGTTCAAATCNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCTTTCATTTCTTAAGGTTGTTTTTTTAT------GAGTATTGGAATTGCAAT------------AGTCTTATTACTCCT---------------------------------TCA------------------AAAAGGAATCCAAGATTT------------------------TTTTTGTTC------CTATCTAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAAGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATTTCATTTTGATGTTTGGTATCAACCAGGAATGACCCATATAAAT---CAATTC---TCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAGATTGTTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------GGAGCTTCTTCTATTTTGCAG------AGGTTATAT------AGAGGTCGAATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTAGTCAAT---------------TATGAA---------------------------TGA Cymbosema_roseum_DC2868 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGGTCATTTCTGCTAATGATTCTAAC------AAAAATCCACTT---------TTTTTTGAGTATAACAATAATTTTTAT---TCTCAATTAATATTTGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGGAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGCTACTGGGTGAAAGATGTCTCTTTCTTTTATTTATTTAGGTTGTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACATTA------------AAGAAATCAATT------TTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATCTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATAAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTGAAACAAGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGTTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATGCATTTCTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTAGATATTATTGACCGATTTTTACGGATATCTAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCG------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Cytisus_scoparius_AY386902 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGCAC------TTCCTATACCC------ACTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGTTATAATAAAAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCGAAAGATGCCCCTTTGTTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AATCTGATTACTCCA------------AAAAAATTGATTTCTACTTTTTCA------------------AAAAGTAATCTAAGAGTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACAATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAG---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAAAACTATCTTATCCATTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTCGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTAGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTGGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGGTATTTCAA------AGGGCTTCTTCTACTTTGCAG------GGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATTTGATCAAT---------------CATGAA---------------------------TGA Dalbergia_congestiflora_AF142696 ATGGAGGACTATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTACGGTCATGATTTAAATAGAAATCGATCCATTTTGGTGGAA---AATGTGGAT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC---AAAAAAAACCCA------------TTTGGGGGTTATAACAAGAATTTGTAT---TCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGCGGAAATTCCATTTTCCAGACAATTACAATTTCGTTCTTCT---------TTAGAAGAGTCGGAAATCATAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTTAATTTTGTTTCAGATGTACAAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAAGTNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCTTTCATTTATTAAGATTGTTTATTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAACTGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGAATT------------------------CTCTTGTTC------CTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAAGAGATCCTCTTATTTACGATTAAACTCTTTTATCGTTATTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATCTCATCTATTTCTGGCAATGTCATTTTTATGTTTGGTCTCAACCTGGAACGATCCATATAAAT---CCATTATTATCCGAGAATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTCAATTTTTCAGTGGTCCGGAATCAAATGCTAGAAAATTCATTTCTAATCGAAATTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCTGTTTGGGCCGATTCATCCGATTTTGATATTATTAACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATTAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCACTTTTTTAAAAAGA------TTATATTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAGGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAA------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAATGTA------------AATGGA---------------------------TAA Dalbergiella_nyasae_AF142706 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCACCAGGAC------TTTCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTATGGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTTTAAC------AAAAATCCA------------TTTTGGGGGTATAACAATAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGTTGTCGTCGTTGAAATTCCATTTTCCCTACAATTT------AGCTTTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGAGTCAGATATACGAATACCCTGTCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGATGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------TACTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAACTTTTATGTATGGGAATATGAATCTATTTTTCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTCGCGTTATTTTTGAGCGAATTTTTTTCTATGCAAAAATAGAATAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTGT---ACCTTATCATTC------TTCAAGTAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAGTACTATTTTATCTATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGATATTTTTTAAATGTGCGGCTAAATCTTTCCGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAATTCCAATTTTTCTTATAATTAGATCATTGGCAAAAGAGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTTAAAAGA------TTAGGTTCAGAAAGATTATTGGAAGAATTATTT---ACAGAAGAAGAACAAATTTTTTCTTTGATCTTTCCA------AGAACCTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TAA Dalea_brachystachya_EU025886 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ATTTATTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAA---AATGTGGAT------TATGATAAC------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA---------CAATTTTGGGGATATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGAGCAGAAGTAATAAAATCTTATAATAAGTTGCGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAAGTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAC------CAGTATTGTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTAGTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTGGAAATTTTTCCC------AAGGATTTTTTGTCC---ACCTTATCATTG------TTCAAGGAT---CCCTTAATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTCTTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATCATTAGTTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCGCAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAGGAATTATTGAAAGAATTTTTT---ACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------GGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Dalea_cliffortiana_AY391787 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGCAC------TTCCTATACCC------ATTTATTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAA---AATGTGGAT------TATGATAAC------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA---------CAATTTTGGGGATATAACAAGAATTTGTAT---TCTCAAATGATATCCGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGTGGGCAGAAGTAATAAAATCTTATAAAAAGTTGCGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAC------CAGTATTGTAATTCGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTAGTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATACCCATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTTTTTCCC------AAGGATTTTTTGTCC---ACCTTATCATTG------TTCAAGGAT---CCCTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTCTTTATGGCAATGTCATTTTAATGTTTGGTCTCAACCGGGAACGATCTATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAACCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCGCAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTCAAAAGA------TTGGGTTCAGAAGAATTATTGAAAGAATTTTTT---ACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------GGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CATTCA---------------------------TGA Dalea_hospes_AY391789 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ATTGATTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCCTGATTTA------AATGGATCCATTTTGGTAGAA---AATGTGGAT------TATGATAAC------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA---------CAATTTTTGGGATATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTCATAAAATCTTATAATAAGTTACGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAC------CAGTATTGTAATTCGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTAGTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACAATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTTTTTCCC------AAGGATTTTTTGTCC---ACCTTATCATTG------TTCAAGGAT---CCCTTGATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTCTTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATCTAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCACAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTAGTTCGTAAACACAAAAGTACTGTGCGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAGAATTATTGAAAGAATTTTTT---ACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------GGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGTAAC------GATCTGGTCAAT---------------CATTCC---------------------------TGA Dalea_lanata_AY391790 ATGGAGGAATATCAAGTA---------TATTTCGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ATTTATTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAA---AATGTGGAT------TATGATAAC------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA---------CAATTTTGGGGATATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTCATAAAATCTTATAATAAGTTGCGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTAGTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTCTTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTTTTTCCC------AAGGATTTTTTGTCC---ACCTTATCATTG------TTCAAGGAT---CCCTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTCTTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCGCAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAGAATTATTGAAAGAATTTTTT---ACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATAT------GGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Dalea_lumholtzii_AY391791 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ATTTATTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAA---AATGTGGAT------TATGATAAC------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA---------CAATTTTGGGGATATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTCATAAAATCTTATAATAAGTTACGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAC------CAGTATTGTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTAGTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTTTTTCCC------AAGGATTTTTTGTCC---ACCTTATCATTG------TTCAAGGAT---CCCTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTCTTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCACAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAGAATTATTGAAAGAATTTTTT---ACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------GGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGTAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Dalea_mollissima_AY391794 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATTTCGCCAACAGGAC------TTCCTATACCC------ATTTCTTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAA---AATGTGGAT------TATGATAAC------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA---------CAATTTTTGGGATATAACAAGAATTTGTAT---TCTCAAAAAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGGGCCGAAGTCATAAAATCTTATAATAAGTTGCGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGG{AG}AATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAT------CAGTATTG{GT}AATTGGAAT------------AGTTTTATTAAAAAA------------AAAAAATCGATTTCTAGTTTTTCA------------------AATAGTAATCCAAGATTT------------------------TTCTTATTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTTTTTCCA------AAGGATTTTTTGTCC---ACCTTATCATTG------TTCAAGGAT---CCCTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTATTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTGGGGGAGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTGTTCCTATAATTAGATCATTAGCTAAAGCTAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCGCAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAGAATTATTGAAAGAATTTTTT---ACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCCACTTTGCAG------AGGTTATAT------GGAGGTCGAATTTGGTATTTGGATATTATT---TTTAGCAAC------GATCTGTTCAAT---------------CATGAA---------------------------TGA Dalea_neomexicana_AY391795 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATATCC------ATTTCTTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAA---AATGTGGAT------TATGATAAC------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCGGCTAATGATTTTAAG------AAAAATAAA---------CAATTTTGGGGATATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTAGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTCATAAAATCTTCTAATAAGTTGCGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTTCTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTTTTATTAATCAA------------AAAAAATCGATTTCTAGTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGTGTTCTTTTTGAGCGAATCTATTTCTATGAAAAAATAGAACAT------CTTGTGGAATTTTTTCCC------AAGGATTTTTTGTTC---ACCTTATCATTG------TTCAAGGAT---CCCTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTATTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATCTAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATAC{AC}ATAGTTCCAATTACTCCTATAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGGATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCACAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATCCTTCGGCTTTCTTGTATTAAAAGTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTCGGTTCAGAAGAATTATTGAAAGAATTTTTT---ACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTCTAT------GGAGGTCGAATTTGGTATTTAGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Dalea_pogonathera_AY391796 ATGGAGGAATATCAAGTC---------TATTTCGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ATTTATTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAA---AATGTGGAT------TATGATAAC------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA---------CAATTTTGGGGATATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACGCACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTCATAAAATCTTATAATAAGTTGCGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTGACATATTTAAATTTTGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTAGTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTCTTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTTTTTCCC------AAGGATTTTTTGTCC---ACCTTATCATTG------TTCAAGGAT---CCCTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCACCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTCTTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCGCAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAGAATTATTGAAAGAATTTTTT---ACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATAT------GGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCC---------------------------TGA Dalea_pulchra_AY386860 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ATTTATTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAA---AATGTGGAT------TATGATAAC------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA---------CAATTTTGGGGATATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTCATAAAATCTTATAATAAGTTAAGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAC------CAGTATTGTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTAGTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTTTTTCCC------AAGGATTTTTTGTCC---ACCTTATCATTG------TTCAAGGAT---CCCTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTCTTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCACAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAGAATTATTGAAAGAATTTTTT---ACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------GGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGTAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Dalea_purpurea_AY391798 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ATTTATTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAA---AATGTGGAT------TATGATAAC------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTTCTAATGATTTTAAC------AAAAATCAA---------CAATTTTGGGGATATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTAATAAAATCTTATAATAAGTTGCGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAC------CAGTATTGTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTAGTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATATTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTTTTTCCC------AAGGATTTTTTGTCC---ACCTTATCATTG------TTCAAGGAT---CCCTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTCTTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCGCAGAAAAATTTCTCAGTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAGAATTATTGAAAGAATTTTTT---ACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------GGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CATTCA---------------------------TGA Dalea_scandens_AY391800 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ATTTATTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAA---AATGTGGAT------TATGATAAC------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA---------CAATTTTGGGGATATAACAAGAATTTTTAT---TCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTCATAAAATCTTATAATAAGTTACGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAC------CAGTATTGTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTAGTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTTTTTCCC------AAGGATTTTTTGTCC---ACCTTATCATTG------TTCAAGGAT---CCCTTGATTCATTATGTTAGATATCAAGGAAAATACATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTCTTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCACAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAGAATTATTGAAAGAATTTTTT---ACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------GGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGTAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Daniellia_klainei_EU361927 ATGGAGGAATTTCGAGTA---------TATTTAGAACTAAATAGGTTTCAGCAATATGAC------CCCCTATACCC------ACTTATCTTTAGGGAATACATTTATGCACTTGCTTATGATTATGATTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCCGACAAT------AAA------TCTAGTTTCCTAATTGTAAAACATTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTTCTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCGCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCTATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCATAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCCTTTTTTGAGGATCAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAATCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAATATCTTTCTTCAC------GAGTATTGTAATCGGAAC------------ATTAGTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTCTGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAAAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGAAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAATTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTGGGGCATCCCATTAGTAGGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTAACTTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAAGAAGACGAGATCCTTTCTTTGATCTTCTCA------AAAACTTCTTTTACTTTGCAGAGG---GGGTTATAT------AGAGTCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------AATGAA---------------------------TGA Daviesia_latifolia_AY386887 ATGGAGGAATATCAAATA---------TATTTAGAACTAGATAGATCCCTCCAACAATAT------TTCTTATACCC------ACTCACTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCCTTTTTGTGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCCCTTGATTATTTCTGTTAATGATTATAAT------CAAAATCCA------------TTATTGGGCTATAATGACAATATTGAT---TATCAAAGAATATCGGGGGTTTTTGCCGTCGTCGCGGAAATTCCATTTTCCCTACAATTA------AACTCTTAC---------TTAGAGGAGGCCGAAATCTTTAAATCTTATAAGAATTTCCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAACTATGTGTCAGATATACGAATACCCTATCCCATCCATTTGGAAATCTTGATTCAAACCCTTCGATACTGGATTAAAGATGCCCCTTTTTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATAGTTTT------------------ATTAATCCA------------AAAAAATATATTTATACTTTTTCA------------------AAACCTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTCATATATATGGGAATATGAATTTATCTTCCTTTTTCTACGTAACAAATCCTCTAATTTACGATTCAAATCTTTTTCCGTTATTTTTGAGCGAATCGATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTTTCT---ACCCTATCATTC------TTCAAAGGC---CACTTTATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCTCTATTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTTATGTTTGGCCTAAACCAGGAACGATCCATATAAAC---CAATTA---TCCAAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATATTTCCGCGGTACGGAGTCAAATGATGCAAAATTCATTTCTAATCCAAAAGGTTATGAAAAAGTTTGATACAATAGTTCCAATTCTTCCTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTTGGGCATCCCATTAGTAAGCCGGTTTGGTCCGATTCATCCGATTTTTATATTATTGATCAATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATAGAATAAAGTATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTCTACGCATTTTTTTGAAACGA------TCAGGTTCGGAAAAATTATTGGAAGAATTTTTT---TCAGAGGAAGAAGAAATTATTTCTTTCATCTTTTCA------AAACCTTCTTCGACTTTTAAG------GGTTTCTAT------AGAGGTAGGATTTGGTATTTAGATATTCTT---TCTCGCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Decorsea_schlechteri_AY582975 ATGGAGCAATATCAAGCA---------TATTTAGAACTCCGTAGATCTCGATACCAGGAC------ATCCTATACCC------ACTTTTTTTTCGGGAATCCGTTTATGGACTAGCTTATGGTCATGAG---------------TCCTTTTTTATAGAA---AATGTAGAT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAAGTACTCGAATGTATCAACAGACTCATTTCATTCTTTTTGCTAACAATTCTAAC------AAAAATATT------------TTTGTGGGTTATAACTATAATTTGGTT---TCTCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCTATACAATTA---TTTAACTCTTCT---------TTAAGGGGATTAGAAATCGTAAAATCTTATCAAAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTTATATATTTAAATCATAAGTCAGATATACGAGTACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTAATAAGGTTGTTTTTTTAT------TACTATTATAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAATTGATTTTTACTTTTTTT---------------TCAAAAAGGAATCTAAGAATT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCAGTTACAGTTAAAACATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTACT------AAGAATTGTTCATAT---ACCTTATCATTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAATAAATGCAAATATTATTTTATCTATTTATGGCAATATCATTTTGATATTTGGACTGGACCAGGAACGATCCATATCAAC---CAATTA---TCTCAGTATTCATTTAACTTTTTA------GGCTATTTTTTAAGTATTCCACTAAATCTTTCAGTAGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATAAAAATTGTTTTAAAAAAGCTTGATACAATAGTTCCTATTATTCCTCTAATGAGATCATTGGCGAAAGCAAAATTTTGTAATGTATTGGGTCATCCCATTAGTAAGCCGATTTGGGCCAATTTCTCTGATTTTGATATTCTTGACCGGTTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTCTTTAAAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAGCACAAAAGTACTGTGCGCACTTCTTTTAAAAAA------TTAAGTTCAGAAAAATTATTGGAAGAATTTTTT---ACA---GAAGAAGATATTTTTTCTTTTATTTTTCCA------AGACCTTCTTTTACTTTGCAG------AGGTTTTAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTTTTCAAT---------------CATTTC---------------------------TAA Deguelia_dasycalyx_LPQ14503 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCATCATGAC------TTCCTATACCC------ACTTATTTTTCGAGAGTATATTTATGGACTTGCTTATGATCATGATTTA------AATAGATCCATTTTTGTAGAA---AATATAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTATGCTAATGAGTCTAAC------AAAAATCCA------------TTTTGGGGATATAACAATAATTTTTAT---TCTCAAATAATATTAGAAGGTTTTGTTGTTGTTGTGGAAATTCCATTTTCCCTACAATTT------AGTTTTTCT---------TTAGGGGGGAGAGAAATCATAAAATATTTTTATAATTTGCGATCAATTCATTCCATTTTTCCCCTTTTCGAAGATAAGTTTACATATTTAAATTATAAGTCAGATATACAAATACCCTATCTTATCCATCTGGAAATCTTGATTCAAATCCTTCGCTACTGGGTGAAAGATGTCTCTTTCTTTCATTTATTAAGATTGTTTTATTAT---------TATTGTAATTGGAAT------------AGTCTTATTAATTCA------------AAGAAATCAATTTCTATTTTTTCAAAT------------TCAAAAAGTAAGCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTATATGTATGGGAGTATGAATATATCTTTTTTTTTCTACGTAACAAATCCTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTGTATAAAAATAGAACAT------CTTGTACAAGTCGTTGAT------AAGAATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCGCTTTTGATGAATAAATGGAAATACTATTTTATTTATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAT---CAATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTTAAATATGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATTGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTATTCTAATTAAATCATTGATTAAAGCGAAATTTTGTAATGTATTGGGGCATCCTATTAGTAAATCGGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAGGAGTTTGTATCGAATCAAATACATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGATCCGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGATTTTTTCTTTGATCTTTCAA------AGAACTTCTTCTCCTTTCCAG------AGATTACAT------AGAGGTCGAATTTGGTATTTAGATATTCTT---TTCAGCAAT------GATCTGATCAAT---------------CATTTA---------------------------TAA Delonix_elata_EU361928 ATGGAGGAATTTCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGTTGGAA---AATCTAGGT------TATGACAAT------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCAAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AACTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGATGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGGAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTATTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTCCGACTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCTGATATGCAGAAACCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAGATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Dermatophyllum_arizonicum_AY3868 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTTGCCAACAGGAC------TTCCTATACCC------ACTTCTTTTTCAGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCGTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTTGTTCAAACCCTTCGATACTGGGTCAAAGATGCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCTATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTCTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTTCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCAGAATGGCTTTAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTACGACTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAGATTGTTAGTAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGGGAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTTCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Dermatophyllum_secundiflorum_AF1 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTTGCCAACAGGAC------TTCTTATACCC------ACTTCTTTTTCAGGAGTATATTTATGGACTCGCTTATGATCATGATTTA------AATAGATCAATTTTAGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTNGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCGTTTTCCCTACAATTT------AGCTCTTCC---------TTAGAGCAGGCAGAAATCATAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACACATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTTGTTCAAACTCTTCGATACTGGGTCAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTCTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTTCT------AAGGATTTGTTGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAGATTGTTAGGAAAAAGCTTGATNNAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGGGAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCANCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Derris_laxiflora_AF142715 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCACCATGAC------TTCCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTTGCTTATGATCATAATTTA------AATAGATCCATTTTTGTAGAA---AATATAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTATGCTAATGAGTTTAAC------AAAAATCCA------------TTTTTTGGATATAACAATAATTTTTAT---TCTCAAATAATATTAGAAGGTTTTGTTGTTGTCGTGGAAATTCCATTTTCCCTACAATTT------CGTTTTTCT---------TTAGGGGGGGGAGAAATCATAAAATATTTTTCTAATTTGCGATCAATTCATTCCATTTTTCCCCTTTTCGAAGATAAATTTACATATTTAAATTATAAGTCAGATATACAAATACCCTATCCTATCCATCTGGAAATCTTGATTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTCATTTATTAAGATTGTTTTATTAT---------TATTGGAATTGGAAT------------AGTCTTATTAATTCA------------AAGAAATCCATTTCTATTTTTTCAAAT------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATATATCTTTTTTTTTCTACGTAACAAATCCTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTGTGAAAAAATAGAACAT------CTTGTACAAGTCGTTGAT------AAGAATTTTTTGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTTATTTATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAT---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGCTATTTGTTAAATATGCAGTTAAATCTTTCAGTGGTACGGAGTCAAATGTTTCAAAATTCATTTCTAATTGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCTTCTAATTAGATCATTGATTAAAGCGAAATTTTGTAATTTATTGGGGCATCCTATTAGTAAGTCGGTTTGGACCGATTCATCCTATTTTGATATTCTTGACCGATTTTTGTGGATATGCAGAAATTTTTCTCATTATTACAACGGATGCTCAAAAAGAAGGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCATAAACACAAAAGTACTGTGCGTGCTTTTTTGAAAAGA------TTAGAATCCGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGATTTTTTCTTTGATCTTTCAA------AGAACTTCTTCTCCTTTCCAG------AGATTACAT------AGAGGTCGAATTTGGTATTTAGATATTCTT---TTCAGCAAT------GATCTGATCAAT---------------CATTTA---------------------------TAA Desmanthus_cooleyi_AY386916 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTGAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATATCGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAAAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTACTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAAGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTCCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTTTAATTAGATCATTGTCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGATTCTTCTACTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Desmodium_barbatum_EU717420 ATGGAGGAAGATCGAGTA---------TTTTTTGAACTCCATAGATCTCGCCACCGGGAC------ATCCTATACCC------GTTTTTTTTTCGGGAGTATGTTTATGGACTCGCTTATAGTCGTGGA---------------TCCATTTTTGTAGAA---AATGTAGGT------TATAACAAG------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCTTTTGATCGTTATTGGTAATGATTCTAAA------AAAAATCCT------------TTTTGGGGTTATAATAAAAATTATTAT---TCTCAAATAATATTAGAAGGTTTTGTTGTTGTTCTGGAGATTCTATTTTCCCTACAATTA---TATATATCTTCC---------TTAAAAGAGTTAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAAGATAAATTTATATATTTCAATCATAAGTCAGATATAAGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTTTTTCGTTCATTTATTAAGGTTGTTTTTTTAT------TACTATTCTGACTGGAAT------------AGTCTTTTTACTCCA------------AAAAAATCGATTTCGACTTTTTTT---------------TTTAAAAGTAATTCAAGATTT------------------------TTCTTACTA------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTATTTTTCTACGTAACAAATCCTCTCCGTTACGATTAAAATATTTTCGTGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGCAGAAATATTTGTT------AAGAATTTTTCGTAT---ACCTTATTATCC------TTTAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAGAAT------ACACCCCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGGCATTTTGATATTTGGTCTGAACCAGGAACGATCGATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------AGTTATTTTTTAAGTATTAGGCTAAATCTTTCAGTGGTACGAAGTCAAATGGTACAAAATTCATCTCTAATAAAAATTGTTATGAAAAAACTTGATACAATAGTTCTAATTATTCCTCTAATTAGATTATTGGCTAAAGCAAAATTTTGTAATGTATGGGGTCATCCCATTAGTAAGCCAATTTGGGCCAATTTATCTGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAAACTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTGCGCACTTTTTTGAAAAGA------TTGGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAGGATATTTTTTCTTTTATTTTTCCA------AGAACTTCTTTTACTTTGCAG------AGGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGAAAT------GATTTGGTCAAT---------------CATTCA---------------------------TAA Detarium_macrocarpum_EU361929 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGCAA---AATATAGGT------TCTGACAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAAAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGCACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGGCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCGTATTACTTCA------------AAAAAATCAATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATAAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTGTTTTTGGATTATTTTTCCAGTGTACGACGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATAGAAAATGTTATCAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCCGATTTATCCAATTTGGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Dialium_guianense_EU361930 ATGGGGGAATCTCAAATC---------TATTTTGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAATATATTTATACACTTGCTTATGATCATGGTTTA------AATAGTTCAATTTTGGTGGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAATGATTCTAAC------AAAAATAAA------------TTTTTTGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTGTGGAAATTCCATTTTCCTTACAATTA------------TCC---------TTAGAGGAGGCAAAAATCATAAAATCTTAT---AAATTACGATCAATTCATTCAATATTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATGTGGCAGATGTCCGAATACCCTATCCTATTCATCTGGAAATATTGGTTCAAAGCCTTCGCTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAC------GAGTATTGTAATTGGAAT------------AGTCTTATTATTCCA------------AAAAAATCTTGGATTACTTTTTCAAATTCA------------AAAAGTAATCCAAGATTT------------------------TTCTTGGTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCGTCTCATTTACGATTAACATATTCTGGAGTTCTTTTTGAGCGAGTATTTTTCTATGGAAAAAGAGAGCAT------CTTGTAGAAGTCTTTGCT------AATGATTTTCCGTCT---ACCCTATGGTTT------CTCAAGGAC---TCTAACATTCATTATGTTAGATATCAAGGAAAATCCATCCTGGCTTCAAAGAAT------ACGCCTCTTTTGATCAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTGTGTTTGGTCTCAACCAGGAAGGATCCATATAAAC---CAATTA---TCCGAGCATTCGTTTTACTTTCTG------GGCTATTTTTCAAAAGTCCGGCTATATCCTTCAGCGGTACGGAGTCAAATGCTACAAAATTCATTTATAATAGAAAATTTTATGAAAAAGCTCGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCACCCCATTAGTAAGCCAGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAGATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAANGTACTGTACGCGCTTTTTTGAAANGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Dichilus_lebeckioides_GQ246143 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCCACAGCAC------TTCCTTTACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAA---AATATAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTGGCTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAATAAGAATTTGTAT---TCTCAAATAATATCGGAGGGTTTTGCCATCGTCGCGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------CTAGAGGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTAACATATTTAAATTATGTGTCAGATGCACGCATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCTAAGAGTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGTCCCTTTTGATGAATAAATGGAAAAACTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAAAAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCAGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATAAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAGGAAGAGATTCTTTCTTTGATCTTTAAA------AGGGCTTCTTCTACTTTGCAG------AGGTTCTAT------AGAGGTCGGATTTGGTATTTGGATATAATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Dichrostachys_richardiana_AF5218 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNATTGTAAANCGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGATACAACAAGAATTTTGAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTTCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCTATTATTCCTCTAATTAGATCATTGGCTAAAGCTAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTTCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATTAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAAGAAGAAAATCTTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGAAA------AAGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Dicraeopetalum_stipulare_GQ24614 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATATCTCGCCAACAGGAC------TTCCTATATCC------ACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGTTCATGATTTT------AATGGATCCATTTTTGCGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGATATAACAAGAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTG------AGCTCTTCC---------TTAGAAGAGGCAGAAATCGTAAAATATTATAATAATTTGCGATCAATTCATTCTATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATTCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AACAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAATATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCATTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CAATTC---TCTGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGCTAGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCGTTAGTAAATCGGTCTGGGCCGATTTATCCGATTTTGATATTATTGACCGATTTTTGCGGATATATAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCGTATTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTTCTTTTTTAAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAATTTCAAAGAACTTCTTCGACTTTGCAG------AGGTTGTAT------AAGGGCGGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGATCAAT---------------CATGAA---------------------------TGA Dicymbe_altsonii_EU361932 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCGAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATTAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGATTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCTATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAATCCTTTTTGAGCGAATCTATTTTTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTGACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGACGGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCGGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGGTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGTCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTCTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTCCCCTCTTTTTTGAAAAGA------TTAGGTCCAGAA---TTTTTGGAA{AG}AATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAAAGA---AGGTTATAT------AGAGGCCGTATTTGGTATTGGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Dimorphandra_conjugata_EU361934 ATGGAGGAATTTCAAGTA---------TATTTAGGACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGTTCCATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATAAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATACCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAATATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCAT------TTTGTAGAAGTCTTTGAT------AAGAATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATTCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTTATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTGCTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Dinizia_excelsa_JX295860 ATGGAAGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTTGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAT------AAAAATCCA------------TTTTGGGGATACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATAGTAAAATCTTCT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGCGAAAGATGCTTCTTGTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATACAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATATGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTCGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGATTCAAATGTTGGAAAATTCATTTCTAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTCATCTTCCGA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGGGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Dioclea_grandiflora_JX295862 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATGGATCTATTTTTGTAGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGGTCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTTGAGTATAACAATAATTTTTAT---TCTCAATTAATATTAGAGGGTTTTGTTGTTATCGCGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATATTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTTATTTATTTAGGTTGTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCCATTTTTACTTTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATAAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGATTGTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Dioclea_lasiophylla_DC2324 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGAAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATGTAGGTTATGACTATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGGTCATTTCTGCTAATGATTCTAAC------AAAAATCCATTT---------TTTTTTGAGTATAACAATAATTTTTAT---TCTCAATTAATATTAGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGGAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGCTACTGGGTGAAAGATGTCTCTTTGTTTTATTTATTTAGGTTGTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTTA------------AAGAAATCAATT------TTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAGGAAT------ACGCCTCTTTTGATAAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAAGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTATTTG------GGTTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCGAAAGTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGGGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Diphysa_floribunda_AF203575 ATGGAGGAATATCAAATA---------TATTTAGAACTAGATAAATTTCGCCACCAGAAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGGTTTAAATATAAATCGATCCATTTTGATGGAC---AATGTGGAT------TATGATAAA------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAACCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTGCATTTTCCCGACAATTC------CGTTCTTCTTTAGCT---TTAGAGGAGTCAGAAATCGTAAAATCTTTTAATAAATTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTATATATTTAAATTTTGTTTCAGATTTACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAAGTNNNNNNNNNNNNNNNNNNNNNNCCCTCTTCTTGCATTTATTAAGATTGTTTCTTTTT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAACTTATTTCTACTTTTTCA------------------AAAAGTAATCCAAGAATT------------------------TTCTTGGTC------CTATATAATTTTTATGTATGTGAACATGAATCCATCTTCCTTTTTCTACGTAAGAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCTCCTCTTTTGATGAATAAATGGAAACACTATCTCATCTATTTGTGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCGTATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAATCAAATGTTAGAAAATTCATTTCTAATCGAAATTTTAATGAAAAAGCTTGATACAATAGTTCCAATAATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCTGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATATTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTAGAAGAATTCTTT---ACAGAGGAAGAAGAAATTCTTTCTTTGATTTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAT------GATCTTGTCAATGTA------------AATGGA---------------------------TAA Diplotropis_brasiliensis_AY38693 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAA---AATGTAGGT------TATGACAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA------------TTCTTGGGGTATAACAATAGTTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Diplotropis_ferruginea_JX124397 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAA---AATGTAGGT------TATGACAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA------------TTCTTGGGGTATAACAAGAGTTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Diplotropis_incexis_JX124401 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAA---AATGTAGGT------TATGACAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA------------TTCTTGGGGTATAACAAGAGTTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Diplotropis_martiusii_AY386938 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAA---AATGTAGGT------TATGACAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA------------TTCTTGGGGTATAACAAGAGTTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Diplotropis_purpurea_JX124418 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAA---AATGTAGGT------TATGACAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA------------TTCTTGGGGTATAACAAGAGTTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Diplotropis_triloba_JX124398 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAA---AATGTAGGT------TATGACAAA------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAAGAAA------------TTCTTGGGGTATAACAAGAGTTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Dipogon_lignosus_AY582988 ATGGAGCAATATCAAGCA---------TATTTAGAACTCCGTAGATCTCGATACCAGGAC------ATCCTATACCC------ACTTTTTTTTCGGGAATCTATTTATGGACTAGCTTATGGTCATGAG---------------TCCTTTTTTACAGAA---AATGTAGAT------TATAACAAT------AAA------TTTAGTTTACTAATTGTACAACGTTTAAGTACTCGAATGTATCAACAGACTCATTTCAGTCTTTGTGCTAACGATTCTAAC------AAAAATACT------------TTTGTGGGTTATAACTATAATTTTGAT---TCTCAAATAATATTAGAAGGTTTTGGTGTCGTCGTGGAGATTCTATTTTCTCTACAATTA---TTTATCTCTTCC---------TTAAGGGGATTAGAAATCGTAAAATCTTATCAAAATTTACAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATAAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTCATTTAATAAGGTTGTTTTTTTAT------TACTATTATAATTGGAAT------------AGTCTTTTTCCTCCA------------AAAAAAAGGATTTCTACTTTTTTT---------------TCAAAAAGGAATCTAAGAATT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATTTTTCTTTTTCTACGTAACAAATGCTCTCAGTTACAGTTAAAACATTTTCTCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAAGAAAACAT------CTTGTAGAAGTATCTACT------AAGACTTGTTCATAT---ACCTTATTCTTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATAAAGGAAAATCTATTCTGGTTTTAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGGCTGGACCAGGAACGATCTATATAAAC---CAATTA---TCTCAGTATTCATTTCACTTTTTA------GGCTATTTTTTAAGTATTCCACTAAATCTTTCAGTAGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCAAAATTGTTATTAAAAAGCTTGATACAATAGTTCCCATTATTCCTCTAATGAGATCATTGGCTAAAACAAAATTTTGTAATGTAATGGGTCATCCCATTAGTAAACCGGTTTGGGCTAATTTCTCTGATTTTGATATTCTTGACCGGTTTTTGCGCATATGCAGAAATTTTTCTCATTATTACAACGGATCCGCAAAAAAAAAGAGTTTCTATCAAATAAAATATATACTTCGGTTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAAA------TTAAGTTCAAAAAAATTGTTGGAAGAATTTTTT---ACA---GAAGAAGATCTTTTTTCTTTGATTTTTCCA------AGAACTTCTTTTACTTTGCGG------GGGGTTTAT------AGAGGTCGGATTTGGTATTTGGATATTTTT---TTCAAAAAC------GATTTCGCCAAT---------------CATTTT---------------------------TAA Dipteryx_alata_AY553717 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAA---AATAAGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNN------------NNNNNNNNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTT------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------CTAGGTTCAGAAGACTTATTTGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTAGTCAAT---------------CATTCA---------------------------TGA Dipteryx_magnifica_JX295871 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATAAGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAAAAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTT------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATATTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Dipteryx_odorata_JX295898 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATAAGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTT------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------CTAGGTTCAGAAGACTTATTTGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTAGTCAAT---------------CATTCA---------------------------TGA Dipteryx_oleifera_JX295933 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATAAGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTT------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------CTAGGTTCAGAAGACTTATTTGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATGTTATT---TTCATCAAC------GATCTAGTCAAT---------------CATTCA---------------------------TGA Dipteryx_polyphylla_JX295870 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATAAGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTT------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Dipteryx_punctata_JX295869 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAA---AATAAGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTT------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------CTAGGTTCAGAAGACTTATTTGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTAGTCAAT---------------CATTCA---------------------------TGA Dipteryx_rosea_JF491268 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATAAGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTT------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------CTAGGTTCAGAAGACTTATTTGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTACCCAAT---------------CATTCA---------------------------TGA Diptychandra_aurantiaca_EU361935 ATGGAGGAATTTCAAGTA---------TATTTAGAACCAGATAGATCGCGCCAACATGAC------TTCCTATACCC------ACTTTTTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGGTTA------AATGGATCCATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTAATCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCATCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCGTCC---------TTAGAGGAAGCAGAAATCGTAAAATCTTCT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAATATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGGAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGGAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTACGTAGCAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGAAAAAATAGAACAT------TTGGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTTTGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAACATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATATTTCTCATTATTACAACGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCG------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Discolobium_psoraleifolium_AF270 ATGAAGGAATATCAAATA---------GATTTAGAACTAGATAGATCCCGCCAACCGAAC------CTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCCATGGTCATGATTTAAATTTAAATCGACCCATTTTGGTGGAA---AATGTAGAT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTTTGCTAACGATTCGAAC------AAAAATCAA------------TTTAGAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCATTGTGGAAATTCCATTTTCCCGACAATTA------AGTTCCTCT---------TTCGAGGAGGCAGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCGATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTTTTACTCAA------------AAAAAACTGTTTTCTAATTTTACA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTTTA------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATGCATTTTGGCTTCAAAGAAT------GCGCTTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTATGGCAATGTCATTTTGATGTGTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGAGAGGTTATCTTTCAAATGTGCGGTTAAATTTTTTAGTGGTACGTAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAAAAGTTCCAATTATTCCTTTAATTCGATTTTTGGCTAAAGTGAAATTTTGTAATATATTAGGGCATCCTATTAGTAAACCCGTTTGGACCGATTCATCCGATTTTTTTATTATTCCCCGATTTTTGCAGATATACAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTTTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAATGTA------------AAAGGA---------------------------TAA Distemonanthus_benthamianus_EU36 ATGGAGGAATCTCAAATA---------TATTTCGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATACACTTGCTTATGATCATGGTTTA------AATAGTTCAATTTTGGTAGAA---AATGTAGGT------TATGACAAA------AAA------TCTAGTTTACTAATTGTAAAACATTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCCGAGGGGTTTGCCGTCATTGTGGAAATTCCATTATCTTTACAATTA------------TCC---------TTCGAGGATGCAAAAATCATAAAATCTTAT---AAATTACGATCAGTTCATTCAATATTTCCTTTCTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTCCGAATACCCTATCCTATCCATCTGGAAATATTGGTTCAAAGCCTTCGCTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGACTCTTTCTTTAC------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGGTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCGTCTCATTTACGATTAACATCTTCTGGAGTTCTTTTTGAGCGAGTATATTTCTATGGAAAAAGAGAGCAT------CTTGTAGAAGTCTTTGCT------AATGATTTTCCGTCT---ACCCTATGGTTC------CTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATCCTGGCTTCAAAGAAT------ACGCCTCTTTTGATCAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTGTGTTTGGTCTCAACCAGGAAGGACCCATATAAAC---CAATTC---TCCGAGCATTCATTTTACTTTCTG------GGCTATTTTTCAAAAGTCCGGCTATATCCTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCGTTTATAATAGAAAATTTTATGAAAAAGCTCGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCGAAAGCGAAATTTTGTAACGTATTAGGGCACCCCATTAGTAAGCCAGTCTGGGCTGATTCATCAGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAAA------TTCGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAACTTCTTCTACTTGGCAG------AGGTTATAT------AGAAGTCGGATTTGGTATTTGGATATTATT---TGCATCACT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Disynstemon_paullenoides_GU95167 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCACCAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTGTGGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATGTAGGT------TATGACAAT------AAA------TTTAGTTTACTAAATATAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCCAAC------AAAAATCCA------------TTTTGGGGGTATAACAAAAATTTTTAT---TCTCAAATACTATTAGAGGGTTTTGTTGTCGTCGTGGAAATTCCTTTTTCCCTACAATTT------AGCTCTTCC---------TTAAAGGAGGTAGAAATCGTAAAATCTTATAAAAATTTGCGATCGATTCATTCCATTTTTCCCTTTTTTGAGGATAAATTTACATATTTAAATTATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGATGAAAGATGTTTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------TACTATTGTAATTGGAAT------------AGTCTTATTACTCCC------------CAAAAATTAATTTATACTTTTTCA---------------TCAAAAAGTAATCCGAGATTT------------------------TTTTTGTTC------CTATATAATTTATATGTATGGGAATACGAATATATCTTTCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTTGCGTTCTTTTTGAGCGAATTTATTTCTATACAAAAATAGAATAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTAT---CCCTTATCATTT------TTCAAAGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCTATTCTGGTTTCAAAAAAT------ACGCCTCTTTTGATCAATAAATGGAAATACTATTTTATCCATTTTTGGCAATGTCATTTTGATGTTTGGTCTCAATCAGAAACGATCCATATAAAC---CAATTA---TCAAAGCATCCATTTCACTTTTTG------GGCTATTTTTTAAATGTGCGGATAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAATCGAACTTGTTATGAAAAAGCTTGATACAAGAGTTCCAATTATTCTTTTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTCGGGCATCCCATTAGTAAGTCGATCTGGGCCGATTTATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAAAGGATCCTCAAAAAAAAAGAGTTTGTATCGGATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTCCGCGCTTGTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACCGAAGAAGAACAGATTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTAGTTTACAG------AGGTTATAT------AGAGATCGGATTTGGTATTTGGATATTCTT---TTAAGCAAC------GAATTAGTCAAT---------------CATTCA---------------------------TAA Dolichopsis_paraguariensis_AY509 ATGGAGAAATATCAAGCA---------TATTTAGAACTCCGTAGATCTCGATACCAGGAT------ATCCTATACCC------ACTTTTTTTTCGGGAATCTATTTATGGACTAGCTTATGGTCATGAG---------------TCCTTTTTTATAGAA---AATGTAGAT------TATAACAAT------AAT------TTTAGTTTACTAATTGTAAAACGTTTAAGTACTCGAATGTATCAACAGACTCATTTCATTCTTTTTGCTAACGATTGTAAC------AAAAAGATT------------TTTGTGGGTTATAACTATAATTTTGAT---TCTAAAAAAATATTAGAAGGTTTTGGTGTCGTCGTGGAGATTTTATTTTCTCTACAATTA---TTTATCTCTTCC---------TTAAGGGGATTAGAAAGCGTAAAATCTTATCAAAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTAATATATTTCAATCATAAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTAATCAGGTTGTTTTTTTAT------TACTATTATAATTGGAAT------------AGTCTTTTTCCTCCA------------AAAAAAAGGATTTCTACTTTTTTT---------------TCAAAAAGGAATCTAAGAATT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAAAAAATCCTCTCAGTTACAGTTAAAACATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAAAACAT------CTTCTAGAAGTATCTACT------AAGAATTGTTCATAT---ACCTTATTTTTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTTAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATATATTTATGGCAATGTCATTTTGATATTTGGGCTGGACCAGGAACGATCTATATAAAC---CAATTA---TTTCAGTATTCATTTCACTTTTTA------GGCTATTTTTTAAGTATTCCACAAAATCTTTCAGTAGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCAAAATTGTTATCAAAAAACTTGATACAAGAGTTCCCATTATTCCTATAATCAGATCATTGGTTAAAACAAAATTTTGTAATGTAATGGGTCATCCCATTAGTAAGTCGGTTTGGTCCAATTTCTCTGATTTTGATATTATTGACCGGTTTTTGCGCATATGCAGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTCTATCAAATAAAATATATACTTCGGTTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTTAAAAAA------TTAAGTTCAGAAAAATTATTGGAAGAATTTTTT---ACA---GAAGAAGATCTTTTGTCTTTGATTTTTCCA------AGAACTTCTTTGACTTTGCGG------AGGTTTTAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTAGAATTTAAAATAGGTTATGATACTTTTTAA Dolichos_trilobus_AY582976 ATGGAGCAATATCAAGCA---------TATTTAGAACTCCGTAGATCTCGATACCAGGAC------ATCCTATACCC------ACTTTTTTTTCGGGAATCTATTTATGGACTAGCTTATGGTCATGAG---------------TCCATTTTTATAGAA---AATGTAGAT------TATAACAAT------AAA------TTTAGTTTACTAATTGTCAAACGTTTAAGTACTCGAATGTATCAACAGACTCATTTCATTCTTTTTGCTAACGATTCTAAC------AAAAATATT------------TTTGTGGGTTATAACTATAATTGGGTT---TCTCAAAAAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCTCTACAATTA---TTTAACTCTTCC---------TTAAGGGGATTAGAAATCGTAAAATCTTATAAAAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTTATATATTTAAATCATAAGTCAGATATACGAGTACCTTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTAATAAGGTTGTTTTTTTAT------TACTATTATAGTTGGAAT------------AGTCTTTTTACTCCA------------AAAAAATTGATTTCTACTTTTTTT---------------TCAAAAAGGAATCTAAGAATT------------------------TTCTTGTTC------CTATATAATTTCTATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAATAAATCCTCTCAGTTACAGTTAAAACATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTACT------AAGAATTGTTCATAT---ACCTTATCATTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAAGAAATGCAAATACTATTTTATCTATTTATGGCAATATCATTTTGATATTTGGGCTGGACCGGAAACGATCCATATCAAC---CAATTA---TCTCAGTATTCATTTCACTTTTTA------GGCTATTTTTTAAGTATTCCGCTAAATCTTTCAGTAGTACGAAGTCGAATGTTGCAAAATTCATTTCTAATAAAAATTTTTATCAAAAAGCTTGATACAATAGTTCCCATTATTCCTCTAATGAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTCTCTGATTTTGATATTCTTGACCGGTTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAAAGGATCCGCAAAAAAAAAGAGTTTCTTTCAAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAAA------TTAAGTTCAGAAAAATTATTGGAAGAATTTTTT---ACA---GAAGAAGATCTTTTTTCTTTGATTTTACCA------AGAACTTCTTTTACTTTGCAG------AGGTTTTAT------AGAGGTCGGGTTTGGTATTTGGATATTTTT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTC---------------------------TAA Dorycnium_pentaphyllum_JQ619968 ATGGAGGAATATCAGTTA---------TATTTGGAACTGGATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTGTTTTTCACGAATATATTTACGGACTCGCTTATAGTCATGATTTA------AATAGATCGATTTTTGTAGAA---AATATTGGT------TATGATAAT------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAC------AAAAATCGA------------TTTTTGAGGTATAATAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCATCGTGGAAATTCTGTTTTCTTTACAATTA------AGCTCGTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAAAATCTGCGATCAATTCATTCTATTTTTCCCTTTTTCGAGGATAAAGTTACATATTTAAATTATATATCAGATATACGAGTCCCTTATCCTATCCATCTGGAAATCTTAGTCCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTGTTTCATTTATTAAGATTGTTTCTTTAT------GATTATTGTAATTGGAAT------------AGTATTTTTATTCCA------------AAAAAATCGATTTATACTTTTTCA------------------AAAAAGAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATATGAATCTATCTTTTTTTTTCTACGTACCAAATCTTTTCATTTACGATTAAAATCTTTTAGAGTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAAAGGACAT------CTTGTAGAAGTATTTGGT------AAGGATTTTTTTTCT---ACCTTAACATTC------TTTAAGGAT---CCTTTCATCCATTATGTTAGATATCAGGGAAAATCCATTCTGGCTTCCAAGAAT------TTGCCTATTTTAATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCGCGAACAATCCGTATAAAC---CAATTA---TCCGAATATTCATTTCACTTTTTG------GGCTATTTTTTAAAGGTGGGACTGAAGCATTCAGTAGTACGGGGTCAAATGCTGCAAAATGGATTTCTAATCAAAATTTTTATTAAAAAGCTTGATATAATAGTTCCAATTATTCCAATAATTAGATTATTGGCTAAATCGAAATTTTGTAATGTATTAGGGAATCCCCTTAGTAAGCCGTCCTGGGCCGACTTATCCGATTTTGAGATTATTGCCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCCTGTAAACACAAAAGTACTGTACGCGCTTTTTCGAAAAGA------TTAGGTTCGGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTACGG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTTAGCAACGATAACGATCTAATCAAT---------------CATGAC---------------------------TGA Duparquetia_orchidacea_EU361937 ATGGCGGAATTTCCAGTA---------TATTTCAAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATCTTTCGGGAGTATATTTATGCATTTGCTTATGATCATGGTTTA------AATAGTTCCATTTTAGTAGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATCCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAGAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCATCATTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGGGGAGGCAGAAATCGTAAAATCTTCT---AATTTAGGATCAATTCATTCAATATTTCCTTTTTTCGAGGAAAGATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCACCTGGAAATCTTGGTTCAAACCCTTCGCTACTGGGTGAAAGATGCCGCTTCTTTTCATTTATTAAGGCTCTTTCTTCAC------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAGAGTCGATTTCTTCC------------------------AAAAGGAATTCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGGAAAAATGGAGCAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTCCACTC---CCCTTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATCTTATTAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGCTATTTTTCAAGTGTGCGGCTAAATCCTTTAACGGTACGGAGTCAAGTGTTGGAAAATTCATTTATAATAGAAAATGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAAAATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGTCGATTCATCCGATTTTGATATTATTGAACGATTTGGGGGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAACGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAGCTCTTT---ACAGAAGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCCGGTTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TAA Duparquetia_orchidacea_RADS ATGGCGGAATTTCCAGTA---------TATTTCAAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATCTTTCGGGAGTATATTTATGCATTTGCTTATGATCATGGTTTA------AATAGTTCCATTTTAGTAGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATCCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAGAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCATCATTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGGGGAGGCAGAAATCGTAAAATCTTCT---AATTTAGGATCAATTCATTCAATATTTCCTTTTTTCGAGGAAAGATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCACCTGGAAATCTTGGTTCAAACCCTTCGCTACTGGGTGAAAGATGCCGCTTCTTTTCATTTATTAAGGCTCTTTCTTCAC------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAGAGTCGATTTCTTCC------------------------AAAAGGAATTCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGGAAAAATGGAGCAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTCCACTC---CCCTTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATCTTATTAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGCTATTTTTCAAGTGTGCGGCTAAATCCTTTAACGGTACGGAGTCAAGTGTTGGAAAATTCATTTATAATAGAAAATGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAAAATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGTCGATTCATCCGATTTTGATATTATTGAACGATTTGTGTGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAACGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTATTGGAAGAGCTCTTT---ACAGAAGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCCGGTTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TAA Dussia_lanata_JX295925 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTTCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATGGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Dussia_lehmannii_JX295924 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTTCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATGGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Dussia_macroprophyllata_AY386903 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATCATTTTCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATGGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Ebenopsis_ebano_AF274123 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGNAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGTTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTGCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACTCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTACGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGCAGATATGCAGAGATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGTTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTACTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATAT------AGGGGTCGTATTTGGTATTTTGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Ebenus_cretica_JQ619960 ATGAAGGAATATCAAGTA---------TATTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCCATTTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TATAGTTTACTAATGGTAAAACGTTTAATTACTCGAATGTATCAACAGAATTGTTTGATGATTTCGGCTAATGATTCGAAC------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTAT---TCTAAATTAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTA------AGTTCTTCC---------TTAGAAGAGGCCGAAATCATCAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCGATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTAAAAGATGCCCCTTTTTTTCATTTATTACGTTTGTTTCTTTAT------AATTTTTGTAATTTGAAT------------AGTTTGATTACTCCA------------AAA---------TCGACTTTTTCA------------------AATAGTAATCCAAGATTA------------------------TTCTTGTTC------CTCTATAATTGTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATTTTTTTTTATGAAAAAAGAGAACAT------CTTGTAGAAGTTTTTGAT------AAGGATTTTTCGTCT---ACCTTAACATTC------TTCAAGGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCCCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATCTTTTTTTGATATTTGGTCTGAACCGGGAACGATCCACATAAAC---CAATTA---TCTGAACATTCATTTCACCTTTTA------GGCTATTTTTCAAATGTTCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTACAAAATACATTCCTAATAGAAATTGTTAACAAAAAACTCGATATAATAGTTCCAATTATTCCTTTAATTAGATCATTGGCGAAAGCGAAATTTTGTAATGTATTAGGTCAACCTATTAGTAAGCCGGTATGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGCGAATATCTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACCTTGGCTTGTAAACACAAAAGTAGTGTACGCGCTTTTTTGAAAAGA------TCAGGTTCAGAAGAATTATTGGAAGAATTCTTT---AGAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTACAT------CGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Endertia_spectabilis_EU361943 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTATTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCGAAC------AAAAATCAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGATTTGCCGTCATTCTGGAAATTCCATTTTACCTACGATTA------ATCTCTTTC---------TTAGAGGAGGCAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTA---ATT---CTTCAT------GAGTATTGTAATTGGAAC------------ATTATTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------TTATATAATTTTTATCTATGTGAATACGAATCGATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTCCT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCTATTCTGGCTTCTAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTCTTTTTCCAGTGTACGGCGAAATACTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGAGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCCGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGATGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Entada_abyssinica_AF521829 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNATTGTAAANCGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCACTGTGGAAATTCCATTTTCCCCACAATTA------ATCTCTTCT---------TTAGAGAAGGCCGAAATAATAAAATCTTAT---AATTTACGATCAGTTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCCGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTGTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATACATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGTGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCGTTTATACTGGAAAATTGGATGAAAAAGCTTGATACAATAATTCCCATTATTCCTCTAATTAGATCATTGGCTAAAGCTAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGTCCGATTCATCCGATTTGGATATTATTGAAAGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGACGAATTCTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Enterolobium_cyclocarpum_AY65027 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTAAAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGCAGATATGCAGAGATCTCTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTTTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Eperua_rubiginosa_EU361947 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAACTCC---------GAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTCTCAACAAAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCATCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGGCAGATGTACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTTGTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTGATCTATGTGAATACGAATCTATCTTACTTTTTTTTCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTATTTACT------AAGGATTTTATGTCT---ACCCTATGGTTT------TTCAACGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATTTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTAGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTAATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Eremosparton_flaccidum_JQ619964 ATGAAGGAATATCAAGTA---------TTTTTAGAACGCGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTAGGGAGTATGTTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCTACATTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTCAC------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTAT---TCTAAAATAATATCAGAGGGCTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTT------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAAATTCCATATTTAAATTATGTGTCAGATATACGAATACCCTATCCAATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCCTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTTTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCTGAGATTA------------------------TTCTTATTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCTTCT---ACGTTAACATTC------TTCAAGGAT---CCTCTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGGAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAA---GAATTA---TCCGAACATTCATTTTACCTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGGCGGTCTGGGCCGATTCATCCGATTTTGAAATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TCAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCGTCTTCTACTTTGCAG------AAGTTAAAT------GGAAATAGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATTTGGTCAAT---------------CATGAA---------------------------TGA Eriosema_diffusum_JQ587629 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---------------NNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------TACTATTGTAATTTGAAT------------AGTCTTTTTACTCCA------------AAAAAATGGATTTCTACTTTTTTT---------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTC------TTATATAATTTATACGTCCGGGAATCTGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCAGCTACGATTAAAAGATTTTCACGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAATAT------CTTGTAGAAGTATTTACT------ACGGATTTTTCATAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCCATTCTGGTTTCAAAGAAG------ACCCCTCTTTTGATAAATAAATGGAAATACTATTTTCTCTATTTATGGCAATGTCATTTTGATATTTGGTCTCAATCAGTAACGATCCATATAAAC---CAATCA---TCCCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCGGCTAAATATTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCAAAATTTTTATAAAAAAGCTTGATACAATAGTTCCAATTTTTACTCTAATTAGATCATTGGCAAAAGAAAAATTTTGTAATGTAGTGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGATATTATTGACCGATTTTTGCGTATATGTAGAAATTTTTCTCATTATTACAATGGATCCGAAAAAAAAAATAGTTTGTATCAAATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Errazurizia_benthamii_AY391803 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTGGAT------TATGACAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATATA------------TTTTTGGGGTATAACAAGAATTTTTAT---TCTCAAATAATATCAGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTACCTACAATTA------CGTTCTTCC---------TTAGATGGGTCAGAGGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCAA------------AAAAAATCTATTTCTACTTTTTCA------------------AAAAATAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATCGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------AACCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCAGTTTTTTTTGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGTATCCCGTTAGTAAACCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAGCGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTCCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTTTTT---TCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAACAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Errazurizia_megacarpa_AY391804 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTGGAT------TATGACAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATATA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTACCTACAATTA------CGTTCTTCC---------TTAGAGGGGTCAGAGGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCAA------------AAAAAATCTATTTCTACTTTTTCA------------------AAAAATAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATCGCACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------AACCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTTGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGTATCCCGTTAGTAAACCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTACGTAAACACAAAAGTACTTTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTAGAAGAATTTTTT---TCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGTATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Erythrina_cristagalli_AY386869 ATGGAGGAATATCAAGTA---------TATTTAAAACTCCATAGATCTCGCCATCAGGAC------CTCCTATACCC------ACTTTTTTTTCGGGAGTCTATTTATAGACTCGCTTATGGTCATGGG---------------TCCTTTTTTGTAGAA---AATGTAGGT------TATAATAAA------AAA------TGGAGTTTACTAATTGTAAAACGCTTAATTACTCGAATGTATCAACAGATTGATTTGATCATTTTTGCTAATGATTCTAAC------AAAAATCCT------------TTTGGGGATTCTAATAAAAATTTTTAT---TCTCTAATAATATTAGAAGGTTTTGTTGTTGTCGTGGAAATTCGATTTTCCTTACAATTT---TGGATCTCTTCC---------TTAAAGGAATTAGAAATCGTAAAATCTTATAATACTTTGAGATCAATTTCTTCCATTTTTCCCTTTTTCGAAGATAAATTGATATATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTTTTTCTTTCATTTTTTAAGGTTGTTTTTTTAT------TACTATTTTAATTCGACT------------AGTGTTTTTACTCCA------------AAAAAAGATATTTCTATTTCTTTT---------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTTTACGTAACAAATCCTCTCAGTTACGGTTCAAATATTTTCGTGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTTTAGAAATATCTGCT------AAGGATTGTTTATAT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCCATTTTTGTTTCAAAGAAT------ACCCCTCTTTTGATAAAGAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCGATCAGAAACAATCTATCTAAAC---CAATTA---TCCCAGCATTCATTTAACTTTTTG------GGTTATTTTTTAAGTATTCGACTAAATGTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTTTAATTCAAATTTTTATAAAAAAGCTTGATACAATAGTTCGAATTCTTCCTCTAATTAGATTATTGGCTAAAGAAAAATTTTGTAATATATTGGGTCATCCCATTAGTAAGCCGGTTTGGGTCAATTTATCTGATTTTGATATTATTGACCGATTTTTGCAGATATGTAGAAATTTTTCTCATTATTACAATGGATCTGAAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGGAAGCATAAAAGTACTGTGCGCACTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACA---GAAGAAGATATTTTTTCGTTGATTTTTCCA------AGAACTTCTTTTACTTTACAG------AGGTTATAT------AGAGATCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTGGTGAAT---------------CATTCA---------------------------TAA Erythrophleum_suaveolens_EU36194 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATTGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTATCAGATGTACGAATACCCTACCCTATCCATCTGGAAATATTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTTTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGTCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAATCAAATGTTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGGGTTTTTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACATAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAAAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTTTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Etaballia_guianensis_AF272074 ATGAAACAATATCAAATA---------TATTTAGAACTAGATAGANNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAAGGTATTTCCACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTATAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AATAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAACC---CAATTATTATCCGAGCATTCATTTAACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCCATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTNNNNNNNCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATGCTCAAAAAAAAAANGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAGGA------TTAGATTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGATTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTA------------AATGGA---------------------------TAA Euchlora_hirsuta_JQ041113 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTCCTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATTTCTTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------TTATATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTAAGTAATAAATCGTCTTATTTAGGATTAACATCTTTTAGCGTTCTTTTTGAGAGAATTTATTTCTATGGAAAAATAGAAAAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGAAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCTTTTTGGCTTCAAGGAAT------GCGCCCCTTTTGATGAATAAATGGAAAAATTATCTTATCCATTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCAGGAATGATCCAAATAAGC---CGATTC---TCCGAGTATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTGTCAGCGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTCGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCAGCCTGGGCTCATTTATCCGATTTTGATATTATTGACCGCTTTTTGCTCATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Eurypetalum_tessmannii_EU361950 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATTTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTCTCAACAAAATCATTTGATTATTTATGCTAATGATTCTAAC------AAAAATCAA------------TTTTGTGGGTACAACAAGAATCTATAT---TCTCAAATAGTATCAGAGGGGTTTGCCATCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTCAATTATGTGGCAGATGTACGAATACCTTACCCTATCCATCTGGAAATTTGGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTTGTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCAAATTCA------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTACTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAATATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTATTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAACGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCGACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCGAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCA{AC}AAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTAGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTAATCTTATCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Exostyles_aff_venusta_JX152591 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGAAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATACTAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGTAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAATCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCGTCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Exostyles_godoyensis_JX152589 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATACTAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTTA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCGTCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Exostyles_venusta_JX152590 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATACTAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGTAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAATCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCGTCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAAAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Eysenhardtia_orthocarpa_AY386909 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTGGAT------TATGACAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATCTA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCCGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTCCATACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAGGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCTATTTCTACTTTTTCA------------------AAAAAGAATCCCAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGCATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCCATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTGTCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTACGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCCATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGCCTTTCTTGTATTAAAACCTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTTTTT---TCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Eysenhardtia_polystachya_EU02590 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTGGAT------TATGACAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATCTA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCCGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTCCATACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAGGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCTATTTCTACTTTTTCA------------------AAAAAGAATCCCAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGCATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCCATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTGTCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTACGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCCATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGCCTTTCTTGTATTAAAACCTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTTTTT---TCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Eysenhardtia_texana_AY391807 ATGGAGGANTATCATGTN---------TATNNNNAACTAGATNNNNNNNNNNNNNNGGAC------TTNCTATACCC------ACTTATTTTGCGGGAGTATATGGANGGNCTTGTGGATGANCATGATTTN------NATCCATCCATTTTGGTGGAG---AANGTGGAT------AATGNCAAG------AAA------TCTANCTTACTNATTGNAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATCTA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCCGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTCCATACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAGGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTTTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCTATTTCTACTTTTTCA------------------AAAAATAATCCCAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCCATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTACGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCCATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGCCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTTTTT---TCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATTCA---------------------------TGA Faidherbia_albida_AF274129 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTTGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGACTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCTATTTATGGCAATGTTATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATAAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGCAGATATGCAGAGATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAACAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAAA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Fiebrigiella_gracilis_AF203590 ATGAAACAATATCAAATA---------TATTTAGAACTAGATAGATCTCGTCAACAGAAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTCTGGTCATGATTTAAATAGAAATCGATCCATTTTGGTGGAA---AATGTGGAT------TCTGATAAG------AAA------TCTAGCTTACTAATTGTAAAACGTTTAATTACTCGAATATGTCAACAGAATCATTTGATTCTTTTTGATAACGATTCTAAT------AAAAATCAA------------TTTTGGGGGTATAACAAGATATTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCATGGAAATTCAATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGAAATCGTAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTTTTTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCTTTCATTTATTAAGATTGTNTATTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTTATTTTTCCTTTTTCA------------------AAAAGTAATCCGAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAAAAATCCTCTTATTTACGATTAAACTCTTTTAGAGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTTCT------AATAATTTTTCGTCT---ACCTTATCTTTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAAAT------GTGCCTCTTTTGATGAATAAATGGAAATACTATCTAATCTATTTTTGGCAATGTAATTTTGATGTTTGGTCTCAACCCGGAACGATCTATATAAAC---CAATTA---TTCGAGAATTCATTTCATTCTTTTTGGGGGGGCTATCTTTCAAATGTACAGCTAAACTTTTCCGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTCGATACAATAGTCCCAATTATTCCTTTAATAAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAACCCCGTTTGGACCGATTCATCTGATTTTGATATTATTGACCGATATTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCTTCAAAAAAA---AGTTTGTATCGAATAAAATATATAATTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTCGAAGAATTCTTT---GCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGATCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATTTGATCAATGTC------------AAT------------------------------TGA Fissicalyx_fendleri_AF272063 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCCTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAACCGATTTTTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAAAAATCCTCTCATTTACGATTCAACTCTTTTAGCGTTCTTTTTGAACGAATCGATTTCTATACAAAAATAGAACAT------CTTGTANAAGTCTTTTCT------AATAATTTTTCGTCT---ACCTTATCATCT------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAGT------GCGCCTCTTTTGATGAATAAATGGAAATACTATTTCATCTATTTCTGGCAATGTCATTTTGATCTTTGGTTTCAAGGCGGAACGATCTATATAAAC---CAATTA---TTCGAGAATTCATTTCATTCTTTTTGGGGGGGCTATCTTTCAAATGTACGGCTAAACTTTTCAGTGGTACGGAGTCAAATGCTCGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTCGATACAATAGTACCAATTATTCCTTTAATAAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTNNNNNNNNCGTTTGGACCGATTCATCTGATTTTGATATTATTGACCGATATTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCGTCAAAAAAA---AGTTTGTATCGAATAAAATATATAATTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGATCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATATA------------AAT------------------------------TGA Fordia_splendidissima_AF142718 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCACCATAAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATGATCATGATTTA------AATAGATCCATTTTTGTAGAA---AATATAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTATGCTAATGAGTCTAAC------AAAAATCCA------------TTTTGGGGATATAACAATAATTTTTAT---TCTCAAATAATATTAGAAGGTTTTGTTGTTGTCGTGGAAATTCCATTTTCACTACAATTT------AGTTTTTCT---------TTAGGGGGGGGGGGAATCATAAAATATTTTTATAATTTGCGATCAATTCATTCCATTTTTCCCCTTTTCGAAGATAAATTTACATATTTAAATTATAAGTCAGATATACAAATACCCTATCCTATCCATCTGGAAATCTTGATTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTCATTTATTAAGATTGTTTTATTAT---------TATTGTAATTGGAAT------------AGTCTTATTAATTCA------------AAGAAATCAATTTCTATTTTTTCAAAT------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATATATCTTTTTTTTTCTACGTAACAAATCCTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTGTGCAAAAATAGAACAT------CTTGTACAAGTCGTTGAT------AAGAATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTTATTTATTTATGGCAAGGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAT---AAATTA---TCCGAACATTCATTTCACTTTTTG------GGCTATTTTTTAAATATGCAGTTAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAATTGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCTTCTAATTAGATCATTAATTAAAGCGAAATTTTGTAATTTATTGGGGTATCCTATTAGTAAGTCGGTTTGGATCGATTCATCCGATTTTGATATTCTTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACACGGATCCCTCAAAAAGAAGGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGATCCGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGATTTTTTCTTTGATCTTTCAA------AGAACTTCTTCTCCTTTCCAG------AGATTACAT------AGAGGTCGAATTTGGTATTTAGATATTCTT---TTCAGCAAT------GATCTGATCAAT---------------CATTTA---------------------------TAA Gagnebina_commersoniana_AF521836 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNATTGTAAANCGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTTTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGCAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTT------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATGGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATAAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCTATTATTCCTCTAATTAGATCATTGGCTAAAGCTAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTTCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACNCAAAAGTACTGTACGGGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAAATCTTTTTTCTTTGATCTTCTCA------AGAACTTCTTCTATTTTGCAA------AAGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Galactia_martii_LPQ7583 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCTATTTTTGTAGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTGTTGAGTATAACAGTAATTTTTAT---TCTCAATTAATATTAGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGCTACTGGGTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCCATT------TTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTTTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTCGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAATCGGTCTGGTCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGGGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Galactia_striata_AF142704 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTGTTGAGTATAACAGTAATTTTTAT---TCTCAATTAATATTAGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATATAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTTATTTATTTAGGTTTTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCCATTTCTACTTTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AATAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTTTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTCGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAATCGGTCTGGTCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGGGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Galega_orientalis_AF522083 ATGAACGAATATCAAGTA---------TATTTAGAACGAGCTCGATCTCGCCAACAGGAC------GTGCTATATCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTCTAGTCATAATTTT------AATAGATCCATTTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCGGGTAATGAGTCTAAC------AAAAATCCA------------TTTTGGGGTTATAATAAGAATTTTGAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCTTTTTTCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAAAATTTGCGATCAATTCATTCTATTTTCCCCTTTTTGGAGGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATTTTAGTTCAAATCCTTCGATACTGGATGAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTGTGTAATTGCAAT------------AGTTTTATTACTACC------------AAAAAATCTATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTACGTGAATATGAATCTATCTTCCTTTTTCTACGTAATAAATCTTCTCATTTACGATTAAAATCTTTTAGCTTTTTTTTTGAGCGAATTTTTTTTTATGCAAAAAGAGAACAT------CTTATAGAAGTTTTTGCT------AAGGATTTTTCGTAT---CCTTTACCATTC------TTCAAGGAT---CCTATCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAAAT------GCGCCTCTTTTGATCAATAAATGGAAACACTATTTTATCCATTTAGGGGAATGTTTTTTTGATGTTTGGTCTCAACCGGGAACGATCAATATAAAC---CAATTA---TCCGAACATTCATTTTACCTTTTG------GGCTATTTTTCAAATGTCCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTACAAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTCGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAACGATTTTTGAGAATAGCCCGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAACTACGGTACGCGCTTTTTTGAAAAGA------TCAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCG------AGAGATTCTTCTACTTTGCGA------AGGTTACAT------AGAAACCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAAT---------------CATGAA---------------------------TGA Gastrolobium_punctatum_AY386885 ATGGAGGAATACCCAGTA---------TATTTAGAATTTGATAGATCCCGTCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGAATCGCTTACGGACATGATTTA------AATAGATCCATTTTTGTAAAA---AATGTAGGT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCAAAAGATTCTTTTTGCTAATGATTTTTAC------AAAAATCAA------------TTTTTGGCGTATAACAAGGATTTAGAT---TCTCGAATAATATCAGGGGGATTTACCGTCGTTGTGGAAATTCCATTTTCCCCACAATTA------AGTTCTTTT---------TTAGAGGAAACACAAATAGTAAAATCGTATAAAAATTTGCGATCAATTCATTCCATTTTCCCCGTTTTCGAGGATAAATTTTCATATTTAAACTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATATTGGTTCAAACTCTTCGATACTGGTTGAAAGATACCCCTTTCTTTCATTTATTACGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT---------AGTAGTCTTATTACTCCA------------GAAAAATTGATTTTTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTT------CTGTATAATTTGTATGTATGGGAATACGAATCGATCTTCCTTTTTCTACGTAATAAATCATCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATGGAACAT------CTTGTAGAAGTATTTTCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAAGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTACAAAGAAT------ACACCTATTTTGATTAAAAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTATCAACCGGAAACAATCAATATAAAC---CAATTA---TACAAGCATTCATTTTATTTTTTG------GGCTATTTTTCAAACGTGCGGCTAAATCCTTCTGCAGTAAGGAGTCAAATGCTGCGAAGTTCATTTCTAATCGAAAATGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGGTCATTGGCAAAAGCTAAATTTTGTAATGGATTGGGGCATCCCATTAGTAAGTCGATCTGGGCTGATTCACCCGATTTTTTTATAATTGAGCGATTTTTTAAGATCTATAGAAATATTTCTCATTTTTACAACGGATCCTCAAAAAAAAAAAATTTGTATCGAATAAAGTATATACTTAGGCTTTCTTGTGTGAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTCTTAAAAAGA------TTTTATTCGGGAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTCCTTTGCTCTTTCCA------AAAGCTTCTTGTACTTTTCATGGG---GGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCACCAAC------GATATGGTTAAT---------------CTTGAA---------------------------TGA Genista_monspessulana_AY386862 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGCAC------TTCCTATACCC------ACTAATTTTTCGGGAATATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTTTTTCGGCTAATGATTCTAAC------AAAAATCAA------------TTATGGGGTTATAATAAAAATTTGTAC---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCGAAAGATGCCCCTTTGTTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AACCTGATTACTCCA------------AAAAAATTGATTTCTACTTTTTCG------------------AAAAGTCATCTAAGAGTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTACTTTTTCTACGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATAGAAAAATAGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTATCATTCTTCAAGGAG---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAAAACTATCTTATCCATTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATCAGTAAGCCGCTTTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGTCTCGTAAACACAAAAGTACTATACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGGTATTTCAA------AGGGCTTCTTCTACTTTGCAG------GGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATTTGGTCAAT---------------CATGAA---------------------------TGA Genistidium_dumosum_AF543858 ATGGAGGAGCATCAAGTA---------TATTTAGAACTGGATAGATCTTGCCAACAGGAC------TTCCTATACCC------ACTTGTTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGATCCATTTTTGCGGAA---AATGTAGGT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATCTCTGCTAATGATTCTAAA------AAAAATAGA------------TTTTTGAGGTATAATAAGAATATTTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTAGAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATAATAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTTGAGGATAAATTTACATATTTAAATTATTTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGATTGTTTCTTTAT------GATTATTGTAATTCGAAT------------AGTCTTATTACTCCT------------AAAAAATGGATTTCGACTTTTTCA------------------AAAAGTAATTCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATATGAATCTATCTTCTATTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGTCTTTTTTTTGAGCGAATCTTTTTCGATGCAAAAAGAAAACAT------CTTGTAGAAGTCGTTGCT------AAGGATTTTTTGTCT---ACCTTAACATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTAATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTGATCTTTGGGCTCAACCAGGAACGATCCACATAAAC---CTATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCGACTAAATCGTTCAGTGGTACGTAGTCGAATGCTGCAAAATGCATTTCTAATCGAAATTGTTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAATTTTTGTAATGTATTAGGGAATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCGGATTTTGATATTATTGACCGATTTTTACGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCGGAAAAATTGTTGGAAGAATTTTTT---ATAGAAGAACAAGAGATTGTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTTTTTTTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Geoffroea_spinosa_AF270879 ATGAAAGAATATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAATATAAATCGATCCATTTTGGTGGAA---AATGTGAAT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAACTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAT------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGAAATCGTAAAATCTTTTACAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCTTTCATTTATTAAGATTGTTTATTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTCTACTTTTTCA------------------AAAAGTAATTCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAAAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCCATTTCTATGCAAAAATGAAACAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCCGGAACGATCCATATAAAC---CAATTATTATTCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATTCCATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAGGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTAGAAGAATTCTTT---ACAGAGGAAGAAGAAATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTTTAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTA------------AATGGA---------------------------TAA Gilletiodendron_pierreanum_EU361 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTCTCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTCTCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATCAATTTCCATATTTAAATTCTGTGGCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCACACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCGTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGGGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATTCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GATTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Gleditsia_sinensis_AY386930 ATGAAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCTTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAACTCAATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAAGCATTTGATTCTTTCTGCTAATGATTCGAAC------AAAAATCAA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCCTTATTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CGTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCT---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGTCTTCAAAGAAT------ACGCCATTTTTTATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAACAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAAAA---TTTTTGGAAGAATTTTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTACCA------AGAGCTTCTTTTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Gleditsia_triacanthos_AY386849 ATGAAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCTTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCGATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCGAAC------AAAAATCAA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATATGAATCTATCCTTATTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CGTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCT---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGTCTTCAAGGAAT------ACGCCATTTTTTATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAACAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAACAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAAAA---TTTTTGGAAGAATTTTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTACCA------AGAGCTTCTTTTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAC---------------------------TGA Gliricidia_brenningii_AF547199 ATGGAGGAGCATCGAGTA---------TATTTAGAACTGGATAGATCTCGCCAACAAGAC------TTCCTATACCC------ACTTGTTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGATCCGTTTTTGTGGAA---AATGTAGGT------TATGATAAA------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCAAATGTATCAACAGAATCATTTGATCATTTCGGCTAATGATTCTAAA------AAAAACACA------------TTATTGAGGTATAATAAGAATATTTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATTCTAAAATCTTATAATAATTTGCAATCAATTCATTCTATTTTTCCCTTTTTTGAGGATCAATTTATATATTTAAATTGTGTGTCAGATATACGAATACCCTATCCTATCCATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTAT------GATTATTGGAATTGGAAT------------AGTCTTATTACTCCTCTTATTACTCCAAAAAAATGGATTTCGACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATATGAATCTATCTTCTATTTTCTATGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAGAAAACAT------CTTGTAGAAGTCGTTGCT------AAGGATTTTTTGTCT---ACCTTAACATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCTCTTTTAATGAATAAATGGCAATACTATTTTATCCATTTATGGCAATCTCATTTTGATATTTGGGCTCAACCAGGAACGATCCACATAAAC---CTATTA---TCCGAACATTCATTTTACCTTTTG------GGCTATTTTTTAAATGTGCGGCTAAATCGTTCAGTAGTACGTAGTCAAATGCTGCAAAATACATTTCTAATTGAAATTGTTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGAATCCCATCAGTAAGCCGGTCTGGGCCGATTCATCAGATTTCGATATTATTGACCGATTTTTACGGATATGTAGAAATCTTTCTCATTATTATAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCATTTTTGAAAAGA------TTAGGTTCAGAAAAATTGTTGGAAGAATTTTTT---ATAGAAGAACAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTTCAG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Glycine_max_AF142700 ATGGAGGAATCTCGAGCA---------TATTTAGAACTCCATAGATCTCGACACCAGGAC------ACCCTATACCC------TCTTTTTTTCCGGGAATCTATTTACGGACTAGCTTGTGGTCATGGG---------------TCCATTTTTGTAGAA---AATGTCGGT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTCATCATTTTTACTAACGATTCTAAC------AAAAATCCT------------TTTATGGGTTATAACAATCATTTTTAT---TCTCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCCCTACAATTT---TGTATATCTTCC---------TTAAGGGAATTCGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATCCACCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTTTTTTTTTCT------TATTATTATAATTGGAAT------------AGTATTTTTACTCCA------------AAAAAATGGATTTCTACTTTTTTT---------------TCAAAAAGTAATCCAAGATTT------------------------TTTTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTAAGTTACGATTAAAATATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTGTT------AAGGATTGTTCATAT---ACCTTATCATTC------TTTAAGGAT---ACTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTTTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCGACCAGGAACGATCCATATAAAC---CAATTA---TCCCAACATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCGGCCCAATCTTTCAGTGGTACGAAATCAGATGTTGCAAAATTCATTTCTAATAAAAATGGTTATGAAAAGGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCGAAAGCAAAATTTTGTAATGTATTTGCCCATCCCATTAGTAAGCCGGTTTGGCCCAATTTATCTGATTTTGATATTATTGACCGGTTTTTGCGGATATGCCGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTGTATCAAATAAGATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGCGCGCACTTTTTTGAAAAGA------TTAGGGTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGACTTTTTCTTTGATTTTTCCA------AGAACTTCTTTTACTTTGCAG------AGGTTATAT------ATAGGTCGGATTTGGTATTTGGATATTCTT---GTCAGAAAC------GATTTCGTCAAT---------------CATTTC---------------------------TAA Glycyrrhiza_lepidota_AY386883 ATGAAGGAATATCAAGTA---------TATTTAGAACGAGATAGATCTCGCCAGCAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAATATATTTATGGAATTGCTTATAGCCATAATTTT------AATAGATCCATTTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTCGGGGTATAATAAGAATATTTAT---TCTCAACTAATATCAGACGGTTTTGCCGTCGTAGTGGAAATTCCATTTTTCTTACAATTT------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAATTTACATATTTAAATTATGTGTCAGATATAAGAATACCCTATCCTATCCATTTGGAAATCTTAGTTCAAATCCTTCGACACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGATTGTTTCTTTAT------AATTTTTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGGGTTTTTTTTGAGCGAGTTTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGATGTTTTTGCT------AAGGATTATTCACCT---ACCTTAACTTTA------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAGGGAAAAGCCATTCTGGCTTCAAGGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTCGAATGTGCGGCTAAATCGTTCAGTGCTACGGAGTCAAATGCTGCCAAATACATTTCTAATCGAAATTGTTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGAGCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AAAGCTTCTTCTACTTTGCAG------AAGTTACAT------AGAAATAGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------AATGAA---------------------------TGA Gompholobium_minus_AY386891 ATGGAGGGATATCAAGTA---------TATTTAGAACAAGATGGATCCCGTCAATTGGAT------TTCCTATACCC------ACTTTTTTTTCGGGAGTATATTTATGGACTCACTTATGGTCATGATTTT------TATAGATCCATTTTTGTGGAA---AATGTGGCT------TATGACAAA------AAA------TACAGTTTTTTAATTGTAAAACGTTTAATTACTGGAATGTATCAACAGAATCCTTTGATTATTTCTGCTAATGATTCTAAA------AAAGATGCA------------TTTTTAGGGTATAATAAGAATCTCTAT---TCTCAAATAATATCCGGGGGATTTGCGGTCATCGTAGAAATTTCCTATTCTTTACAATTA------AGCTCTTCC---------TTAGGGGAGGCAGAAATCATAAAATCTTATCCAAATTTTCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAACTATGTGTCAGATATACGAATACCCTACCCTATCCATCTAGAAATATCGGTTCAAACGCTTCGATACTGGGTGAAAGATGCCCCGATCTCTCATTTATTAAGGTTGTTTATTTAT------GAGTATTGTAATTGGAAT---------AGTAGTATTATTACTCCA------------CAAAAATCTATTTTTATTTTTTCA------------------AAAAGTCATCCAAGATTG------------------------TTCTTGTTA------CTATATAATCTTTATGTATGGGAATACGAATATATCTTCCTTTTTCTACGTAAGAAATCATGTCATTTACAATTTAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGGAAAAGTCGAAGAT------ATTATAGAAGTCTTTGCT------AAGGAGTTTTCGTCT---ACCTTGTCGTTC------TTCAAGGAT---CCTTTCGTTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCACCTCTTTTGATGAATAAATGGAAATACTTTGTTATCCATTTATGGCAATGTCATTTTTATATTTGGTCTCAACCAGGAATCATCCATATAAAC---CAATTA---TCCAAGTATTCATTTCACTTTTTG------GGATATTTTTCAAATGTACGGTTAAACCTTTCCGCGGTACGGAGTGAAATGCTGAAAAATCCTTTTCTTATCGAAAATGTTATCAAAAAGCTTGATACAAAAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGTCATCCTATTAGTAAGCCGGTCTGGGCCGATTCGTCCGATTTTTGTATTATTGACCGATTTTTGAGGATATGCCGAAATCTTTCTCATTATTACAAAGGATCCTCAAAAAAAAGGAGTTTGTATCGAATAAAGTATATACTTCGTCTTTCTTGTGTTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGGGCTTTCTTGAAAAGA------TTAGGTTCGGAAGAATTCTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTGTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGAAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------AATGATTGGTTA---------------------TGA Goniorrhachis_marginata_EU361959 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAAATAGGTTTCGGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTCCTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAT------AAAAAGAAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCATCATTCTGGAAATTCCATTTTCCCTACGATTT------ATCTCTTTC---------TTAGAGGAGGCAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCATATATAAGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTTTTATTACTTCA------------AAAAAATCTATTTCTACTTTTTCAAATTCA------------AAGAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATTTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCGATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTGT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTTATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGGTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATAT------AGAGGCCATATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Gossweilerodendron_balsamiferum ---------TTTCAAGGA---A---GGTTTTAAGAATTAGAT------CTGCAACATGA------ACACATATACCC---A--CGTTCTCTTTCGGGAGTATATTTATGCACTT------GATCACTCCATTTTGA--AAT------ATA----------C-AATTCG---------------AAT------CAA------TCTAGTTTATTCATTGTAAAACCTTTAATTACTCGTATGTATAAACCTGATCACTTGATTTTT------AAAGATCAA------------TTTTTT------------GTTTGAGAG---ACCAAGATTATTTTT---TTGCAAAGAATCTCACAGGGATTTGCCGTTATTGTGGGAATT------ACCCTACTC---------GTCTAGTATA-AA----CGTAGGAGGGTCG---ATTCGGAAATCTTAT---AATTTACGATCAATTCATTCAATACTTCCTTTATTATAGGATAAAGTTCCTTATATAAGTTATATGTTAGATGCCCAAATACCTAATCCAATTAATCTGGAACTTTTGGTGGAGACCCTTGCCTCCTCCTTCAAAGATATCTATTTTTTTCATTTA------GTCTTTCTTCAC-----A------------TTGAATA--AC--CA------------TTTTTT-CT------ACAAAAAAA--------------------C-GG---------------------------------------T--------------TTCCTGTTC---C--CGATATAATTTTTATATATTTGAATACGAATCCATCTTCCTTTTTCTCCGTAAAAAATCCTCTCCGGTACGACTAACACCCCTCCACTTCTTTTTTGAGAGAATAGATTTC------TAAATGGAACAT---A--------AAGGTCTCTGTGTCT---AATGATTTTCCT------ACCCTATGG---------TTTAAGGAC-C-CCTTTCATACATGATGCTAGACATGAGGGAAAATAC------ACCCCTAAGGGT------TCGTTCCTTTTCAAGCATAAATGGAAATATTTTTGTCTCAATTACTGGCAATTTAATTTTGTTCTTTGCTCGAAACCC---CGGATT---CCCAATC--AAATTCT--TATGAG------TGTGACTTTTCC-----AGGTCGTTTTTCAAGAGTACAGTTAAATCTTTCGGTGGTACGAAGTCAAATGCTAGAAAATTCATTGCTAATAGAAAGTGTTAAAAATAAGCTTGATACAACAGTCCCAATAATTGCTCTAATTAGATCGTTGACTATAGCGAAATTTTGTAACGCATTAGGGGATCCCGTTCGTATGCCCATCTGGACCGATTCATCCGTTTTTGTTATAATTGATCGATTTGCGCGGATATGCAGAAATCTTTCTCATTATTACAGCGGATCGTCAAAAAAAAAGAATTTCTATCGGGTAAAATATATACTTAGACTTTCTTGTATTAAAACTTTGACTCGTAAATCCAAAAGTGCTGTA------TTTTGGAAAAGA-----TTTAGATTCAGAA------TTCGAGGAATCCTTG---ACAGAAGAAGAAGAATTT------TTGATCTTCCTA------AGAAGG---TCTACTTTG--------AAGCTTTAAT------AGGGGTCGGTTT---TATTTAGAT---------TTCATCAAG---------------GAT------------------------------------T-G{CT}N-----{AG}-{CGT}TN Grazielodendron_riodocense_AF270 ATGAAAGAATATCAAATA---------TATTTAGAACTAGATAGATCTCGTCAACAGAAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAATATAAATCGATCCATTTTTGTGGAA---AATGTGGAT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAATCAA------------TTTNGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTTGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTACAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTAGAGGATAAATTTACATATTTTAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATCCCCCCTTCTTTAATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGACCAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCAAAATTGTTATGAAAAAACTTGATACCATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCTATTAGTAAGCCCGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCGCAAAAAAAAGAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTA------------AATGGA---------------------------TAA Gueldenstaedtia_stenophylla_JQ66 ATGAAGGAATATCCAGTA---------TATTTAGCAGGAGATAGGTCTCGCCAACAGGAC------TTCCTATACCC------ACTTCTTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCTATTTTTGTGGAA---AATGTAGGT------TATGACAAG------AAA------TCTAGTTTACAAATTATAAAACGTTTAATTAGTAGAATGTATAAACAGAATCATTTGATCATTTCTTCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAATAATATTCTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGCGGAAATTCCATTTTTCCTACAATTA------AGCTCTTCC---------TTAGAGGAGACAGAAATAGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAAAATGACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATTTTGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGTTCTAATTTTTTT---------------AATTTGAAT------------AGTTTGATTACTCCA------------AAA---------TCGACTTTTTCC------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATATGAATCTATCTTCCATTTTGTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAACGAATCTTTTTTGATGCAAAAAGAGAACAT------CTTGTAAATGTTTTTGCT------AAGGATTTTTCGTCT---ACCTTACCATTC------TTCAAGGAT---CCTCTCCTTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCTTTTATGGCAATGTTTTTTTGATATTTGGTCTCAACCAGAAATGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACCTTTTA------GGCTATTTTTCGAATGTGAGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTACAAAATACATTTCTAATCGAAATTGTGATCAAAAAACTTGATCTAATAGTTCCCATTATTCCTATAATTAGATCATTGACTAAAGCGAAATTTTGTAATGTATTAGGTCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTCTTGATCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAAAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TCAGGTTCTGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCTTGTTCTACTTTGCAG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Guianodendron_praeclarum_JX12440 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAA---AATGGAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA---AAAAAAAATAAA------------TTCTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATCCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGTGATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTACCAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAACAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGATTAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Guianodendron_praeclarum2_JX1244 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAA---AATGGAGGT------TATGACAAT------CAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA---AAAAAAAATAAA------------TTCTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATCCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTGGAGGATCAATTTACATATTTTAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGTGATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAACAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGATTAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CCTGAA---------------------------TGA Guilfoylia_monostylis_EU604031 AT{AG}GAGGAATTTCAAAGA---------TATTTTAAACTAGATAGATCTCGGCAACATGAC------TTCCTATACCC------ATTTATCTTTCGGGAGTATATTTATACACTTGCTTATGATCATGGTTTA------AATAGCTCGATTTTGTTGCAA---AATGTAAGT------TATGACAAT------AAA------TCCAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTTTTATTTCGGCTAATGATTCTAAC------AAAAATATA------------TTTTTGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAAGGGTTTGCAGTTATTGTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTCC---------TTAGGGGGGGCAGAAATCAAACAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCCTTTTTCGAGGATAAATTTCCATATTTAAATTATCTGTCAGATGTACTAATACCTTATCCTATCCATCTGGAAATCCTGGTTCAAACCTTTCGCTACTGGGTGAAAGATGCTCCTTCTTTTCATTTTTTAAGGCTCTTTCTCCAC------GAGTATTGTAATCGGAGT------------AGTCTTATTACTCCA------------AAAAAATCTATTTCTATTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATATTTATGTTTATGAATACGAATCTATCTTCCTTTTTCTCCATAACAAATCTTCTCATTTACGATTAACATCTTCTAGAGTCTTTTTTGAGCGAATATATTTCTATGGAAAAATAGAACAT------CTTGCAGAAGTCTTTGCT------AATAATTTTCCGGCC---ACCCTATGGTTT------TTCAAGGAC---CCTAACATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAGAAT------ACGCCGCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTGAACCTGGAAGGATCCATATAAAC---CAATTA---TATGGGCATTCGTTCGACCTTTGG------GGCTATTTTTCAGGTGTGCAGCC{AC}AATCCTTCAGTGGTAAGGAGTCAAATGCTAGAAAATTCATTTATAATAGAAAATGTTAGTAAAAAGCT{GT}GATACTATAGTTCCAATTATTCCTCTAATTGGATCATTGGCTAAAGCAAAAATTTGTAACGCATCGGGTCATCCCATTAGTAAGTCTATCTGGACCGATTTATCAGATTTTGATATTATTGACCGATTTGTGCGGATATGGAGAAATCTTTCGCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACGGAGGAAGAAGAAATTCTTTCTTTGATCTTACCA------GGAGTT---------TTACAG------AGACTATAT------GGAGGTCGGATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGCCAAT---------------CATTCA---------------------------TGA Gymnocladus_chinensis_AY386928 ATGAAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTAGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCAATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCGAAC------AAAAATCAA------------TTTTTGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGAAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATATTGGTCCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTTTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------CAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTTATTTTTCTCCGTAAGAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CGTGTAGAAGTCCTTGAT------AAGGATTTTCCGTCT---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATAAAGGAAAATCCATTCTGTCTTCAAAGAAT------ACGCCATTTTTTATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGATATTTTTCAAATGTTCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAATTTTTGTAATGTATTAGGTCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGA------TTAGGTTCAGAA---GTTTTGGAAGAATTTTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTACCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Halimodendron_halodendron_JQ6199 ATGAAGGAATATCAAGTA---------TATTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCCAGTTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTA------AGCTCTTCC---------TTAGGGGAGGCAGAAATCGTAAAATCTTATCAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------CATTTTTGTAATTGGAAT------------AGTTTTAGTACTCCA------------AAA---------TCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGGAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTCT---ACCTTAACATTC------TTCAATGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GGGCCTCTTGTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTAATATTTGGTCTCAACCAGGAACGATTCATATAAAC---CAATTA---TCCGAACATTCATTTCACCTTTTA------GGCTATTTTTCAAATGTTCGGTTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAACGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACCTTGGCTTGTAAACACAAAACCACTGTACGCGCTTTTTTGAAAAGA------TCAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Hammatolobium_kremerianum_JQ6199 ATGGAGGAATATCAGTTA---------TATTTGGAACAGGATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTGTTTTTCACGAATATATTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCGATTTTTGTAGAA---AATATAGGT------TATGATAAT------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAC------AAAAATCGA------------TTTTTGAGATATAATAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCAATTTTCTTTACAATTA------AGCTCGTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAAAATCTGCGATCAATTCATTCTATTTTTCCCTTTTTCGAGGATAAAGTTACATATTTAAATTATATATCAGATATACGAGTCCCTTATCCTATCCATTTGGAAATCTTAGTCCAAATCCTTCGATACTCGGTGAAAGATGCCCCTTTGTTTCATTTATTAAGATTGTTTCTTTAT------GATTATTGTAATTGGAAT------------AGTATTCTTTTTCCC------------AAAAAATCGATTTATACTTTTTCA------------------AAGAATAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATATGAATCTATCTTTTTTTTTCTACGTACCAAATCTTCTCATTTACGATTAAAATCTTTTAGAGTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAAGGGACAT------CTTGTAGAAGTATTTGTT------AAGGATTTTTTTTCT---ACCTTAACATTC------TTTAAGGAT---CCTTTCATCCATTATGTTAGATATCAGGGAAAATCCATTCGGGCTTCCAAGAAT------TTGCCTATATTAATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTTATTTTGATGTTGGGTCTCAATCGCGAACAATCCATATAAAC---CAATTA---TCCGAATATTCATTTCACTTTTTG------GGCTATTTTTTAAGGGGGGGGCTGAAGCATCCAGTGGTACGGGGTCAAATGCTGCAAAATGGATTTCTAATCAAAATTATTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCAATAATTAGATTATTGGCTAAATCGAAATTTTGTAATGTATTAGGGAATCCCCTTAGTAAGCCGTCCTGGGCCGACTTATCCGATTTTGAGATTATTGCTCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCCTGTAAACACAAAAGTACGGTACGCACTTTTTCGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCG------AGAACTTCTTCTACTTTACGG------AGGTTACAC------AGAAATCGGATTTGGTATTTGGATATTCTT---TTTAGCAACGATAACGATCTAATCAAT---------------CATGAC---------------------------TGA Hardenbergia_violacea_EU717425 ATGGAGGAATATCGAGTA---------TATTTAGAACTCCATAGATCTCGCCACCAGCAT------ATCCTATACCC------ACTTTTTTTTCGGGAATATATTTATGGACTCGCTTATGGTCGTGGA---------------TCCATTTTTGTAGAA---AATGTAGGT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTTTGCTAATGATTCTAAC------AAAAATCCT------------TTTTGGGGTTATAACAATCCATTTTAT---TCTCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCTCTACAATTA---TTTATCTCTTCC---------TTAAAGGAGTTAGAAATCGTCAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAATTGATCTATTTAAATTATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATGTTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------TATTATTGTAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAATCGATTTCTACTTTTTTT---------------TCAAAAAGTAATCCAAGATTT------------------------TTTTTGTTC------CTATATAATTTATATGTATGGGAATACGAATTTATCTTTCTTTTTCTACGTAACAAATCCTCTCAGTTACGATTAAAAGATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAAAAGAACAT------CTTGTAGAAATATTTGCT------AAGGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ATGCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTGGATATTTGGTCTCAACCAGGAACGATCCATATAAAC---CCGTTA---TCCCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAATATTCAGCTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATAAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTGGGTTATCCCATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGAAATTATTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGACTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTGTTGGAAGAATTCTTT---ACAGAAGAAGAAGATATTTTTTATTTGATTTTCCCA------AGAACTTCTTTTACTTTGCAT------AGGTTATAT------AGAGGTCGTATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTGGTCAAT---------------AATTCA---------------------------TAA Harleyodendron_unifoliolatum_JX1 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTTGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Harpalyce_arborescens_AF142689 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCACCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATCTT------AATGGATCCAATTTTGTGGAA---AATGGGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTATTTTTTCTAATGATTCTAAA------AAAAATCCA------------TTTTTGGGATATAACAAGGATTTGTAT---TCTCAAATAATAGCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGAAAATCATAAAATCCTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCTTAGTTCAAGTCCTTCGATACTGGGTGAAGGATGTCCCCCTTTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGCAACAGTAATAGTAATAAGATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGGAATCCAGGATTT------------------------TTTTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCCATCTTCCTGTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTATCTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCAT------CTTGTAGAAGTCTTTGCT------AAAGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGGTTCAAAGAAT------GTGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATCTCATTTTGATGTTTGGTCTCAACCAGGAATGACCCATATAAAT---CAATTC---TCCAAGCATCCATTTCTCTTTTTG------GGCTATTATTCAAATGTGCGATTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTTTGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATACACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------CGAGCTTCTTCTATTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGGAAC------GATCTAGTCAAT---------------TATGAA---------------------------TAA Harpalyce_brasiliana_GQ246153 ATGGAGGAATATCAAGTA---------TATTTAGAACTAAATAGATCTCACCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGAATCCAATCTTGTGGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTTTTATTTTTTCTAATGATTCTAAA------AAAAATCCA------------TTTTTGGGATATAACAAGGATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGAAAATCATAAAATCCTATAATAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCCTAGTTCAAATCCTTCGATACTGGGTGAAGGATGTCCCCCTTTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGCAACAGTAACAGTAATAGTAATAATCTTATT------ACTCCCCAAAAATGGATTTCTACTTTTTCA------------------AAAAGGAATCCAGGATTC------------------------TTTTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCCATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTATCTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCAT------CTTGCAGAAGTGTTTGCT------AAAAATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGCTTCAAAGAAT------GTGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATCTCATTTTGATGTTTGGTCTCAACCAGGAATGACCCATATAAAT---CAATTC---TCCGAGCATCCATTTCTCTTTTTG------GGCTATTATTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTTTGAAAAATTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------CGAGCTTCTTCTATTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGGAAC------GATCTAGTCAAT---------------TATGAA---------------------------TGA Harpalyce_formosa_GQ246154 ATGAAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCACCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATCTT------AATGGATCCAATTTTGTGGAA---AATGGGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTATTTTTTCTAATGATTCTAAA------AAAAATCCA------------TTTTTGGGATATAACAAGGATTTGTAT---TCTCAAATAATAGCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAAAAATCATAAAATCCTATAATAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAGGATGTCCCCCTTTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGCAAC------AGTAACAGTAATAGTAATAAGATTCTTACTCCAAAAAAATCGATTTCTACTTTTTCA------------------AAAAGGAATCCGGGATTT------------------------TTTTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCCATCTTCCTGTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTATCTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCAT------CTTGTAGAAGTCTTTGCT------AAAGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGGTTCAAAGAAT------GTGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATCTCATTTTGATGTTTGGTCTCAACCAGGAATGACCCATATAAAT---CAATTC---TCCGAGCATCCATTTCTCTTTTTG------GGCTATTATTCAAATGTGCGATTAAATCTTTCAATGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTTTGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------CGAGCTTCTTCTATTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGGAAC------GATCTAGTCAAT---------------TATGAA---------------------------TGA Havardia_alibicans_AF523085 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAATATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAAAAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTTTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCCACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATACATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACTCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAGGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGCAGATATGCAGAGATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGTTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATAT------AGGGGCCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Hebestigma_cubense_AF543850 ATGGAGGAGCATCAAGTA---------TATTTAGAATTGGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTGTTTTTCGGGAGTATATTTATGGACTTGCTTATGGCCATGATTTA------AATAGATCCATTTTTGTGGAA---AATGTAGGT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAA------AAAAATACA------------TTTTTGAGGTATAATAAGAATTTTTAC---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGAAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATAATAATTTGCAATCAATTCATTCCATTTTCCCCTTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGATTGTTTCTTTAT------GATTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCGACTTTTTCA------------------AAAAGTAATCCGAGATTT------------------------TTCTTCTTT------CTATATAATTTTTATGTATGTGAATATGAATCTATCTTCTATTTTATACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATATTTTTCTATGCAAAAAGAAAACAT------CTTGTAGAAGTCGTTGCT------AAGGATTTTTTGTCT---ACTTTAACATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTTAAAGAAT------GCGCCTCTTTTAATGAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATCTTTGGGCTCAACCAGGAACGATCCACATAAAC---CTATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCGACTAAATCGTTCAGTGGTACGTAGTCAAATGCTGCAAAATGCATTTCTAAGCGAAATAGTTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGAATCCCATTAGCAAGCCGGTCTGGGCCGATTCATCAGATTTTGATATTATTGCCCGATTTTTACGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTGTTGGAAGAATTTTTT---ATAGAAGAACAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCGACTTTGCAG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTCAACAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Hedysarum_boreale_AY386892 ATGAAGGAATATCAAGTA---------TATTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCATCATTTT------AAGAGATCCATTTTTGTGGAA---AATGTAAGT------TATGACAATGACAATAAA------TATAGTTTACTAATGGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATGATTTCGACGAATGATTCGAAC------AAAAATCCG------------TTTTTAGGGTATACTAAGAATTTTTAT---TCTCAATTAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCCGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCGATCCATCTGGAAATATTAGTTCAAATCCTTCGATACTGGGTAAAAGATGCGCCGTTTTTTCATTTATTACGGTTGTTTCTGTAT------AATTTTTGTAATTGGAAT------------AGTTTGATTACTCCA------------AAA---------TCTACTTTTTCA------------------AAAAATAATCCAAGATTA------------------------TTCTTGTTC------CTCTATAATTGTTATGTATGTGAATATGAATCTATTTTCCTTTTTCTACGTAAAAAATCCTCTTATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATTTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGAT------AAGGATTTTTCGTCT---ACCTTAACATTG------TTCAAGGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATATTTGGTCTGAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACCTTTTA------GGCTATTTTTCAAATGTTCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTACAAAATACATTCCTAATCGAAATTGTTAGCAAAAAACTGGATATAATAGTTCCAATTATTCCTTTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGTCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGCGAATATCCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTAGAGTACGCGCTTTTTTGAAAAGA------TCAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAAT------GATTTGGTCAAT---------------CATGAA---------------------------TGA Helicotropis_linearis_JN008258 ATGGAGAAATATCAAGCA---------TATTTAGAACTCCGTAGATCTCGATACCAGGAT------ATCCTATACCC------ACTTTTTTTTCGGGAATCTATTTATGGACTAGCTTATGGTCATGAG---------------TCCTTTTTTATAGAA---AATGTAGAT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAAGTACTCGAATGTATCAACAGACTCATTTCATTCTTTTTGCTAACGATTCTAAC------AAAAAGACT------------TTTGCGGGTTATAACTATAATTTTGAT---TCTCAAATAAGATTAGAAGGTTTTGGTGTCGTCGTGGAGATTTTATTTTCTCTACAATTT---TTTATCTCTTCC---------TTAAGGGGATTAGAAAGCGTAAAATCTTATCAAAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATAAGTCAGAGATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTAAAAGATGTCTCTTTCTTTCATTTAATAAGGTTGTTTTTTTAT------TACTATTATAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAATGGCTTTCTACTTTTTTT---------------TCAAAAAGGAATCTAAGAATT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAATAAATCCTCTCAGTTACTGTTAAAAAATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAAAACAT------CTTGTAGAAGTATCTACT------AAGAATTGTTCATAT---ACCTTATTCTTC------TTTAAGGAT---ACTTTTATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTTAAAGAAT------ACTCCTCTTTTGATAAAAAAATGGAAATACTATTTTATATATTTATGGCAATGTCATTTTGATATTTGGGCTGGACCAGGAACGATCTATATAAAC---CAATTA---TCTCAGTATTCATTTCACTTTTTA------GGCTATTTTTTAAGTATTCCACAAAATCTTTCATTAGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCAAAATTGTTATCAAAAAACTTGATACAATAGTTCCCATTATTCCTATAATCAGATCATTGGCTAAAACAAAATTTTGTAATGTAATGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTTTCTGATTTTGATATTCTTGACCGGTTTTTGCGCATATGCAGAAATTTTTCTCCATATTACAATGATCCGCCAAAAAAAAAGAGTTTCTATCAAATAAAATATATACTTCGGTTTTCTGGTATAAAAACTTGGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAAA------TTAAGTTCAGAAAATTTATGGGAAGAATTTTTT---ACA---GAAGAAGATCTTTTTTCTTTGATTTTTCCA------AGAACGTCTTTGACTTTGCGG------AGGTTTTCT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCATAAAC------GATTTCGTCAAT---------------CATTTAGAATTTAAAATAGGTTATGATACTTTTTAA Hippocrepis_unisiliquosa_JQ61998 ATGGAGGAATATCAGTTA---------TATTTGGATCTAGATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTGTTTTTCACGAATATATTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCGATTTCTATAGAA---AATATAGGT------TATGATAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCGACAGAATCATTTGATTTTTTCGGCTAATGATTCTAAC------AAAAATAGA------------TTTTTGAGGTATAATAAGAATTTTTAT---TCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCTATTTTCCTTACAATTA------AGCCCGTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAAAATCTGCGATCAATTCATTCTATTTTTCCCTTTTTAGAGGATAAAGTTACATATTTAAATTCTATATCAGATATACGAGTCCCTTATCCTATCCATCTGGAAATCTTAGTCCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGATTGTTTCTTTAT------GATTATTGTAATTGGAAT------------AGTATTATTATTCCA------------AAAAAATCTATTTATACTTTTTCA------------------AAAAATAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATTTATGTGAATGTGAATCTATCTTTTTTTTTCTACGTACCCAATCTTCTCATTTACGATTCAAATCTTTTAGAGTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAAAAAACAT------CTTGTAAAAGTATTTGTT------AAGGATTTTTTTTCT---ACCTTAACATTC------TTTAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATTCATTCTGGCTTCAAAAAAT------TTGCCTATTTTAATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCGGGAACAATCCATATAAAC---CAATTA---TCCGAAAATTCATTTCACTTTTTG------GGCTATTTTTTAAAGCGGGGGCTAAAGCATTCAGGGGTACGGGGTCAAATGCTGCAAAATGGATTTCTAATTAAAATTATTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCAATAATTAAATTATTGGCTAAAGCGAGATTTTGTAATGTATTGGGGAACCCTCTTAGTAAGCCGTCCTGGGCCGACTTATCGGATTTTGATATTATTGCCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCCTGTAAACACAAAAGTACCGTACGTGCTTTTTTGAAAAGA------TTGGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACGGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTACGA------AGTTTCCAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTTAGCAACGATAACGATCTAATTAAT---------------CATGAC---------------------------TGA Hoffmannseggia_glauca_EU361969 ATGGAGGAATTTCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCTTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCAGTTTGGTGGAA---AATCAAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGATAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCCAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCTCTACAATTA------ATTTCTTAC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATGCAATATTTCCTTTTTTTGAGGAAAAATTTTCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCACAGATTC------------------------TTCCTCTTC------CTATATAATTTTTATGTATATGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCATCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCCATTTTTATGCAAAAATAGAACAT------TTTTTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCTTATGGTTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTGGATGAATAAATGGAAATACTATCTTATCTATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATAGAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATTGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATCCCGAAATCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGTTTTTTTGAAAAAA------TTGGGTTCAGAA---TTATTAGAAGAATTCTTT---ACAGAAGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGATTCTTCTACTTTCCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Hoita_orbicularis_EF549962 ATGGAGGAATATCGAGCA---------TATTTAGAACTCCATAGATCTCGACACCAGGAC------ACCCTATACCC------ACTTTTTTTTCGGGAATATATTTATGGACTAGCTTGTGGTTATGGG---------------TCCATTTTTGTAGAA---AATGTAGGT------TATAACAAA------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACCCATTTCATCATTTTTGCTAACGATTCTAAC------AAAAATCCT------------TTTAGGGGTTATAATAATCATTTTAAT---TCTCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCCCTACAATTA---TTTACCTCTTCC---------TTAAGGGAATTAGAAATCGTAAAATCTTATAATAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATCAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTTTTTTTTTCTTACTATTATAATAATAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAAAGGATTTCTACTTTTTTT---------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTACCAAATCCTCTCAGTTACGGTTAAAAAATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTGTT------AAAGATTGTTCATAT---ACCTTATCATTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCAGGTTTCAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCGACCAGGAACGATCCATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCAGCTCAATCTTTCAGTGGTACGAAGTCAGATGTTGCAAAATTCATTTCTAATCAAAATTATTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTCGATCTTTGGCTAAAGCAAAATTTTGTAATGTATTTGGTCATCCTATTAGTAAGCCGGTTTGGGCCAATTTATCTTATTTTGATATTATTGACCGGTTTTTGCGGATATGCCGAAATTTTTCTCATTATTACAATGGATCCACAAAAAAAAAAAGTTTGTATCAAATAAGATATATACTTCGGCTTTCTTGTATAAAAACCTTGGCTCGTAAGCACAAAAGTACTGCGCGCACTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGATATTTTTTCTTTGATTTTTCCA------AGAACTTCTGTTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTA---------------------------TAA Holocalyx_balansae_AY553714 ATGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGAGTTA------AATAGATCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCGTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------TTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCCTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Holocalyx_balansae_JX152593 ATGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGAGTTA------AATAGATCAATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCGTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------TTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCCTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Hovea_purpurea_AY386889 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCCAATTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAA------AAAAATCCA------------TTTTGGGGGTATAACAAGGATTTGTAT---TCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCTTTAGAT---TTAGAGGAGGCGAAAATCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCCTTCTTTCATTTATTAAGGTTATTTTTTTAT------GAGTATTGGAATTGCAAT------------ACTCTTATTACTCCC------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGGAATCCAGGATTT------------------------TTTTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGGT------AAAGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAAGCAGGAACGACCCATAGAAAT---CAATTC---TCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCTAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTGGATACAATAGCTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTACAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTGGGTTCAAAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCCATTTTACAC------CGGTTATAT------AGAGGTCGAATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTAGTCAAT---------------TATGAA---------------------------TGA Humularia_corbisieri_AF272069 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCTTTCATTTATTAAGATTATTTATTTATATTTTTGAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAACTTATTTCTACTTTTTCA------------------AAAAATAATCCAAGAATT------------------------TTCTTGTTC------CTATTTCATTTTTATCTATGGGAACACGAATCCATCTTCCTTTTTCTACGTAAGAAATCCTCTCATTTACGATTTAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTTTATGCAAAAATTGAACAT------CTTGTAGAACTCTTTGAT------AAGAATTTTTGGTTT---ATCTTATCATTC------TTCAAGGAT---CCGTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTATGGCTTCAAAGAAT------GCGCCTCTGTTGCTGAATAAATGGAAACACTATCTCATCTATTCCTGGCAATGTCATTTTTATGTTTGGTCTCAACCGGGAACGATCCATATAAAC---CAACTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATATTTCAAATGTGCAGCTAAATTTTTTAGTGGTACGGAATCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATAATTGCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATNNNNNNNNNCGTTTGGGCCGATTCATCCGATTCNGATATTATTGACCGATTTGNGCGTATATGCAGAAATCTTTCTCATTATTATAGNGGATCCTCNAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCTTGTGCTAAAACTTTGGCTCGGAAACACAAAAGTACTGTACGCGCCTTTTTGAAAACA------TTAGGTTCNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNNNNN------------NNNNNN---------------------------NNN Hybosema_ehrenbergii_AF547195 ATGGAGGAGCATCAAGTA---------TATTTAGAACTGGGTAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTGTTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGATCCGTTTTTGTGGAA---AATGTAGGT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCAAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAA------AAAAATACA------------TTATTGAGGTATAATAAGAATATTTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATTCTAAAATCTTATAATAATTTGCAATCAATTCATTCTATTTTTCCCTTTTTTGAGGATAAATTTACATATTTAAATTGTGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGATTGTTTCTTTAT------GATTATTGGAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTCTTC------CTATATCATTTTTATGTATGTGAATATGAATCTATCTTCTATTTTCTACGTAACAAATTCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAGAAAACAT------CTTGGAGAAGTCGTTGCT------AAGGATTTTTTGTCT---ACCTTAATATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCTCTTTTAATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATCTCATTTTGATATTTGGGCTCAACCAGGAACGATCCGCATAAAC---CTATTA---TCCGAACATTCATTTTACCTTTTG------GGCTATTTTTTAAATGTGCGGCTAAATCGTTCAGTAGTACGTAGTCAAATGCTGCAAAATACATTTCTAATTGAAATTGTTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGAATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCAGATTTCGAAATTATTGACCGATTTTTACGGATATGTAGAAATCTTTCTCATTATTATAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCATTTTTGAAAAGA------TTAGGTTCAGAAAAATTGTTGGAAGAATTTTTT---ATAGAAGAACAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTTCAG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Hymenaea_courbaril_AY386906 ATGGATGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGCACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGATTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATCAATTTCCATATTTAAATTATGTGGCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCTTCTTCTTTTTATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCGTATTACTTCA------------AAGAAATCTATTTATACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTCTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGCCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAAATGTTAGGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTTGATATTATTGACTTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTGTGAAAAAA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTTTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Hymenaea_verrucosa_EU361974 ATGGATGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTCCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGCACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGATTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGGCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCTTCTTCTTTTTATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCGTATTACTTCA------------AAAAAATCTATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTCTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGCCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAAATGTTAGGAAAAAGCTTGATACAAAAATTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTTGATATTATTGACTTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTGTGAAAAAA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGATATTCTTTCTTTGATCTTTTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Hymenolobium_alagoanum_JX295906 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAANTAATTCAACATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Hymenolobium_grazielanum_JX29590 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAANTAATTCAACATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Hymenolobium_heringerianum_JX295 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAANTAATTCAACATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Hymenolobium_heterocarpum_JX2959 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAANGAATTCAACATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Hymenolobium_heterocarpum2_JX295 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAANGAATTCAACATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Hymenolobium_janeirense_JX295904 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAANTAATTCAACATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Hymenolobium_mesoamericanum_AY38 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAAATAATTCAACATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Hymenolobium_petraeum_JX295909 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CCAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAANTAATTCAACATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Hymenolobium_sericeum_JX275933 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGGCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAA------------AAAANGAATTCAACATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------TATTCA---------------------------TGA Hypocalyptus_coluteoides_AY38688 ATGGAGGAATATCCAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGACTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTTCCGTCGTCGTGGAAATTCCATTTTCCCTAAAATTA------AGCTCTTCC---------TTAGGGGAGGCAGAAATTGCAAAATCTTATCAAAATTTGCGATCAATTCATTCAATTTTCCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCTTTCGTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTCTAATTGTAAT------TGGAATAGTCTTATTACTCCA------------AAAAAATATATTTATACTTATTCA------------------AAAAGTAATACAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATTTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTCAAATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTGCGTCT---ACCCTATCATTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCCACCCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAGGAGCGGTCCGTATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTTAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGCCAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAATCGAATTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTGTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTTTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCCCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGA------TTGGGTTCAGAAGAATTATTGGAAGAATTATTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATAT------GGAGGGCAGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Indigofera_suffruticosa_AF142697 ATGGAGGAATATCAAGTA---------TATTTACAACTAAATAGATCTCGTCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCTATTTTTGTAGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATTATTTCTACGAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAATAATCATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGAGATCAATTCATTCCATTTTTCCTTTTTTCGAAGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTATTTAT------TACTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGGAATACAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATATGAATACGAATCTATCTTCCTTTTTCTACATAACAAATCCTCTAATTTACGATTCAAATCTTTTAGCGTTCTTTTTGAGCGAATCTTTTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTCTTTGCT------AAGGATTTTTCGTCG---ACCTTATCATTCTTCAAGTTCAAGGAT---CCCTTCATTCATTATGTTCGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GCACCTCTTTTGATGAATAAATGGAAATACTATTTTTTCCATTTATGGCAATGTCATTTTTTTGTTTGGTTTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTTACTATTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTACAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACATAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCGTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAT------GATATGGTTAAT---------------CATGAA---------------------------TGA Inga_edulis_AF523078 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCCCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCGTTTTAGTGCAA---AATCTCGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAAACATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAGATTTCCATATTTAAATTATGTGTCAAATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTCTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCGTTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTTAGTGGTACGGAGTCAAATGTTCGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAGATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGCTTTTTGCAGATATGCAGAGATCTCTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGATTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGA------TTTGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------------------CATCAA---------------------------TGA Inocarpus_fagifer_AF270878 ATGAAACAATATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAGC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAATATCAATCGATCCATTTTGGTGGAA---AATGTGGAT------TATGATAAG------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTGTCAACAGAATCATTTGATCCTTTTTGCTAATGATTCGAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTCAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTGCATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCNNNNNNNNNNNNNNNNNNNNNNCCCCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------CAGTATTGTAATTGGAAT---------------ATTATTACTCAA------------AAAAAACGAATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAACACGAATCTATCTTCCTTTTTCTACGTAAGAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCGATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGAT---CCTTTGATTCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAACCCCGTTCGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATGCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCCGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGATTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTA------------AATAGA---------------------------TAA Intsia_bijuga_EU361981 ATGGAGGAATTTCA{AC}GTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGCCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGAAAAAGATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAAAATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ATCTTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTCTTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGACGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGA---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Isotropis_foliosa_AY386890 ATGGAGGAATATCAAGTA---------TCTTTAGAACTAGATAGATCCCATCAACAGGAC------TTCCTATATCC------ACTTATTTTTCGGGAGTATATTTATGGGCTCGCTTATGGTCATCATTTC------ACTAGATACATTTTTGTGGAA---AATATAGGT------TATGATAAT------AAA------TCTAGTTTACGAATTGTAAAACGTTTAATTACTCGAATGTATCAAAGGAATCCTTTGATTATTTTGGTTAATGATTTAAAA------AAAAATACA------------TTTGTGGGGTATAACAAGAATTTATAT---TCTCAAATAATATCTGGGGGGGTTTCTGTCATTGTGGAAATTCCATTTTCCATACAATTA------AGCTCTTCC---------TTCGAAGAGGCAAAAATCGTAAACTCTTATAATAATTTTAGATCAATTCATTCCACTTTTGCCTTTTTTGAGGATAAATTTACATATTTAAACTATGTATCAGAGATACGACTACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATACCTCTCTATTTCATTTATTAAGATTTTTTCTTTAT------GAGTATTGTAATTGGAAT---------GGTAGTCTTAGTACTCAA------------AAAAAATCGATTTCTATTTTTTCA------------------AAAAGTAATACAAGATTT------------------------TTTTTGTTC------CTTTATAATTTGTATGTATGGGAATACGAATATATCTTCCTTTTTCTACGTAAAAAATCATCTCAATTACGATTAAAAGCTTTTCGTGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAACAT------CTTGTAGAGATAATTACT------AAGTATTTTTCGTCT---ATCCTCTCATTC------TTCAAAGAT---CCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTGCAAAGAAT------TCATCCCTTTTGATGAATAAATGGAGATACTACTTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCGGGAACGATCCATCTAAAC---CAATTA---GATAAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGGGCTTAAATCTTTCCGCAGTACGGAATCCAATGCTGCAAAATTCATTTCTAATCAAAAATTGTATCAAAAAGCTTGATACAATAGTTCCAATTCTTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATATATTAGGACATCCTATTAGCAAGCCAGTCTGGGCAGATTCATCTGATTTTTATATTCTTGACCGATTTTTGAGGGTATATCGAAATCTTTCTCATTATTACAACGGATCTTCAAAAAAAAAGAGTTTGTATCAAATAAAGTATATACTTCGACTTTCTTGTGTTAAAACTTTGGCTCGTAAACACAAAAGTACTGAACGAGCTTTTTTGAAAAAA------TTAGGTTCGGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCGTTGAGATTTCCA------AGAGGTTCTTCTACTTTGCGG------GGGTTATAT------AGAGGTGGGATTTGGTATTTGGATATTCTT---TTCACCAAC------GATCTGGTTAAT---------------CATCAA---------------------------TGA Kennedia_nigricans_EU717424 ATGGAGGAATATCGAGTA---------TATTTAGAACTCCATAGATCTCGCCACCAGCAT------ATCCTATACCC------ACTTTTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCGTGGA---------------TCCATTTTTGTAGAA---AATGTAGGT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTTTGCTAATGATTTTAAC------AAAAATCCT------------TTTTGGGGTTATAACAATCCATTTTAT---TCTCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCTCTACAATTA---TTTATCTCTTCC---------TTAAAGGAGTTAGAAATCGTCAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAATTTATCTATTTAAATTATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATGTTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------TATTATTGTAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAATCGATTTCTACTTTTTTT---------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCAGTTACGATTAAAAGATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAAGAGAACAT------CTTGTAGAAATATTTGCT------AAGGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ATGCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCAACCAGGAACGATCCATATAAAC---CCGTTA---TCCCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCGGCTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATAAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGGATTGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGAAATTATTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGACTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGATATTTTTTCTTTGATTTTCCCA------AGAACTTCTTTTACTTTGCAT------AGGTTATATTTATATAGAGATCGTATTTGGTATTTGGATATTCAA---ATCAGAAAT------GATTTGGTCAAT---------------AATTCA---------------------------TAA Koompassia_excelsa_EU361988 ATGGAGGAATCTCAAATA---------TATTTCGAATTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATACACTTGCTTATGATCATGGTTTA------AATAGTTCCATTTTGGTGGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTGTGGAAATTCCATTTTCCTTACAATTA------------TCC---------TTAGAGGAGGCAAAAATCATAAAATCTTAT---AAATTACGATCAATTCATTCAATATTTCCTTTCTTCGAGGATCAATTTTCATATTTAAATTATGTGTCAGATGTCCGAATACCCTATCCTATCCATCTGGAAATATTGGGTCAAAGCCTTCGCTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAC------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAATGAA------------AAAAGTAATCCAAGATTT------------------------TTCTTGGTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCGTCTCATTTACGATTAACATCTTCTGGAGTTATTTTTGAGCGAGTCTATTTCTATGGAAAAAGAGAGCAT------CTTGTAGAAGTCTTTGCT------AATGATTTTCCATCT---ACTCTATGGTTC------CTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATCTTGGCTTCAAAGAAT------ACGCCTCTTTTGATCAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTTGTGTTTGGTCTCAACCAGGAAGGATCCATATAAAC---CAATTA---TCCGAGCATTCGTTTTACTTTTTG------GGCTATTTTTCAAAAGTCCGGCTATATCCTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATAGCAAATTTTATGAAAAAGCTTTATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCACCCCATTAGTAAGCCAGTCTGGGCCGATTCATCAGATTTTTATATTATTGGCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCAA------AGAACTTCTTCTACTTGCCAG------AGGTTATAT------AGAAGTCGGGTTTGGTATTTGGATATTATT---TTCATCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Kotschya_ochreata_AF272065 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNTATTTATGGACTCGCCTATGGTCATGATTTCAATAGAAATCGATCCGTTTTGGTGGAA---AATGTGGAT------TATGATAAG------AAA------TTTAGTCTACTAATTGTCAAACGTTTAATTACTCGAATGTATCCACAGAATCATTTGATTATTTTTTCTAACGATTCTAAC------AAAAACCCT------------TTTTGGGGGTATAACAAGAATTTCGAT---TCTCAAATAATATCTGAGGGTTTTGCCGTCGTCGTGGAAATTCTGGTTTCCCCCCAATTC------CGTTCCTTT---------TTAGAGGAGTCAGAAATTATTCAATCTTTGAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAGGATAAATTGACATATTTCAATTTTGTTTCAGATGTACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAAGTNNNNNNNNNNNNNNNNNNNNNNNNCTCCGCTCTTTCTTATTAAGATTATTTATTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACCAAA------------AAAAAACTTATTTCGACTTTTTCA------------------AAAAAAAATCTAAAAATT------------------------TTCATGTTC------CTATTTCATTTTTATGTCTGGGAACACGAATCCATCTGCCTTTTTCTATGTAAGAAATCCTCTCATTTACGATTTTACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATTCAAAAATTGAACAT------CTTGTGGAACTCTTTCAT------AAGAATTTTTGGTTT---ACCTTATCCTTC------TTCAAGGAT---CCGTTGATCCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTGTTGCTCCATAAATGGAAACACTATCTCATCTATTTCTGGCAATGTAATTTTGATGTTTGGTCGCAACCGGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTACATTTCAAATGTGCGGCTAAATTTTTTAGTGGTACGGAATCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTGCTTTAAGTAGATCTTTGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCCATTAGTAAGCCTGTTTGGGCCGATTTATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATTTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGATTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCCCTGATTTTTCCA------AGAGTTTCTTCCACTTTGCAG------AGGTTATAC------AGAGATCGGATTTGGTATTTAGATATTATT---TTCAGCAAG------GATCTGGTCAATGTA------------AATGGA---------------------------TAA Kummerowia_stipulacea_EU717417 ATGGAGGAATATCGCGTA---------TTTTTAGAACTCCAGAGATCTCGCCACCGGGAC------ATCCTATACCC------GCTTTTTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCGTGGA---------------TCCATTTTTGTGGAA---AATGTAGGT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTATTGTTAATGATTCTAAA------AAAAATCCT------------TTTTTGGGTTATAACAATAATAATTATTATTCTCAAATAATATTCGAAGGTTTTGTTGTCGTTCTAGAGATTCTATTTTCTCTACAATTA---TATATATCTTCC---------TTAAAAGAGTTAGAAATCGTAAAATCTTATAATAATTTGGGATCAATTCATTCCATTTTTCCTTTTTTCGAAGATAAATTTATATATTTCAATCATAAGTCAGATATAAGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCTTTCGATATTGGATAAAAGATGTCTTTTTCTTTCACTTATTAAGGTTGTTTTTTTAT------TACTATTGTGACGGGAAC------------AGTTTTTTTACTCCA------------AAAAAATCGATTTCTACTTTTTTTAAT------------TTTAAAAGTAATCCAAGATTT------------------------TTTTTACTA------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAATAAATCCTCTCAGTTACGATTTAAATATTTTCTCGTTTTTTTTGAGCGAGTTTTTTTCTATGAAAAAATAAAACAT------CTTGCAGAAATATTTGTT------AAGAATTTTTCATAT---ACCTTATTATCG------TTCAGGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCAACCAAGAACGATCGATATAAAC---CAATTA---TCTCAGCATTCATTTCACTTTTTG------GGTTATTTTTTAAGTATTCGACTAAATCTTTCGGTGGTACGAAGTCAAATGTTACAAAATTCATCTCTAATAAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTTTAATTAGATTATTGGCTAAAGCAAAATTTTGTAATGTAGGGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATTTTTCTCATTATTACAGTGGATCTTCAAAAAAAAAGACTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAACTACTGTGCGCACTTTTTTGAAAAGA------TTACCTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAGGGTATTTTTTCTTTGATTTTTCCA------AGAACTTCTTTTACTTTGCAG------AAGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTGTT---TTCAGAAAT------GATTTGGTCAAT---------------CATTCA---------------------------TAA Kunstleria_ridleyi_JX506598 ATGGATGGATATCGAGTA---------TATTTAGAACTACATAGATCTCGCCACCAGGACATC---ATCCTATACCC------ACTTATTTTTCGGGAATATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATGTAGGT------TATAAAAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCG------------TTTTGGGGGTATAACAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGTTGTCGTCGTGGAAATTCGATTTTCCCTACAATTA---TTTATCTCTTCC---------TTAGAGGAGTTAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAATTGATATATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATTCTTCGATACTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------TACTATTGTAATTGGAAT------------AGTCTTTTTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCTAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCACTTACAAATAAAATCTTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTGGT------AAGGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTATGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCAACCTGGAACGATCCATATAAAG---CAATTA---TCCAAGCATTCATTTTACTTTTTG------GGTTATTTTTTAAATGTACAACTAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAACTGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGACTAAAGCAAAATTTTGTAATGTATTGGGTCATCCTGTTAGTAAGTCGACTTGGGCCGATTTATCCGATTTTGATATTATTGACCGATTTTTGAGACTATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTAAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGACTTCTTT---ACAGAAGAAGA---GATTTTTTCTTTTATTTTTCCA------AGAACTTCTTTTACTTTACAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAA------GATTTGGTCAAT---------------CATTCA---------------------------TAA Labichea_punctata_EU361989 ATGGGGGAATCTCAAATA---------TATTTCGAACTAGATAGATCTCGCCAACATGAT------TTCCTATACCC------ACTTTTTTTTCGGGAGTATATTTATACACTTGCTTATGATCATGGTTTA------AATAGTTCCATTTTGGTGGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATAAA------------TTGTTGGGGTACAACACGAATTTGTAT---TCTCAAATAATATCGGAGGGGTTTGCCATCATTGTGGAAATTCCATTTTCCTTACAATTA------------TCC---------TTAGAAGAGGAAAAAATCGTAAAATCTTAT---AAATTACGATCAATTCATTCAATATTTCCTTTCTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTCCGAATACCCTATTCTATCCATCTGGAAATATTGGTTCAAAGCCTTCGCTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAC------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAATTCA------------AAAAGGAATCCAAGATTT------------------------TTCTTGGTC------CTATATTATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCGTCTCATTTACGATTAACATCTTCTGGAGTTCTTTTTGAGCGAGTATATTTCTCTGGAAAAAGAGAGCAT------CTTGTAGAAGTCTTTGCT------AATGATTTTCCGTCT---ACCTTATGGGTC------CTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATCCTGGCTTCAAAGAAT------ACGCCCCTTTTGATCAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTGTGTTTGGTCTCAACCAGGAAGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GCCTATTTTTCAAAAGTCCGGCTATATCCTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATAGAAAATTTTTTGAAAAAGCTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCACCCCATTAGTAAGCCAGTCTGGGCTGATTCATCAGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGTTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGACCTTCTTCTACTTGGCAG------AGGTTATAT------AGAAGTCGGATTTGGTATTTAGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Lablab_purpureus_AY582989 ATGGAGCAATATCAAGCA---------TATTTAGAACTCCGTAGATCTCGATACCAGGAC------ATCCTATACCC------ACTTTTTTTTCGGGAATCTATTTATGGACTAGCTTATGGTCATGAG---------------TCCTTTTTTACAGAA---AATGTAGAT------TATAACAAT------AAA------TTTAGTTTACTAATTGNACAACGNTNNAGTACTCGAATGTATCAACAGACTCATTTCAGTCTTTGTGCTAACGATTCTAAC------AAAAATACT------------TTTGTGGGTTATAACTATAATTTTGAT---TCTCAAATAATATTAGAAGGTTTTGGTGTCGTCGTGGAGATTCTATTTTCTCTACAATTA---TTTATCTCTTCC---------TTAAGGGGATTAGAAATCGTAAAATCTTATCAAAATTTACAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATAAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTCTTTCATTTAATAAGGGTGTTTTTTTAT------TACTATTATAATTGGAAT------------AGTCTTTTTCCTCCA------------AAAAAAAGGATTTCTACTTTTTTT---------------TCAAAAAGGAATCTAAGAATT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATTTTTCTTTTTCTACGTAACAAATGCTCTCAGTTACAGTTAAAACATTTTCTCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAAGAAAACAT------CTTGTAGAAGTATCTACT------AAGACTTGTTCATAT---ACCTTATTCTTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATAAAGGAAAATCTATTCTGGTTTTAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGGCTGGACCAGGAACGATCTATATAAAC---CAATTA---TCTCAGNATTCATTTCACTTTTTA------GGCTATTTTTTAAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTAATTTCTCTGATTTTGATATTCTTGACCGGTTTTTGCGCATATGCAGAAATTTTTCTCATTATTACAACGGATCCGCAAAAAAAAAGAGTTTCTATCAAATAAAATATATACTTCGGTTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAAA------TTAAGTTCAGAAAAATTGTTGGAAGAATTTTTT---ACA---GAAGAAGATCTTTTTTCTTTGATTTTTCCA------AGAACTTCTTTTACTTTGCGG------GGGGTTTAT------AGAGGTCGGATTTGGTATTTGGATATTTTT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTC---------------------------TAA Laburnum_anagyroides_HE967423 NNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNN------NNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------------NNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AATTTGATTACTCCA------------AAAAAATTGATTTCTACTTTTTTC------------------AAAAGTAATCTAAGAGTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAAGAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAG---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATTAATAAATGGAAAAACTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNNNNNNNNNNNNNNNNN------NNNNNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNN------NNNNNNNNNNNN---------------NNNNNN---------------------------NNN Lackeya_multiflora_AL ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCCATTTTTGTAGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTGTTGAGTATAACAATAATTTTTAT---TCTCAATTAATATTAGGGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCTTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTTATTTATTTAGGTTGTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCCATTTCTACTTTTTCAAAT------------TCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTAATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAATCGGTCTGGTCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGGGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTGGCTCATAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTGGGTTTAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATAT------AAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---------------CATTCA---------------------------TAA Ladeania_juncea_EF549986 ATGGAGGAATATCGAGCA---------TATTTAGAACTCCATAGATCTCGACACCAGGAC------ACCCTATACCC------ACTTTTTTTTCGGGAATATATTTATGGACTAGCTTGTGGTTATGGG---------------TCCATTTTTGTAGAA---AATGTAGGT------TATAACAAA------AAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACCCATTTCATCATTTTTGCTAACGATTCTAAC------AAAAATCCT------------TTTAGGGGTTATAATAATCATTTTAAT---TCTCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCCCTACAATTA---TTTACCTTTTCC---------TTAAGGGAATTAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTTTTTTTTTCTTACTATTATAATAATAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAAAGGATTTCTACTTTTTTT---------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTACCAAATCCTCTCAGTTACGGTTAAAATATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTGTT------AAGGATTGTTCATAT---ACCTTATCATTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAACTACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCGCCCAGGAACGATCCATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCAGCTCAATCTTTCAGTGGTACGAAGTCAGATGTTGCAAAATTCCTTTCTAATCAAAATTAGTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTCGATCTTTTGCTAAAGCAAAATTTTGTAATGTATTTGGTCATCCTATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGATATTATTGACCAGTTTTTGCGGATATGCCGAAATTTTTCTCATTATTACAATGGATCCACAAAAAAAAAAAGTTTGTATCAAATAAGATATATACTTCGGCTTTCTTGTATAAAAACCTTGGCTCGTAAGCACAAAAGTACTGCGCGCACTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGATATTTTTTCTTTGATTTTTCCA------AGAACTTCTGTTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAA------GATTTCGTCAAT---------------CATTTA---------------------------TAA Lamprolobium_fruiticosum_GQ24615 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGAGAGTATATTTATGGACTTGCTTATGGTCATGATTTT------AATAGATCCAATTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTCAA------AAAAATCTA------------TTTTGGGGGTATAACAGGGATTTGTAT---TCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTAGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCGAAAATAATAAAATACTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCCTTCTTTCATTTATTAAGGTTATTTTTTTAT------GAGTATTGGAATTGCAAT------------ACTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------------------AAAAGGAATCCAGGATTT------------------------TTTTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGGT------AAAGATTTTTCGTAT---CCTTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGTTTCAAAGAAT------GTGCCCCTTTTGATGAAGAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGACCCATATAAAT---CAATTC---TCCAAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATTTTTTAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTGGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTGGGTTCAGAAGAATTCTTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTATTTTACAC------AGGTTATAT------AGAGGTCAGATTTGGTATTTGGATATTCTT---TTCAGCAGT------GATCTAGTTAAT---------------TATGAA---------------------------TGA Lathyrus_sativus_AF522086 ATGAAGGAATATAAAGTA---------TATTTAGAACGAGCTAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTCTTTTTAGGGAGTATATTTATGGACTTGCTTATAGTCATAATTTG------AATAGATCTATTTTTTTGGAA---AATGTAGGT------TATGACAAT------AAA------TATAGTTTACTAATTGTAAAACGGTTAATTACTCGAATGTATCAACAGAATCATTTAATCATTTCGGCTAATGATTCTAAC------AAAAATCGA------------TTTTGGGGATATAATAAGAATTTGGAT---TCTCAAATAATATCAGAGGGGTTTGCCATCGTCGTGGAAATTCCATTTTTGCGACAATTA------AGCTCCTCC---------TTAGAGGAGGCAGAAATCCTCCAATCTTATAAAAATTTGAGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTTTTTCATTTATTAAGGCTGTTTCTTTAT------AATTTTTGTAATTGGAAT------------AGTTTTATTACTACC------------AGAAAATGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTA------------------------TTCTTGTTC------CTCCATAATTTTTATGTATGTGAATATGAATCTATCTTCGTTTTTCTACGTACTAAATCCTCTCATTTACGATTCAAATCTTTTAGCGTTTTTTTTGAGCGAATTTTTTTTTATGCAAAAAGAGAGCAT------CTTGAAAAAGTTTTTTAT------AAAGATTTTTCGTAT---CCTTTAACATTC------TTCAAAGAT---CTTAACATTCATTATGTTCGATATCAAGGAAAATGCATTCTGGCTTCAAAGAAT------GCGCCTTTTTGGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATGTTTGGTCTCAACCAAGAATGATCAATATAAAC---CCATTA---TCCGAACATTCATTTCAGCTTTTA------GGCTATTTTTTAAATGTGCGACTAAATCGTTCCGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTATCCAAAATTTGGATATAATAGTTCCAATTATTCCGCTAATTAGATCATTGGCTAATGCGAAATTTTGTAATATATTAGGGGAACCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TCAGGTTCAGAAGAATTATTGCAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGATTCCTCTACTTTGCAG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGTAAC------GATCTGGTCCAT---------------GATGAA---------------------------TGA Lebeckia_sericea_GQ246144 ATGGAGGAATATCAAGTA---------TATTTAGAACTGGGTATATCTCGCCAACTGGAC------TTCCTATACCC------CCTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCCTTTTTGCAGAA---AATGGAGAT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTATAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTACTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAAAATTTGTAC---TCTCAAATAATATCGGAAGGTTTTGCCATCGTTGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAGTCGTAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTGACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCACTTATTAAGGTTGTTTCTTTCT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTTTTGTTT------TTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTAAGTAATAAATCCTCTTATTTACAATTAACATCTTTTAGCGTTCTTTTTGAGAGAATCTATTTCTATGGAAAAATAGAACAT------TTTTTAAAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATTATTC------TTCAAGGAT---CCTTTCATTCATTATTTTAGATATCAAGGAAAATCCTTTTTGGCTTCAAGGAAT------GCGCCACTTTCGATGAATAAATGGAAAAACTATCTTATACGTTTATGGCAAGGTTATTTTAATGTTTGGTCTCAACCAGGAATGATCCAAATAAGC---CAATTC---TCCGAACATTCATTTCATCTTTTG------GGTTATTTTTCAAATGTGCGGTTAAATCTTGCAGCGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAAATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATCAGTAAGCCGGCCTGGGCCCATTCATCCGATTTTGATATTATTGACCGATTTTTGCGTATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTTCTTTTTTGACAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTTTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAACTTCTTCTACTTTGCGG------GGGTTATAT------AGAGGTCGGATTTGGTATTTAGATATTTTT---TTCGGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Lecointea_hatschbachii_JX152594 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGATCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATTATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Lecointea_peruviana_EU361990 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAA---AATGTAAGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAGATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTGGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAA{AT}TTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCCTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Lecointea_peruviana_JX295927 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAA---AATGTAAGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAGATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTGGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTCTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Lennea_modesta_AF543851 ATGGAGGAGCATCAAGTA---------TATTTAGAATTGGATAGATCTCGCCACCAGTAC------TTCCTATACCC------ACTTGTTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGATCCATTTTTCTGGAA---AATGTAGGT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAA------AAAAATACA------------TTTTTGAGGTATAATAAGAATATTTAT---TCTCAAATAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATAATAATTTGCAATCAATTCATTCTATTTTTCCCTTTTTTGAAGATAAATTTACATATTTAAATTATGTGTCAGATATAGGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGATTGTTTCTTTAT------GATTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCGACTTTTTCA------------------AAAAATAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATGTATGTGAATATGAATCTATCTTCTATTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGTGTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAGAAAACAT------CTTGTAGAAGTCGTTGCT------AAGGATTTTTTGTCT---ACCTTAACATTC------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTAGCTTCAAAGAAT------GCGCCTCTTTTAATGAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATCTTTGGGCTCAACCAGGGACGATCTACATAAAC---CTATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCGGCTAAATCGTTCAGTGGTACGTAGTCAAATGCTGCAAAATGCATTTCTAATCGAAATTGTTATAAAAAAGCTTGATATAATAGTTCCAATTATTCCTCTAATTCGATCATTGACTAAAGCGAAATTTTGTAATGTATTAGGGAATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCAGATTTTGATATTATTGAACGATTTTTACGGATATGCAGAAATCTTTCTTATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTGTTGGAAGAATTTTTT---ATAGAAGAACGAGAGATTCTTTCTTTAATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTACAT------AGAAATCGAATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Lens_culinaris_AF522089 ATGAAGGAATCTCAAGTC---------TATTTAGAACGAGCTAGATCTCGCCAACAGCAC------TTCCTATACTC------ACTTATTTTTAGGGAGTATATTTATGGACTTGCTTATAGTCATAATTTG------AATAGATCCCTTTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TATAGTTTACTAATTGTAAAACGGTTAATTACTCGAATGTATCAACAGAATCATTTAATCATTTCGGCTAATGATTCTAAC------AAAAATTCA------------TTTTGGGGGTATAATAATAATTATTAT---TCTCAAATAATATCAGAGGGTTTTTCCATCGTCGTGGAAATTCCATTTTTCCTACAATTG------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATCAAATATTATAAAAATTTCAGATCAATTCATTCGATTTTTCCCTTTTTGGAGGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCTTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGGCTGTTTCTTTGT---------------AATTGGAAT------------AGTTTTATTACTACTAAAAAG------AAAAAATCGATTTCTACTTTTTCA------------------AAAATTAATCCAAGATTC------------------------TTCTTGTTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCGTTTTTCTACGTAATCAATCCTCTCATTTACCATTAAAATCTTTTCGCGTTTTTTTTGAGCGAATTTTTTTTTATGCAAAAAGAGAGCAT------CTTGTAAAACTTTTTGCT------AAAGATTTTTTGTAT---ACTTTAACATTAACATTCTTCAAGGAT---CCTAACATTCATTATGTTCGATATCAAGGAAAATGCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGGATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATGTTTGGTCTCAACCAAGAACGATCAATATAAAC---CCATTA---TCCGAACATTCATTTAAGCTTTTA------GGCTATTTTTCAAATGTGCGACTAAATCGTTCAGTGGTACGGAGTCAAATGTTGCAAAATACATTTTTAATCGAAATTGTTATCAAAAAAATTGATATAATAGTTCCAATTCTTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCAGCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATCCAGAAATCTTTCTCATTATTATAAAGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TCAGGTTCAGAAGAATTCTTGCAAGAATTCTTT---ACAGAGGAAGAAGAAATTCTTTCTTTGATTTTTCCA------AGAGATTCCTCTACTTTGGAG------AGGTTATCT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGTAAC------GATCTGGTCCAT---------------GATGAA---------------------------TAA Leonardoxa_africana_EU361992 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTC------ATCTCGTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTTAATTATATGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTGGATTCAAACCCTTCGTTACTGGGTGAAAGATCCCTCTTCTTTTCATTTATTAAAGCTATTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTCTATTTTTTCA------------------AAGAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATATGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTATATGGAAAAATGCAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCAGATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTGG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTCGGATATTCTTGACCTATTTCTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTTGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGA---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Leptoderris_brachyptera_JX506611 ATGGGGAAATATCAAGTA---------TA{CT}TTAGAACTAGATAGATCTCGCCACCAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTT------AATATATCCATTTTTGTAGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTGCTAGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGACTCTAAG------AAAAATCCA------------TTTTGGGGATATAACAATAATTTTTAT---TCTCAAATAATATTAGATGGTTTTGTTGTCATCGTGGAAATTCCATTTTCCCTACAATTT------AGTTCTTCT---------TTAGAGGGGGCAGAAATCATAAAATATTTTAATAATTTGCGATCAATTCATTCCATTTTTCCCCTTTTCGAAGATAAATTTATCTATTTAAATTATAAGTCAGATATACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGATTGCTTTATTAT------TATTATTGTAATTGGAAT------------AGTCTTATTACCCTA------------AAGCAATCAATTTCTACTTTTTCAAAT------------TCAAAAAGTAATCAAAGATTT------------------------TTCTTCTTC------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTTTACGTAGCAAATCCTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGCAAAAATAGAACAT------CTTGTACAAGTCCTTGCT------AATAATTTTTTGTAT---ATCTTATCATTC------TTCAAGGAT---CCTTTTATCCATTATGTTAGATATCAAGAAAAATCACTTCTGATTTCAAGGAAT------AAGCCTCTTTTGATGAATAAATGGAACTACTATTTTATTCATTTATGGCAGTGTCATTTTGATGTTTGGTCTGAACCAGGAACGATCTATATAAAT---CAATTA---TCCATAAATTCATTTCGCTTTTTG------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTCCTAATCAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAGGGAAAATTTTG{GT}AATGTATTGGGGCATCCCATTAGTAAGTCGGTCTGGGCTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATTTTTCTCATTATTACAACGGGTCCTCAAAAAGAAAGAGTTTGTATCGAATAAAATATATACTTCGCCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTCTGAAAAGA------TTAGGCTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGATTTTTTCTTTGATCTTTCAA------AGAACTTCTTCTACTTCTCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATTTGGTCAAT---------------CATTTA---------------------------TAA Leptolobium_bijugum_JX124404 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCCCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAATAAA------------TTCTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTCCA------------------AGAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAAAGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Leptolobium_brachystachyum_JX124 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAANAAAAAAAAAATAAA------------TTCTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTTTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAAAGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCT------AAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Leptolobium_dasycarpum_JX124408 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGAC------TTCCTATACCC------ACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAATAAA------------TTCTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCA---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATTCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Leptolobium_elegans_JX124410 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGAC------TTCCTATACCC------ACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAA---AATGTGGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAATAAA------------TTCTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTGGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATTCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Leptolobium_nitens_JX124409 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGAC------TTCCTATACCC------ACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATTGTCATGATTTT------AATAGATCAATCTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAATAAA------------TTCTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATTCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Leptolobium_panamense_AF142684 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGAC------TTCCTATACCC------ACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAA---AATGTAGGT------TATGNCAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAATAAA------------TTCTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Leptolobium_parvifolium_JX124411 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGAC------TTCCTATACCC------ACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCGAATGATTCTAAA---AAAAAAAATAAA------------TTCTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Leptolobium_tenuifolium_JX124413 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCCCCAACAGGAC------TTCCTATACCC------ACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAA---AATGTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAATAAA------------TTCTTGGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGNNNNNNNNNNNNNNNNNCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------------------AGAAGGAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATTCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Leptospron_adenanthum_AY582983 ATGGAGAAATATCAAGCA---------TATTTAGAACTCCGTAGATCTCGATACCAGGAT------ATCCTATACCC------ACTTTTTTTTCGGGAATCTATTTATGGACTAGCTTATGGTCATGAG---------------TCCTTTTTTATAGAA---AATGTAGAT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGTTTAAGTACTCGAATGTATCAACAGACTCATTTCATTCTTTTTGCTAACGATTCTAAC------AAAAAGACT------------TTTGTGGGTTATAACTATCATTTTGAT---TCTCAAATAATATTAGAAGGTTTTGGTGTCGTCGTGGAGATTTTATTTTCTCTACAATTT---TTTATCTCTTCC---------TTAAGGGGATTAGAAAACGTAAAATCTTATCAAAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATAAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTAATAAGGTTGTTTTTTTAT------TACTATTATAATTGGAAT------------AGTCTTTTTCCTCCA------------AAAAAATGGATTTCTACTTTTTTT---------------TCAAAAAGGAATCTAAGAATT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTCCGTAACAAATCCTCTCAGTTACAGTTAAAACATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAAAACAT------CTTGTAGAAGTATCTACT------AAGAATTGTTCATAT---ACTTTATTCTTC------TTTAAGGAT---ACTTTCATCCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTTAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATATATTTATGGCAATGTCATTTTGATATTTGGGCTGGACCAGGAACGATCTATATAAAC---CAATTA---TCTCAGCATTCATTTCACTTTTTA------GGCTATTTTTTAAGTATCCCACAAAATCTTTCAGTAGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCAAAATTGTTATCAAAAAACTTGATACAATAGTTCCCATTATTCCTATAATCAGATCATTGGCTAAAACAAAATTTTGTAATGTAATGGGTCATCCCATTAGTAAGCCAGTTTGGGCCAATTTCTCTGATTTTTATATTCTTGACCGGTTTTTGCGCATATGCAGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTCTATCAAATAAAATATATACTTCGGTTTTCTTGTATCAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAAA------TTAAGTTCAGAAAAATTATTGGAAGAATTTTTT---ACA---GAAGAAGATCTTTTTTCTTTTATTTTTCCA------AGAACTTCTTTGACTTTGCGG------AGGTTTTAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTCGTCAAT---------------CATTTA---------------------------TAA Lespedeza_cuneata_EU717416 ATGGAGGAATATCGTGTA---------TTTTTAGAACTCCATAGATCTCGTCACCGGGAC------ATCCTATACCC------GCTTTTTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCGTGGA---------------TCCATTTTTGTGGAA---AATGTAGGT------TATAACAAT------AAA------TTTAGTTTACTAATTGTAAAACGCTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTATTGTTAATGATTCTAAC------AAAAATCCT------------TTTTTGGGTTATAACAATAATTATTAT---TCTCAAATAATATTCGAAGGTTTTGTTGTCGTTCTAGAGATTCTATTTTCTCTACAATTA---TATATATCTTCC---------TTAAAAGAGTTAGAAATCGTAAAATCTTATAATAATTTGGGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAATTTATATATTTCAATCATAAGTCAGATATAAGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAATCTTTCGATATTGGATAAAAGATGTCTTTTTCTTTCACTTATTAAGGTTGTTTTTTTAT------TACTATTGTGACGGGAAC------------AGTTTTTTTACTCCA------------AAAAAATCGATTTCTACTTTTTTT---------------TTTAAAAGTAATCCAAGATTT------------------------TTCTTACTA------CTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAATAAATCCTCTCAGTTACGATTTAAATATTTTCGCGTTTTTTTTGAGCGAGTTTTTTTCTATGAAAAAATAGAACAT------CTTGCAGAAATATTTGTT------AAGAATTTTTCATAT---ACCTTATTATCC------TTCAGGGAT---CCTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCAACCAAGAACGATCGATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------GGTTATTTTTTAAGTATTCGGCTAAATCTTTCGGTGGTACGAAGTCAAATGTTACAAAATTCATCTCTAATAAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCAAAATTTTGTAATGTATGGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGACTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAGA------TTACGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAGGGTATTTTTTCTTTGATTTTTCCA------AGAACTTCTTTTACTTTGCAG------AAGTTATAT------AGAGGTCGCATTTGGTATTTGGATATTGTT---TTCAGAAAT------GATTTGGTCAAT---------------CATTCA---------------------------TAA Lessertia_herbacea_AY920453 ATGAAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAT------TTCCTATACCC------ACTTATTTTTAGGGAGTATGTTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCTACATTTGTGGAA---AATGTAGGT------TATGACAATGACAATAAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTAT---TCTAAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTT------AGCTCTTCC---------TTAGAGGAGGCAAAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTAAAAGATGCCCCCTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTTTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCGAGATTA------------------------TTCTTATTC------CTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACCATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTCT---ACCTTAACATTC------TTCAAGGAT---CCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGGAATGTTTTTTTGATGTTTGGTCTCAACCGGGAACGATCCATATAAAA---CAATTA---TCCGAACATTCATTTTACCTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCGTTCACTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGGCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGA------TCAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCGTCTTCTACTTTGCAG------AAGTTAAAT------GGAAATAGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATTTAGTCAAT---------------CATGAA---------------------------TGA Leucaena_leucocephala_AF523094 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCGAAC------AAAAATCCA------------TTTTTGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAAAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATGCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ATCCTATGGTTC------TTCAAGGAC---CCTACCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAATGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCCCTTCATCCGATTTTGATATTACTTGACCGATTTTGCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTTTTGCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTCCAG------AAGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Leucomphalos_brachycarpus_JX2958 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCACCAACCGGAC------TTCCTATACCC------ATTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTCTTGTGGAA---AATATAGGT---AGTTATGACAAT------AAA------TCTAGTTTATTAGTTATAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTAATTATTTATGTTAATGATTCTAAC------AAAAATCAA------------TTCTTGGGGTATAACAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCTTACAATTC------AGCTCTTTC---------TTAAAGGAGGCCGAAATCGTCAAATCTTATAATAATTTGCGATCCATTCATTCAATTTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATGTGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTTTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATCATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---AACTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCGAAGAAT------GCGCTTATTTTGATGAAGAAATGGAAATACTATTTTACCCATTTCTGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATTCATATAAAC---CAATTA---TCCAAACATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGTCTCAATCTTTCAGTGGTACGGAGTCAAATGCTACAAAATTCATTTCTAATAGAAATTTTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTTTTGATCGATTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTAGCTCGTAAACACAAAAGTACTGTACACGTTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTCTTGGAAGAATTCTTT---ACAGAGGAAGAGGAAATTCTTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGATTATAT------AGAGGTCGGATTTGGTATTTGGATATTCTT---TTCGGCAAC------GATCTGGTCAAT---------------AATTCA---------------------------TGA Leucomphalos_mildbraedii_JX29586 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCACCAACCGGAC------TTCCTATACCC------ATTCATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTCTTGTGGAA---AATATAGGT---AGTTATGACAAT------AAA------TCTAGTTTATTAGTTATAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAAAATCAA------------TTCTTGGGGTATAACAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAAAGGAGGCCGAAATCGTCAAATCTTATAATAATTTGCGATCCATTCATTCAATTTTTCCTTTCTTCGAGGATAAATTGACATATTTAAATTATGTGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTTTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATCATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---AACTTATCATTC------TTTAAGGAT---CCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCGAAGAAT------GCGCTTATTTTGATGAAGAAATGGAAATACTATTTTACCCATTTCTGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCAAACATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGTCTCAATCTTTCAGTGGTACGGAGTCAAATGCTACAAAATTCATTTATAATAGAAATTTTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTTTTGATCGATTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTAGGCTTTCTTGTATAAAAACTTTAGCTCGTAAACACAAAAGTACTGTACACGTTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTCTTGGAAGAATTCTTT---ACAGAGGAAGAGGAAATTCTTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGATTATAT------AGAGGTCGGATTTGGTATTTGGATATTATT---TTCGGCAAC------GATCTGGTCAAT---------------AATTCA---------------------------TGA Libidibia_ferrea_EU361901 ATGGAGGAATTTCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAAGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAAGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAAGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTCTTC------CTATATAATTTTTATGTATATGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCGTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTTTAGAAGTCTTTGGT------AAGAATTTTCCGTCC---ACCTTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTGGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATAGAAAC---CAATTA---TCCGAGCATTCGTTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATTGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCCAGAAATCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTATACGCGTTTTTTTGAAAAGA------TTGGGTTCAGAA---TTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAACTTCTTCTACTTTCCAG------AGGTTATAT------AGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------------------CATCAA---------------------------TGA Lonchocarpus_lanceolatus_AF14271 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCATCATGGC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATGATCATGATTTA------AATAGATCCATTTTTGTAGAA---AATATAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTATGCTACTGAGTCTAAC------AAAAATCCA------------TTTTGGGGATATAACAATAATTTATAT---TCTCAAATAATATTAGAAGGTTTTGTTGTTGTCGTGGAAATTCCATTTTCCCTACAATTT------AGTTTTTCT---------TTAGGGGGGGGAGAAATCATAAAATATTTTTCTAATTTGCGATCAATTCATTCCATTTTTCCCCTTTTCGAAGATAAATTTACATATTTAAATTATAAGTCAGATATACAAATACCCTATCTTATCCATCTGGAAATCTTGATTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTCATTTATTAAGATTGTTTTATTAT---------TATTGTAATTGGAAT------------AGTCTTATTAATTCA------------AAGAAATCCATTTCCATTTTTTCAAAT------------TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTC------CTATATAATTTATATGTATGGGAATATGAATATATCTTTTTTTTTCTACGTAACAAATCCTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTGTACAAAAATAGAACAT------CTTGTACAAGTCGTTGAT------AAGAATTTTTCATAT---ACCTTATCATTC------TTCAAGGAT---CCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTTATTTATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAT---CAATTA---TCCAAACATTCATTTCACTTTTTG------GGATATTTTTTAAATATACAGTTAAATCTTTTAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAATTGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCTTCTAATTAGATCATTGATTAAAGCGAAATTTTGTAATGTATTGGGGCATCCTATTAGTAAGTCGGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAGGAAGGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAACGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGATCCGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGATTTTTTCTTTGATCTTTCAA------AGAACTTCTTCTCCTTTCCAG------AGATTACAT------AGAGGTCGAATTTGGTATTTAGATATTCTT---TTCAGCAAT------GATCTGATCAAT---------------CATTTA---------------------------TAA Lotus_purshianus_AF142729 ATGGAGGAATATCAGTTA---------TATTTGGAACTAGATAGATATCGTCAACAGGAC------TTCCTATACCC------ACTTGTTTTTCACGAATATATTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCGATTTTTGTAGAA---AATATAGGT------TATGATAAA------AAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCGACAAAATCATTTGATTATTTCGGCTAAAGATTCTAAT------AAAAATAGA------------TTTTTGCGGTATAATAAGAATTTTTAT---TCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCTATTTTCTTTACAATTA------AGCGGGTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAAAATCTGCGATCAATTCATTCTATTTTTCCCTTTTTCGAGGATAAAGTTACATATTTAAATTATATATCAGATATACGAGTCCCTTATCCTATCAATCTGGAAATCTTAGTCCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTGTTTCATTTATTAAGATTGTTTCTTTAT------GATTATTGTAATTGGAAT------------AGTATTATTATTCCA------------AAAAAATCTATTTTTCTTTTTTCA------------------AAAAATAATCCAAGATTT------------------------TTCTTCTTC------CTATATAATTTTTATCTATGTGAATTTGAATCTATCTTTTTTTTTCTACGTACCAAATCTTCTCATTTACGATTAAAATCTTTTAGAGTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAAAGGACAT------CTTGTAGAAGTATTTCTT------AAGGATTTTTTTTCT---ACCTTAACATTC------TTTAAGGAT---CCTTTTATCCATTATGTTCGATATCAGGGAAAATCCATTCTGGCTTCCAAGAAT------TTGCCTATTTTAATGAATAAATGGAAATACTTTTTTATCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCGCGAACAATCCATATCAAC---CAATTA---TCCGAATATTCATTTCACTTTTTG------GGCTATTTTTTAAAGGTGGGGCTGAAGCATTCAGTGGTACGGGGTCAAATGCTGCAAAATGGATTTCTAATCAAAATTCTTATCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATTATTGGCTAAATCGAAATTTTGTAATGTATTAGGGAATCCCCTTAGTAAGCCGTCCTGGGCCGACTTATCCGATTTTGAGATTATTGCCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCCTGTAAACACAAAAGTAGCGTACGCGCTTTTTTGAAAAGA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTAAGG------AGGTTACAT------AGAAATCGGATTTGGTATTTGGATATTCTT---TTTAGCAACGATAACGATATAATCAAT---------------CATGAC---------------------------TGA Luetzelburgia_amazonica_JX152622 AAGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGA------------AAAAGTAATCCAAGAATT------------------------TCTCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAANGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Luetzelburgia_andina_JX152624 AAGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGA------------AAAAGTAATCCAAGAATT------------------------TCTCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCTGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Luetzelburgia_andradelimae_JX152 AAGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGA------------AAAAGTAATCCAAGAATT------------------------TCTCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAANGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Luetzelburgia_auriculata_JX15263 AAGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCTAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGA------------AAAAGGAATCCAAGAATT------------------------TATCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAANGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Luetzelburgia_bahiensis_JX152634 AAGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGA------------AAAAGTAATCCAAGAATT------------------------TCTCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAANGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Luetzelburgia_guaissara_JX152636 AAGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGA------------AAAAGTAATCCAAGAATT------------------------TCTCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAANGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Luetzelburgia_guianensis_JX15263 ATGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTTGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGA------------AAAAGTAATCCAAGAATT------------------------TCTCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAANGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CATGAA---------------------------TGA Luetzelburgia_harleyi_JX152642 AAGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGA------------AAAAGTAATCCAAGAATT------------------------TCTCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAANGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Luetzelburgia_neurocarpa_JX15264 AAGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAATA------------AAAAGTAATCCAAGAATT------------------------TCTCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAANGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Luetzelburgia_praecox_JX152646 AAGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGACTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGA------------AAAAGTAATCCAAGAATT------------------------TCTCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACAATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAANGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Luetzelburgia_purpurea_JX152648 AAGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAATA------------AAAAGTAATCCAAGAATT------------------------TCTCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAANGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Luetzelburgia_sotoi_JX152652 AAGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGA------------AAAAGTAATCCAAGAATT------------------------TCTCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAANGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AAAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Luetzelburgia_trialata_JX152617 AAGGAGGAATATCAAGTATTCAANGTATATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAA---AATATAGGC------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTAGGGTATAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGA------------AAAAGTAATCCAAGAATT------------------------TCTCTCTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCT---ACCTTATCATTC------TTCAAGGAT---CTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAACNNCCTATTA---TCCAAGCATTCT---CACTTTTTT---NGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCNTCAAAAAAAANGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATA------TTAGGTTCAGAAGAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATAT------AGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAAT------GATCTGGTCAAT---------------CGTGAA---------------------------TGA Lupinus_argenteus_AY386956 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATCTCTCGCCAACAGCAC------TTACTATACCC------ACTCATTTTTCGGGAGTATATTTATGGACTCGTTTATGGTCATGATTTT------AATGGATCTATTTTTTTGGAA---AATCTAGAT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGGATCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAA------AAAAATCAA------------TTTTTGAGTTATAATAAAAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGTCAAAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTTGTTTCACTTATTAAGGTTGTTTTTTTAT------GAATATTGTAATTGGAAT------------AATCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCTAAGAGTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTCAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTATCGTTCTTTTTGAACGGATCTATTTCTATGGAAAAATAGAACAT------TTTTTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACC------TTC------TTCAAGGAG---CTTTTCATTCATTATGTTAGATATCAAGAAAAATATATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAAAATTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCACGAACCATCCAAATAAAC---CAATTT---TCCGAGGGTTCATTTCGCCTTTTG------GGATATTTTTCAAATGTGCGGTTGAATCGTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTCTTAGGACACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCAGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAAGAAGAAGAGATTCTTTCTTTGGTCTTTCAA------AGGGTTTCTTCTACTTTGCAG------GGGTTATAT------AGAGGTAGGGTTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Lupinus_cosentinii_AY386943 ATGGAGGAATATCAAGAT---CAAGTATATTTAGAACTAGATATCTCTCGCCAACAGCAC------TTCCTATACCC------ACTCATTTTTCGGGAGTATATTTATGGACTCGTTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAA---AATGTAGAT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGGATCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAA------AAAAAGAAA------------TTTTTGAGTTATAATAAAAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGTCAAAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCTAAAGATGCCCCTTTCTTTCACTTATTAAGGTTGTTTTTTTAT------GAATATTGTAATTGGAAT------------AATCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCTAAGAGTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTTTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAG---CTTTTCATTCATTATGTTAGATATCAAGAAAAATATATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAAAATTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGGGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCGTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTCTTAGGGCACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTCATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGGTCTTTCAA------AGGGCTTCTTCTACTTTGCAG------GGGTTTTAT------AGAGGTAGGGTTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Lupinus_odoratus_EU025914 ATGGAAGAATATCAAGTA---------TATTTAGAACTCGATATCGCTCGCCAACAGAAC------TTCCTATACCC------ACTCATTTTTCGGGAGTATATTTATGGACTCGTTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAA---AATGTGGAT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGGATCAACAGAATCATTTGATTATTTCGGCTAATGATTATAAA------AAAAATCAA------------TTTTTGAGTTATAAAAAAAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGTCAAAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCTAGAGATGCCCCTTTGTTTCACTTATTAAGGTTATTTTTTTAT------GAATATTGTAATTGGAAT------------AATCTTATTACTCCA------------AAAAAATCTATTTCTACTTTTTCA------------------AAAAGTAATCTAAGAGTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCGATGGAAAAATAGAACAT------TTTTTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTCTCATTC------TTCAAGGAG---CTTTTCATTCATTATGTTAGATATCAAGAAAAATATATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAAAATTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAATCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGGGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTACGGTTGAATCGTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTCTTAGGACACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAAGAGATTCTTTCTTTGGTCTTTCAA------AGGGCTTCTTCTACTTTGCAG------GGGTTATAT------AGAGGTAGGGTTTGGTATTTGGATATTATT---GTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Lupinus_sparsiflorus_JQ619990 ATGGAGGAATATCACGTA---------TATTTGGAACTAGATATCTCTCGCCAACAGCAC------TTCCTATACCC------ACTCATTTTTCGGGAGTATATTTATGGACTCGTTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAA---AATGTAGAT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGGATCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAA------AAAAATCAA------------TTTTTGCGTTATAATAAAAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGTCAAAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCTAAAGATGCCCCTTTGTTTCACTTATTAAGGTTGTTTTTTTAT------GAATATTGTAATTGGAAT------------AATCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCTAAGAGTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAAGAGACCAT------TTTTTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGAG---CTTTTCATTCATTATGTTAGATATCAAGAAAAATATATTTTGGCTTCAAAGAAT------GCGGCTCTTTTGATGAATAAATGGAAAAATTATCTTATCTGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATTCAAATAAAC---CAATTC---TCCGAGAGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCGTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTCTTAGGACATCCCATTAGTAAGCCCGTTTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACATAAAAGTACTGTACGTGCTTTTTTGACAAGA------TTAGGTTCA{AG}AAAAATTATTGGAAGAATTCTTT---ACAGAA{AG}AA{AG}AA{AG}AGATTCTTT{CT}TTTGGTCTTTCAA------AGGG{CG}TT{CT}TT{CT}T{AT}CTTTGC{AC}G------GGGTTATAT------AGAGGTAGGGTTTGGTATTTGGATATTATT---TTC{AC}GCAAC------GAT{CT}TGGTCAAT---------------C{AC}TGAA---------------------------TGA Lupinus_texensis_JQ619989 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATCTCTCGCCAACAGCAC------TTCCTATACCC------ACTCATTTTTCGGGAGTATATTTATGGACTCGTTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAA---AATGTAGAT------TATGATAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGGATCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAA------AAAAATCAA------------TTTTTGAGTTATAATAAAAATTTGTAT---TCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGTCAAAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTTGGCTAAAGATGCCCCTTTGTTTCACTTATTAAGGTTGTTTTTTTAT------GAATATTGTAATTGGAAT------------AATCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------------------AAAAGTAATCTAAGAGTT------------------------TTCTTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTTTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGAG---CTTTTCATTCATTATGTTAGATATCAAGAAAAATATATTTTGGCTTCAAATAAT------GCGTCTCTTTTGATGAATAAATGGAAAAATTATCTTATCTGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGGGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTACGGTTGAATCGTTCAGCGGTACGGAGTCAAATGCTGAAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCAAAATTTTGTAATGTCTTAGGACACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGA------TTAGGTTCAGAAAAATTATTGGAAGAATTCTTT---ACAGAGGAAGAGGAGATTCTTTCTTTGGTCTTTCAA------AGGACTTCTTCTACTTTGCAG------GGGTTATAT------AGAGGTAGGGTTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---------------CATGAA---------------------------TGA Lysidice_rhodostegia_EU361995 ATGGAGGAATCTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCC------ACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATATAGGT------TCTGACAAT------AAA------TCTAGTTTATTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATCAA------------TTTTGTGGGTACAACAAGAATTTATAT---TCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGGCAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTATTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------------------AACAGGAATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTTTATCTATATGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTCCT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGAC---CCTTTCATTCATTATGCTCGATATAAAGGAGAATCGATTCTGGCTTCTAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------TGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGA------TTAGGTTCAGAA---TTTTTGGAAGAATTCTTT---ACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATAT------AGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---------------GATGAA---------------------------TGA Lysiloma_acapulcensis_AF274126 ATGGAAGAATTTCAAGCA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCC------ACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAA---AATCTAGGT------TATGACAAT------AAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATCTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTAT---TCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTTTGTGTCAGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------------------AAAAGTAATCCAAGATTT------------------------TTCCTGTTC------CTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCACCC---ACCCTATGGTTC------TTCAAGGAC---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTTTAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCGATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAAATTATTGAGCGATTTTTGCAGATATGCAGAGATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGA------TTAGGTTCTGAA---TTATTGGAAGAATTCTTT---ACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATAT------AGGGGTCGGATTTGGTATTTTGATATTTTCGATTTT---------------------------------------CATCAA---------------------------TGA Lysiphyllum_gilvum_EU361876 ATGGAGGAATTTCAAGTA---------TATTTAGAAATATATAGATCTCGAAAAAATGAC------TTCCTATACCC------ACTTATCTTTCGGGAATATATTTATACACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAA---AATGTAGAT------TATGACAAT------AAA------TCTAGTTTCCTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATTCTTTTCTTATTTCTGCTAATGATTCTACC------AAAAAGAAATTCAAAAATCCATTTTTAGGGTACAACAAAAATTTGTAT---TCTCAAATAATATCAGAGGGGTTTGCCATCATTTTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAAAGGAGGCGGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGATCAATTTCCATATTTGAATTATGTGTCAGAGGTACAAATACCCTACCCTATCCATTTGGAAATTCTGCTTCAAACCCTTCGCTATTGGTTGAAAGATGTCTCGTCTTTTCATTTATTAAGGATCTTTCTTCAC------CAATATTGTAATTCGAAT------------AGTCTTATTACTCTA------------AAAAAATCAATTTCTACTTTTGGA------------------AAAAGTCATCCAAGATTC------------------------TTCTTGTTC------CTATATAATTTGCATGTCTTCGAATATGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCCTTTGGAGTCCTTTTTGAGCGGATCTATTTCTATGGAAAAACAGAACAT------CTTGTAGAAGTCTTTGCT------AAAGATTTTCTGTCG---ACCCTATGGTTA------TTCAAGGAT---CCTTTCATTCATTATGTTAGATATCAAGGAAAATCGATTCTGGCTTCAACGAAT------ACGCCTCTTTTTTTGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTAATTTTTATGTTTGGTCTCAACCAGGAAGAATCCATATAAAC---CAATTA---TCTGAGCATTCATTCTACTTTTTGTTTTTGGGTTATTTTTCAAGTG