#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 19:35 GMT TreeBASE (cc) 1994-2008 Study reference: Ghebretinsae A., Thulin M., & Barber J. 2007. Relationships of Cucumbers and Melons Unravelled- Molecular Phylogenetics of Cucumis and Related Genera (Benincaseae, Cucurbitaceae). American Journal of Botany, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1823] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=50; TAXLABELS Citrullus_lanatus Cucumella_aspera Cucumella_bryoniifolia Cucumella_cinerea Cucumella_kelleri Cucumis_aculeatus Cucumis_africanus Cucumis_anguria Cucumis_anguria_anguria Cucumis_baladensis Cucumis_canoxyi Cucumis_carolinus Cucumis_dipsaceus Cucumis_ficifolius Cucumis_globosus Cucumis_hastatus Cucumis_heptadactylus Cucumis_hirsutus Cucumis_humifructus Cucumis_hystrix Cucumis_insignis Cucumis_kalahariensis Cucumis_meeusei Cucumis_melo_agrestis Cucumis_melo_cantaloupe Cucumis_melo_inodorus Cucumis_melo_melo Cucumis_metuliferus Cucumis_myriocarpus Cucumis_prophetarum Cucumis_pubituberculatus Cucumis_pustulatus Cucumis_quintanilhae Cucumis_rigidus Cucumis_rostratus Cucumis_sacleuxii Cucumis_sagittatus Cucumis_sativus Cucumis_sativus_hardwickii Cucumis_sativus_xishuangbannanesis Cucumis_thulinianus Cucumis_zeyheri Cucurbita_pepo Dicaelospermum_richeti Muellerargia_timorensis Mukia_javanica Mukia_maderaspatana Myrmecosicyos_messorius Oreosyce_africana_1 Oreosyce_africana_2 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=50; TAXLABELS Citrullus_lanatus Cucumella_aspera Cucumella_bryoniifolia Cucumella_cinerea Cucumella_kelleri Cucumis_aculeatus Cucumis_africanus Cucumis_anguria Cucumis_anguria_anguria Cucumis_baladensis Cucumis_canoxyi Cucumis_carolinus Cucumis_dipsaceus Cucumis_ficifolius Cucumis_globosus Cucumis_hastatus Cucumis_heptadactylus Cucumis_hirsutus Cucumis_humifructus Cucumis_hystrix Cucumis_insignis Cucumis_kalahariensis Cucumis_meeusei Cucumis_melo_agrestis Cucumis_melo_cantaloupe Cucumis_melo_inodorus Cucumis_melo_melo Cucumis_metuliferus Cucumis_myriocarpus Cucumis_prophetarum Cucumis_pubituberculatus Cucumis_pustulatus Cucumis_quintanilhae Cucumis_rigidus Cucumis_rostratus Cucumis_sacleuxii Cucumis_sagittatus Cucumis_sativus Cucumis_sativus_hardwickii Cucumis_sativus_xishuangbannanesis Cucumis_thulinianus Cucumis_zeyheri Cucurbita_pepo Dicaelospermum_richeti Muellerargia_timorensis Mukia_javanica Mukia_maderaspatana Myrmecosicyos_messorius Oreosyce_africana_1 Oreosyce_africana_2 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1923] TITLE Cucumis_trnsg; LINK TAXA = Taxa1; DIMENSIONS NCHAR=791; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Citrullus_lanatus AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATATAAATTCTCGTAATTTGTATCCA----AAAATCAGTTCGAAATTGAAAAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATTTTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATTGAATGCATTCAGAGGGAAAGGCTGACATAGATGTTAT----GGGTGGCATTTTTTTTT----GTTTACATCTTACATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTCCACGTTCGGTTTTGAATTAGAGACGTT--------CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumella_aspera AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGTTTTATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAAAAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-AAAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTGTTCTAATCGTAACTAAATCTTCAATCTCCCTTATACA-AA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACCAAATACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTTTGATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTT-----GTTTACATCTTACATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumella_bryoniifolia AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGTTTTATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGAGTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTGCTAAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAGTTCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACCAAATACTTTTCCTAAGGATTATATTAGCTAGAAATAGGGAACGAAATAAATAACTGGAAAGATTTTGATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTT-----GTTTACATCTTACATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAA----TAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumella_cinerea AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGTTTTATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGAGTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTTC-AAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGAGAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTCTATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTT-----GTTTACATCTTACATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumella_kelleri AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGTTTTATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTGCTAAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGTAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAGTTCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTGATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTT-----GTTTACATCTTACATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAA----TAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_aculeatus AGTGGTAAAAGTGCGATTCG-TTCTATGAAACCCTTAATAGTTAAGGGATCCTTCGGTTTTATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAAAAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCGCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_africanus AGTGGTTAAAGTGCGATTCG-TTCTTTGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATTAAATTACGAAACATAATAATATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTATACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCGCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_anguria AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGATTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTTTTT--GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGGAACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCGCTAGCC--CTCCAAGCTAACGATGCGGGTTC Cucumis_anguria_anguria AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGATTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTTTT---GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGGAACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCGCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_baladensis AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGTTCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAATAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCGCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_canoxyi AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAAACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCGCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_carolinus AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCGCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_dipsaceus AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGATTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACGTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCGTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGGAACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCGCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_ficifolius AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTCTAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_globosus AGTGGTAAAAGTGCGATTCG-TTCTATGAAACCCTTAATAGTTAAGGGATCCTTCGGTTTTATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAAAAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_hastatus AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-AAAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTTT----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_heptadactylus AGTGGTTAAAGTGCGATTCG-TTCTTTGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATTAAATTACGAAACATAATAATATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTATACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_hirsutus AG-GGTAAGTGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATCCAAATTCTCGTGATTTGTATCCATCCAAAAATCTGTTCGAAATTGCTAAAAATTGGATCATGAAATTACGAAACAGAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTGTATGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTAGAATCTCCTCTTGTATA-------------------GGGATCATCTAGAAAGCAGATCCTTATGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTTTTTTTTTTTACATCTTCCATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATAAGAGACGTTCAGTT---CAAAATGAATGAATCAACCGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_humifructus AG-GGTAAGTGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATCAAAATTCTCGTGATTTGTATCCATCCAAAAATGTGTTCGAAATTGCTAAAAATTGGATGATGAAATTACGAAACAGAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTGTATGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTAGAATCTCCTCTTGTATA-------------------GGGATCATCTAGAAAGCAGGTCCTTTTGAATGCATTCAGAT-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTTTTTT--TTTACATCTTCCATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTGAGTT---CAAAATGTATGAATCA-CCGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGAGGCGGGTTC Cucumis_hystrix AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGGTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCTAAATTG-AAAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGAGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------AGGAGATTGAAGCAAAACAAAATAGCTATTAAACTATTTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTTTATAGTTTATA------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTT-----GTTTACATCTTCAATTTTTA--AATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_insignis AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTATTCGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGGAACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_kalahariensis AGTGGTTAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATTAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTATACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_meeusei AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTTT----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_melo_agrestis AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGGTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATATGTTCTAAATTGAAAAAAATTGGATCATGAAATTACGAAACATAGTTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------AAGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTTTAGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTCTATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGTATTTTTTTTT----GTTTACATCTTATAAATTTAGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCGAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCGTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_melo_cantaloupe AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGGTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATATGTTCTAAATTGAAAAAAATTGGATCATGAAATTACGAAACATAGTTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------AAGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTTTAGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTCTATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGTATTTTTTTTT----GTTTACATCTTATAAATTTAGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCGAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCGTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_melo_inodorus AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGGTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATATGTTCTAAATTGAAAAAAATTGGATCATGAAATTACGAAACATAGTTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------AAGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTTTAGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTCTATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGTATTTTTTTTT----GTTTACATCTTATAAATTTAGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCGAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCGTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_melo_melo AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGGTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATATGTTCTAAATTGAAAAAAATTGGATCATGAAATTACGAAACATAGTTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------AAGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTTTAGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTCTATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGTATTTTTTTT-----GTTTACATCTTATAAATTTAGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCGAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCGTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_metuliferus AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTGAAAAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------AAGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTCTATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGAATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCTGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_myriocarpus AGTGGTTAAAGTGCGATTCG-TTCTTTGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTGAACAAAATTGGATCATTAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTATACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_prophetarum AG-GGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_pubituberculatus AG-GGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_pustulatus AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGATTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTCTAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGGAACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_quintanilhae AGTGGTTAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATTAAATTACGAAACATAATAATATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTATACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_rigidus AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGTTCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTTT----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_rostratus AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCTAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTTT----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_sacleuxii AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_sagittatus AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGGTTGATTAATATTCCGATGAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAGATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTGAACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------AGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTCTATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGTATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_sativus AGTGGTAAAGGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGCATCCTTCGGGTTGATTAATATTCCGATCAATAACTTTATTTCTTAGAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAGATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCTAAATTGTACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGAGATCCATGGATAAAGGTGGAATTTCTTCTTATCGTAACTAAATCTTCAATTCTTTCTTTGTATAA--------AGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATTTCTATTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAACTACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTTCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTTTACATGTTTACATCTTCAATTT--TTGAATTTATCCATCTTCCATAAAGCCGGGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTTGACCAAAATGAT-GAATCAA-CGTCGACTATAACCTCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_sativus_hardwickii AGTGGTAAAGGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGCATCCTTCGGGTTGATTAATATTCCGATCAATAACTTTATTTCTTAGAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAGATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCTAAATTGTACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGAGATCCATGGATAAAGGTGGAATTTCTTCTTATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------AGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATTTCTATTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAACTACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTTCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTTTACATGTTTACATCTTCAATTT--TTGAATTTATCCATCTTCCATAAAGCCGGGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTTGATCAAAATGAT-GAATCAA-CGTCGACTATAACCTCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_sativus_xishuangbannanesis AGTGGTAAAGGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGCATCCTTCGGGTTGATTAATATTCCGATCAATAACTTTATTTCTTAGAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAGATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCTAAATTGTACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGAGATCCATGGATAAAGGTGGAATTTCTTCTAATCGTAACTAAATCTTCAATTCTTTCTTTGTATAA--------AGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATTTCTATTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAACTACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTTCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTTTACATGTTTACATCTTCAATTT--TTGAATTTATCCATCTTCCATAAAGCCGGGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTTGATCAAAATGAT-GAATCAA-CGTCGACTATAACCTCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_thulinianus AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTT-----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucumis_zeyheri AGTGGTAAAAGTGCGATTCG-TTCTTTGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCGAAATTG-ACAAAATTGGATCATTAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTATACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTTT----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Cucurbita_pepo AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGAATTATTAATATTCCGATCAAAAACTTTTTTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATATAAATTCTCGTGATTTGTATCCA----AAAATCAGTTCGAAATTG-AAAAAATTGGATCACGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTAGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGGATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAGTGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAACTACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTATGTATGGGTGGCATTTTTTTTTT---CTTTACAACTTACATGT--AAGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTT--------CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Dicaelospermum_richeti AGTGGTAAAAGTGCGATTCGTTTCTATGAATCCCTT-ATAGTTAAGGGATCCTCCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATCAAAATTATCGTGATTTGTATCCC----AAAATCTGTTCTAAATTG-AAAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------AGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATTTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTT-----GTTTACATCTTCAATTT--TGGAATTTAGTCATCTTCCATAAA----GGAGCCGAATGAACCCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGTG-AATTCAA-CGTCGACTATAACCCCTAGCCCCTTCCAAGCTAACGATGCGGGTTC Muellerargia_timorensis AGTGGTAAGAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATCTAAATTCTCGTAATTTGTATCCA----AAAATCTGTTCGAAATTGCTAAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATCTTTTCTATGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTGCAACCAGAGGGAAAGGCTGACATAGATGTTAT----GGGTGGCATTTTTTTTT----GTTTACATCTTACATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTCCACGTTCGGTTTTGAATTAGAGACGTT--------CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Mukia_javanica AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTA-GGGATCCTTCGGGTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGCTTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATAAAAATTCTCGTGATTTGTATCCT----AAAATCTGTTCTAAATTG-AAAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------AGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATTTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTTTCTTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGGAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTTT----GTTTACATCTTCAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAAACAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGTG-GAATCAAACGTCGACTATAACCTCTAGCC--TTCCAAGCTAACGATGCGGGTTC Mukia_maderaspatana AGTGGTAAAAGTGCGATTCG-TTCTATTAATCCCTTAATAGTTAAGGGATCCTTCGGGTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATCAAAATTCTCGTGATTTGTATCCC----AAAATCTGTTCTAAATTG-AAAAAATTGGATCATCAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGAAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------AGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATTTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTAGTTATAATCTCCTCTTGTATAGGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGGCATTTTTTTT-----GTTTACATCTTCAATTT--TGGAATTTAGCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAACCGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Myrmecosicyos_messorius AGTGGTAAAAGTGCGATTCGTTTCTTTGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTGATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAATCAAAATTCTCGTGATTTGTATCCA---CAAAATCTGTTCGAAATTG-ACAAAATTGGATCATTAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGAAGGAATAAGGGATCCATGGATAAAGGTGGAATTTTTTCTAATCGTAACTAAATCTTCAATTTTTTCTTTGTATAA--------GGGAGATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCGGAAACAAAATACTTTTCCTAAGGATTATATTAAAGAGAAATAGGGAACGAAATAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCGTCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATAGCATTTTTTTTT----GTTTACATCTTAAATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGAT-GAATCAA-CGTCGACTATAACCCCTAGCC--TTCCAAGCTAACGATGCGGGTTC Oreosyce_africana_1 AGTGGTAAAAGTGCGATTCG-TTCTATGAATCCCTTAATAGTTAAGGGATCCTTCGGTTTTATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAAAAAAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCCAAATTG-AAAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGACGGAATAAGGAATCCATGGATAAAGGTGGAATTTGTTCTAATCGTAACTAAATCTTCTC-TTTTTCTTTGTAGATTTGTAGAAGGGATATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCAGAAACAAAATACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAATTAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCAGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGACATTTTTTTT-----GTTTACATCTTACATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACAAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAAT-TG-GAATCAAACGTCGACTATAACCTCTAGCC--TTCCAAGCTAACGATGCGGGTTC Oreosyce_africana_2 AGTGGTAAAGGTGCGATTCG-TTCTATTAATCCCCT-A-AGCTAAGGAACCCCTCGGTTTTATTAATATTCCGATCAAAAACTTTATTTCTTAAAAGGATTTAATCCTTTACCTCTCGATGAAAGATTCGAGGAAAAAAATAAATTCTCGTGATTTGTATCCA----AAAATCTGTTCCAAATTG-AAAAAATTGGATCATGAAATTACGAAACATAATTTTATTGAATTGGATCAATACTTCCAATTGACGGAATAAGGAATCCATGGATAAAGGTGGAATTTGTTCTAATCGTAACTAAATCTTCTCTTTTTTCTTTGTAGAA--------GGGATATTGAAGCAAAACAAAATAGCTATTAAACAATGTC--TTTGGTTTACTAGAGACGTCGACATCGTTTTTT-AGCTCGGCAGAAACAAAATACTTTTCCTAAGGATTATATTAAATAGAAATAGGGAACGAATTAAATAACTGGAAAGATTGTTATAATCTCCTCTTGTATA-------------------GGGATCATCTATAAAGCGGGTCCTTTTGAATGCATTCCGAC-----GGAAAGGCTGACATAGATGTTAT----GGATGACATTTTTTTTTT---GTTTACATCTTACATTT--AGGAATTTATCCATCTTCCATAAA----GGAGCCGAATGAAACCAAAGTTTCACGTTCGGTTTTGAATTAGAGACGTTCAGTT---CAAAATGTG-GAATCAAACGTCGACTATAACCTCTAGCC--TTCCAAGCTAACGATGCGGGTTC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Cucumis_trnsg) = N: 1-791; CODONPOSSET CodonPositions (CHARACTERS = Cucumis_trnsg) = N: 1-791; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1924] TITLE Cucumis_ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=706; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Citrullus_lanatus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-CAAACAAATTGTCCGTGCCGGTGGGCGGGGGG---------AAGCATTATGCTCT-C-GCG-TGCCC-CCTCCCCCTC---------------GGCGCGTCT-AAACCAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTTGCCTGCCCCTTGCCCCGGCCTCGGC-GTGCAGGGGGTGGAGCATTCTTGTCGTATTATTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCCCCCCC-----ACACAAC--A-CCCC---A-----TGCGGGCTCGTTGC--GTAGGC-A----GGGGCACACGCTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGGCGCACGTCGTCGCGACACTACGGTGGTTGATCCGACCTCGGT-ACCACGTCGCGATCCTGACGT--CGCCTCCTT-----------------GTGGACTCCTACACCGA-CCCTTTGAACGCTGTCCCCCC--AAAGGATGACGCTCTCGAG Cucumella_aspera TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-CTAACAATCTGTCCGCGTCGGGGGCCGGGGGG------------AACCGTGCTCTTC-GCC-TGCCT-CCTTCCCCTCCC-------------GGCGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGCCCCCTGCCCCGGTCTCGGA-GTGCGGGGGCCGGAGCATTCTTGTCGTATAACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCC-----------ACACAAC-C--CCCC---A-----AGCGGGGTCGTTGT--GCTGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGGCGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCCCC-----------------ACGGGCTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumella_bryoniifolia TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-CAAACAATCTGTCTGCGTCGGGGGCCGGGGGG------------AACCGTGCTCTTC-GCC-TGCCT-CCTTCCCCTCCC-------------GACGTGTCT-AAACCAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGCCCCTTGCCCCGGTCTCGGA-GTGCGGGGGCCGGAGCATTCTTGTCGTATAACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCC-----------ACACAAC-C-TCCC----A-----AGTGGGATCGTTGT--GCTGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGGCGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCTTCCCC-----------------ACGGGCTCCTGCAT-GA-CCCTCTGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumella_cinerea TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-CAAACAATCTGTCCGCGTCGGGGGCCGGGGGG------------AACCGTGCTCTTC-GCC-TGCCT-CCTT-CCCTCCC-------------GACGCGCCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTTGCCCGCCCCCTGCCCCGGCCTCGGA-GTGCGGGGGCTGGAGCATTCTTGTCGTATAACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAAC-C--CCTCCC-A-----AGCGGGGTCGTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGGCGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGAAGC--TGCCTCCCC-----------------ACGGGCTCCTGCAC-GA-CCCTTCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumella_kelleri TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-CAAACAATCTGTCCGCGTCGGGGGCCGGGGGG------------AACCGTGCTCTTC-GCC-TGCCT-CCTT-CCCTCCC-------------GACGCGCCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTTGCCCGCCCCCTGCCCCGGCCTCGGA-GTGCGGGGGCTGGAGCATTCTTGTCGTATAACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAAC-C--CCTCCC-A-----AGCGGGATCGTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGGCGCTCGTCGTCACGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGAAGC--TGCCTCCCC-----------------ACGGGCTCCTGCAC-GA-CCCTTCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumis_aculeatus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTACGTGTCGGGGG-CGGGGGG----------AAAAGCATGCTCTTT-GCC-TGCCT-CCT-CCCCTCCC-------------GACGCGCCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTAGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCCCC--------ACACAACTCATCCCC---A-----TGCGGGATC-TTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGC--CGCATCC-------------------AAGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC--AAAAAGGACGACGCTCTCGAC Cucumis_africanus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGCCGGGGG-CGGGGGG----------AAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC----TCCC-----GACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCTTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCC-----------ACACAACTCATCCCCC--A-----CGCGGGATGTTTGT--GCGGGC-A----GGGGCATACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumis_anguria TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGAACGCGTCGGGGG-CGGGGGG----------AAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC-------------GGCGTGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCCC---------ACACAACTCATCCCC---A-----TGCGGGATCTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC-AAAAAAGGACGACGCTCTCGAC Cucumis_anguria_anguria TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGAACGCGTCGGGGG-CGGGGGG----------AAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC-------------GGCGTGTCTTAAACAAAACCCCGGCGCAGGCCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCACCGCTGCCCCCCCC---------ACACAACTCATCCCC---A-----TGCGGGATCTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC-AAAAAGGGACGACGCTCTCGAC Cucumis_baladensis TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGTCGGGGG-CGGGGGGTGGGGGG-----AAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC----TCCC-----GAAGCGTCTTAAACAAAACCCCGGCGCAGGTCGGGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTACCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCAAGGGAACGTCTGCCTGGGCGTCACGCATCGCTGCCCC-------------ACACAACTCATCCCCC--A-----TGCGGGATCTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTCTGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumis_canoxyi TCGATGCCTAAAACATCAAACGA--CCCGCGAA-CGCGTTCG-AAAACAAACTGTCCGCGTCGGGGGCGGGGGG-----------AAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC-------------GGTGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCC-------AC--ACACAACTCATCCCC---A-----TGCGGGATCTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCCCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGTTGCCTCC---AAAGGGACGACGCTCTCGAC Cucumis_carolinus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGTCGGGGG-CGGGGGG----------AAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC-------------GACGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAACTCATCCCC---A-----TTCGGGATCTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTTCGAACGCCGCCCCCC--AAAAGGACGACGCTCTCGAC Cucumis_dipsaceus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGAACGCGTCGGGGG-CGGGGG-TGGGGG---AAAAAGCATGCTCTCT-GCC-TGCTT-CCT-CCCCTCCCC---TCCC-----GACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCAGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCTCCCCCC-ACC-ACACAACTCATCCCC---A-----TGCGGGATCTTTGT--GCGGG-AAGGGTGGGGCACACAGTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCTTACAC-GA-CCCTCCGAACGTCGCCCCC--AAAAAGGACGACGCTCTCGAC Cucumis_ficifolius TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGTCGGGGG-CGGGGGG----------AAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC-------------GACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAACTCATCCCC---A-----TGCGGGATCTTTGT--GCAGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGAT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTTCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumis_globosus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGTCGGGGG-CGGGGGG----------AAAAGCATGCTCTTT-GCC-TGCCT-CCT-CCCCTTCC-------------GACGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGCCCCCTGCCCCGGCCTCGGG-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTGGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAAGGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGTTGCCCCCCC----------ACACAACTCATCCCC---A-----TGCGGGATCTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGAGCACCGTCGTGTGGATGGCTTAAATTTGAGTCCTCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCCTCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumis_hastatus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGTCGGGGG-CGGGGGG----------AAAAGCATGCTCTTT-GCC-TGCCT-CCT-CCCCTCCC-------------GGCGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGTGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCC-------AC--ACACAACTC-TCCCC---A-----TGCGGGATTTTTGT--GCGGAC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCCTCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumis_heptadactylus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACCGTCCGCGTCGGGGG-AGGGGGG---------AAAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC----TCCC-----GACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAACTCATCCCCC--A-----CGCGGGGTGTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTTCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumis_hirsutus TCGATGCCTAA--CATCAAACGA-----G-GAA-CGCGTTTA-ACAACAAACTGTCCGTGTCGGGGGGCGGGGGG--------------------------GCC-TGCCC-CCT-CCCCTCC--------------GACGCGCCT-AAACCAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGCCCCCTGCCCCGGTCTCGGC-GTGCGGGGGGCGGAGCATTCTTGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAA-----CCCCCA-A-----TTCGGGACCGTTGT--GCGGGC-G----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGGCGCCCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCAGT-ACCGTGTCTCGACCTCGATGC--AGCCTCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC--AAAAGGGACTACGCTCTCGAC Cucumis_humifructus TCGATGCCTAA--CATCAAACGA--CCCGTGAA-CGCG-TTA-ACAACAAACCGTCCGTGTCGGGGG-CGGGGGG--------------------------GCCTTGCCC-CCT-CCCCTCC--------------GACGCGCCT-AAACCAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGCCCCCTGCCCCGGTCTCGGC-GTGCGGGGGGCGGAGCATTCTTGTCGTATTTCTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAAC-C--CCCTC--------TTCGGGAACGTTGT--GAGGGT-G----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGGCGCTTGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGTGTCTCGACCTCGACGC--CGCCTCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCCC-AAAAAGGACGACGCTCTCGAC Cucumis_hystrix TCGATGCCTAAAACATCAAACGA--CCCGCGAA-CGCGTTTACAAAACAAACCGACCGCGTCGGGGG-CGAGG--TGGGG---AGGCGAGCACGCTCTTT-GC-TTGCCTTCCT---CCTCCCCC--TCCC-----GGCGCGTCTAAAACAAAACCCCGGCGTAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCCGCCCCTCGTCCCGGCCTCGGTTGTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGTGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGTTGTCCCC--------ACCCACACAACTCC-CCCCCCCA--CCGTGCGGGCTCGTTGT--GCGGGCGA-----GGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGTGACCGCGTCTCGGCCTCGACGT--CGCCTCC-------------------ACGGACTCCTGCAT-GA-CCCTCCGAACGTCGCCCCCGC-AAAGGGACGACACTCTCGAC Cucumis_insignis TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGAACGCGTCGGGGG-CGGGGG-TGGGGGG---AAAAGCATGCGCTCT-GCC-TGCCT-CCT-CCCCTCCCC---TCCC-----GACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCTCCCCCCCACC-ACACAACTCATCCCC---A-----TGCGGGATCTTTGT--GCGGGC-AGGGTGGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCCC-AAAAAGGACGACGCTCTCGAC Cucumis_kalahariensis TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGTCGGGGG-CGGGGGG---------AAAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC----TCCC-----GACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGGAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCCCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGGATTGCTGCCCCCCCC---------ACACAACTCATCCCCC--A-----CGCGGGATGTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACTCTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTCCAC-GA-CCCTCCGAACGCCGCCCCC--AAAAAGGACGACGCTCTCGAC Cucumis_meeusei TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGTCGGGGG-CGGGGGG----------AAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC----TTCC-----GACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTTGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGATTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAACTCATCCCCC--A-----TGCGGGATCTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--TGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTTCGAACGCCGCCCC----AAAAGGACGACGCTCTCGAC Cucumis_melo_agrestis TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTTCGCGTTAGGGG-CGGGGGG------------AAGCATGCTCTTT-GGC-TGCCT-CCT-CCCCTTCC-------------AACGCGTTT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGTCCCCTGCCCCGGCCTCGGC-GTGCGGGGGATGGAGCATTCTAGTCGTATTACTAACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCC--------ACC-ACACAACTC-TCCCC---A-----TGCGGGGTCGTTGT--GAAGGC-A----GGGACACACACTGGCCTCCCGTACGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGATGCTCGTCGTCGCGACACTACGGTGGTTGATTCAACCTCGGTGAC-GCGTCTCGACCTCGACGT--CGACTTC-------------------ACGGACTCCTTCAC-GA-CCCTTCGAACGCCGCCCCTT--AAAAGGACGACGCTCTCGAC Cucumis_melo_cantaloupe TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTTCGCGTTAGGGG-CGGGGGG------------AAGCATGCTCTTT-GGC-TGCCT-CCT-CCCCTTCC-------------AACGCGTTT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGTCCCCTGCCCCGGCCTCGGC-GTGCGGGGGATGGAGCATTCTAGTCGTATTACTAACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCC--------ACC-ACACAACTC-TCCCC---A-----TGCGGGGTCGTTGT--GAAGGC-A----GGGACACACACTGGCCTCCCGTACGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGATGCTCGTCGTCGCGACACTACGGTGGTTGATTCAACCTCGGTGAC-GCGTCTCGACCTCGACGT--CGACTTC-------------------ACGGACTCCTTCAC-GA-CCCTTCGAACGCCGCCCCTT--AAAAGGACGACGCTCTCGAC Cucumis_melo_inodorus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTTCGCGTTAGGGG-CGGGGGG------------AAGCATGCTCTTT-GGC-TGCCT-CCT-CCCCTTCC-------------AACGCGTTT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGTCCCCTGCCCCGGCCTCGGC-GTGCGGGGGATGGAGCATTCTAGTCGTATTACTAACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCC--------ACC-ACACAACTC-TCCCC---A-----TGCGGGGTCGTTGT--GAAGGC-A----GGGACACACACTGGCCTCCCGTACGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGATGCTCGTCGTCGCGACACTACGGTGGTTGATTCAACCTCGGTGAC-GCGTCTCGACCTCGACGT--CGACTTC-------------------ACGGACTCCTTCAC-GA-CCCTTCGAACGCCGCCCCTT--AAAAGGACGACGCTCTCGAC Cucumis_melo_melo TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTTCGCGTTAGGGG-CGGGGGG------------AAGCATGCTCTTT-GGC-TGCCT-CCT-CCCCTTCC-------------AACGCGTTT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGTCCCCTGCCCCGGCCTCGGC-GTGCGGGGGATGGAGCATTCTAGTCGTATTACTAACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCC--------ACC-ACACAACTC-TCCCC---A-----TGCGGGGTCGTTGT--GAAGGC-A----GGGACACACACTGGCCTCCCGTACGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGATGCTCGTCGTCGCGACACTACGGTGGTTGATTCAACCTCGGTGAC-GCGTCTCGACCTCGACGT--CGACTTC-------------------ACGGACTCCTTCAC-GA-CCCTTCGAACGCCGCCCCTT--AAAAGGACGACGCTCTCGAC Cucumis_metuliferus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGTCGGGGG-CGGGGGG------------AAGCATGCTCCTTGGCC-TGCCT-CCTCCCCCTCCC-------------GGCGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCCCC--------ACACAACTC--CCCCC--A-----TGCGGGATCGTTGT--GCGGGC-A---GGGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGGCGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCCTCC-------------------ACGGACTCCTTCAC-GA-CCCTCCGAACGCCGCCCCC--AAAAAAGAAAACACTCTCTAC Cucumis_myriocarpus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACCGTCCGCGTCGGGGG-CGGGGGG----------AAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC----TCCC-----GACGCGGCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGGGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCCCC--------ACACAACTCATCCCCC--A-----CGCGGGATGTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTTGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGGCTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumis_prophetarum TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTACGTGTCGGGGG-CGGGGGG----------AAAAGCATGCTCTTT-GCC-TGCCT-CCT-CCCCTCCC-------------GACGCGCCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTAGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCCCC--------ACACAACTCATCCCC---A-----TGCGGGATCTT-GT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGACGCTAGT?GTCGCGACACTACGGTGGTTGATCCAACCT?GGT-ACCGCGTCTCGACTTCGACGC--CGCATCC-------------------AAGGACTCTTGCAC-GA-CCCTCCGAACGCCGCCCC----AAAAGGACGACGCTCTCCAC Cucumis_pubituberculatus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACGAACTGTCCGCGTCGGGGG-CGGGGGG----------AAAGGCATGCTCTCT-GCC-GGCCT-CCT-CCCCTCCCC------------GACGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGACGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCC---------ACCCACACAACTCATCCC----A----GTGCGGGATCTTTGTGTGCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCTTCGCGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumis_pustulatus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACGAACTGAACGCGTCGGGGG-TGGGGG-TGGGGGGG-AAAAAGCATGCTCTCT-GCC-TGCCC-CCT-CCCCTCCCC---TCCCCTTCCGACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCCGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCTCCCCCC-ACC-ACACAACTC---------A------------TCTTTGTGTGCGGGC-AGGGTGGGGCACACGCTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGTCGCCCCC--AAAAAGGACGACGCTCTCGAC Cucumis_quintanilhae TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGCCGGGGG-CGGGGGG----------AAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC----TCCC-----GACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCC-----------ACACAACTCATCCCCC--A-----CGCGGGATGTTTGT--GCGGGC-A----GGGGCATACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumis_rigidus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGTCGGGGG-CGGGGGG----------AAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC----TCCC-----GAAGCGTCTTAAACAAAACCCCGGCGCAGGTCGGGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTACCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCAAGGGAACGTCTGCCTGGGCGTCACGCATCGCTGCCCC-TCCCCCC-----ACACAACTCATCCCCC--A-----TGCGGGATCTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTCTGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumis_rostratus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGTCGGGGG-CGGGGGG----------AAAAGCATGCTCCTT-GGC-TGCCT-CCTCCCCCTCCC-------------GGCGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCCCC--------ACACAACTC-TCCCCC--A-----TGCGGGATCGTTGT--GCGGGC-A---GGGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGGCGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGTGACCGCGTCTCGACCTCGACGT--CGCCTCC-------------------ACGGACTCCTTCAC-GA-CCCTCCGAACGCCGCCCCC----AAAGGACGACGCTCTCGAC Cucumis_sacleuxii TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGTCGGGGG-CGGGGGGTGGG------AAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC-------------GACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCCC---------ACACAACTCATCCCCC--A-----TGCGGGATCGTTGT--GCGGGC-A---GGGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCAGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTTCAC-GA-CCCTCCGAACGCCGCCCCC--AAAAAGGACGACGCTCTCGAC Cucumis_sagittatus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-CAAACAAACTGCCCGCGTTAGGGG-CGGGGGG------------AAGCATGCTCTTT-GCC-TGTCT-CCT-CCCCTTCC-------------AACGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGGATTCGCCTGCCCCCTGTCCCGGCCTCGGC-GTGCGGGGGATGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCC--------ACC-ACACAACTCCTCCC----A-----TGCGGGATAGTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTACGCATCGTCGTGCGGATGGCTTAAATTTGAGTCCTCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGTGACCATGTCTCGACCTCGACGT--TGACTCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCC----AAAAGGACGACTCTCTCGAC Cucumis_sativus TCGATGCCTAAAACATCAAACGA--CCCGCGAA-CGCGTTTACAAAACAAACCGACCGCGTCGGGGG-CGA----TGGGG---AGGCGAGCACGCTCTTT-GC-TTGCCTTCCT---CCTCCCCC--TCCC-----GGCGCGTCTAAAACAAAACACCGGCGTAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCCGCCCCTCGTACCGGCCTCGGTGGTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGTGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGTTGTCCCC--------ACCCACACAACTCC-CCCGCCCA--CCGTGCGGGCTCGTTGT--GCGGGCGA-----GGGCACACACTGGCCTACCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGTGAC-GCGTCTCGGCCTCGACGT--CGCCTCC-------------------ACGGACTCCTGCAT-GA-CCCTCCGAACGTCGCCCCCGC-AAAGGGACGACACTCTCGAC Cucumis_sativus_hardwickii TCGATGCCTAAAACATCAAACGA--CCCGCGAA-CGCGTTTACAAAACAAACCGACCGCGTCGGGGG-CGA----TGGGG---AGGCGAGCACGCTCTTT-GC-TTGCCTTCCT---CCTCCCCC--TCCC-----GGCGCGTCTAAAACAAAACACCGGCGTAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCCGCCCCTCGTACCGGCCTCGGTGGTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGTGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGTTGTCCCC--------ACCCACACAACTCC-CCCGCCCA--CCGTGCGGGCTCGTTGT--GCGGGCGA-----GGGCACACACTGGCCTACCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGTGAC-GCGTCTCGGCCTCGACGT--CGCCTCC-------------------ACGGACTCCTGCAT-GA-CCCTCCGAACGTCGCCCCCGC-AAAGGGACGACACTCTCGAC Cucumis_sativus_xishuangbannanesis TCGATGCCTAAAACATCAAACGA--CCCGCGAA-CGCGTTTACAAAACAAACCGACCGCGTCGGGGG-CGA----TGGGG---AGGCGAGCACGCTCTTT-GC-TTGCCTTCCT---CCTCCCCC--TCCC-----GGCGCGTCTAAAACAAAACACCGGCGTAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCCGCCCCTCGTACCGGCCTCGGTGGTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGTGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGTTGTCCCC--------ACCCACACAACTCC-CCCGCCCA--CCGTGCGGGCTCGTTGT--GCGGGCGA-----GGGCACACACTGGCCTACCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGTGAC-GCGTCTCGGCCTCGACGT--CGCCTCC-------------------ACGGACTCCTGCAT-GA-CCCTCCGAACGTCGCCCCCGC-AAAGGGACGACACTCTCGAC Cucumis_thulinianus TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGTCGGGGG-CGGGGGGTGGGGG----AAAAGCATGCTCTCT-GCC-TGCCT-CCT-CCCCTCCC----TCCC-----GACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAACTCATCCCC---A-----TGCGGGATCTTTGT--GCAGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGAT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTTCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucumis_zeyheri TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AAAACAAACTGTCCGCGCCGGGGG-CGGGGGG----------AAAAGCATGCTCTCT-GCC-TGCCT-CCT---CCTCCC----TCCC-----GACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGAATTCGCCTGCCCCTTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAACTCATCCCCC--A-----CGCGGGATGTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Cucurbita_pepo TCGATGCCTAAA-CATCAAACGA--CCCGTGAA-CGTGTTTT-CAAACTTTTTGT--GTCGGGGGG-------------------AGCATTCG------------TGCCC-CCTC----T----------------GAT--GCCT-AAACCAAAA-TCGGCGCAAGTCGCGCCAAGGA-TTTCAAACGAATAAGCTTGCCCCTCGCCCCGGTCTCGGT-GTGCGGGGGGCAAAGCATTCTTGTCGTATTATTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGTTGCCCCC--------AC--ATACAAC--A-CCC----A--C--TTAGGTCTCGTTGC--ATTGGC-G----GGGGCACATGTTGGCCTCCCGTGCGCACTGTCGCACGGATGGCTTAAAATTGAGTCCTCGGCATCTGTTGTCGTGACACTACGGTGGTTGATTCAACCTCGGT-ACCGTGTCTCGATCTC-AGCT--TGCGTGCCTCCTCTTTGTGAGTGAGGGAGGAATCTTATGTTGA-CCCTTTGAACATTGTCCCC----AAAGGACGATGCTCTCGAC Dicaelospermum_richeti TCGATGCCTAA--CATCAAACGA--CCCGCGAAACGCGTTTA-CGAACAAACCGTCCGCGTCGGGGG-CGGGG--TGGGG---AAGCGGGCATGCTCTAT-GCC-TGCCTCCCT---CCTCCCCCCCTCCC-----GGCGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTCAAATGGATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GCGCGGGGGGTGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAACT---CCCCCCCACACCGTGCGGGGTCGTTGT--GCGGGC-G----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACGCTACGGTGGTTGATCCAACCTCGGTGAC-GCGTCCCGACCTCGAGCGTCCGCCTCC-------------------ACGGACTCTTGCAC-GA-CCCTCCGAACGCCGCCCCCGC-AAAGGGACGACACTCTCGAC Muellerargia_timorensis TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-CAAACAACC-GTGCGCGCAGGCG-ATGGGGGG--------------------------GCT-TGCCC-CCTCCC--TGCC-------------GACGCGTCT-AAACCAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCCGCCCCCTGCCCCGGCCTCGGC-GTGTGGGGGACGGAGCATTCTTGTCGTATTATTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAAC--A-CCCC---G-----TGTGGGATTGTTGT--GCGGGC-G-----GGGCACACGCTGGCCTCCCGTACGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGGCGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCATGTCTCGACTTCGACAT--CGCCTCA-------------------ACGGACTCCTACAC-GA-CCCTCCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Mukia_javanica TCGATGCCTAA--CATCAAACGA--CCCGCGAAACGCGTTTA-CAAACAAACCGTCCGCGTCGGGGG-CGGGG--TGGGG---AAGCGGGCATGCTCTAT-GCC-TGCCTGCCT---CCTCCCCCCCTCCC-----GGCGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTCAAATGGATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GCGCGGGGGGTGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAACT---CCCCCCCACACCGTGCGGGGTCGTTGT--GCGGGC-G----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACGCTACGGTGGTTGATCCAACCTCGGTGAC-GCGTCCCGACCTCGAGCGTACGCCT---------------------ACGGACTCTTGCAC-GATCCCTCCGAACGCCGCCCCCGC-AAAGGGACGACACTCTCGAC Mukia_maderaspatana TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-CGAACAAACCGTCCGCGTCGGGGG-CGGGG--TGGGG---AAGCGGGCATGCTCTAT-GCC-TGCCTGCCT---CCTCCCCCCCTCCC-----GGCGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTCAAATGGATTCGCCTGCCCCCTGCCCCGGCCTCGGC-GCGCGGGGGGTGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAACT---CCCCCCCACACCGTGCGGGGTCGTTGT--GCGGGC-G----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACGCTACGGTGGTTGATCCAACCTCGGTGAC-GCGTCCCGACCTCGACGT--CGCCTAC-------------------ACGGACTCTTGCAC-GA-CCCTCCGAACGCCGCCCCCG--AAAGGGACGACGCTCTCGAC Myrmecosicyos_messorius TCGATGCCTAAA-CATCAAACGA--CCCGCGAA-CGCGTTTA-AGAACAAACTGTCCGCGCCGGGGG-CGGGGGG----------AAAAGCATGCTCTCT-GCC-TGCCT-CCT---CCTCCC----TCCC-----GACGCGTCTTAAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAATTGGATTCGCCTGCCCCTTGCCCCGGCCTCGGC-GTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCC----------ACACAACT---CCCCCCC-CA---CGCGGGATGTTTGT--GCGGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGTGACCGCGTCTCGACCTCGACGT--CGCATCC-------------------ACGGACTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Oreosyce_africana_1 TCGATGCCTAAA-CATCAAACGAGCCCCGCGAA-CGCGTTTA-CAAACAATCTGTCTGCGTCGGGGGCCGGGGGG------------AACCGTGCTCTTC-GCC-TGCCT-CCTTCCCCTCCC-------------GAAGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGCCCCCTGCCCCGGTCTCGGC-GTGCGGGGGCCGGAGCATTCTTGTCGTATAACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCC-----------ACACAACCC-T--CCCC-A-----AGCGGGGTCGTCTT--GCTGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGGCGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCCCC-----------------ACGGGCTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC Oreosyce_africana_2 TCGATGCCTAAA-CATCAAACGAGCCCCGCGAA-CGCGTTTA-CTAACAATCTGTCCGCGTCGGGGGCCGGGGGG------------AACCGTGCTCTTC-GCC-TGCCT-CCTTCCCCTCCC-------------GAAGCGTCT-AAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCTGCCCCCTGCCCCGGTCTCGGC-GTGCGGGGGCCGGAGCATTCTTGTCGTATAACTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCC-----------ACACAACC-----CCCC-A-----AGCGGGGTCGTTGT--GCTGGC-A----GGGGCACACACTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCCCGGCGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGT-ACCGCGTCTCGACCTCGACGT--CGCATCCCC-----------------ACGGGCTCCTGCAC-GA-CCCTCCGAACGCCGCCCCC---AAAAGGACGACGCTCTCGAC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Cucumis_ITS) = N: 1-706; CODONPOSSET CodonPositions (CHARACTERS = Cucumis_ITS) = N: 1-706; END; BEGIN TREES; TITLE Tb8438; LINK TAXA = Taxa2; TRANSLATE 1 Oreosyce_africana_2, 2 Oreosyce_africana_1, 3 Myrmecosicyos_messorius, 4 Mukia_maderaspatana, 5 Mukia_javanica, 6 Dicaelospermum_richeti, 7 Cucumis_zeyheri, 8 Cucumis_thulinianus, 9 Cucumis_sativus_xishuangbannanesis, 10 Cucumis_sativus_hardwickii, 11 Cucumis_sativus, 12 Cucumis_sagittatus, 13 Cucumis_sacleuxii, 14 Cucumis_rostratus, 15 Cucumis_rigidus, 16 Cucumis_quintanilhae, 17 Cucumis_pustulatus, 18 Cucumis_pubituberculatus, 19 Cucumis_prophetarum, 20 Cucumis_myriocarpus, 21 Cucumis_metuliferus, 22 Cucumis_melo_melo, 23 Cucumis_melo_inodorus, 24 Cucumis_melo_cantaloupe, 25 Cucumis_melo_agrestis, 26 Cucumis_meeusei, 27 Cucumis_kalahariensis, 28 Cucumis_insignis, 29 Cucumis_hystrix, 30 Cucumis_humifructus, 31 Cucumis_hirsutus, 32 Cucumis_heptadactylus, 33 Cucumis_hastatus, 34 Cucumis_globosus, 35 Cucumis_ficifolius, 36 Cucumis_dipsaceus, 37 Cucumis_carolinus, 38 Cucumis_canoxyi, 39 Cucumis_baladensis, 40 Cucumis_anguria_anguria, 41 Cucumis_anguria, 42 Cucumis_africanus, 43 Cucumis_aculeatus, 44 Cucumella_kelleri, 45 Cucumella_cinerea, 46 Cucumella_bryoniifolia, 47 Cucumella_aspera, 48 Muellerargia_timorensis, 49 Citrullus_lanatus, 50 Cucurbita_pepo; TREE Fig._1b = [&R] (50,(49,48),((47,(2,1)),(46,45),44,((((42,3,7,16),32,20,27),(((41,40,36),17),28),39,15,38,37,35,8,26,18,13,(43,34),19,14,33),(((29,((11,10,9),(6,4))),5),(((25,24,23,22),21),12))),(31,30))); END; BEGIN TREES; TITLE Tb8437; LINK TAXA = Taxa1; TRANSLATE 1 Oreosyce_africana_2, 2 Oreosyce_africana_1, 3 Myrmecosicyos_messorius, 4 Mukia_javanica, 5 Mukia_maderaspatana, 6 Dicaelospermum_richeti, 7 Cucumis_zeyheri, 8 Cucumis_thulinianus, 9 Cucumis_sativus_xishuangbannanesis, 10 Cucumis_sativus_hardwickii, 11 Cucumis_sativus, 12 Cucumis_sagittatus, 13 Cucumis_sacleuxii, 14 Cucumis_rostratus, 15 Cucumis_rigidus, 16 Cucumis_quintanilhae, 17 Cucumis_pustulatus, 18 Cucumis_pubituberculatus, 19 Cucumis_prophetarum, 20 Cucumis_myriocarpus, 21 Cucumis_metuliferus, 22 Cucumis_melo_melo, 23 Cucumis_melo_inodorus, 24 Cucumis_melo_cantaloupe, 25 Cucumis_melo_agrestis, 26 Cucumis_meeusei, 27 Cucumis_kalahariensis, 28 Cucumis_insignis, 29 Cucumis_hystrix, 30 Cucumis_humifructus, 31 Cucumis_hirsutus, 32 Cucumis_heptadactylus, 33 Cucumis_hastatus, 34 Cucumis_globosus, 35 Cucumis_ficifolius, 36 Cucumis_dipsaceus, 37 Cucumis_carolinus, 38 Cucumis_canoxyi, 39 Cucumis_baladensis, 40 Cucumis_anguria_anguria, 41 Cucumis_anguria, 42 Cucumis_africanus, 43 Cucumis_aculeatus, 44 Cucumella_kelleri, 45 Cucumella_cinerea, 46 Cucumella_bryoniifolia, 47 Cucumella_aspera, 48 Muellerargia_timorensis, 49 Citrullus_lanatus, 50 Cucurbita_pepo; TREE Fig._1a = [&R] ((50,49),48,(((((47,(2,1)),46),(45,44)),(((((((42,16,7,3),(32,20),27),((41,40),(36,17),28),(39,15),38,(37,(35,8),26),18,13),(43,19)),34),((33,((29,(11,10,9)),(6,4,5))),((25,24,23,22),12))),(21,14))),(31,30))); END; BEGIN TREES; TITLE Tb8439; LINK TAXA = Taxa1; TRANSLATE 1 Oreosyce_africana_2, 2 Oreosyce_africana_1, 3 Myrmecosicyos_messorius, 4 Mukia_javanica, 5 Mukia_maderaspatana, 6 Dicaelospermum_richeti, 7 Cucumis_zeyheri, 8 Cucumis_thulinianus, 9 Cucumis_sativus_xishuangbannanesis, 10 Cucumis_sativus_hardwickii, 11 Cucumis_sativus, 12 Cucumis_sagittatus, 13 Cucumis_sacleuxii, 14 Cucumis_rostratus, 15 Cucumis_rigidus, 16 Cucumis_quintanilhae, 17 Cucumis_pustulatus, 18 Cucumis_pubituberculatus, 19 Cucumis_prophetarum, 20 Cucumis_myriocarpus, 21 Cucumis_metuliferus, 22 Cucumis_melo_melo, 23 Cucumis_melo_inodorus, 24 Cucumis_melo_cantaloupe, 25 Cucumis_melo_agrestis, 26 Cucumis_meeusei, 27 Cucumis_kalahariensis, 28 Cucumis_insignis, 29 Cucumis_hystrix, 30 Cucumis_humifructus, 31 Cucumis_hirsutus, 32 Cucumis_heptadactylus, 33 Cucumis_hastatus, 34 Cucumis_globosus, 35 Cucumis_ficifolius, 36 Cucumis_dipsaceus, 37 Cucumis_carolinus, 38 Cucumis_canoxyi, 39 Cucumis_baladensis, 40 Cucumis_anguria_anguria, 41 Cucumis_anguria, 42 Cucumis_africanus, 43 Cucumis_aculeatus, 44 Cucumella_kelleri, 45 Cucumella_cinerea, 46 Cucumella_bryoniifolia, 47 Cucumella_aspera, 48 Muellerargia_timorensis, 49 Citrullus_lanatus, 50 Cucurbita_pepo; TREE Fig._2 = [&R] ((50,49),48,(((((47,(2,1)),46),(45,44)),((((((43,19),((((42,16),32,20,(7,3)),27),((41,40),36,28,17),(39,15),38,37,(35,8),26,18,13)),34),33),14),((((29,(11,10,9)),((6,4),5)),((25,24,23,22),12)),21))),(31,30))); END;