#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 5:20 GMT TreeBASE (cc) 1994-2008 Study reference: Stchigel A.M., Sutton D., Cano J., Wiederhold N.P., & Guarro J. 2015. Two new species of Spiromastigoides (Spiromastixales, Ascomycota). Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S18317] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=48; TAXLABELS Ajellomyces_capsulatus_UAMH_7141 Ajellomyces_dermatitidis_ATCC_18187 Ajellomyces_grisea_CBS_128.88 Ajellomyces_grisea_UAMH_6836 Amauroascus_niger_ATCC_22339 Aphanoascus_mephitalis_ATCC_22144 Arachnomyces_glareosus_CBS_116129 Arachnomyces_minimus_CBS_324.70 Arachnomyces_nodosetosus_CCF_3957 'Arthroderma cajetani OMH H1-10' Arthroderma_ciferrii_ATCC_24447 Arthroderma_otae_UAMH_2338 Ascosphaera_aggregata_KVL_1006 'Ascosphaera apis ATCC MYA-4450' Ascosphaera_apis_CBS_252.32 Ascosphaera_duoformis_ARSEF_693 Ascosphaera_subglobosa_A.A._Wynns_5004 'Bettsia alvei KVL 10-08' Byssochlamys_nivea_CBS_100.11 Chrysosporium_keratinophilum_CBS_392.67 Chrysosporium_tropicum_MUCL_10068 Chrysosporium_vallenarense_UAMH_6914 Ctenomyces_serratus_CBS_187.61 'Eremascus fertilis KVL 10-09' Eurotium_herbariorum_ATCC_16469 Gymnascus_aurantiacus_ATCC_22394 Gymnoascus_littoralis_CBS_454.73 Gymnoascus_ruber_CBS_352.90 Lecythophora_hoffmannii_CBS_140.41 'Nannizziopsis arthrosporioides UTHSC R-4263' 'Nannizziopsis guarroi UTHSC 06-3993' 'Nannizziopsis guarroi UTHSC 07-3227' 'Nannizziopsis pluriseptata UTHSC 10-1045' Nannizziopsis_vriesii_IMI_149994 Paracoccidioides_brasiliensis_IMTSP_556 Paracoccidioides_brasiliensis_Pb01 Petromyces_alliaceus_ATCC_16891 Pseudospiromastix_tentaculata_CBS_184.92 Spiromastix_alatospora_CBS_457.73 Spiromastix_asexualis_CBS_136728 Spiromastix_asexualis_CBS_136729 Spiromastix_sp._JCM_11276 'Spiromastix sp. UTHSCSA DI 14-25' 'Spiromastix warcupii AFTOL-ID 430' Spiromastix_warcupii_CBS_576.63 Spiromastix_warcupii_NRRL_3034 Spiromastix_warcupii_UAMH_7099 Uncinocarpus_reesii_ATCC_34533 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=7; TAXLABELS Spiromastix_alatospora_CBS_457.73 Spiromastix_asexualis_CBS_136728 Spiromastix_asexualis_CBS_136729 Spiromastix_sp._JCM_11276 'Spiromastix sp. UTHSCSA DI 14-25' Spiromastix_warcupii_CBS_186.92 Spiromastix_warcupii_CBS_576.63 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M33669] TITLE 'Spiromastigoides ITS D1-D2 ACT TUB'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=2563; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Spiromastix_alatospora_CBS_457.73 GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGTGCCTGTGGTCCCCGGCGGGCTCCCTTCTTCGGGGGTCCGTTCGGGGCTACATCCGGCCCAACCGTGTCTATCTGTACCTGTTGCTTCGGCGGGCCTGCGGGCT-TGCTCGCTGCCGGGAGCCGTTAACGCTCCGGGCTCGTGCCCGCCGAAGACGCCTAGAACTTCTGGTGAATCGAGCGGTCTGAGTGGACTTTG-AAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAA-CCCCTTCAAGCTCAGCTTGTGTGTTGGGC-GCCGTCCTCGCTGGACGCGCCCGAAAGGCAGTGGCGGCTCCGTGCTTCGGTGCCCGAGCGTATGGGCGTTA-TC-ACCCGCTCTGGTGGCCCGGC{CT}GGCGCTGGCCCCT-----------------------------------------------------CTAAAGTCTCAACGAGAATCTTCGTGGTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAAGCAGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGCCGCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGGTGGGCCGGCTGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGACTCCAGGGGCTCACCGGGCATGCTCTGCCCGGGCACTCCCCTGGGGCCGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCTGCCCGGATCGAGGAACCACCCCGTGCTGCTGACCGAGGCCCCCATCAACCCCAAGTCCAACCGAGAGAAGATGACCCAGATCGTTTTCGAAACCTTCAATGCCCCCGCTTTCTACGTCTCCATCCAGGCCGTCCTGTCCCTGTATGCTTCCGGTCGTACCACTGGTATTGTTCTTGACTCTGGTGATGGTGTCACCCACGTCGTCCCCATCTACGAGGGTTTCGCTCTTCCCCACGCCATCTCGCGTATGGACATGGCTGGTCGTGACTTGACAGACTACCTGATGAAGATCCTTGCCGAGCGTGGCTACAGCTTCTCGACCACCGCTGAACGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTTGCTCTTGACTTCCAGCAGGAGATCCAGACCGCGTCCCAGAGCTCCGCTTTGGAGAAGTCCTACGAACTCCCCGACGGTCAAGTCATCACCATTGGCAACGAGCGGTTCCGTGCTCCTGAGGCTCTCTTCCAGCCTAGCGTGCTCGGCCATGAGGGTGGTGGTATCCACACTACTACCTACAACGCCATCATGAAGTGTGATGTCGACGTGAGGAAGGATCTCTACGGCAACATTGTCATGGTAAGACCATTCCTCCC---GTTCCTGGTTGATAGCAATT--TAACACTAACATGTTATAGTCTGGTGGTACTACCATGTACCCAGGTATCTCCGACCGTATGCAGAAGGAGATCACTGCCCTTGCTCCCTCAACCATGAAGGTCAAGATCATCGCTCCTCCCGAACGTAAATACTCCGTCTGGATTGGAGGTTTACGGCGACCTGAACCACCTCGTCTCCGCTGTTATGTCCGGCGTATCCACCTCCCTCCGATTCCCCGGCCAGCTCAACTCTGATCTCCGCAAGTTGGCTGTCAACATGGTTCCTTTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCTCCGCTCACCAGCCGTAACGCCTACTCTTTCCGTGCCGTCACGGTTCCAGAGCTCACCCAGCAGATGTACGACCCCAAGAACATGATGGCTGCTACTGATTTCCGTAACGGTCGTTACCTCACTTGCTCTGCTATCTTGTGAGTTTC-CCCTTATATGCG---ATTATCATGCAAACCATT-----CTAACTCCCATCCAGCCGTGGCCGCGTCGCCATGAAGGAAGTCGAGGACCAAATGCGCAACGTCCAGAACAAGAACAGCACCTACTTCGTCGAATGGATCCCGAACAACGTGCAAACCGCCCTCTGCTCCATCCCTCCCCGTGGTCTCTCCATGTCCTCCACTTTCGTCGGAAACTCCACATCCATCCAGGAGCTCTTCAAGCGTGTCGGTGACCAGTTCACTGCTATGTTCCGTCGCAAGGCTTTCTTGCATTG Spiromastix_asexualis_CBS_136728 G-AACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGTGCCTGTAGTTGTTGGCGGGCTC----CCTCGGGGGTTCGTTCAGCGCTACATCCGGCCCAACCGTGTCTATTTCTACCTGTTGCTTCGGCGGACCTGCGGGCT-TGCTCGCTGCCGGAAGCCCCTAAGGCTTCGGGCTCGTGTCCGCCGAAGACGCCTAGAACTACTGTTGAACTTGGCGGTCTGAGTAAACTTGATTAATTATCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTCCGAGCGTCATTGCAA-CCCCTTCAAGCTCAGCTTGTGTGTTGGGCGGTCGTCCTCGCTGGACGCGCCCCAAAGGCAGTGGCAGCTCCGTGCATCGGTGCCCGAGCGTATGGGCTTTAGTTAACCCGCTCTAGTGGCCCGGCCGGCGCTGGCCCCCTA--------------------------------AGTCTTAACTGGACTCCGGTTAAGGTCTTAACTC-AATCTTCGTGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCAGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGTCGCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGGTGGGCCGGCCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGAGGGCTCACCGAGCATGCT-TGCTTGGGCACTCCCTCAGGGTCGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCCCGGAATGTGTCGTCCTTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCTGCTTGGACCGAGGAACACCCCCGTCCTGTTGACCGAGGCTCCCATCAACCCCAAGTCCAACAGAGAGAAGATGACCCAGATCGTTTTCGAAACCTTCAATGCCCCCGCCTTCTACGTCTCCATCCAGGCCGTCCTCTCCCTGTACGCCTCTGGTCGTACCACTGGTATCGTTCTTGACTCTGGTGATGGTGTCACTCACGTCGTCCCCATCTACGAGGGTTTCGCTCTCCCCCACGCCATCTCCCGTATGGACATGGCTGGCCGTGACTTGACCGACTACCTCATGAAGATTCTTGCCGAGCGTGGCTACTCCTTCTCGACCACCGCTGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTCCAGCAGGAGATCCAGACCGCTGCCCAGAGCTCTGCTTTGGAGAAGTCCTACGAACTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGGTTCCGTGCTCCTGAGGCTCTCTTCCAGCCTAGCGTCCTCGGCCATGAGGGCGGTGGTATCCACACTACTACCTACAACGCCATCATGAAGTGTGATGTCGATGTGAGGAAGGATCTCTACGGCAACATCGTCATGGTATGACTTCCCTTT----ATCTCTAAGACAAGTTCGATTC-GTAAACTAACATATCATAGTCCGGTGGTACGACCATGTACCCAGGTATCTCCGACCGTATGCAGAAGGAGATCACTGCCCTTGCTCCCTCGACCATGAAGGTCAAGATCATCGCTCCTCCCGAACGTAAATACTCCGTCTGGATCGGTGGTTTACGGCGACCTGAACCACCTCGTCTCCGCTGTCATGTCCGGCGTGTCCACCTCCCTGCGATTCCCCGGCCAGCTCAACTCCGATCTCCGCAAGTTGGCTGTTAACATGGTTCCCTTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCTCCTCTCACCAGCCGCAACGCCTACTCTTTCCGTGCCGTCACCGTTCCCGAGCTCACCCAGCAGATGTACGACCCTAAGAACATGATGGCCGCTACTGACTTCCGTAACGGCCGTTACCTCACCTGCTCTGCTATCTTGTAAGTTTATTCCCGTTGTGCA------TTGGTATTAGGTATT---TTCTAACTCCCATCCAGCCGTGGCCGCGTCTCCATGAAAGAAGTCGAAGACCAAATGCGCAACGTCCAAAACAAGAACAGCAGCTACTTCGTCGAATGGATCCCGAACAACGTGCAGACAGCCCTCTGCTCCATCCCTCCCCGTGGTCTCTCCATGTCCTCCACTTTCGTCGGAAACTCCACCTCCATCCAGGAACTCTTCAAGCGTGTTGGTGACCAGTTCACGGCTATGTTCCGTCGCAAGGCTTTCTTGCATTG Spiromastix_asexualis_CBS_136729 GTAACAAGGTTTCAGTAGGTGAACCTGCGGAAGGATCATTACCGTGCCTGTAGTTGTTGGCGGGCTC----CCTCGGGGGTTCGTTCAGCGCTACATCCGGCCCAACCGTGTCTATTTCTACCTGTTGCTTCGGCGGGCCTGCGGGCT-TGCTCGCTGCCGGAAGCCCCTAAGGCTTCGGGCTCGTGTCCGCCGAAGACGCCTAGAACTACTGTTGAACTTGGCGGTCTGAGTAAACTTGATTAATTATCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTCCGAGCGTCATTGCAA-CCCCTTCAAGCTCAGCTTGTGTGTTGGGCGGTCGTCCTCGCTGGACGCGCCCCAAAGGCAGTGGCAGCTCCGTGCATCGGTGCCCGAGCGTATGGGCTTTAGTTAACCCGCTCTAGTGGCCCGGCCGGCGCTGGCCCCCTA--------------------------------AGTCTTAACTGGACTCCGGTTAAGGTCTTAACTC-AATCTTCGTGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCAGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGTCGCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGGTGGGCCGGCCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGAGGGCTCACCGAGCATGCT-TGCTTGGGCACTCCCTCAGGGTCGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCCCGGAATGTGTCGTCCTTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCTGCTTGGACCGAGGAACACCCCCGTCCTGTTGACCGAGGCTCCCATCAACCCCAAGTCCAACCGAGAGAAGATGACCCAGATCGTTTTCGAAACCTTCAATGCCCCCGCCTTCTACGTCTCCATCCAGGCCGTCCTCTCCCTGTACGCCTCTGGTCGTACCACTGGTATCGTTCTTGACTCTGGTGATGGTGTCACTCACGTCGTCCCCATCTACGAGGGTTTCGCTCTCCCCCACGCCATCTCCCGTATGGACATGGCTGGCCGTGACTTGACCGACTACCTGATGAAGATCCTTGCCGAGCGTGGCTACTCCTTCTCGACCACCGCTGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTCCAGCAGGAGATCCAGACCGCTGCCCAGAGCTCTGCTTTGGAGAAGTCCTACGAACTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGGTTCCGTGCTCCTGAGGCTCTCTTCCAACCTAGCGTCCTCGGCCATGAGGGCGGTGGTATCCACACTACTACCTACAACGCCATCATGAAGTGTGATGTCGATGTGAGGAAGGATCTCTACGGCAACATCGTCATGGTATGACTTCCCTTT----ATCTCTAAGACAAGTTCGATTC-GTAAACTAACATATCATAGTCCGGTGGTACGACCATGTACCCAGGTATCTCCGACCGTATGCAGAAGGAGATCACTGCCCTTGCTCCCTCGACCATGAAGGTCAAGATCATCGCTCCTCCCGAACGTAAATACTCCGTCTGGATCGGTGGCTTACGGCGACCTGAACCACCTCGTCTCCGCTGTCATGTCCGGCGTGTCCACCTCCCTGCGATTCCCCGGCCAGCTCAACTCCGATCTCCGCAAGTTGGCTGTTAACATGGTTCCCTTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCTCCTCTCACCAGCCGCAACGCCTACTCTTTCCGTGCCGTCACCGTTCCCGAGCTCACCCAGCAGATGTACGACCCTAAGAACATGATGGCCGCTACTGACTTCCGTAACGGCCGTTACCTCACCTGCTCTGCTATCTTGTAAGTTTATTCCCGTTGTGCA------TTGGTATTAGATATT---TTCTAACTCCCATCCAGCCGTGGCCGCGTCTCCATGAAAGAAGTCGAAGACCAAATGCGCAACGTCCAAAACAAGAACAGCAGCTACTTCGTCGAATGGATCCCGAACAACGTGCAGACAGCCCTCTGCTCCATCCCTCCCCGTGGTCTCTCCATGTCCTCCACTTTCGTCGGAAACTCCACCTCCATCCAGGAACTCTTCAAGCGTGTTGGTGACCAGTTCACGGCTATGTTCCGTCGCAAGGCTTTCTTGCATTG Spiromastix_sp._JCM_11276 GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGTGCCTGTAGTTGTTGGC-GGCTC----CTTCGGGGGCTTGTTCAGCGCTACATTCGGCCCAACCGTGTCTATTTGTACCTGTTGCTTCGGCGGGCCTGCGGGCT-TGCTCGCTGCCGGAGGCCCCTAAAGCTCCGGGCTCGAGTCCGCCGAAGACACCTAGAACTTCTGTTGAACTTAGCGGTCTGAGTGGACTTTA-TAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTCTGGTATTCCGGGAGGCATGCCTGTCCGAGCGTCATTGCAACCCCCTTCAAGCTCAGCTTGTGTGTTGGGC-GCCGTCCTCGCTGGACGCGCCTGAAAGGCAGTGGCAGCTCCGTGCTTTGGTGCCCGAGCGTATGGGCTTTAGTT-ACCCGCTCTAGTGGCCCTGCCGGCGCTGGCCCTCTA--------------------------------AGGCTTAACTGGACTCCAGTTAAGATCTTAACTA-AATCTTCGTGGTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAAGCAGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTCGGTGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGTCGCCGCCTAAGTCCCCTGGAACGGGGCGTCAGAGAGGGTGAGAATCCCGTCTTTGGTGGGCTGGCCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGGGGGCTCACTGAGCATGCT-TGCTTAGGCACTCCCTCAGGGTCGGGTCAGCATCGGTTTAGGCGGTTGGTTAAAGGCTCCCGGAATGTGTCGCCCTTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCTGCCTGGACCGAGGATCCACCCCGTCCTGTTGACCGAGGCTCCCATCAACCCCAAGTCCAACCGAGAGAAGATGACCCAGATCGTTTTCGAAACCTTCAATGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTCCTGTCCCTGTACGCTTCTGGTCGTACCACTGGTATCGTTCTTGACTCTGGTGATGGTGTCACTCACGTCGTCCCCATCTACGAGGGTTTCGCTCTCCCCCACGCCATCTCCCGTATGGACATGGCTGGTCGTGACTTGACCGACTACCTGATGAAGATCCTTGCCGAGCGTGGCTACTCCTTCTCGACCACCGCTGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTTGCTCTCGACTTCCAGCAGGAGATCCAGACCGCTTCTCAGAGCTCTGCTTTGGAGAAGTCCTACGAACTCCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGGTTCCGTGCTCCTGAGGCTCTCTTCCAGCCTAGCGTGCTCGGCCATGAGGGTGGTGGTATCCACACTACTACCTACAACGCCATCATGAAGTGTGATGTCGACGTGAGGAAGGATCTCTACGGCAACATCGTCATGGTAA-ACTTCCTTTTCCTTATT-CCTTGTCAATG---ATAA-TAGTACTAACATAATATAGTCCGGCGGTACGACCATGTACCCAGGTATCTCCGACCGTATGCAGAAGGAGATCACTGCCCTCGCTCCCTCGACCATGAAGGTCAAGATCATCGCTCCTCCCGAACGTAAATACTCCGTCTGGATCGGTGGTTTACGGCGACCTGAACCACCTCGTCTCCGCTGTCATGTCCGGCGTGTCCACCTCTCTGCGTTTCCCCGGCCAGCTCAACTCCGATCTCCGCAAGTTGGCTGTTAACATGGTTCCCTTCCCTCGTCTCCATTTCTTCATGGTTGGCTTTGCTCCTCTCACCAGCCGCAACGCCTACTCTTTCCGTGCCGTCACCGTTCCGGAGCTCACCCAGCAGATGTACGACCCTAAGAACATGATGGCTGCTACTGACTTCCGTAACGGTCGTTACCTCACCTGCTCTGCTATCTTGTAAGTTT--TCCTCATATACAGCTGTCACGTTGTTACCC------CACTAATACCATTCCAGCCGTGGCAAGGTCTCCATGAAAGAAGTCGAAGACCAAATGCGCAACGTCCAAAACAAGAACAGCACCTACTTCGTCGAATGGATCCCGAACAACGTGCAGACCGCCCTCTGCTCCATCCCCCCGCGCGGTCTCTCCATGTCCTCCACCTTTGTCGGAAACTCCACCTCCATCCAGGAACTCTTCAAGCGTGTTGGTGACCAGTTCACGGCCATGTTCCGTCGCAAGGCTTTCTTGCATTG 'Spiromastix sp. UTHSCSA DI 14-25' GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGTGCCCGCGGCCGCCGGC-GGCTC----CTTCGGGGGCTCGTTCGGCGCCGCGTCCGGCCCAACCGTGTCTATCTGTACCTGTTGCTTCGGCGGGCCTGCGGGCTCTGCTCGCTGCCGGGGGCCCCTGGGGCTCCGGGCTCGTGCCCGCCGAAGACGCCTGGAACTACTGTCGAAGTTGGCGGTCTGAGTGGACTTGA-TAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAA-CCCCTTCAAGCCCGGCTTGTGTGTTGGGC-GTCGTCCCCGCTGGACGCGCCCGAAAGGCAGTGGCGGCTCCGTG-TCCGGTGCCCGAGCGTATGGGCTTTG-TC-ACCCGCTTCAGTGGCCCGGCCGGCGTCGGCCTCCAAGTCTTAACTGGAGTCTAGTTAAAGCCTTCACGGGACTTAACTGGACTTTGGTTAAGGTCTTAACCA-AACTTTCGTGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCAGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTCCGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGCCGCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGGTGGGCCGGTCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCTCCAGGGGTTCAGCGGGCATGCTCTGCCCGTGCACTCCCCCGGGGCCGGGTCAGCATCGGTTCGGGCGGTTGGTCAAAGGCTCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCAGCCAGCCTGGACCGAGGAACCACCCCGTGCTGCTGACCGAGGCTCCCATCAACCCCAAGTCCAACCGAGAGAAGATGACCCAGATCGTTTTCGAAACCTTCAACGCCCCCGCTTTCTACGTCTCCATCCAGGCCGTCCTGTCCCTGTACGCTTCCGGTCGTACTACTGGTATCGTCCTTGACTCTGGTGATGGTGTCACTCACGTCGTCCCCATCTACGAGGGTTTCGCTCTCCCCCACGCCATTTCTCGTATGGACATGGCTGGTCGTGACTTGACCGACTACCTCATGAAGATCCTTGCCGAGCGTGGTTACTCCTTCTCGACCACCGCTGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTTGCTCTCGACTTCCAGCAGGAGATCCAGACTGCTTCCCAGAGCTCCGCTTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGTAACGAGCGGTTCCGTGCTCCGGAGGCTCTCTTCCAGCCTAGCGTGCTTGGTCATGAGGGTGGTGGTATCCACACTACTACCTACAATGCCATCATGAAGTGCGATGTCGATGTCAGGAAGGATCTCTACGGCAACATTGTCATGGTACGTTTACTTCCTCGCTAATATGTATATACCTGTGTTCCGTAACACTAACCTGTCACAGTCTGGTGGTACGACCATGTACCCAGGTATCTCCGACCGTATGCAGAAGGAGATCACTGCCCTCGCACCCTCGACCATGAAGGTCAAGATCATCGCTCCTCCCGAACGTAAATACTCCGTCTGGATCGGTGGCTTACGGCGACCTGAACCACCTCGTCTCCGCCGTCATGTCTGGCGTGTCCACGTCGCTCCGTTTCCCTGGTCAGCTCAACTCCGATCTCCGCAAGTTGGCTGTCAACATGGTTCCCTTCCCTCGTCTCCATTTCTTCATGGTCGGCTTTGCTCCGCTCACCAGCCGCAACGCCTACTCTTTCCGCGCCGTCACTGTTCCTGAGCTCACTCAACAGATGTACGACCCTAAGAACATGATGGCTGCTACGGACTTCCGTAACGGTCGTTACCTGACTTGCTCTGCTATCTTGTAAGTCCCTAATCCCTATACT---TACCCGGTACACACCGATAAGTACTAATCCTTTTCCAGCCGTGGCCGCGTCTCCATGAAGGAAGTCGAAGACCAAATGCGCAACGTCCAAAACAAAAACTCCACCTACTTCGTCGAATGGATCCCCAACAATGTCCAAACAGCCCTCTGCTCCATCCCGCCGCGCGGTCTCTCCATGTCCTCCACCTTCGTCGGAAACTCTACCTCCATCCAGGAACTGTTCAAGCGTGTCGGCGACCAGTTCACTGCGATGTTCCGCCGCAAGGCTTTCTTGCATTG Spiromastix_warcupii_CBS_186.92 GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGTGCCTGTAGTTGTTGGC-GGCTC----CTCCGGGGGTTCGTTCAGCGCTACGTTCGGCCCAACCGTGTCTATCTATACCTGTTGCTTCGGCGGGCCTGCGGGCT-TGCTCGCTGCCGGGAGCCCCTAAAGCTCCGGGCGCGTGCCCGCCGAAGATGCCTAGAACTACTGTTGAACTTAGCGGTCTGAGTGGGCTTTA-TAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTCTGGTATTCCGGGAGGCATGCCTGTCCGAGCGTCATTGCAA-CCCCTTCAAGCTCAGCTTGTGTGTTGGGC-GACGTCCCCGCTGGACGCGCCCGAAAGGCAGTGGCGGCTCCGTGCTTCGGTGCCCGAGCGTATGGGCTTTAGTT-ACCCGCTCTAGTGGCCCGGCCGGCGCTGGCCCCCTA--------------------------------AGTCTTAACTGGACTCCGGTTAAGGTCTTAACTG-AAATTTCGTGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCAGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGTCGCCGCCTAAGTCCCCTGGAACGGGGCGTCAGAGAGGGTGAGAATCCCGTCTTTGGTGGGCTGATCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGGGGGCTCACTGAGCATGCT-TGCTTAGGCACTCCCTCAGGGTCGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCTCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCCGGATCGAGGAACCACCCCGTCCTGTTGACCGAGGCTCCCATCAACCCCAAGTCCAACCGAGAGAAGATGACCCAGATCGTTTTCGAAACCTTCAATGCCCCCGCCTTCTACGTCTCCATCCAGGCCGTCCTGTCTCTGTACGCTTCTGGTCGTACTACTGGTATCGTTCTTGACTCTGGTGATGGTGTCACTCACGTCGTCCCCATCTACGAGGGTTTCGCTCTCCCCCACGCCATCTCCCGTATGGACATGGCTGGTCGTGACTTGACCGACTACCTGATGAAGATCCTTGCCGAGCGTGGCTACTCCTTCTCGACCACCGCTGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTTGACTTCCAGCAGGAGATCCAGACCGCTTCCCAGAGCTCTGCTTTGGAGAAGTCCTACGAACTGCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGGTTCCGTGCTCCTGAGGCTCTCTTCCAGCCTAGCGTGCTTGGTCATGAGGGTGGTGGTATCCACACTACTACCTACAACGCCATCATGAAGTGTGATGTCGACGTGAGGAAGGATCTCTACGGCAACATCGTCATGGTAAGACTGCTTTTCTCCCATTTCCTTGTCAATGGTAATAA-TAGTACTAACATATCATAGTCCGGTGGTACGACCATGTACCCAGGTATCTCCGACCGTATGCAGAAGGAGATCACTGCCCTTGCCCCCTCGACCATGAAGGTCAAGATCATCGCTCCTCCCGAACGTAAATACTCCGTCTGGATCGGTGGTTTA-GGCGACCTGAACCACCTCGTTTCCGCTGTCATGTCCGGCGTGTCCACCTCTCTGCGTTTCCCCGGCCAGCTCAACTCTGATCTCCGCAAGTTGGCTGTTAACATGGTTCCCTTCCCTCGTCTCCACTTCTTCATGGTTGGCTTTGCTCCTCTCACCAGCCGCAACGCCTACTCTTTCCGTGCCGTCACCGTTCCGGAGCTCACCCAGCAGATGTACGACCCTAAGAACATGATGGCTGCTACTGACTTCCGTAACGGTCGTTACCTCACCTGCTCTGCTATCTTGTAAGTTTCGTTCC----TACA---ATCTTGGTATGAGGCATTT--TTCTAACTCCC-TCCAGCCGTGGCCGCGTCTCCATGAAAGAAGTCGAAGACCAAATGCGCAACGTCCAAAACAAGAACAGCACCTACTTCGTCGAATGGATCCCGAACAACGTGCAGACCGCCCTCTGCTCCATCCCTCCACGCGGTCTCTCCATGTCCTCCACCTTTGTCGGAAACTCCACCTCCATCCAGGAACTCTTCAAGCGTGTCGGTGACCAGTTCACGGCCATGTTCCGTCGCAAGGCTTTCTTGCATTG Spiromastix_warcupii_CBS_576.63 GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGTGCCTGTAGTTGTTGGC-GGCTC----CTCCGGGGGTTCGTTCGGCGCTACGTTCGGCCCAACCGTGTCTATCTATACCTGTTGCTTCGGCGGGCCTGCGGGCT-TGCTCGCTGCCGGGAGCCCCTAAAGCTCCGGGCGCGTGCCCGCCGAAGACGCCTAGAACTACTGTTGAACTTAGCGGTCTGAGTGGGCTTTA-TAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTCTGGTATTCCGGGAGGCATGCCTGTCCGAGCGTCATTGCAA-CCCCTTCAAGCTCAGCTTGTGTGTTGGGC-GACGTCCCCGCTGGACGCGCCCGAAAGGCAG{GT}GGCGGCTCCGTGCTTCGGTGCCCGAGCGTATGGACTTTAGTT-ACCCGCTCTAGTGGCCCGGCCGGCGCTGGCCCCCTA--------------------------------AGTCTTAACTGGATTCCGGTTAAGGTCTTAACTG-AAATTTCGTGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCAGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGTCGCCGCCTAAGTCCCCTGGAACGGGGCGTCAGAGAGGGTGAGAATCCCGTCTTTGGTGGGCTGATCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGGGGGCTCACTGAGCATGCT-TGCTTAGGCACTCCCTCAGGGTCGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCTCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCCGGATCGAGGAACCACCCCGTCCTGTTGACCGAGGCTCCCATCAACCCCAAGTCCAACCGAGAGAAGATGACCCAGATCGTTTTCGAAACCTTCAACGCCCCCGCCTT{CG}TACGTCTCCATCCAGGCCGTCCTGTCCTTGTACGCTTCTGGTCGTACCACTGGTATCGTTCTTGACTCTGGTGATGGTGTCACTCACGTCGTCCCCATCTACGAGGGTTTCGCTCTTCCCCATGCCATCTCCCGTATGGACATGGCTGGTCGTGACTTGACCGACTACCTGATGAAGATCCTTGCCGAGCGTGGCTACTCCTTCTCGACCACTGCTGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTTGACTTCCAGCAGGAGATCCAGACCGCTTCCCAGAGCTCTGCTTTGGAGAAGTCCTACGAACTCCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGGTTCCGTGCTCCTGAGGCTCTCTTCCAGCCTAGCGTACTCGGCCATGAGGGCGGTGGTATCCACACTACTACCTACAACGCCATCATGAAGTGTGATGTCGACGTGAGGAAGGATCTCTACGGCAACATCGTCATGGTAAGACTGCTTTTTTCCTATT-CCTTGTCAATGGTAATAA-TAGTACTAAAATATCATAGTCCGGTGGTACGACCATGTACCCAGGTATCTCCGACCGTATGCAGAAGGAGATCACTGCCCTCGCTCCCTCGACCATGAAGGTCAAGATCATCGCTCCTCCCGAACGTAAATACTCCGTCTGGATCGGTGGCTTACGGCGACCTGAACCACCTCGTTTCCGCTGTCATGTCCGGCGTGTCCACCTCTCTTCGTTTCCCCGGCCAGCTCAACTCTGATCTCCGCAAGTTGGCTGTTAACATGGTTCCCTTCCCTCGTCTCCACTTCTTCATGGTCGGCTTTGCCCCTCTCACCAGCCGCAACGCCTACTCTTTCCGTGCCGTCACCGTTCCGGAGCTCACCCAGCAGATGTACGACCCTAAGAACATGATGGCTGCTACTGACTTCCGTAACGGTCGTTACCTCACCTGCTCTGCTATCTTGTAAGTTTCGTTCC----TACA---ATCCTGGTATGAGGCATTT--TCCTAACTCCC-TCCAGCCGTGGCCGCGTCTCCATGAAAGAAGTCGAAGACCAAATGCGCAACGTCCAAAACAAGAACAGCACCTACTTCGTCGAATGGATCCCGAACAACGTGCAGACCGCCCTCTGCTCCATCCCTCCACGCGGTCTCTCCATGTCCTCCACCTTTGTCGGAAACTCCACCTCCATCCAGGAACTCTTCAAGCGTGTCGGTGACCAGTTCACGGCCATGTTCCGTCGCAAGGCTTTCTTGCATTG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M33668] TITLE Spiromastigoides_D1_D2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=504; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ajellomyces_capsulatus_UAMH_7141 AGCGGCAAGAGCTCAAATTTGAAATCCGGCCCCCCT--GGGGGCCTGAGTTGTAATTTGCAGAGGATGCTTCGGGCGCGACCGCGGTCCAAGTCCCCTGGAACGGGGCGTCGTAGAGGGTGAGAATCCCGTCTCCGGCCGGCCGGTCTCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTCAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGTTCAGCG-GGCATTCGT-TGCCCGTGCAATCCCCCG-CGGCCGGGCCAGGGTCGGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATATCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAAC Ajellomyces_dermatitidis_ATCC_18187 AGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTT---GGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGTGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCTTCGCCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGTGGGGGTTCAGCG-GGCATTCGT-TGCCCGTGCACTCCCCCA-CGGGCGGGCCAGCGTCGGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAAC Ajellomyces_grisea_CBS_128.88 AGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTC---GGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCGTGGTCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGTAGAGGGTGAGAATCCCGTCTTCGGCCGGCTGGCTTCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGCTCAGCG-GGCACTCGT-TGCCCGTGCACTCCCCCG-GGGTCGGGTCAGCGTCAGTTTCGGCGGTCGGTCAAAGGCCCCCAGAATGTGTCGCCCTTCGGGGCGTCTTATAGCTGGGGGTGCAATGCGGCCCGCCGGGACTGAGGAAC Ajellomyces_grisea_UAMH_6836 AGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTC---GGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCGTGGTCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGTAGAGGGTGAGAATCCCGTCTTCGGCCGGCTGGCTTCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGCTCAGCG-GGCACTCGT-TGCCCGTGCACTCCCCCG-GGGTCGGGTCAGCGTCAGTTTCGGCGGTCGGTCAAAGGCCCCCAGAATGTGTCGCCCTTCGGGGCGTCTTATAGCTGGGGGTGCAATGCGGCCCGCCGGGACTGAGGAAC Amauroascus_niger_ATCC_22339 AGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCGTC--AGGAGTCCGAGTTGTAATTTGGAGAGGACACTTCGGGTGCGGCCACGGCGTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTTGAGCCGCTGAACCGCGCCCATGCGAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGGTCGTGGGGGCTCAGCG-GGCATGCG--TGCCCGTGTACTCCCCCA-TGTTCGGGCCAGCATCAGTTTCGGCGGTTGGTTAAAGGCTCATGGAATGTATCGTCCTCCGGGACGTCTTATAGCCAGGGGCGTAATGCGGCCAGCCGGGACTGAGGAAC Aphanoascus_mephitalis_ATCC_22144 AGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCGTT--AGGTGCCCGAGTTGTAATTTGGAGAGGATACTTCGGGTGTGGCTACGGCGTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTTAAGTCGATAGACCACGCCCATGCGAAGTTCCTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGGTCATAGGGGCTCAACGTGGCATTTGTATGCCCGTGTACTCCCCTG-TGTTCGGGCCAGCATCAGTTCTGGCGGTTGGTTAAAGGCCCTTGGAATGTATCATCCTCCGGGATGCCTTATAGCCAAGGGTGTAATGCAGCCAGCCGGGACTGAGGAAC Arachnomyces_glareosus_CBS_116129 AGCGGCAAGAGCTCAAATTTGAAATCTGGTCCCCTC---GGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTTCGGCCCCGGTCTAAGTCCCCTGGAACGGGGCGTCATGGAGGGTGAGAATCCCGTCTGGGATCGAC-GGCCGGACCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGGCTCAGCC-GGCATTCT--TGCCGGTGCACTCCCCCG-CGGTCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGTCCCCGGAATGTGTCGCCCCTCGGGGCGTCTTATAGCCGGGGGCGCAATGCGGCCTGCCCGGACCGAGGAAC Arachnomyces_minimus_CBS_324.70 AGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCCCC---GGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCCCGGCCCCGGTCTAAGTCCCCTGGAACGGGGCGTCACGGAGGGTGAGAATCCCGTCTGGGACCGGC-GGCCGGACCCGTGCGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGGCTCAGCC-GGCATTCT--TGCCGGTGCACTCCCCCG-CGGTCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGTCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGCGCAATGCGGCCTGCCCGGACCGAGGAAC Arachnomyces_nodosetosus_CCF_3957 ????????????????ATTTGAAATCTGGCCCCTCC--CGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTCCGGCCCCGGTCTAAGTCCCCTGGAACGGGGCGTCACGGAGGGTGAGAATCCCGTCTGGGACCGTCAGGCCGGCCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTCCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGGCTCAGCC-GGCATTCTC-TGCCGGTGCACTCCCCCG-CGGTCGGGCCAGCGTCGGTTCAGGCGGTCGGTCAAAGGCCCCCGGAATGTGTCGCCCCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCCGCCCGGACCGAGGAAC 'Arthroderma cajetani OMH H1-10' AGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCTTC-GGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGTGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGACGGCCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGC-GGGGTTCAGCG-GGCGCTCGT-CGCCCGTGCACTCCCCGT-TCTCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCTGTCGGGACTGAGGAAC Arthroderma_ciferrii_ATCC_24447 AGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTA--GGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGCGGCCACGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGGTCGTTGGTCCACGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGAGCGC-GGGGCTCATCA-GGTGCGTGT-CACCTGTGCACTCCCCGC-CGCTCGGGCCAGCATCAGTTCTGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGCCGGGACTGAGGAAC Arthroderma_otae_UAMH_2338 AGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCTTGGGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGTGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTCTTGGGCGGCCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGAGGGGCGGGGTTCAGCG-GGTGCGCGT-CACCCGTGCACTCCCCGTCCCCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTAGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGCCGGGACTGAGGAAC Ascosphaera_aggregata_KVL_1006 AGCGGCAAAAGCTCAAATTTGAAATCTGGCCTCTTT---GGGGTCCGAGTTGTAATTTGGAGAGGATGCTCTGGGAGTGGTCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGACTTCGCCCGTGTAGAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCATGTGAAATTGTTGAAAGGGAAGCACATGCGACCAGAGTCGGCCGTGGGGGTTCGGCG-GGGGTTCT--CCCTCGTTTACTCCCCTG-CGGTCGGGCCAGCATCAGTTCTGGCGGCCGGTTAAAGGCTTCGGGAATGTGTCGTCCTCCGGGACGTCTTATAGCCCGAGGTGCAATGCGGCCAGCCGGGACTGAGGAAC 'Ascosphaera apis ATCC MYA-4450' AGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTC---GGGGTCCGAGTTGTAATTTGGAGAGGATGCTCTGGGAGTGGTCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCTGCAACCGTGTAGAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCATGTGAAATTGTTGAAAGGGAAGCACATGCGACCAGAGTCGGCCGTGGGGGTTCAGCA-GGGGTTCT--CCCCTGTGTATTCCCCTG-CGGTCGGGCCAGCATCAGTTCTGGCGGCCGGTTAAAGGCTTCGGGAATGTATCCTCCTCCGGGAGGTCTTATAGCCCGAGGTGCAATGCGGCCAGCCGGGACTGAGGAAC Ascosphaera_apis_CBS_252.32 ????????????????????????????????????---?????CCGAGTTGTAATTTGTAGAGGATGCTCTGGGAGTGGTCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCTGCAACCGTGTAGAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCATGTGAAATTGTTGAAAGGGAAGCACATGCGACCAGAGTCGGCCGTGGGGGTTCAGCA-GGGGTTCT--CCCCTGTGTATTCCCCTG-CGGTCGGGCCAGCATCAGTTCTGGCGGCCGGTTAAAGGCTTCGGGAATGTATCCTCCTCCGGGAGGTCTTATAGCCCGAGGTGCAATGCGGCCAGCCGGGACTGAGGAAC Ascosphaera_duoformis_ARSEF_693 AGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTCC---GGGGTCCGAGTTGTAATTTGGAGAGGATGCTCTGGGGGTGGTCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGACCATGCCCGTGTAGAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCACAAGCGACCAGAGTCGGCCGCGGGGGTTCAGCA-GGGGTCCT--CCCCTGTGTATTCCCCCG-TGGTCGGGCCAGCATCAGTTCTGGCGGCCGGTCAAAGGCTCCGGGAATGTGTCGCCCTTCGGGACGACTTATAGCCCGGGGTGCAATGCGGCCAGCCGGGACTGAGGAAC Ascosphaera_subglobosa_A.A._Wynns_5004 AGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTC---GGGGTCCGAGTTGTAATTTGGAGAGGATGCTCTGGGGGTGGTCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCCATGCCCGTGTAGAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAGTTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGAGTCGGCCACGGGGGCTCAGCG-GGGGTCCT--CCCCTGTGTACTCCCCCG-CGGTCGGGCCAGCATCAGTTCTGGCGGTCGGTCAAAGGCTCCGGGAATGTACCGTCCTTCGGGACGTCTTATAGCCCGGGGTGCAATGCGGCCAGCCGGGACTGAGGAAC 'Bettsia alvei KVL 10-08' AGCGGCAACAGCTCAAATTTGAAATCTGGCCTC------ACGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGAGCATGGTC-CGGCCTAAGTGTCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGTCGGGTGCCTACGCTCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCGGCCGATCATCC-GGTGTTCT--CACCGGTGCACTCGGTCG-CGTGCAGGCCAGCATCGGTTCTGGTGGCTGGATAAAGGCCCTAGGAATGTGGCTCCTCTCGGGGAGTGTTATAGCCTAGGGTGCAATGCAGCCTACCGGGACCGAGGACC Byssochlamys_nivea_CBS_100.11 AGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCTCC---GGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGTCCCCATCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGT-GGCCGTGCCCGTGTGAAGCTCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGGTTCAGCC-GGTACTCG--TACCGGTGTATTCCCCCG-TGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCAGCCTGGACCGAGGAAC Chrysosporium_keratinophilum_CBS_392.67 AGCGGCAAAAGCTCAAATTTGAAATCTGGCACCGTT--AGGTGTCCGAGTTGTAATTTGGAGAGGATACTTCGGGTGTGGCTACGGCGTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTTAAGTCGTTTGTCCATGCCCATGCGAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGGTCATAGGGGCTCAGCG-AGCATGCG--TGCTCGTGTACTCCCCTG-TGTTCGGGCCAGCATCAGTTCTGGCGGTTGGTTAAAGGCCCTTGGAATGTATCATCCTCCGGGATGTCTTATAGCCAAGGGTGTAATGCAGCCAGCCGGGACTGAGGAAC Chrysosporium_tropicum_MUCL_10068 AGCGGCAAAAGCTCAAATTTGAAATCTGGCACCGTT--AGGTGTCCGAGTTGTAATTTGGAGAGGATACTTCGGGTGTGGCTACGGCGTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTTAAGTCGTTTGTCCACGCCCATGCGAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGGTCACAGGGGCTCAGCG-AGCATGCG--TGCTCGTGTACTCCCCTG-TGTTCGGGCCAGCATCAGTTCTGGCGGTTGGTTAAAGGCCCTTGGAATGTATCGTCCTCCGGGACGTCTTATAGCCAAGGGTGTAATGCGGCCAGCCGGGACTGAGGAAC Chrysosporium_vallenarense_UAMH_6914 AGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTT--AGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGAGCGGCCACGGCTTAAGTGCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTGGGTCGTTGGTCCGCGCCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGTAC-AGGGTTCAGCG-GGTGCGTGT-CACCCGTGCACTCCCTGT-TTCCCGGGCCAGCATCAGTTCTGACGGCCGGTCAAAGGCCCCTGGAATGTGTCGTCTTTCGGGACGTCTTATAGCCAGGGGTGCAATGCGGCCCGTTGGGACTGAGGAAC Ctenomyces_serratus_CBS_187.61 AGCGGCAAAAGCTCAAATTTGAAATCTGGCCCTTTC---AGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTTTGGTCGTCGGCCCGCGCCCGTGTGAAGCTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGTGC-GGGGTTCAGCG-GACGCGTGT-CGTCCGTGCACTCCCCGT-TTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCTCTGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCAGAGGTGCAATGCGGCCTGTTGGGACTGAGGAAC 'Eremascus fertilis KVL 10-09' AGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCTC---GGGGTCCGAGTTGTAATTTGTAGAAGATGCTTCGGGTGTGGCCCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGACCGGT-GGCCTCCCCCGTGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGTCGATCATCC-GGGGTTCT--CCCCGGTGCACTCGGCCG-TGCGCAGGCCAGCATCGGTTTGGGCGGCCGGACAAAGGCCTCGGGAATGTGGC-TCCTTCGGGA-GTGTTATAGCCCGAGGTGCAATGCGGCCAGCCCGGACCGAGGACC Eurotium_herbariorum_ATCC_16469 AGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCTCC---GGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGCGGCCCCCGTCTAAGTGCTCTGGAACGGGCCATCGGAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCCGCGTCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTTCC-GGGGTTCAGCC-GGCTTTCG--GGCCGGTGTACTTCCCCG-GGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAACGCCCCTCGGGGCGCCTTATAGCCAGGGGTGTCATGCGGCCAGCCTGGACCGAGGAAC Gymnascus_aurantiacus_ATCC_22394 AGCGGCAAAAGCTCAAATTTGAAATCTGGCCCTTTC---AGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGAGCGGCGGCGGTCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTCTTGGATCGCATTGCCGTGACCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCTGCCTCGGAGGCTCAGTG-GGCACGTG--TGTCCATGCACTCCTCCGGTGGTGGGGCCAGCATCAGTTCTGACGGTCGGTCAAAGGCCCCTGGAATGTATCGTCCTCCGGGACGTCTTATAGCCAGGGGTGCAATGCGGCCAGTCGGGACTGAGGAAC Gymnoascus_littoralis_CBS_454.73 AGCGGCAAAAGCTCAAATTTGAAATCTGGCCCTTTC---AGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGAGCGGCGGCGGTCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTCTTGGACCGCATGCCCGTGACCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGGCCGCAGAGGCTCAGTG-GGCACGTG--TGCCCATGCACTCCTCTG-TGGTCGGGCCAGCATCAGTTCTGACGGCCGGTCAAAGGCCCCCGGAATGTATCCTCCTCCGGGAGGTCTTATAGCCGGGGGTGCAATGCGGTCAGTCGGGACTGAGGAAC Gymnoascus_ruber_CBS_352.90 AGCGGCAAAAGCTCAAATTTGAAATCTGGCCCTTTC---AGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGAGTGGCGGCGGTCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTCTTGGATCGCAGTGCCGTGACCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCTGCCTCGGAGGCTCAGTG-GACACGTG--TGTCCATGCACTCCTCCGGTGGTGGGGCCAGCATCAGTTCTGACGGTCGGTCAAAGGCCCCTGGAATGTATCGTCCTCCGGGACGTCTTATAGCCAGGGGTGCAATGCGGCCAGTCGGGACTGAGGAAC Lecythophora_hoffmannii_CBS_140.41 AGCGGCAACAGCTCAAATTTGAAATCTGGCTTC--------GGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGT-GCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTAT--AGTCGGAC-ACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCC-AGTGTTCT--CACTGGTGCACTCGACCC-GGCTCAGGCCAGCGTCGGTTCTCGTGGGGGGATAAAAACTTCGGGAACGTGGC-TCCTCCGGGA-GTGTTATAGCCCGTTGTTTAATACC-CTCGTGGGGACCGAGGTTC 'Nannizziopsis arthrosporioides UTHSC R-4263' AGCGGCAGAAGCTCAAATTTGAAATCTGGCCCCTCT--GGGGGTCCGAGTTGTAATTTGCAGAGGACACTTCGGGTGCGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCCG-TGGGCTTGCCCCGTGTGAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAGGCTAAATACTGGCGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCAGCCAGACACGGACCCGGGGGCTCAGCG-GGCATGCG--TGCCCGTGCACTCCCCCGCGGTCCGGGCCAGCATCGGTTTCGGCGGCCGGTCAAAGGCCCCGGGAAGGTATCGTCCTCCGGGACGACTTACAGCCCGGGGCGCAATGCGGCCAGCCGGGACCGAGGAAC 'Nannizziopsis guarroi UTHSC 06-3993' AGCGGCAGAAGCTCAAATTTGAAATCTGGCCCCTCT--GGGGGTCCGAGTTGTAATTTGCAGAGGACACTTCGGGTGCGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGGAGAGGGTGAGAATCCCGTCTGGGACCG-TGGACCTGCCCCGTGTGAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCAGCCAGACAGGAACCCGGGGGCTCAGCG-GGCATGCG--TGCCCGTGCACTCCCCCGCGGTTCCGGCCAGCATCAGTTTCGGCGGCCGGTCAAAGGCCCCGGGAAGGTATCGTCCTCCGGGACGACTTACAGCCCGGGGTGCAATGCGGCCAGTCGGGACTGAGGAAC 'Nannizziopsis guarroi UTHSC 07-3227' AGCGGCAGAAGCTCAAATTTGAAATCTGGCCCCTCT--GGGGGTCCGAGTTGTAATTTGCAGAGGACACTTCGGGTGCGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGGAGAGGGTGAGAATCCCGTCTGGGACCG-TGGACCTGCCCCGTGTGAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCAGCCAGACAGGAACCCGGGGGCTCAGCG-GGCATGCG--TGCCCGTGCACTCCCCCGCGGTTCCGGCCAGCATCAGTTTCGGCGGCCGGTCAAAGGCCCCGGGAAGGTATCGTCCTCCGGGACGACTTACAGCCCGGGGTGCAATGCGGCCAGTCGGGACTGAGGAAC 'Nannizziopsis pluriseptata UTHSC 10-1045' AGCGGCAGAAGCTCAAATTTGAAATCTGGCCTCTTT--GGGGGTCCGAGTTGTAATTTGCAGAGGACACTTCGGGTGCGGCCGCGGCCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTGGGCCG-TGGGCCTGCCCCGTGTGAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAGGCTAAATACTGGCGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCAGCCAGACACGGACTCGGGGGCTCAGCG-GGCATGCG--TGCCCGTGCACTCCCCCGCGGTCCGGGCCAGCATCGGTTTCGGCGGCCGGTCAAAGGCCCCGGGAAGGTATCGTCCTCCGGGACGACTTACAGCCCGGGGTGCAATGCGGCCAGCCGGGACCGAGGTAC Nannizziopsis_vriesii_IMI_149994 AGCGGCAGAAGCTCAAATTTGAAATCTGGCCCCTCT--GGGGGTCCGAGTTGTAATTTGCAGAGGACACTTCGGGTGCGGTCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGGAGAGGGTGAGAATCCCGTCTGGGACCG-TGGACCTGCCCCGTGTGAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCAGCCAGACAGGGACCCGGGGGCTCAGCG-GGCATGCG--TGCCCGTGCACTCCCCCGCGGTCCCGGCCAGCATCGGTTTCGGCGGCCGGTCAAAGGCCCCGGGAAGGTATCGTCCTCCGGGACGACTTACAGCCCGGGGTGCAATGCGGCCAGTCGGGACCGAGGAAC Paracoccidioides_brasiliensis_IMTSP_556 ??????????????????TTGAAATCTGGCTCCTTC---GGGGCCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCGTGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCCCCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGCTCAGCG-GGCACTCGT-TGCCCGTGCACTCCCCCG-TGGTCGGGCCAGCGTCGGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAAC Paracoccidioides_brasiliensis_Pb01 AGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTC---GGGGCCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCGTGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCCCCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGCTCAGCG-GGCACTCGT-TGCCCGTGCACTCCCCCG-TGGTCGGGCCAGCGTCGGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAAC Petromyces_alliaceus_ATCC_16891 AGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTC---GGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTATCTAAGTGCCCTGGAACGGGCCGTCGGAGAGGGTGAGAATCCCGTCTGGGATAGGGTGTCCGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTTC-AGGGTTCAGCC-GGCACTCG--TGCCGGTGTACTTCCCTG-GAGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAAC Pseudospiromastix_tentaculata_CBS_184.92 AGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCA-GGGGGTCCGAGTTGTAATTTGGAGAGGATGCTTCGGGTGCGGCCCCGGTCTAAGTCCCTTGGAACGGGGCATCAGAGAGGGTGAGAGTCCCGTCTTCGGCCGGC-GGCCAAGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGCTCAGCG-GGCATGCT--TGCCCGTGCACTCCCCCG-TGGTTGGGCCAGCATCGGTTCGGGCGGTTGGTTAAAGGTCCCCGGAATGTGTCGCCCTTCGGGGCGTCTTATAGCCGGGGGCGCAATGCGGCCTGCCCGGACCGAGGCAC Spiromastix_alatospora_CBS_457.73 AGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTC---GGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGCCGCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGGTGGGCCGGCTGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGACTCCAGGGGCTCACCG-GGCATGCTC-TGCCCGGGCACTCCCCTG-GGGCCGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCTGCCCGGATCGAGGAAC Spiromastix_asexualis_CBS_136728 AGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTC---GGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGTCGCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGGTGGGCCGGCCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGAGGGCTCACCG-AGCATGCT--TGCTTGGGCACTCCCTCA-GGGTCGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCCCGGAATGTGTCGTCCTTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCTGCTTGGACCGAGGAAC Spiromastix_asexualis_CBS_136729 AGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTC---GGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGTCGCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGGTGGGCCGGCCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGAGGGCTCACCG-AGCATGCT--TGCTTGGGCACTCCCTCA-GGGTCGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCCCGGAATGTGTCGTCCTTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCTGCTTGGACCGAGGAAC Spiromastix_sp._JCM_11276 AGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTC---GGTGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGTCGCCGCCTAAGTCCCCTGGAACGGGGCGTCAGAGAGGGTGAGAATCCCGTCTTTGGTGGGCTGGCCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGGGGGCTCACTG-AGCATGCT--TGCTTAGGCACTCCCTCA-GGGTCGGGTCAGCATCGGTTTAGGCGGTTGGTTAAAGGCTCCCGGAATGTGTCGCCCTTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCTGCCTGGACCGAGGATC 'Spiromastix sp. UTHSCSA DI 14-25' AGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTCC---GGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGCCGCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGGTGGGCCGGTCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCTCCAGGGGTTCAGCG-GGCATGCTC-TGCCCGTGCACTCCCCCG-GGGCCGGGTCAGCATCGGTTCGGGCGGTTGGTCAAAGGCTCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCAGCCAGCCTGGACCGAGGAAC 'Spiromastix warcupii AFTOL-ID 430' AGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTC---GGGGCCCGAGTTGTAATTTGCAGAGGATGCTCCGGGGGTGGTCGCCGCCTAAGTCCCCTGGAACGGGGCGTCAGAGAGGGTGAGAATCCCGTCTTTGGTGGGCTGATCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGGGGGCTCACTG-AGCATGCT--TGCTTAGGCACTCCCTCA-GGGTCGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCTCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCCGGATCGAGGAAC Spiromastix_warcupii_CBS_576.63 AGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTC---GGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGTCGCCGCCTAAGTCCCCTGGAACGGGGCGTCAGAGAGGGTGAGAATCCCGTCTTTGGTGGGCTGATCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGGGGGCTCACTG-AGCATGCT--TGCTTAGGCACTCCCTCA-GGGTCGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCTCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCCGGATCGAGGAAC Spiromastix_warcupii_NRRL_3034 AGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTC---GGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGTCGCCGCCTAAGTCCCCTGGAACGGGGCGTCAGAGAGGGTGAGAATCCCGTCTTTGGTGGGCTGATCTCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGGGGGCTCACTG-AGCATGCT--TGCTTAGGCACTCCCTCA-GGGTCGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCTCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCCGGATCGAGGAAC Spiromastix_warcupii_UAMH_7099 AGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTC---GGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGTGGTCGCCGCCTAAGTCCCCTGGAACGGGGCGTCAGAGAGGGTGAGAATCCCGTCTTTGGTGGGCTGATCGCTCCCGGGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGACGAAAAGTACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTGGCCGCCAGATTCGGCCTTGAGGGCTCACTG-AGCATGCT--TGCTTAGGCACTCCCTCA-GGGTCGGGTCAGCATCGGTTCAGGCGGTCGGTCAAAGGCCCTCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCTGCCCGGATCGAGGAAC Uncinocarpus_reesii_ATCC_34533 AGCGGCAAAAGCTCAAATTTGAAATCTGGCCCCGTC--AGGGGTCCGAGTTGTAATTTGGAGAGGATACTTCGGGTGTGGCCGTGGCTTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTTGAGTCACCGGTCCACGCCCATGCGAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGAGCGC-AGGGTTCAGCG-GGCATGCG--TGCCCGTGTACTCTCTG--CGCTCGGGCCAGCATCAGTTTCGGCGGTTGGTTAAAGGCCTCTGGAATGTATCGTCCTCCGGGACGTCTTATAGCCAGGGGTGCAATGCGGCCAGCCGGGACTGAGGAAC ; END; BEGIN TREES; TITLE 'Spiromastigoides d1-d2'; LINK TAXA = Taxa1; TRANSLATE 1 'Nannizziopsis guarroi UTHSC 06-3993', 2 'Nannizziopsis pluriseptata UTHSC 10-1045', 3 Spiromastix_asexualis_CBS_136729, 4 Nannizziopsis_vriesii_IMI_149994, 5 Ajellomyces_grisea_CBS_128.88, 6 Pseudospiromastix_tentaculata_CBS_184.92, 7 Spiromastix_warcupii_CBS_576.63, 8 Spiromastix_sp._JCM_11276, 9 Ajellomyces_capsulatus_UAMH_7141, 10 Arthroderma_ciferrii_ATCC_24447, 11 Amauroascus_niger_ATCC_22339, 12 Aphanoascus_mephitalis_ATCC_22144, 13 Gymnoascus_littoralis_CBS_454.73, 14 Gymnoascus_ruber_CBS_352.90, 15 'Arthroderma cajetani OMH H1-10', 16 Arthroderma_otae_UAMH_2338, 17 Ascosphaera_apis_CBS_252.32, 18 Spiromastix_warcupii_UAMH_7099, 19 Chrysosporium_vallenarense_UAMH_6914, 20 Chrysosporium_keratinophilum_CBS_392.67, 21 Ctenomyces_serratus_CBS_187.61, 22 Chrysosporium_tropicum_MUCL_10068, 23 Spiromastix_asexualis_CBS_136728, 24 'Spiromastix warcupii AFTOL-ID 430', 25 Arachnomyces_glareosus_CBS_116129, 26 Arachnomyces_minimus_CBS_324.70, 27 Ajellomyces_dermatitidis_ATCC_18187, 28 Ajellomyces_grisea_UAMH_6836, 29 Byssochlamys_nivea_CBS_100.11, 30 Eurotium_herbariorum_ATCC_16469, 31 Spiromastix_alatospora_CBS_457.73, 32 Petromyces_alliaceus_ATCC_16891, 33 Ascosphaera_subglobosa_A.A._Wynns_5004, 34 'Eremascus fertilis KVL 10-09', 35 Ascosphaera_duoformis_ARSEF_693, 36 Ascosphaera_aggregata_KVL_1006, 37 'Ascosphaera apis ATCC MYA-4450', 38 Paracoccidioides_brasiliensis_IMTSP_556, 39 Gymnascus_aurantiacus_ATCC_22394, 40 'Spiromastix sp. UTHSCSA DI 14-25', 41 Arachnomyces_nodosetosus_CCF_3957, 42 'Bettsia alvei KVL 10-08', 43 Lecythophora_hoffmannii_CBS_140.41, 44 Paracoccidioides_brasiliensis_Pb01, 45 'Nannizziopsis guarroi UTHSC 07-3227', 46 'Nannizziopsis arthrosporioides UTHSC R-4263', 47 Spiromastix_warcupii_NRRL_3034, 48 Uncinocarpus_reesii_ATCC_34533; TREE tree_1 = [&R] ; END; BEGIN TREES; TITLE 'Spiromastigoides ITS D1-D2 ACT TUB'; LINK TAXA = Taxa2; TRANSLATE 1 Spiromastix_asexualis_CBS_136728, 2 Spiromastix_asexualis_CBS_136729, 3 'Spiromastix sp. UTHSCSA DI 14-25', 4 Spiromastix_warcupii_CBS_576.63, 5 Spiromastix_sp._JCM_11276, 6 Spiromastix_alatospora_CBS_457.73, 7 Spiromastix_warcupii_CBS_186.92; TREE tree_2 = [&R] ; END;