#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 11:07 GMT TreeBASE (cc) 1994-2008 Study reference: Kwon O., Kim Y., & Lee C. 2015. Taxonomic position and the species identity of the cultivated Yeongji "Ganoderma lucidum" in Korea. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S18237] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=62; TAXLABELS Ganoderma_lingzhi_China_Cui6982 Ganoderma_lingzhi_China_Cui9164 Ganoderma_lingzhi_China_Dai12438 'Ganoderma lingzhi China Wu 1006-38' Ganoderma_lucidum__Canada_ATCC46755 Ganoderma_lucidum__Finland_Dai_11593 Ganoderma_lucidum__Japan_KACC51690 'Ganoderma lucidum Korea ASI-7094' 'Ganoderma lucidum Korea IUM-0047' 'Ganoderma lucidum Korea ASI-7074' 'Ganoderma lucidum Korea ASI-7091' 'Ganoderma lucidum Korea ASI-7135' 'Ganoderma lucidum Korea IUM-0938' 'Ganoderma lucidum Korea IUM-3986' 'Ganoderma lucidum Korea IUM-4002' 'Ganoderma lucidum Korea IUM-4100' 'Ganoderma lucidum Korea KU-4035' Ganoderma_lucidum__Sweden_Dai_2272 Ganoderma_lucidum__U.K_HMAS86597 'Ganoderma lucidum Bangladesh IUM-4304' 'Ganoderma lucidum France Gl-1-3' Ganoderma_lucidum_Italy_Glu1 Ganoderma_lucidum_Japan_KACC42232 Ganoderma_lucidum_Japan_KACC51689 'Ganoderma lucidum Korea ASI-7004' 'Ganoderma lucidum Korea ASI-7013' 'Ganoderma lucidum Korea ASI-7071' 'Ganoderma lucidum Korea IUM-0757' 'Ganoderma lucidum Korea IUM-4537' Ganoderma_meredithae_U.S.A_ATCC64492 'Ganoderma meredithae unknown ASI-7140' Ganoderma_multipileum_China_BCRC37033 Ganoderma_multipileum_China_HMAS242384 Ganoderma_resinaceum__U.K_CBS152.27 'Ganoderma resinaceum Czech IUM-3651' Ganoderma_resinaceum_U.K_HMAS86599 Ganoderma_sichuanense__China_HMAS130131 Ganoderma_sichuanense__China_HMAS240176 Ganoderma_sichuanense__China_HMAS240178 Ganoderma_sichuanense__China_HMAS250677 Ganoderma_sichuanense__China_HMAS251146 Ganoderma_sichuanense__China_HMAS99391 Ganoderma_sichuanense_China_HMAS130128 Ganoderma_sichuanense_China_HMAS240175 Ganoderma_sichuanense_China_HMAS240177 Ganoderma_sichuanense_China_HMAS240187 Ganoderma_sichuanense_China_HMAS250672 Ganoderma_sichuanense_China_HMAS251145 Ganoderma_sichuanense_China_HMAS251147 Ganoderma_sichuanense_China_HMAS251148 Ganoderma_sichuanense_China_HMAS60537 Ganoderma_sichuanense_China_HMAS62503 Ganoderma_sichuanense_China_HMAS76566 Ganoderma_tropicum_China_HMAS263143 'Ganoderma tropicum Taiwan Wu 0407-2' Ganoderma_tsugae_Canada_ATCC64795 'Ganoderma tsugae U.S.A ASI-7064' Ganoderma_weberianum__China_HMAS97365 Ganoderma_weberianum_Australia_SUT_H2 Ganoderma_weberianum_Philippines_CBS219.36 Tomophagus_colossus_Philippines_CGMCC5.763 Tomophagus_colossus_Vietnam_HCMC_10 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M33780] TITLE Ganoderma_ITS_sequence; LINK TAXA = Taxa1; DIMENSIONS NCHAR=559; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ganoderma_lingzhi_China_Cui6982 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_lingzhi_China_Cui9164 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCCTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_lingzhi_China_Dai12438 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lingzhi China Wu 1006-38' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCCTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_lucidum__Canada_ATCC46755 TCGAGTTCTGACTGGGTTGTAGCTGGCCTTCCGAGGCACGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGAT-CTGTGAAGCGTG-CTCCTTGCGGGGCTTC--GTGAAGCGCGTCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCCTTTGCGGGTTT-GTAGGCTTGGACTT-GGAGGCTTGTCGGCCCTTTGTCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTCGCTTGAAGACAGCTTTA Ganoderma_lucidum__Finland_Dai_11593 TCGAGTTCTGACTGGGTTGTAGCTGGCCTTCCGAGGCACGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGAT-CTGTGAAGCGTG-CCCCTTGCGGGGCTTC--GTGAAGCGCGTCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCCTTTGCGG-TTT-GTAGGCTTGGACTT-GGAGGCTTGTCGGCCCTTTGTCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTCGCTTGAAGACAGCTTTA Ganoderma_lucidum__Japan_KACC51690 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea ASI-7094' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea IUM-0047' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCAAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea ASI-7074' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCCTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTCGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea ASI-7091' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGTTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATTGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea ASI-7135' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea IUM-0938' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCGTATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGTGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea IUM-3986' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCTGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTCTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea IUM-4002' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCCGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea IUM-4100' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGTGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea KU-4035' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGTGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_lucidum__Sweden_Dai_2272 TCGAGTTCTGACTGGGTTGTAGCTGGCCTTCCGAGGCACGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGAT-CTGTGAAGCGTG-CCCCTTGCGGGGCTTC--GTGAAGCGCGTCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCCTTTGCGG-TTT-GTAGGCTTGGACTT-GGAGGCTTGTCGGCCCTTTGTCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTCGCTTGAAGACAGCTTTA Ganoderma_lucidum__U.K_HMAS86597 TCGAGTTCTGACTGGGTTGTAGCTGGCCTTCCGAGGCACGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGAT-CTGTGAAGCGTG-CCCCTTGCGGGGCTTC--GTGAAGCGCGTCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCCTTTGCGG-TTT-GTAGGCTTGGACTT-GGAGGCTTGTCGGCC{CG}TTTGTCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTCGCTTGAAGACAGCTTTA 'Ganoderma lucidum Bangladesh IUM-4304' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCCTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum France Gl-1-3' TCGAGTTCTGACTGGGTTGTAGCTGGCCTTCCGAGGCACGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGAT-CTGTGAAGCGTG-CTCCTTGCGGGGCTTC--GTGAAGCGCGTCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCCTT-GCGG-TTT-GTAGGCTTGGACTT-GGAGGCTTGTCGGCCCTTTGTCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTCGCTTGAAGACAGCTTTA Ganoderma_lucidum_Italy_Glu1 TCGAGTTCTGACTGGGTTGTAGCTGGCCTTCCGAGGCACGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGAT-CTGTGAAGCGTG-CCCCTTGCGGGGCTTC--GTGAAGCGCGTCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCCTTTGCGG-TTT-GTAGGCTTGGACTT-GGAGGCTTGTCGGCCCTTTGTCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTCGCTTGAAGACAGCTTTA Ganoderma_lucidum_Japan_KACC42232 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_lucidum_Japan_KACC51689 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea ASI-7004' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGTTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCCCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATTGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea ASI-7013' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea ASI-7071' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGTGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea IUM-0757' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCGTATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGTGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGCCTTAT----AAGACAGCTTTA 'Ganoderma lucidum Korea IUM-4537' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGTTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTC---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATTGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_meredithae_U.S.A_ATCC64492 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TCGCGAGGCAGG-CTCTTTACCGGGCTT---GCGGAGCGCATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATTGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTTTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGTGTTT-GGCGAGCTTCTAACCGTCTTAT----A-GACAGCTTTA 'Ganoderma meredithae unknown ASI-7140' TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TCGCGAGGCAGT-CTCTTTACCGGGCTT---GCGGAGCGCATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATTGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTTTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----A-GACAGCTTTA Ganoderma_multipileum_China_BCRC37033 TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TCGTAAAACGGGTCCCTTTACCGGGCTT---GCGGAGCGTGTCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTGCAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TGTCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCAGTGTGATAAT-GTCTACGCTGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTCAGTTG-GAGACAACTTTA Ganoderma_multipileum_China_HMAS242384 TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TCGTAAAACGGGTCCCTTTACCGGGCTT---GCGGAGCGTGTCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTGCAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TCTTGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCAGTGTGATAAT-GTCTACGCTGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAGTTG-GAGACAACTTTA Ganoderma_resinaceum__U.K_CBS152.27 TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTCCAGACGTTGTGAAGCGGG-CTCTTTACGGGGCTTGTAAAGCGGCGTGCCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACTTACAGACCTTTGCGGGTTT-GTAGGCTTGGACTTTGGAGGCTTGTCGGCCGTGTTTCGGTCGGCTCCTCTTAAATGTATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACCCGTGAAGCGTTTTGGCGAGCTTCTAACCGTCTCGTTTGTGAGACAGCTTTA 'Ganoderma resinaceum Czech IUM-3651' TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTCCAGACGTTGTGAAGCGGG-CTCTTTACGGGGCTTGTAAAGCGGCGTGCCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGCAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACTTACAGACCTTTGCGGGTTT-GTAGGCTTGGACTTTGGAGGCTTGTCGGCCGTGTTTCGGTCGGCTCCTCTTAAATGTATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACCCGTGAAGCGTTTTGGCGAGCTTCTAACCGTCTCGTTTGTGAGACAGCTTTA Ganoderma_resinaceum_U.K_HMAS86599 TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTCCAGACGTTGTGAAGCGGG-CTCTTTACGGGGCTTGTAAAGCGGCGTGCCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACTTACAGACCTTTGCGGGTTT-GTAGGCTTGGACTTTGGAGGCTTGTCGGCCGTGTCTCGGTCGGCTCCTCTTAAATGTATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACCCGTGAAGCGTTTTGGCGAGCTTCTAACCGTCTCGTTTGTGAGACAGCTTTA Ganoderma_sichuanense__China_HMAS130131 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense__China_HMAS240176 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGTGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense__China_HMAS240178 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGTTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense__China_HMAS250677 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense__China_HMAS251146 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCCTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense__China_HMAS99391 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense_China_HMAS130128 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGTGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense_China_HMAS240175 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCCTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense_China_HMAS240177 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGTGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense_China_HMAS240187 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCGTATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGTGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense_China_HMAS250672 TCGAGTTTTGACCGGCTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense_China_HMAS251145 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAC-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense_China_HMAS251147 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCCTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense_China_HMAS251148 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense_China_HMAS60537 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense_China_HMAS62503 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCTGAGGCATGTGCACGCCCTGTTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_sichuanense_China_HMAS76566 TCGAGTTTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGTTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TTGCGAGGCACG-CTCTTTACCGGGCTT---GCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTT--GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGTGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTAT----AAGACAGCTTTA Ganoderma_tropicum_China_HMAS263143 TCGAGTCTTGACCGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TCGTAAAGCAGGGCCCTTCACCGGGCTTT--GCAGGACGTGTCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATCAGAATGTGTATTGCGATGTAACGCACCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCATCAACCTACAAGCCTTTGCGGTTTT-GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TCTTGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCAAGCTTCTAACAGTCTCAGTTG-GAGACAGCTTTA 'Ganoderma tropicum Taiwan Wu 0407-2' TCGAGTCTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGA--TCGTAAAGCAGGGCCCTTCACCGGGCTTT--GCAGGACGTGTCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCATCAACCTACAAGCCTTTGCGGTTTT-GTAGGCTTGGACTT-GGAGGCTTGTCGGCCGT-TCTTGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCAAGCTTCTAACAGTCTCAGTTG-GAGACAGCTTTA Ganoderma_tsugae_Canada_ATCC64795 TCGAGTTCTGACTGGGTTGTAGCTGGCCTTCCGAGGCACGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGAT-CTGTGAAGCGTG-CTCCTTGCGGGGCTTC--GTGAAGCGCGTCTGTGCCTGCGTGTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGATATCTTCAACCTACAAGCCTTTGCGGGTTT-GCAGGCTTGGACTT-GGAGGCTTGTCGGCCCTTTGTCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GCGAAGCGTTT-GGCGAGCTTCTAACCGTCTTCGCTTGAGGACAGCTTTA 'Ganoderma tsugae U.S.A ASI-7064' TCGAGTTCTGACTGGGTTGTAGCTGGCCTTCCGAGGCACGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGAT-CTGTGAAGCGTG-CTCCTTGCGGGGCTTC--GTGAAGCGCGTCTGTGCCTGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCCTTTGCGGGTTT-GTAGGCTTGGACTT-GGAGGCTTGTCGGCCCTTTGTCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTT-GGCGAGCTTCTAACCGTCTTCGCTTGAAGACAGCTTTA Ganoderma_weberianum__China_HMAS97365 TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAAACGTCGTAAAGCGGGTCTCTTCACCGAGCTTGTAGAGCGGCGT--CTGTGCCTGCGTTTATCACAAACTCTATAAAGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTCGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACTTACGGACCTTTGCGGGTTTTGTAGGCTTGGACTT-GGAGGCTTGTCGGTCGTGTTTCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-ATGAAGCGTTTTGGCGAGCTTCTAACCGTCCT-TGTCTGGGACAACTTTA Ganoderma_weberianum_Australia_SUT_H2 TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAAACGTCGTAAAGCGGGTCTCTTCACCGAGCTTGTAGAGCGGCGT--CTGTGCCTGCGTTTATCACAAACTCTATAAAGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACTTACAGACCTTTGCGGGTTTTGTAGGCTTGGACTT-GGAGGCTTGTCGGCCGTGTTTCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTTTGGCGAGCTTCTAACCGTCCT-TGTTTGG-ACAAATTTA Ganoderma_weberianum_Philippines_CBS219.36 TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAAACGTCGTAAAGCGAGTCTCTTTACCGAGCTTGTAGAGCGGCGT--CTGTGCCTGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACTTACGGACCTTTGCGGGTTTTGTAGGCTTGGACTT-GGAGGCTTGTCGGCCGTGTTTCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAAT-GTCTACGCCGCGACC-GTGAAGCGTTTTGGCGAGCTTCTAACCGTCCT-TGTTTGG-ACAAATTTA Tomophagus_colossus_Philippines_CGMCC5.763 TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGA--TCGCAGAGCAAG--TCTTCTATAGGCTT---GTGAACCGC--CTGGACCTGCGTTTATTACAAATACTATAAAGTACTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCCTTTGCGGGTTTGTTAGGCTTGGTTAT-GGAGGTTTGTCGGCCTT---GCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTTCTTGCGAATCGGCTCTCGGTGTGATAGTTGTCTATGCCGCGACC-GTGAAGCGTTT-GGCAAGCTTCTAACCGTCTCAT--GAGAGACAGCTTCT Tomophagus_colossus_Vietnam_HCMC_10 TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGA--TCGCAGAGCAAG--TCTTCTATAGGCTT---GTGAACCGC--CTGGACCTGCGTTTATTACAAATACTATAAAGTACTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAAATCTTCAACCTACAAGCCTTTGCGGGTTTGTTAGGCTTGGTTAT-GGAGGTTTGTCGGCCTT---GCGGTCGGCTCCTCTTAAATGCATTAGCTTGATTTCTTGCGAATCGGCTCTCGGTGTGATAGTTGTCTACGCCGCGACC-GTGAAGCGTTT-GGCAAGCTTCTAACCGTCTCAT--GAGAGACAGCTTCT ; END; BEGIN TREES; TITLE Ganoderma_ITS_NJ_tree; LINK TAXA = Taxa1; TRANSLATE 1 Ganoderma_lingzhi_China_Cui6982, 2 Ganoderma_lingzhi_China_Cui9164, 3 Ganoderma_lingzhi_China_Dai12438, 4 'Ganoderma lingzhi China Wu 1006-38', 5 'Ganoderma lucidum Bangladesh IUM-4304', 6 Ganoderma_lucidum__Canada_ATCC46755, 7 Ganoderma_lucidum__Finland_Dai_11593, 8 'Ganoderma lucidum France Gl-1-3', 9 Ganoderma_lucidum_Italy_Glu1, 10 Ganoderma_lucidum_Japan_KACC42232, 11 Ganoderma_lucidum_Japan_KACC51689, 12 Ganoderma_lucidum__Japan_KACC51690, 13 'Ganoderma lucidum Korea ASI-7004', 14 'Ganoderma lucidum Korea ASI-7013', 15 'Ganoderma lucidum Korea ASI-7071', 16 'Ganoderma lucidum Korea ASI-7074', 17 'Ganoderma lucidum Korea ASI-7091', 18 'Ganoderma lucidum Korea ASI-7094', 19 'Ganoderma lucidum Korea ASI-7135', 20 'Ganoderma lucidum Korea IUM-0047', 21 'Ganoderma lucidum Korea IUM-0757', 22 'Ganoderma lucidum Korea IUM-0938', 23 'Ganoderma lucidum Korea IUM-3986', 24 'Ganoderma lucidum Korea IUM-4002', 25 'Ganoderma lucidum Korea IUM-4100', 26 'Ganoderma lucidum Korea IUM-4537', 27 'Ganoderma lucidum Korea KU-4035', 28 Ganoderma_lucidum__Sweden_Dai_2272, 29 Ganoderma_lucidum__U.K_HMAS86597, 30 Ganoderma_meredithae_U.S.A_ATCC64492, 31 'Ganoderma meredithae unknown ASI-7140', 32 Ganoderma_multipileum_China_BCRC37033, 33 Ganoderma_multipileum_China_HMAS242384, 34 'Ganoderma resinaceum Czech IUM-3651', 35 Ganoderma_resinaceum__U.K_CBS152.27, 36 Ganoderma_resinaceum_U.K_HMAS86599, 37 Ganoderma_sichuanense_China_HMAS130128, 38 Ganoderma_sichuanense__China_HMAS130131, 39 Ganoderma_sichuanense_China_HMAS240175, 40 Ganoderma_sichuanense__China_HMAS240176, 41 Ganoderma_sichuanense_China_HMAS240177, 42 Ganoderma_sichuanense__China_HMAS240178, 43 Ganoderma_sichuanense_China_HMAS240187, 44 Ganoderma_sichuanense_China_HMAS250672, 45 Ganoderma_sichuanense__China_HMAS250677, 46 Ganoderma_sichuanense_China_HMAS251145, 47 Ganoderma_sichuanense__China_HMAS251146, 48 Ganoderma_sichuanense_China_HMAS251147, 49 Ganoderma_sichuanense_China_HMAS251148, 50 Ganoderma_sichuanense_China_HMAS60537, 51 Ganoderma_sichuanense_China_HMAS62503, 52 Ganoderma_sichuanense_China_HMAS76566, 53 Ganoderma_sichuanense__China_HMAS99391, 54 Ganoderma_tropicum_China_HMAS263143, 55 'Ganoderma tropicum Taiwan Wu 0407-2', 56 Ganoderma_tsugae_Canada_ATCC64795, 57 'Ganoderma tsugae U.S.A ASI-7064', 58 Ganoderma_weberianum_Australia_SUT_H2, 59 Ganoderma_weberianum__China_HMAS97365, 60 Ganoderma_weberianum_Philippines_CBS219.36, 61 Tomophagus_colossus_Philippines_CGMCC5.763, 62 Tomophagus_colossus_Vietnam_HCMC_10; TREE Fig._2 = [&R] ((61,62),(((58,60,59),(35,36,34)),(6,8,9,7,28,29,56,57),(54,55),(32,33),((30,31),(20,21,22,23,24,25,26,13,14,15,16,17,18,27,19,5,10,11,12,50,51,52,53,37,38,39,40,41,42,43,44,45,46,47,48,49,2,1,3,4)))); END;