#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 18:08 GMT TreeBASE (cc) 1994-2008 Study reference: Zomlefer W., Whitten W., Williams N., & Judd W. 2006. Infrageneric phylogeny of Schoenocaulon (Liliales: Melanthiaceae) with clarification of cryptic species based on ITS sequence data and geographical distribution. American Journal of Botany, 93: 1178-1192. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1827] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=74; TAXLABELS Amianthium_muscitoxicum Anticlea_elegans Schoenocaulon_calcicola Schoenocaulon_caricifolium_caricifolium_z252 Schoenocaulon_caricifolium_caricifolium_z253 Schoenocaulon_caricifolium_oaxacense_z237 Schoenocaulon_caricifolium_oaxacense_z242 Schoenocaulon_comatum_OK_z222 Schoenocaulon_comatum_OK_z254 Schoenocaulon_comatum_OK_z257 Schoenocaulon_comatum_SP_NOV_z199 Schoenocaulon_comatum_SP_NOV_z200 Schoenocaulon_comatum_SP_NOV_z248 Schoenocaulon_conzattii Schoenocaulon_dubium_z10 Schoenocaulon_dubium_z267 Schoenocaulon_gheisbrechtii_YUC_z238 Schoenocaulon_gheisbrechtii_YUC_z241 Schoenocaulon_gheisbrechtii_YUC_z244 Schoenocaulon_gheisbrechtii_YUC_z249 Schoenocaulon_ghiesbrechtii_OK_z133 Schoenocaulon_ghiesbrechtii_OK_z201 Schoenocaulon_ghiesbrechtii_OK_z202 Schoenocaulon_ghiesbrechtii_OK_z203 Schoenocaulon_ghiesbrechtii_OK_z204 Schoenocaulon_ghiesbrechtii_YUC_z132 Schoenocaulon_ghiesbrechtii_YUC_z134 Schoenocaulon_ghiesbrechtii_YUC_z223 Schoenocaulon_ghiesbrechtii_YUC_z265 Schoenocaulon_ignigenum_z205 Schoenocaulon_ignigenum_z240 Schoenocaulon_intermedium_z245 Schoenocaulon_jaliscence_jalicense_z224 Schoenocaulon_jaliscence_regulare_z206 Schoenocaulon_macrocarpum_z141 Schoenocaulon_macrocarpum_z207 Schoenocaulon_macrocarpum_z225 Schoenocaulon_madidorum_z226 Schoenocaulon_megarrhizum_deminutum_z260 Schoenocaulon_megarrhizum_mega_z208 Schoenocaulon_megarrhizum_mega_z209 Schoenocaulon_mortonii_OK_z263 Schoenocaulon_mortonii_SP_NOV_z227 Schoenocaulon_mortonii_SP_NOV_z262 Schoenocaulon_mortonii_z135 Schoenocaulon_mortonii_z136 Schoenocaulon_obtusum_z211 Schoenocaulon_obtusum_z228 Schoenocaulon_officinale_z137 Schoenocaulon_officinale_z138 Schoenocaulon_officinale_z139 Schoenocaulon_officinale_z140 Schoenocaulon_officinale_z229 Schoenocaulon_officinale_z250 Schoenocaulon_officinale_z251 Schoenocaulon_pellucidum_z142 Schoenocaulon_pellucidum_z143 Schoenocaulon_plumosum_z230 Schoenocaulon_pringlei_z231 Schoenocaulon_pringlei_z239 Schoenocaulon_rzwedowskii Schoenocaulon_tenorioi Schoenocaulon_tenue Schoenocaulon_tenufolium Schoenocaulon_texanum_z234 Schoenocaulon_texanum_z235 Schoenocaulon_texanum_z236 Schoenocaulon_texanum_z255 Schoenocaulon_texanum_z67 Schoenocaulon_tigrense_z247 Stenanthium_densum Toxicoscordion_nuttallii Veratrum_viride Zigadenus_glaberrimus ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1936] TITLE Schoeno_ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=716; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Amianthium_muscitoxicum GGATCATTGTCGAGACCCT-AACA----CTAATGAATGACCT-----GTGAA-CTTGTTAATGA--ATGTGACAA-CTTGTGCCATCGTGTCGATGTCGTTGCGA-ATGATTCGTGAT--TGTGTCAACAT-TTTTGTGCAAGTCGGAACAA--CAAT--GTACTCCGGCACAACCTT-GTGTCAAGGACGAA------TAAACTACCAAAAATGATTATGCCCT--TCCTCT-AGCATATTTGCTTTTGAGATTTG--GGTG--CATCGTCATCTTGTGAAGAAATTGGATGACTCTCGACAATGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAACCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGATGCCTTTCGGTGGAAGGTACATCTGCCTGTGTGTCATGTTTTGTGTTTGCTCTCTCTGCCTCTTGTGCCCAACTCTT--TT--GGGA-TACT---AGGGGTATTGGATGCAAAGTTTGGCCCCTCGTGCCCAT-GTGCGCGTTGGGCCAAAGATTGGGTTGTCGGCATGGTAGAGTATAGC--TAATGGTTGATGCTTTG-T-TGCATATAT---GCT-GATTGTTGTGCTCTTAATGCCCAAGAAGCATTGGA---TGA-CCCTTGAGACCTAATTTGTGATCGTCGTGCCTTGCTCGACGCC Anticlea_elegans GGATCATTGCTGAGACCCC-AACT----CTAACGAATGACCT-----GTGAA-CATGTGAATGA--ATGTGACAA-CTTGTGCCATCGTGTTGATGTCGTTGCGG-GTGATCCGTGAT--CGTGTCAACAA-GTTGGTGCGGGTCGGAACAC--CAAC--GAACCCCGGCACAACCTT-GTGTCAAGGACGAA------TAAACTACCAAAGATGATAATGCCCT--TTCCTTGAGCGCC---ACGTTCGAGATTTG--GGTG--CATCGTCATGTTGTGAAGAA-TTGGATGACTCTCGACAACGGATATCTGGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAACCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGATGCCATTTGGTGGAGGGCACATCTGCCTGTGTGTCACGTTTCGTGTTTGCTCTTC--GCCTCTTGTGCCCAGCTCCG--CT--GGGA-TGCT---AGAGGTGTCTGACGCAAAGTTTGGCCCCTCGTGCCGTTGTTGCACGTTGGGCTGAAGATTGGGTTGTCGGCATGGAAGAGCATAGC--TAATGGTTGATGCCTTG-TCCGCGTGTAT---ACT-GATTGCTATGCTCTCATTGCCCAAG---CATTGGA---TGA-CCCTTGAGACCCAAATTGCGACCGTCGTGCCTTGCTCGACGCC Schoenocaulon_calcicola ????????????????????????????????????????????????TGAA-CATGTGAAAGA--ATGTGACAA-CTCGTTCCATCGTGTTGATGCCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTCGGTGCGGGTCGGAACACATCAAC--GAACTCCGGCACGGCCGT-GTGTCAAGGACAAATTTTTTTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTTT-TGTG--CGTCGTCATGTTGCGATGAA-CTTGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTT--GCCTCTTGTGCCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTATTTGATTGTCGTGCTCTCATTCCCCAAG---CATTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_caricifolium_caricifolium_z252 GGATCATTGCTAAGGCGCC-GACACA--CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAA----TTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_caricifolium_caricifolium_z253 GGATCATTGCCAAGGCGCC-GACACA--CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAA----TTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_caricifolium_oaxacense_z237 GGATCACTGCTAAGGCCCC-AACA----CTAACGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CTCGTTCCATCGTGTTGATGCCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTCGGTGCGGGTCGGAACACATCAAC--GAACTCCGGCACGGCCGT-GTGTCAAGGACAAA-TTTTTTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTTT-TGTG--CGTCGTCATGCTGCGATGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTT--GCCTCTTGTGCCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTATTTGATTGTCGTGCTCTCATTCCCCAAG---CATTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_caricifolium_oaxacense_z242 GGATCACTGCTAAGGCCCC-AACA----CTAACGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CTCGTTCCATCGTGTTGATGCCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTCGGTGCGGGTCGGAACACATCAAC--GAACTCCGGCACGGCCGT-GTGTCAAGGACAAA-TTTTTTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTTT-TGTG--CGTCGTCATGTTGCGATGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTT--GCCTCTTGTGCCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTATTTGATTGTCGTGCTCTCATTCCCCAAG---CATTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_comatum_OK_z222 GGATCATTGCTAAGGCCCC-AACACCAA----CGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CCTGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAAAAA----AAATTTACCAAAAATGACGTCGTTAT-TTTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGATTCTTTGAACGCAAGTTGTGCCTGAAGCCTTTTGGCGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTT--GCCTCTTGTGCCTAGATCTT--TTGGGCGA-TGTT---GGAGGTGTTGGATGTGAAGTTTGGTCCCTTGTGCCTTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTTTGATTGCTGTGCTCTCATTCCCCAAG---CATTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTGGGCGCC Schoenocaulon_comatum_OK_z254 GGATCATTGCTAAGGCCCC-AACACCAA----CGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CCTGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAAAAA----AAATTTACCAAAAATGACGTCGTTAT-TTTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGATTCTTTGAACGCAAGTTGTGCCTGAAGCCTTTTGGCGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTT--GCCTCTTGTGCCTAGATCTT--TTGGGCGA-TGTT---GGAGGTGTTGGATGTGAAGTTTGGTCCCTTGTGCCTTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTTTGATTGCTGTGCTCTCATTCCCCAAG---CATTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTGGGCGCC Schoenocaulon_comatum_OK_z257 GGATCATTGCTAAGGCCCC-AACACCAA----CGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CCTGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAAAAA----AAATTTACCAAAAATGACGTCGTTAT-TTTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGATTCTTTGAACGCAAGTTGTGCCTGAAGCCTTTTGGCGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTT--GCCTCTTGTGCCTAGATCTT--TTGGGCGA-TGTT---GGAGGTGTTGGATGTGAAGTTTGGTCCCTTGTGCCTTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTTTGATTGCTGTGCTCTCATTCCCCAAG---CATTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTGGGCGCC Schoenocaulon_comatum_SP_NOV_z199 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACA{AG}-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACTCCGGCACGGCCGT-GTGTCAAGGACAAAATTTTTTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTTT-TGTG--CGTCGTCATGTTGCGATGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCA??????????????????AAATGTGA-ACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAAGCCATTTAGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTT--GCCTCTTGTGCCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTATTTGATTGTTGTGCTCTCATTCCCCAAG---CATTGGA---TGA-CCCTTGAGACCCAAATTGTGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_comatum_SP_NOV_z200 GGATCACCGCTAAGGCCCC-AACA----CTAACGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACTCCGGCACGGCCGT-GTGTCAAGGACAAAATTTTTTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTTT-TGTG--CGTCGTCATGTTGCGATGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCA??????????????????AAATGTGA-ACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAAGCCATTT{AG}GTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTT--GCCTCTTGTGCCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTATTTGATTGTTGTGCTCTCATTCCCCAAG---CATTGGA---TGA--CCTTGAGACCCAAATTGTGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_comatum_SP_NOV_z248 GGATCACCGCTAAGGCCCC-AACA----CTAACGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACTCCGGCACGGCCGT-GTGTCAAGGACAAAATTTTTTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTTT-TGTG--CGTCGTCATGTTGCGATGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGA-ACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTT--GCCTCTTGTGCCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTATTTGATTGTTGTGCTCTCATTCCCCAAG---CATTGGA---TGA-CCCTTGAGACCCAAATTGTGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_conzattii GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACT---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_dubium_z10 GGATCATTGCTAAGGCCCC-AACACCAA----CGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAAACCTGTTCCATCGTGTTA---------CG-ATGGCG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCA----GAACCCCGGCACGTCCTT-GTGCCAAGGACAAAAA----AATTTTACCAGAGATGACGTCGTTATTTTTTCTTGAGAACC---GCCTCCGAGATTTT--GGTA--CGTCGTCATGCTGCGAAGAA-TTTCATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAGCCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTGGCTCTTC--GCCTCTTGTGCCTAGATCTA--TT-GGGGA-TAAT---GGAGG-GTTGGATGCGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGGACAGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAGG--GCATCGGA---TGA-CCCTTGAGACCCAAGTTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_dubium_z267 GGATTATTGCTAAGGCCCC-AACACCAA----CGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAAACCTGTTCCATCGTGTTA---------CGGATGGCG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCA----GAACCCCGGCACGTCCCTTGTGCCAAGGACAAAAA----AATTTTACCAGAGATGACGTCGTTAT-TTTTCTTGAGAACC---GCCTCCGAGATTTT--GGTA--CGTCGTCATGCTGCGAAGAA-TTTCATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAGCCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTGGCTCTTC--GCCTCTTGTGCCTAGATCTA--TT-GGGGA-TAAT---GGAGGTGTTGGATGCGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGGACAGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAGG--GCATCGGA---TGA-CCCTTGAGACCCAAGTTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_gheisbrechtii_YUC_z238 GGATCATTGCTGAGGCCCC-GACACCAACTA-CGATTGACCC-----GTGAA-CATGTGACATTGGATGTGAAAA-CCTGTTCCACCGTGTTGATGTCGTTGCGGATGGTGGCATGATATTGCGTCAACAACGTTGGTGCGGGTCGGAACACATCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAACGA---TAAATTTACCAGGAATGACGTCGTTAA-TTTTCTTGAGAACC---GCGTCCGAGAATTT--GTTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTAT--GCCTCTTGTGCCTAGATCTA--CT-GGGGA-TAAT---GGAGGTGTTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATCGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCCTGAGACCCAAATAGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_gheisbrechtii_YUC_z241 GGATCATTGCTGAGGCCCC-GACACCAACTA-CGATTGACCC-----GTGAA-CATGTGACATTGGATGTGAAAA-CCTGTTCCACCGTGTTGATGTCGTTGCGGATGGTGGCATGATATTGCGTCAACAACGTTGGTGCGGGTCGGAACACATCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAACGA---TAAATTTACCAGGAATGACGTCGTTAA-TTTTCTTGAGAACC---GCGTCCGAGAATTT--GTTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTAT--GCCTCTTGTGCCTAGATCTA--CT-GGGGA-TAAT---GGAGGTGTTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATCGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCCTGAGACCCAAATAGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_gheisbrechtii_YUC_z244 GGATCATTGCTGAGGCCCC-GACACCAACTA-CGATTGACCC-----GTGAA-CATGTGACATTGGATGTGAAAA-CCTGTTCCACCGTGTTGATGTCGTTGCGGATGGTGGCATGATATTGCGTCAACAACGTTGGTGCGGGTCGGAACACATCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAACGA---TAAATTTACCAGGAATGACGTCGTTAA-TTTTCTTGAGAACC---GCGTCCGAGAATTT--GTTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTAT--GCCTCTTGTGCCTAGATCTA--CT-GGGGA-TAAT---GGAGGTGTTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATCGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCCTGAGACCCAAATAGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_gheisbrechtii_YUC_z249 GGATCATTGCTGAGGCCCC-GACACCAACTA-CGATTGACCC-----GTGAA-CATGTGACATTGGATGTGAAAA-CCTGTTCCACCGTGTTGATGTCGTTGCGGATGGTGGCATGATATTGCGTCAACAACGTTGGTGCGGGTCGGAACACATCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAACGA---TAAATTTACCAGGAATGACGTCGTTAA-TTTTCTTGAGAACC---GCGTCCGAGAATTT--GTTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTAT--GCCTCTTGTGCCTAGATCTA--CT-GGGGA-TAAT---GGAGGTGTTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATCGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCCTGAGACCCAAATAGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_ghiesbrechtii_OK_z133 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGCGATACTTGGTGTGAATTGCA????????????CCATCGAGTCTTCGAACGCAAGTTGTGCCTGAAGCCATTTGGTGGAGGGCACGTCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_ghiesbrechtii_OK_z201 GGATCATTGCTAAGGCCCC-GACA----C?AACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCTGAAGCCATTTGGTGGAGGGCACGTCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_ghiesbrechtii_OK_z202 GGATTATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGCGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCTGAAGCCATTTGGTGGAGGGCACGTCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_ghiesbrechtii_OK_z203 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCTGAAGCCATTTGGTGGAGGGCACGTCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_ghiesbrechtii_OK_z204 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCTGAAGCCATTTGGTGGAGGGCACGTCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_ghiesbrechtii_YUC_z132 GGATCATTGCTGAGGCCCC-GACACCAACTA-CGATTGACCC-----GTGAA-CATGTGACATTGGATGTGAAAA-CCTGTTCCACCGTGTTGATGTCGTTGCGGATGGTGGCATGATATTGCGTCAACAACGTTGGTGCGGGTCGGAACACATCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAACGA---TAAATTTACCAGGAATGACGTCGTTAA-TTTTCTTGAGAACC---GCGTCCGAGAATTT--GTTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGCGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTAT--GCCTCTTGTGCCTAGATCTA--CT-GGGGA-TAAT---GGAGGTGTTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATCGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCCTGAGACCCAAATAGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_ghiesbrechtii_YUC_z134 GGATCATTGCTGAGGCCCC-GACACCAACTA-CGATTGACCC-----GTGAA-CATGTGACATTGGATGTGAAAA-CCTGTTCCACCGTGTTGATGTCGTTGCGGATGGTGGCATGATATTGCGTCAACAACGTTGGTGCGGGTCGGAACACATCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAACGA---TAAATTTACCAGGAATGACGTCGTTAA-TTTTCTTGAGAACC---GCGTCCGAGAATTT--GTTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTAT--GCCTCTTGTGCCTAGATCTA--CT-GGGGA-TAAT---GGAGGTGTTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATCGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCCTGAGACCCAAATAGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_ghiesbrechtii_YUC_z223 GGATCATTGCTGAGGCCCC-GACACCAACTA-CGATTGACCC-----GTGAA-CATGTGACATTGGATGTGAAAA-CCTGTTCCACCGTGTTGATGTCGTTGCGGATGGTGGCATGATATTGCGTCAACAACGTTGGTGCGGGTCGGAACACATCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAACGA---TAAATTTACCAGGAATGACGTCGTTAA-TTTTCTTGAGAACC---GCGTCCGAGAATTT--GTTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTAT--GCCTCTTGTGCCTAGATCTA--CT-GGGGA-TAAT---GGAGGTGTTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATCGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGCTCCCCTGAGACCCAAATAGCGAACGTCGTGCATTGCTCGGTGCC Schoenocaulon_ghiesbrechtii_YUC_z265 GGATCATTGCTGAGGCCCC-GACACCAACTA-CGATTGACCC-----GTGAA-CATGTGACATTGGATGTGAAAA-CCTGTTCCACCGTGTTGATGTCGTTGCGGATGGTGGCATGATATTGCGTCAACAACGTTGGTGCGGGTCGGAACACATCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAACGA---TAAATTTACCAGGAATGACGTCGTTAA-TTTTCTTGAGAACC---GCGTCCGAGAATTT--GTTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGCGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTAT--GCCTCTTGTGCCTAGATCTA--CT-GGGGA-TAAT---GGAGGTGTTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATCGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCCTGAGACCCAAATAGCGGAAATCGTGCATTGCTCGGTGCC Schoenocaulon_ignigenum_z205 GGATCATTGCTAAGGCCCC-GACACCAA----CGATTGACCC-----GTGAA-CATGTGATAGA--ATGTGAAAA-CCTGTTCCATCGTGTTGATGTCGTTGCGGATGGCGGCATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAAAAA---TAAATTTACGGGAAATGACGTCGTCCT-TTTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTTT--GCCTCCTGTGCCTAGATCTA--CT-GGGGA-TATT---GGAGGTGTTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTTGGTTGTCGGCATTGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_ignigenum_z240 GGATCATTGCTAAGGCCCC-GACACCAA----CGATTGACCC-----GTGAA-CATGTGATAGA--ATGTGAAAA-CCTGTTCCATCGTGTTGATGTCGTTGCGGATGGCGGCATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAAAAA---TAAATTTACGGGAAATGACGTCGTCCT-TTTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTTT--GCCTCCTGTGCCTAGATCTA--CT-GGGGA-TATT---GGAGGTGTTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTTGGTTGTCGGCATTGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_intermedium_z245 GGATCATTGCTAAGGCCCC-GACACCAA----CGATTGACCC-----GTGAA-CATGTGATACG-AATGTGAAAA-CCTGTTCCATCGTGTAGATGTCGTTGCGGATGGCGGCATGTT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACTTCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAAAAA---TAAATTTACGGGAAATGACGTCGTCCT-TTTTTTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCCTT--GCCTCCTGTGCCTAGATCTA--CT-GGGGA-TATT---GGAGGTGTTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTTGGTTGTCGGCATTGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_jaliscence_jalicense_z224 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCCCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGTGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--CGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCACTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_jaliscence_regulare_z206 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCCCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGTGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--CGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCACTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_macrocarpum_z141 GGATCATTGCTAAGGCCCC-GACACCAA----CGATTGACCC-----GTGAA-CATGTGATAGA--ATGTGAAAA-CCTGTTCCATCGTGTTGATGTCGTTGCGGATGGTGGCATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAAAAA---TAAATTTACCAGAAATGACGTCGTCCT-TTTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGAATCGATGAAGAACGTTGCGAAATGCGATACTTGGTGTGAATTGA?????????CGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTTT--GCCTCTTGTGCCTAGATCTA--CT-GGGGA-TAAT---GGAGGTGTTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGACTGAAGATTGGGTTGTCGGCATTGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCCCGGTGCC Schoenocaulon_macrocarpum_z207 GGATCATTGCTAAGGCCCC-GACACCAA---ACGATTGACCC-----GTGAAACATGTGATAGA--ATGTGAAAA-CCTGTTCCATCGTGTTGATGTCGTTGCGGATGGTGGCATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACGTCAGC--GAACTCCGGCACGGCCCTTGTGTCAAGGACAAAAA---TAAACTTACCAGAAATGACGTCGTCCT-TTTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGCGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTTT--GCCTCTTGTGCCTAGATCTA--CT-GGGGA-TAAT---GGAGGTGCTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGACTGAAGATTGGGTTGTCGGCATTGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_macrocarpum_z225 GGATCATTGCTAAGGCCCC-GACACCAA---ACGATTGACCC-----GTGAAACATGTGATAGA--ATGTGAAAA-CCTGTTCCATCGTGTTGATGTCGTTGCGGATGGTGGCATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACGTCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAAAAA---TAAACTTACCAGAAATGACGTCGTCCT-TTTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTGGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTTT--GCCTCTTGTGCCTAGATCTA--CT-GGGGA-TAAT---GGAGGTGCTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGACTGAAGATTGGGTTGTCGGCATTGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_madidorum_z226 GGATCATTGCTAAGGCGCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGC?CGGCCCT-GTGTCAAGGACAAA----TTTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCAAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCATGCTCTTC--GCCTCTTGTGTCTAGATCTA--CT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATGCATGCTATT-GAGTGGTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTTAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_megarrhizum_deminutum_z260 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCCCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGCGATACTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--CGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_megarrhizum_mega_z208 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGGGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_megarrhizum_mega_z209 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGGGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_mortonii_OK_z263 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAATC---GCCCCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGCGATACTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--CGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_mortonii_SP_NOV_z227 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACT---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_mortonii_SP_NOV_z262 ??????????????????????CA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAC-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACT---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTACCCGGTGCC Schoenocaulon_mortonii_z135 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCCCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGCGATACTTGGTGTGAATTGCA??????????????ATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--CGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_mortonii_z136 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAATC---GCCCCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGCGATACTTGGTGTGAATTGCA??????????????ATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--CGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_obtusum_z211 GGATCATTGCTAAGGCGCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAA----TTTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_obtusum_z228 GGATCATTGCTAAGGCGCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCCCGGCCCT-GTGTCAAGGACAAA----TTTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_officinale_z137 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCCCCCCGTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCAT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGAATTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTTTTTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_officinale_z138 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCCCCCCGTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCAT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTTTTTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_officinale_z139 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCCCCCCGTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCAT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTTTTTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_officinale_z140 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCCCCCCGTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCAT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTTTTTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_officinale_z229 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCCCCCCGTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCAT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTTTTTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_officinale_z250 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCCCCCCGTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCAT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTTTTTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_officinale_z251 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCCCCCCGTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCAT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTTTTTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_pellucidum_z142 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCTT-GTGTCAAGGACAAAAA----AAA{AT}TTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCCCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGCGATACTTGGTGTGAATTGCA????????????CCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--CGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCGAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_pellucidum_z143 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCTT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCCCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGCGATACTTGGTGTGAATTGCA?????????????CATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--CGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCGAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_plumosum_z230 GGATCATTGCTAAGGCCCC-GACACCAA---ACGATTGACCC-----GTGAAACATGTGATAGA--ATGTGAAAA-CCTGTTCCATCGTGTTGATGTCGTTGCGGATGGTGGCATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACGTCAGC--GAACTCCGGCACGGCCCT-GTGTCAAGGACAAAAA---TAAACTTACCAGAAATGACGTCGTCCT-TTTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-TTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCGGTGCGTCATGTTTTGTGCTCGCTCTTT--GCCTCTTGTGCCTAGATCTA--CT-GGGGA-TAAT---GGAGGTGCTGGAAGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGACTGAAGATTGGGTTGTCGGCATTGTAGAGTACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGTTGTGCTCTCATTCCCCAAG---CGTTGGA---TGA-CCCTTGAGACCCCAATTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_pringlei_z231 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCTGAAGCCATTTGGTGGAGGGCACGTCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_pringlei_z239 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCTGAAGCCATTTGGTGGAGGGCACGTCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_rzwedowskii GGATCATTGCTAAGGCGCCGAACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCATTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAA----TTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG---CGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Schoenocaulon_tenorioi GGATCATTGCTAAGGCCCC-AACA----CTAACGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CTCGTTCCATCGTGTTGATGCCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTCGGTGCGGGTCGGAACACATCAAC--GAACTCCGGCACGGCCGT-GTGTCAAGGACAAA-TTTTTTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTTT-TGTG--CGTCGTCATGTTGCGATGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTT--GCCTCTTGTGCCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTATTTGATTGTCGTGCTCTCATTCCCCAAG---CATTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_tenue ?GATCATTGCTAAGGCCCC-AACA----CTAACGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CTCGTTCCATCGTGTTGATGCCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTCGGTGCGGGTCGGAACACATCAAC--GAACTCCGGCACGGCCGT-GTGTCAAGGACAAA-TTTTTCTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTTT-TGTG--CGTCGTCATGTTGCGATGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTT--GCCTCTTGTGCCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTATTTGATTGTCGTGCTCTCATTCCCCAAG---CATTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_tenufolium GGATCATTGCTAAGGCCCC-AACA----CTAACGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CTCGTTCCATCGTGTTGATGCCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTCGGTGCGGGTCGGAACACATCAAC--GAACTCCGGCACGGCCGT-GTGTCAAGGACAAATTTTTTTTTTTTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCTCCGAGATTTTT-TGTG--CGTCGTCATGTTGCGATGAA-CTTGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTT--GCCTCTTGTGCCTAGATCTA--TT--GGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTATTTGATTGTCGTGCTCTCATTCCCCAAG---CATTGGA---TGA-CCCTTGAGACCCAAATTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_texanum_z234 GGATCATTGCTAAGGCCCC-AACACCAA----CGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CCTGCTCCATCGTGTTG---------CGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCA----GAACTCCGGCACGTCCCT-GTGCCAAGGACAAAAA----AAATTTACCAGAAATGACGTCGTTATTTTTTCTTGTGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGCTGCGAAGAA-TTTCATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAGCCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTGGCTCTTC--GCCTCTTGTGCCTAGATCTA--TT-GGGGA-TAAT---GGAGGTGTTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGGACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGCTGTGCTCTCATTCCCCAAG---CATCGGA---TGA-CCCTTGAGACCCAAGTTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_texanum_z235 GGATCATTGCTAAGGCCCC-AACACCAA----CGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CCTGCTCCATCGTGTTG---------CGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCA----GAACTCCGGCACGTCCCT-GTGCCAAGGACAAAAA----AAATTTACCAGAAATGACGTCGTTATTTTTTCTTGTGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGCTGCGAAGAA-TTTCATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAGCCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTGGCTCTTC--GCCTCTTGTGCCTAGATCTA--TT-GGGGA-TAAT---GGAGGTGTTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGGACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGCTGTGCTCTCATTCCCCAAG---CATCGGA---TGA-CCCTTGAGACCCAAGTTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_texanum_z236 GGATCATTGCTAAGGCCCC-AACACCAA----CGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CCTGCTCCATCGTGTTG---------CGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCA----GAACTCCGGCACGTCCCT-GTGCCAAGGACAAAAA----AAATTTACCAGAAATGACGTCGTTATTTTTTCTTGTGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGCTGCGAAGAA-TTTCATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAGCCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTGGCTCTTC--GCCTCTTGTGCCTAGATCTA--TT-GGGGA-TAAT---GGAGGTGTTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGGACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGCTGTGCTCTCATTCCCCAAG---CATCGGA---TGA-CCCTTGAGACCCAAGTTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_texanum_z255 GGATCATTGCTAAGGCCCC-AACACCAA----CGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CCTGCTCCATCGTGTTG---------CGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCA----GAACTCCGGCACGTCCCT-GTGCCAAGGACAAAAA----AAATTTACCAGAAATGACGTCGTTATTTTTTCTTGTGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGCTGCGAAGAA-TTTCATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAGCCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTGGCTCTTC--GCCTCTTGTGCCTAGATCTA--TT-GGGGA-TAAT---GGAGGTGTTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGGACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGCTGTGCTCTCATTCCCCAAG---CATCGGA---TGA-CCCTTGAGACCCAAGTTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_texanum_z67 GGATCATTGCTAAGGCCCC-AACACCAA----CGATTGACCC-----GTGAA-CATGTGAAAGA--ATGTGACAA-CCTGCTCCATCGTGTTG---------CGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCA----GAACTCCGGCACGTCCCT-GTGCCAAGGACAAAAA----AAATTTACCAGAAATGACGTCGTTATTTTTTCTTGTGAACC---GCCTCCGAGATTTT--GGTG--CGTCGTCATGCTGCGAAGAA-TTTCATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATACTTGGTGTGAATTGCAGAACCCCGCGAGCCATCGAGTCTTTGAACGCAAGTTGTGCCTGAAGCCATTTGGCGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTGGCTCTTC--GCCTCTTGTGCCTAGATCTA--TT-GGGGA-TAAT---GGAGGTGTTGGATGTGAAGTTTGGTCCCTTGTGCCCTT---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGGACGGAGGTAATGGTTGATGCCTTG-T-TGCATATATGCTGTT-GATTGCTGTGCTCTCATTCCCCAAG---CATCGGA---TGA-CCCTTGAGACCCAAGTTGCGGACGTCGTGCATTGCTCGGTGCC Schoenocaulon_tigrense_z247 GGATCATTGCTAAGGCCCC-GACA----CTAACGATTGACCCC----GTGAA-CATGTGAAAGA--ATGTGACAG-CTCGTTCCATCGTGTTGATGTCGTTGCGGATGGTG-CATGAT--TGCGTCAACAT-GTTGGTGCGGGTCGGAACACATCAAC--GAACAACGGCACGGCCCT-GTGTCAAGGACAAAAA----AAAATTACCAAAAATGACGTCGTTAT--TTTCTTGAGAACC---GCCCCCGAGATTTT--GGTG--CGTCGTCATGTTGCGAAGAA-CTTGATGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTTGCGAAATGTGATGCTTGGTGTGAATTGCAGGACCCCGCGAACCATCGAGTCTTCGAACGCAAGTTGTGCCCGAAGCCATTTGGTGGAGGGCACATCTGCCTGTGCGTCATGTTTTGTGCTTGCTCTTC--GCCTCTTGTGTCTAGATGTA--TT--CGGA-TAAT---GGAGGTGCTGGATGTGAAGTTTGGTCCCTTGTGCCCTA---GCACGTTGGGCTGAAGATTGGGTTGTCGGCATTGTAGAGTATGAAGGTAATGGTTGATGCCTTG-C-TGCATGCATGCTATT-GATTGTTGTGCTCTCATTCCCCAAG---CACTGGAGGATGA-CCCTTGAGACCCAAATTGCGGACGTCGTGGATTGCCCGGTGCC Stenanthium_densum GGATCATTGCTGAGACCCC-AACA----CTAACGAATGACTT-----GTGAA-CATGTGAATGA--TTGTGACAA-CTTGCGCCGTCGTGTTGACGCTGTTGCGG-GTGATCCGTGAT--CGTGTCAACAA-GTTGGTGCGGGTTGGAACAC--CAAC--GAACCCCGGCACAACCTA-GTGTCAAGGACGAA------TAAACTATCAAAAATGACAATGCCCT--TTCCTTGAGCATC---GCGTTCGAGATTTG--GGTG--CATCGTCATGTTGTGAAGAA-TTGGATGACTCTCGACAACGGATATCTGGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGATGCCATTTGGTGGAGGGCACATCTGCCTGTGTGTCACGTTTCGTGTTTGCTCTTT--GCCTCCTGTGCCCAGCTCTA--CT--GGGA-TGCT---AGAGGTGTCGGATGCAAAGTTTGGCCCCTCGTGCCCTTGTCGTGCGTTGGGCTGAAGATTGGGTTGTCGGCATGGAAGGGCATAGC--TAATGGTTGATGCTTAG-T-TGCGCATAT-ATGAC-GATTGCTATGCTCTCATTGCCCAAG---CATTGGATGACGA-CCCTTGAGACCCAAACTGCGACCGTCGTGCCTTGCTCGACGCC Toxicoscordion_nuttallii GGATCATTGCCGAGACCCC-AACA----CTAGCGAATGACCT-----GTGAA-CATGTGAATGA--ATGTGACGA-CTTGTGCCAACGTGTCGATGCCGTAGCGG-ATGATCCGTGAC--CGTGTCGGCAT-GTTGGTGCGGGTCGGGACAC--CAAC--GAACTCCGGCACAGCCTT-GTGTCAAGGATGAA------TAAACCACCAAAAATGACGATGCCCT--TTCCTTGAGCACT---GCGTTCGAGATTTG--GGTG--CATCGTCATGCTGTGAGGAA-TTGGATGACTCTCGACAACGGATATCTGGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAACCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGATGCCATTTGGTGGAGGGCACATCTGCCTGTGTGTCACGTCTCGCGTTTGCTCTTT--GCCTCTTGCGCCCAGCTCTATGCTGTGGGA-TGCT---AGAGGTGTTGGATGCGAAGTTTGGCCCCTCGTGCACCCGGTGCACGTTGGGCTGAAGATTGGGTTGTCGGCATGGAAGAGCATAGC--TAATGGTTGATGCCTTG-T-CGCATATAT---GCT-GATTGCTGTGCTCTCGTTTCCCAAG---CATTGGA---CGA-CCCTCGAGACCCAAACTGCGACCGCCGTGCCTTGCACGGCGAC Veratrum_viride GGATCATTGCTGAGACCCCCAATA----TTAACGTATGACTT-----GTGAA-CATGTTAATGA--ATGCGACAA-CTTGTGCCAACGTGTTGATGTTGTTGCGGGATGATCTGTGAT--CGTGTCAACAT-GTTGGCCTGGGTTGAAACAC--CAAC--GAACTCCGGCACAACCTT-GTGTCAAGGACGAA------TAAATTACCAAAAATGACAATGCCCT--TTCCTCGAGCATT---GCTTTTGAGATTTG--GGTC--CATCGTCATGTTGTGAAGAA-TTGGATGACTCTCGACAACGGATATCTGGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAACCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGTGCCTGATGCCATTTGGTGGAGGGCACATCTGCCTGTGTGTCACGTTTCGTGTTTGCTCCTC--GCCTTTTGTGCCCCGCTCTA--TT--GCGA-TGCT---AGAGGTGTTGGATGCAAAGTTTGGCTCCTCGTGCC-TT-CTGCGCGTTGGGCTGAAGATTGGGTTGCCGGCATGGAAGAGTATAGC--TAATGGTTGATGCTTTG-T-CGCATAAAT---GCT-TATTGGTGTGCTCTCATTGGCCAAG---CATATGT---TGA-CCCTTGAGACCCAAATTGCGATCGTCTTGCCTTGCTCGACGCC Zigadenus_glaberrimus GGATCATTGTCGAGACTCGGGACA----CGATCGGAAGACCC-----GCGAA-TATGTGAATGG--ATGCAACCC-CCTGCCCCTTCGGGTCGATGCCGGTGCTG-ATAGTCCAGGAC--CGCGC-GGCAC-----GTGCGGG-CGGGACAA-CGGACGAAAACCCCGGCGCGATGAT-GCGCCAAGGAAAAA-------ATATT---AGAACTGGGCGCGCCCC----CGCTGAGCCCC-----GGTCGGGGTCGGT-GTAG--CGGCGCTTTGCTCTGGAGAA-TCGGATGACTCTCGGCAACGGATATCTGGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAATGCCATTCGGCAGAGGGCACGCCTGCCTGGGCGTCACGCCTCATGTC-GCTCTGC--GCCCTCCTCCACCCCCACCC--TT--GGGGTTGTCGGTGGGGGCGTCGGACGCGGAGATTGGCCCCCCGTGCGCTC-GTGTGCGGTGGGTTGAAGATCGGGCCGCCGGCGGGGCCGGGCATGGT--GAGTTGTGGACGTCTTCTT-TGCTTGA-----GCC-GGATGCTGTGCTCTTGTGCCCCAGC---GGCGC-A---TGG-CCCTCGAGACCCTAACTAGGGGCGTCGTG---TG--TGGCGCC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Schoeno_ITS) = N: 1-716; CODONPOSSET CodonPositions (CHARACTERS = Schoeno_ITS) = N: 1-716; END; BEGIN TREES; TITLE Tb8451; LINK TAXA = Taxa1; TRANSLATE 1 Zigadenus_glaberrimus, 2 Veratrum_viride, 3 Toxicoscordion_nuttallii, 4 Stenanthium_densum, 5 Schoenocaulon_tigrense_z247, 6 Schoenocaulon_texanum_z67, 7 Schoenocaulon_texanum_z255, 8 Schoenocaulon_texanum_z236, 9 Schoenocaulon_texanum_z235, 10 Schoenocaulon_texanum_z234, 11 Schoenocaulon_tenufolium, 12 Schoenocaulon_tenue, 13 Schoenocaulon_tenorioi, 14 Schoenocaulon_rzwedowskii, 15 Schoenocaulon_pringlei_z239, 16 Schoenocaulon_pringlei_z231, 17 Schoenocaulon_plumosum_z230, 18 Schoenocaulon_pellucidum_z143, 19 Schoenocaulon_pellucidum_z142, 20 Schoenocaulon_officinale_z251, 21 Schoenocaulon_officinale_z250, 22 Schoenocaulon_officinale_z229, 23 Schoenocaulon_officinale_z140, 24 Schoenocaulon_officinale_z139, 25 Schoenocaulon_officinale_z138, 26 Schoenocaulon_officinale_z137, 27 Schoenocaulon_obtusum_z228, 28 Schoenocaulon_obtusum_z211, 29 Schoenocaulon_mortonii_z136, 30 Schoenocaulon_mortonii_z135, 31 Schoenocaulon_mortonii_SP_NOV_z262, 32 Schoenocaulon_mortonii_SP_NOV_z227, 33 Schoenocaulon_mortonii_OK_z263, 34 Schoenocaulon_megarrhizum_mega_z209, 35 Schoenocaulon_megarrhizum_mega_z208, 36 Schoenocaulon_megarrhizum_deminutum_z260, 37 Schoenocaulon_madidorum_z226, 38 Schoenocaulon_macrocarpum_z225, 39 Schoenocaulon_macrocarpum_z207, 40 Schoenocaulon_macrocarpum_z141, 41 Schoenocaulon_jaliscence_regulare_z206, 42 Schoenocaulon_jaliscence_jalicense_z224, 43 Schoenocaulon_intermedium_z245, 44 Schoenocaulon_ignigenum_z240, 45 Schoenocaulon_ignigenum_z205, 46 Schoenocaulon_ghiesbrechtii_YUC_z265, 47 Schoenocaulon_ghiesbrechtii_YUC_z223, 48 Schoenocaulon_ghiesbrechtii_YUC_z134, 49 Schoenocaulon_ghiesbrechtii_YUC_z132, 50 Schoenocaulon_ghiesbrechtii_OK_z204, 51 Schoenocaulon_ghiesbrechtii_OK_z203, 52 Schoenocaulon_ghiesbrechtii_OK_z202, 53 Schoenocaulon_ghiesbrechtii_OK_z201, 54 Schoenocaulon_ghiesbrechtii_OK_z133, 55 Schoenocaulon_gheisbrechtii_YUC_z249, 56 Schoenocaulon_gheisbrechtii_YUC_z244, 57 Schoenocaulon_gheisbrechtii_YUC_z241, 58 Schoenocaulon_gheisbrechtii_YUC_z238, 59 Schoenocaulon_dubium_z267, 60 Schoenocaulon_dubium_z10, 61 Schoenocaulon_conzattii, 62 Schoenocaulon_comatum_SP_NOV_z248, 63 Schoenocaulon_comatum_SP_NOV_z200, 64 Schoenocaulon_comatum_SP_NOV_z199, 65 Schoenocaulon_comatum_OK_z257, 66 Schoenocaulon_comatum_OK_z254, 67 Schoenocaulon_comatum_OK_z222, 68 Schoenocaulon_caricifolium_oaxacense_z242, 69 Schoenocaulon_caricifolium_oaxacense_z237, 70 Schoenocaulon_caricifolium_caricifolium_z253, 71 Schoenocaulon_caricifolium_caricifolium_z252, 72 Schoenocaulon_calcicola, 73 Anticlea_elegans, 74 Amianthium_muscitoxicum; TREE PAUP_1 = [&R] (74,2,((4,73),(1,3,((((((30,(29,33),(19,18),36),(41,42),5),(35,34),(24,23,25,21,20,22,26),(54,51,53,52,50,16,15),(32,61,31),(28,27,71,70,37,14)),((64,(63,62)),((11,72),13,(69,68),12))),((((40,(39,(38,17))),(45,44,43)),(57,55,47,48,58,56,(49,46))),((10,9,8,7,6),(60,59)))),(67,66,65))))); END;