#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 10:49 GMT TreeBASE (cc) 1994-2008 Study reference: Yokoyama R., & Honda D. 2007. Taxonomic rearrangement of the genus Schizochytrium sensu lato based on morphology, chemotaxonomic characteristics, and 18S rRNA gene phylogeny (Thraustochytriaceae, Labyrinthulomycetes): emendation for Schizochytrium and erection of Aurantiochytrium and Oblongichytrium gen. nov. Mycoscience, 48(4): 199-211. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1834] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=51; TAXLABELS Aplanochytrium_kerguelense Aplanochytrium_minutum Aplanochytrium_sp._PR1_1 Aplanochytrium_sp._PR15 Aplanochytrium_sp._SC1_1 Aplanochytrium_stocchinoi Aurantiochytrium_limacinum Aurantiochytrium_mangrovei Aurantiochytrium_sp._BURABQ_133 Aurantiochytrium_sp._FJN_10 Aurantiochytrium_sp._KH105 Aurantiochytrium_sp._N1_27 Aurantiochytrium_sp._NIOS_4 Aurantiochytrium_sp._SEK209 Aurantiochytrium_sp._SEK217 Aurantiochytrium_sp._SEK218 Bacillaria_paxillifer Japonochytrium_sp._ATCC_28207 Labyrinthula_sp._AN_1565 Labyrinthula_sp._L59 Labyrinthula_sp._L72 Labyrinthula_sp._f_Sap_16_1 Oblongichytrium_minutum Oblongichytrium_multirudimentale Oblongichytrium_sp._7_5 Oblongichytrium_sp._8_7 Oblongichytrium_sp._SEK347 Ochromonas_danica Quahog_parasite_X Schizochytrium_aggregatum Schizochytrium_sp._KK17_3 Schizochytrium_sp._N4_103 Schizochytrium_sp._SEK210 Schizochytrium_sp._SEK345 Schizochytrium_sp._SEK346 Thraustochytriidae_sp._BS1 Thraustochytriidae_sp._BS2 Thraustochytriidae_sp._C9G Thraustochytriidae_sp._Fng1 Thraustochytriidae_sp._H1_14 Thraustochytriidae_sp._NIOS_6 Thraustochytrium_aggregatum Thraustochytrium_aureum Thraustochytrium_kinnei Thraustochytrium_pachydermum Thraustochytrium_striatum Ulkenia_profunda_29 Ulkenia_profunda_KMPB_N_3077 Ulkenia_radiata Ulkenia_visurgensis Uncultured_thraustochytrid ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1956] TITLE 18S_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2135; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aplanochytrium_kerguelense ----------------GGTGAT-CCTGCCAGTAGTCATACGCTCG-TCTCAAAGATTAAGCCATGCATGTCTAAGTGCAAG-CAC--TTGTAC-TGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGATG---CCTA---CTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATG-CAA-CAAAGCCCAACT---TTTC---GGA--CGGGCTGTATTTATTAGA-TAG---AAACCAATGCGGGG-TTCTCCCCGG--TGTTGTGGTGAGTCATAATAACTAAG-----CGAATCGCAGTGGC--TTCG---GCCGGCGATGAATCATT-CAAGTTTCTGCCCTATCA-GCTGTCG-ATGGTAG-GGTATTGGCC-TACCAT-GGCGTTAACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTGATAC-GGGGAGGTAGTGA-CAATAAATAACAATAC--GGGGCCC---ATCGGGTCT-TGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCACCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGGATTTCTGGT-AGGAGTGA------CGTTCCGGACTT-------------------GATTGT---------CCGTGT-ATTGTGTTGTCTCCAGCCATCC-------TCGTGGAGAACT-------------TTTCCAGCA--TTAACTTGTTGGGATTGGG----------------ACCCACGTCG-TTTACTGTGAAAAAAT--TAGAGTGTT-TAAA-GCAGGC-----AATCGC--TTGAATAC--ATTAGCATGGAATAATAAGATAGGACTT-TGGTACT----------------------------------ATTTT-GTTGGTT--TG-CATACCAAATTAATG-ATCAACAGGAAC-AGTT--GAGGATATTCGTATGAACATG-T-CAGAGGTGAAATTCTT--GGATTTTGAT-CAGACGAACTACTGCG-AAAGCATTTATCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACTAGGG--ATTGGCGGAC--GTTG-------TTTA------ATTGACTCCGCCA-GCACCTCA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGG--CTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGT-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTGCTAA-ATAGTGTGC---GTATTCGAAA---GAATGCG----TTCGACTTCTTAGAGGGACATTTCG--GTTTT-ACCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACAATGATGAATTCAACGAGTT----------------------------TATA-ACCTTGGTT--GAAAAGCCT-GGG--TAATCTTTTGAACTTTCGTCG-TGATGGGGCTAGACCCTTGCAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCTAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAATCTTCGGACCGTGACTTTGATTTGTTCAC--TCAAAACGCTGTTATGGGAAG---TTGATTA-AACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAG-TGAA-CCT-GCA------------ Aplanochytrium_minutum ----------AACCTGGTTGAT-CCTGCCAGTAGTCATACGCTCG-TCTCAAAGATTAAGCCATGCATGTCTAAGTGCAAG-CAC--TTGTAC-TGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGATT---TCTA---CTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATG-CAA-CAAAGCCCATTT----------------GGGCTGTATTTATTAGA-TAG---AAACCAATGCAGGGTTTTC---CCTGGTGTTGTGGTGAGTCATAATAACTAAG-----CGAATCGCAGTGGC--TTCG---GCCGGCGATGAATCATT-CAAGTTTCTGCCCTATCA-GCTGTCG-ATGGTAG-TGTATTGGAC-TACCAT-GGCGTTAACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTGATAC-GGGGAGGTAGTGA-CAATAAATAACAATAC--GGGGCCC---ATCGGGTCT-TGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGGATTTCTGGTAGGAGTGA------CCGTTCCGAACTT-------------------GATTG----------TTCGTGTATTGTGTTTTCTCCAGCCATCCT-------TGTGGAGAACT-------------TTTCTTGCA--TTAATTTGTAGGGA----------------TTGGGACCCGCATCG-TTTACTGTGAAAAAAT--TAGAGTGTT-TAAA-GCAGGC-----AATCGCT--TGAATAC--ATTAGCATGGAATAATAAGATAGGACTT-TGGTACT----------------------------------ATTTT-GTTGGTT--TG-CATACCAAATTAATG-ATCAACAGGAAC-AGTTT-GAGGATATTCGTATGAACATG-T-CAGAGGTGAAATTCTT--GGATTTTGAT-CAGACGAACTACTGCG-AAAGCATTTATCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACTAGGG--ATTGGCGGAC--GTTGT------CTAT-------ATGACTCCGCCA-GCACCTCA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGT-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTGCTAA-ATAGTGTGCA-TATTCGAAAGA---ATGTGTT------CGACTTCTTAGAGGGACATTTCG--GTTTT-ACCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACAATGATGAATTCAACGAGTT----------------------------TATA-ACCTTGGTT--GAAAAGCCT-GGG--TAATCTTTTGAACTTTCGTCG-TGATGGGGCTAGACCCTTGCAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAATCTTCGGATTGAGACTTTGATTTCTTCAC--GGAAAACGCTGTTTTAAAAAG---TTGATTA-AACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAA--CCTGCAGAAGGATCAAGC Aplanochytrium_sp._PR1_1 -----------------------------------------------------------CCCTT?GAAACCCGG??AG?GTAGGCACTTGCCT--GTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGATT---TCTA---CTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATGCAAC--AAAGCCCATTC----------------GGGCTGTATTTATTAGA-TAG---AAACCAATGCAGGGTTTTC---CCTGGTGTTGTGGTGAGTCATAATAACTAAG-----CGAATCGCAGTGGC--TTCG---GCCGGCGATGAATCATT-CAAGTTTCTGCCCTATCCAGCTGTCGAATGGTAG-TGTATTGGGACTACCAT-GGCGTTAACGGG-TGACGGAGAATTAGGGGTTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTGATAC-GGGGAGGTAGTGA-CAATAAATAACAATAC--GGGGCCC---ATCGGGTCT-TGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCCGGAAGTCCAACCCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGGATTTCTGGTAGGAGTGA------CCGTTCCGAACTT-------------------GATTG----------TTCGTGTATTGTGTTTTCTCCAGCCATCCT-------TGTGGGAGAAC--------------TTTTCTTGCATTAATTTTGTAGGGATTTGGG--------------ACCCGCATCG-TTTACTGTGAAAAAAT--TAGAGTGTT-TAAA-GCAGGC-----AATCGCT-TTGAATAC--ATTAGCATGGAATAATAAGATAGGACTT-TGGTACT----------------------------------ATTTT-GTTGGTT--TG-CATACCAAATTAATGGATCAACAGGAACCAGTTTTGAGGATATTCGTAATGAACATGTCAAGAGGTGAAATTTCTTGGGATTTTTGATCAGACGAACTACTGCGAAAAGCATTTATCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACTAGGG--ATTGGCGGAC--GTTGT------CTAT-------ATGACTTCGCCA-GCACCTCA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGT-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGGGTGCATGGCCCGTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTGCTAA-ATAGTGTGC---ATATTCGAAA---GAATGTG----TTCGACTTCTTAGAGGGACCATTTC-GGTTTT-ACCGGAAGGAAGTTTGAGGCAAATAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACAATGATGAATTCAACGAGTT----------------------------TATA-ACCTTGGTT--GAAAAGCCT-GGG--TAATCTTTTGAACTTTCGTCG-TGATGGGGCTAGACCCTTGCAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAATCTTCGGATTGAGACTTTGATTTCTTCAC--GGAAAACGCTGTTTTAAGAA------------------------------------------------------------------------------------ Aplanochytrium_sp._PR15 --------------------------------------------------A?GCCC?TT?T?GA???GAGG??AGTGCAGG---CACTTGTAC-TGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGATT---TCTA---CTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATGCAAC--AAAGCCCTTTT----------------GGGCTGTATTTATTAGA-TAG---AAACCAATGCAGGGTTTTC---CCTGGTGTTGTGGTGAGTCATAATAACTAAA-----CGAATCGCAGGGGC--TTCG---GCCGGCGATGAATCATT-CAAGTTTCTGCCCTATCA-GCTGTCG-ATGGTAG-TGTATTGGAC-TACCAT-GGCGTTAACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTGATAC-GGGGAGGTAGTGA-CAATAAATAACAATAC--GGGGCCC---ATCGGGTCT-TGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGGATTTCTGGTAGGAGTGA------CCGTTCCGAACTT-------------------GATTG----------TTCGTGTATTGTGTTTTCTCCAGCCATCCT-------TGTGGAGAA---------------CTTTTCTTGCATTAATTTGTAGGGA----------------TTGGGACCCGCATCG-TTTACTGTGAAAAAAT--TAGAGTGTT-TAAA-GCAGGC-----AATCGCT--TGAATAC--ATTAGCATGGAATAATAAGATAGGACTT-TGGTACT----------------------------------ATTTT-GTTGGTT--TG-CATACCAAATTAATG-ATCAACAGGAACAGGTT--GAGGATATTCGTATGAACATG-T-CAGAGGTGAAATTCTT--GGATTTTGAT-CAAACGAACTACTGCGAAAAGCATTTATCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACTAGGG--ATTGGCGGAC--GTTGT------CTAT-------ATGACTCCGCCA-GCACCTCA-TGAGAAATCAAAGTACTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGT-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGGGTGGTGG-TCCATGGCC-GTTCTTAGTTGGGTGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTGCTAA-ATAGTGTGC---ATATTCCGAA-AGAATGGTG----TTCGACTTCTTAGAGGGACATTTCG--GTTTT-ACCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACAATGATGAATTCAACGAGTT----------------------------TATA-ACCTTGGTT--GAAAAGCCT-GGG--TAATCTTTTGAACTTTCGTCG-TGATGGGGCTAGACCCTTGCAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAATCTTCGGATTGAGACTTTG?TTTCTTCAC--GGAAAACGCTGTTTTAAAAAG---TTGATTA-AACCTTACCATTTAGAGGAA?GAG?A-TG?TGCC-------------------------------------- Aplanochytrium_sp._SC1_1 -------------------------------------------------------TTGGA?C?TTT?TAT?C?T??TTTTC??GCACTTG?CT--GTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGATG---CCTA---CTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATG-CAA-CAAAGCCCAACTT--TTCG----GA--CGGGCTGTATTTATTAGA-TAG---AAACCAATGCAGGGATTTC---CCTGGTGTTGTGGTGAGTCATAATAACTAAG-----CGAATCGCAGTGGC--TTCG---GCCGGCGATGAATCATT-CAAGTTTCTGCCCTATCA-GCTGTCG-ATGGTAG-GGTATTGGCC-TACCAT-GGCGTTAACGGGGTGACGAAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCCACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTGATAC-GGGGAGGTAGTGA-CAATAAATAACAATAC--GGGGCCC---ATCGGGTCT-TGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGGATTTCTGGTAGGAGCGA------CCGTGCCGAACTT-------------------GATTG----------TTCGTGTATTGTGTTGTCTTCAGCCATCCT-------CGTGGAGAA---------------CTTTTCGGGCATTAATTTGTCGGGA----------------TTGGGACCCGCGTCGTTTACTTGTGAAAAAAT--TAGAGTGTT-TAAA-GCAGGC-----AATCGCT--TGAATAC--ATTAGCATGGAATAATAAGATAGGACTTTTGGTACT----------------------------------ATTTT-GTTGGTT--TTGCATACCAAATTAATG-ATCAACAGGAAC-AGTTT-GAGGATATTCGTATGAACATG-T-CAGAGGTGAAATTCTT--GGATTTTGAT-CAGACGAACTACTGCG-AAAGCATTTATCAAGGATGTTTTCCATTAAACAAAGAACGAAAAGTTAGGGGATCAAAGATGAATAAATACCATAATGGAAGTCTTTAACCATAAACTATCCCCAATTAGGGAATTGGCGGAA-AGTTGT------CTAT------ATTGACTCCGCC?AGCACCTCAATAAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAAGTATGGTCGCAAAGGCTGAAACTTAAAAGGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTAACTCAACACGGG-AAAACTTACCAGGT?CCAGACATAGTTAAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGGGG-TGCATGGCC-GTTCTTAGTTGG-GGGAGTGATTTGTCTGG-TTAATTCCCGTTAACGAACGAGACCTCAGCCTGCTAA-ATAGTGTGCA-TATTTGAAAGA---ATGTGTT------CGACTTCTTAGAGGGACATTTCG--GTTTT-ACCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACAATGATGAATTCAACGAGTT----------------------------TATA-ACCTTGGTT--GAAAAGCCT-GGG--TAATCTTTTGAACTTTCGTCG-TGATGGGGCTAGACCCTTGCAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAATCTTCGGACTGTGACTTTGATTTGTTAAC--TCAAAACGCTGTTATGGGAAG---TTGATTA-AACCTTACCATTTAGAGG?A?AAGTC-TGG?AAC-------------------------------------- Aplanochytrium_stocchinoi -------------------------------GAGTCATACGCTCG-TCTCAAAGATTAAGCCATGCATGTCTAAGTGCAAG---CACTTGTAC-TGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGATG---CCTA---CTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATGCAAC--AAAGCCCAACTT--TTTG----GA--CGGGCTGTATTTATTAGA-TAG---AAACCAATGCAGGGTTTTC---CCTGGTGTTGTGGTGAGTCATAATAACTAAG-----CGAATCGCAGTGGC--TTCG---GCCGGCGATGAATCATT-CAAGTTTCTGCCCTATCA-GCTGTCG-ATGGTAG-GGTATTGGCC-TACCAT-GGCGTTAACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTGATAC-GGGGAGGTAGTGA-CAATAAATAACAATAC--GGGGCCC---ATCGGGTCT-TGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGGATTTCTGGTAGGAGCGA------CCGTTCCGGACTT-------------------GATTG----------TTCGTGTATTGTGTTGTCTCCAGCCATCCT-------TGTGGAGAA---------------CTTTTCTTGCATTAATTTGTAGGGA----------------TTGAGACCCGCATCG-TTTACTGTGAAAAAAT--TAGAGTGTT-TAAA-GCAGGC-----AATAGCT--TGAATAC--ATTAGCATGGAATAATAAGATAGGACTT-TGGTACT----------------------------------ATTTT-GTTGGTT--TG-CATACCAAATTAATG-ATCAACAGGAAC-AGTTT-GAGGATATTCGTATGAACATG-T-CAGAGGTGAAATTCTT--GGATTTTGAT-CAGACGAACTACTGCG-AAAGCATTTATCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACTAGGG--ATTGGCGGAC--GTTGT------CTAT-------ATGACTCCGCCA-GCACCTCA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGT-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTGCTAA-ATAGTGTGC---ATATTCGAAA---GAATGTG----TTCGACTTCTTAGAGGGACATTTCG--GTTTT-ACCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACAATGATGAATTCAACGAGTT----------------------------TATA-ACCTTGGTT--GAAAAGCCT-GGG--TAATCTTTTGAACTTTCGTCG-TGATGGGGCTAGACCCTTGCAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAATCTTCGGATCGAGACTTTGTTTTGTTTAC--TCAAAACGCTGTTTCGAGAAG---TTGATTA-AACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTA------------------------------ Aurantiochytrium_limacinum -----------------------CCT-CCAGTAGTCATATGCTCG-TCTCAAAGATTAAGCCATGCATGTGTAAGTATAAG-CGA--TTGTAC-TGTGAGACTGCGAACGGCTCATTATATCAGTAATAATTTCTTCGGTAGTTT---CTTT----TATATGGATACCTGCAGTAATTCTGGAAATAATACATGCTGTAAGAGCCCTG------TATG---------GGGCTGCACTTATTAGA-TTG---AAGCCGAT-------------------TTTATTGGTGAATCATGATAATTGAG-----CAGATTGACTT-----TTTT----A-GTCGATGAATCGTT-TGAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAGTG-TATTGGAC-TACGGT-GACTATAACGGG-TGACGGAGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ATATCCAAGGA-TAGCAGCAGGCGCGT--AAATTACC-CACTGTGGACTC-CACGAGGTAGTGA-CGAGAAATATCGATGC--GAAGTGGTATGC---GTTT-TGCTATCGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCA-CAGCCGCGGTAATTCCAGCTCCAGAAGCATATG--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGCATGGGCGA------CCGGTGCTTTCCC------------------TGAATGGGGATTGATTGTCT------GTGTTGCCTT-GGCCAT--------CTT---------------------------TCTCA-TTTTCTTTATAGGGG-----------------------AGAAATCT-TTCACTAAAATCAAAG--CAGAGTGTT-CCAA-GCAGGTC--GTAT-----GACGGTTATG-TTTATTATGGGATGATAAGATAGGACTT-GGGTGCT----------------------------------ATTTT-GTTGGTT--TG-CACGCCTGAGTAATG-GTTAATAGGAAC-AGTT--GGGGGTATTCGTATTTAGGAGCT--AGAGGTGAAATTCTT--GGATTTCCGA-AAGACGAACTAGAGCG-AAGGCATTTACCAAGCATGTTTTC-ATTAATCAA-GAACGAAA-GTCTGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAG-ACCGTAAACGATGCCGACTTGCG--ATTGTTGGGTGCTTT--------TTAT--------AGGG???????-??????CA-T??GAAA??AAA--CTTTTGGGTTCCGGGGG???-?????????-AAG????AAA-TTAAA-GGA-TTT--GGAAGG???--CC?CC?-??GG--??GGGCCTGGCGTTAAATTTA?CCCAAC?GGG?-?AAACTT??????????-????????-??????????-??????-???????????-?????????????-??????-?????????-????????????-?????????????CTGG-TTAATTCC-GTTAACGAACGA?ACCTCGG??TACTAA-ATAGTGCGT--GGTATGGCAACATAGTACGTT-----TT-ACTTCTTA-AGGGACA-GTCC-GG-TTA--C-GGCAGG-AGTTC-A-GCAA-TAACAG-TCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGGGTTCATCGGGTTTTAATT--------C-A-TTTTATGGAATTGAGTGCTTGGTC--GGAAGGCCT-GGC--TAATCCTTGGAACGCTCATCG-TGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGGTCCGATGAAACCATGGGATGTTTCTGTTTGGATTAATTT------TTGGACAGAGGCAGAAC----------------------------------------------------------------------------------- Aurantiochytrium_mangrovei ----------------GTTGAT-CCTGCCAGTAGCCATATGCTCGGTCTCAAAGATTAAGGCATGCATGTGTAAGTATAACGCGA--TTGTTC-TGTGAGACTGCGAACGGCTCATTATATCAGTAATAATTTCTTCGGTAGTTT---CTTT----TATATGGATACCTGCAGTAATTCTGGAAATAATACATGCTGT-AAGAGCCCGACT----TTG---------GGGCTGCACTTATTAGA-TTG---AAGCCGAT-------------------TTTATTGGTGAATCATGATAATTGAG-----CAGATTGACTT-----TTTT------GTCGATGAATCGTT-TGAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAG-TGTATTGGAC-TACGGT-GACTATAACGGG-TGACGGAGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ATATCCAAGGA-TAGCAGCAGGCGCGT--AAATTACC-CACTGTGGACTC-CACGAGGTAGTGA-CGAGAAATATCGATGC--GAAGTGGTATGC---GTTT-TGCTATCGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCACAGGCCGCGGTAATCCCAGCTCCAGAAGCATATGCGTAAACGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGCATGGGCGA------CCGGTGCTTTCCC-------------------TGTAATGGGGATTGATTGTC----TGTGTTGCCTT-AGCCAT-----------------------------------CTTTCTCATGTCATTTTGGTTAGA------------------------GAAATCT-TCCACTGTAATCAAAG--CATAGTGTC-CCAA-GCAGGTCGTATGAC-----CGGTATGT---TAATTATGGGATGATAAGATAGGACTG--GGTCTCTA----------------------------------TTTGGTGGGTT---GGCACGCCTGAGTAATG-GTTAATAGGAAC-AGTT--GGGGGTATCCGTATTTAGGAGCT--AAAGGTGAAATTCTT--GGATTCCCGA-AAGACGAACTACAGCG-AAGGCATTTACCAAGCATGTTTTC-ATTAATCAA-GAACGAAA-GTCTGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAG-ACCGTAAACGATGCCGACTTGCG--ATTGTTGGGTGCTTTTTATAGGGCCCC-----------CGCCCCCCAGCAGCACA-TGAAAAACCAAAGTCTTTTGGGTTCCCGGGGGGAGTATGGCCCCAAGGGCAGAAACTTAAA-GGATTCAACGGAAGGGCCACCCACCAGAGACGTTGGAGCCCGCGGCTTAATTTAACTCAACACGGGAAAAACTCACCAGGCCCAGATCATAGG-TAGGATAGAA-AGATTGAGACGCCCTCTCATAGATTCTATGGG-TGGGGG-CGCATGCCC-GCTCTTAGTGGG-GGGAGAGATTTGTCTGGGTTAATTCC-GTTAACGAACGAGACCTCGGCCTACTAA-ATATTGCCGGGCGTATGGCAAC---ATATGTACGTTTGTAACTTCTTAAAGGGACATGTCC-GGTTTA-CCGAGAAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCC-TTAAATG-TTCTGGGCCGCACGCGCGCTACACTGATGGGTTCATCGGGTCTTTAGTTG------TAATTTTTGGAAATTGCGTCGCTTGGTC--GGAAGGCCT-GGC--TAATCCTTTGAACGCCCATCG-TGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGGTCCGATGAAACCCATGGGATGTTT?TGTTTGGATTCATTTTTGG----------------------------------------------------------------------------------------------------- Aurantiochytrium_sp._BURABQ_133 --------CCAACCTGGTTGAT-CCTGCCAGTAGTCATATGCTCG-TCTCAAAGATTAAGCCATGCATGTGTAAGTATAAG-CGA--TTGTAC-TGTGAGACTGCGAACGGCTCATTATATCAGTAATAATTTCTTCGGTAGTTT---CTTT----TATATGGATACCTGCAGTAATTCTGGAAATAATACATGCTGTAAGAGCCCTGTATG---------------GGGCTGCACTTATTAGAATGA----AGCCGAT-------------------TTTATTGGTGAATCATGATAATTGAG-----CAGATTGACAT-----TTTT------GTCGATGAATCGTT-TGAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAG-TGTATTGGAC-TACGGT-GACTATAACGGG-TGACGGAGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ATATCCAAGGA-TAGCAGCAGGCGCGT--AAATTACC-CACTGTGGACTC-CACGAGGTAGTGA-CGAGAAATATCGATGC--GAAGCGT--GTATGCGTTT-TGCTATCGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGAAGCATATG--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGCATGGGCGA------CCGGTGCTTTCCCT------------------GAATGGG------GATTGATTGTCTGTGTTGCCTT-GGCCAT-----------------------------------CTTTCTCATGCTATTTTGGTATGA--------------------------GATCT-TTCACTGTAATCAAAG--CAGAGTGTT-CCAA-GCAGGTCGTATGAC-----CGGTATGT---TTATTATGGGATGATAAGATAGGACTT-GGGTGCT----------------------------------ATTTT-GTTGGTT--TG-CACGCCTGAGTAATG-GTTAATAGGAAC-AGTT--GGGGGTATTCGTATTTAGGAGCT--AGAGGTGAAATTCTT--GGATTTCCGA-AAGACGAACTAGAGCG-AAGGCATTTACCAAGCATGTTTTC-ATTAATCAA-GAACGAAA-GTCTGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAG-ACCGTAAACGATGCCGACTTGCG--ATTGTTGGGTGCTTTAT------ACAT--------GGGCCTCAGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-TAGGATTGAC-AGATTG-AGAGCTCTTTC-ATGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCGGCCTACTAA-ATAGTGCGTG--GTATGGCAACATAGTGCGTT-----TTTACTTCTTAGAGGGACATGTCC-GGTTTA--CGGGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGGGTTCATCGGGTTTTAATTCT--------GTTTTTATGGAATTGAGTGCTTGGTC--GGAAGGCCT-GGC--TAATCCTTGGAACGCTCATCG-TGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGGTCCGATGAAACCATGGGATGTTTCTGTTTGGATTCATTT------TTGGACAGAGGCAGAAC---TCGGGTG-AATCTTATTGTTTAGAGGAAGGTGAAGTCGTAACAAGG---------------------------------- Aurantiochytrium_sp._FJN_10 -------TCCAACCTGGTTGAT-CCTGCCAGTAGCCCTACGCTCG-TCTCAAAGATTAAGCCATGCATGTGTAAGTATAAG-CGA--TTATAC-TGTGAAACTGCGAACGGCTCATTATATCAGTTATAATTTCTTCGGTAGTTTCT--------TTACATGGATACCTGCAGTAATTCTGGAATTAATACATGCTGT-AAGGGCCCGACTGCTTGCG---GGA---GGGCCGCACTTATTAGAATTG---AAGCCAAC-------------------TTTATTGGTGAGTCATGATAATTTCG-----CAGATCGCCAT-----TTTT------GGCGATGAATCGTT-TGAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAG-TGTATTGGAC-TACGGT-GACTATAACGGG-TGACGGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATGTGGACTC-CACGAGGTAGTGA-CGAGAAATATCAATGC--GGGGCAC---TTCGTGTCT-TGCTATTGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGAAGCGTATG--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGCGTGGGAGC-----CCTGGCCTTTGCGC-------------------GAATGCG------CTCTGTTTGCTGTGCGGCTCCTCTGCCAT----------------------------------------CCTCGCCAGCCTTTTGGTT------------------------GGCGTCA-TTCACTGTAATTAAAG--CAGAGTGTT-CCAA-GCAGGTCGTATGAT-----CTGGATGT---TTATTATGGGATGATCAGATAGGACTC-GGGTGCT----------------------------------ATTTT-GTTGGTT--TG-CACATCTGAGTAATG-ATTAATAGGAAC-AGTT--GGGGGTATTCGTATTTAGGAGCT--AGAGGTGAAATTCTT--GGATTTCCGA-AAGACGAACTACAGCG-AAGGCATTTACCAAGCATGTTTTC-ATTAATCAA-GAACGAAA-GTCTGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAG-ACCGTAAACGATGCCGACTTGCG--ATTGCGGGGC--GTTTG-------TAT-------TGGACCTTCGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-TAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCGGCCTACTAA-ATAGCGACGG--GTATGGCGAC---ATACCTG---GGTCTGCTTCTTAGAGGGACATGTTC-GGTTTA--CGAGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAACGGGTCTTTTCGCT------------GCTCGCAGCGAGTTGCTTTGCC--GGAAGGCAT-GGC--TAATCCTTTCAACGCTCATCG-TGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGGTCCGATGAAACCATGGGATGACCTTTTGAGCGTTTATTC------GCGATGGAGGTCAGAAC---TCGGGTG-AATCTTATTGTTTAGAGGAAGGTGAAGTCGTAACAAGG---------------------------------- Aurantiochytrium_sp._KH105 --------CCAACCTGGTTGAT-CCTGCCAGTAGCCCTACGCTTCGTCTCAAAGACTAAGCCATGCATGTGTAAGTATAAGCGAA--TTATAC-TGTGAAACTGCGAACGGCTCATTATATCAGTTATAATCCCTTCGGTAGTTCCT--------TTACACGGATACCTGCAGTAATTCTGGAATTAATACGTGCTGT-ACGGGCCCGACT---TTCG--GGGA---GGGCCGCACTTATTAGGTCTA----AGCCAACG-------------------TTCTTGGTGAGTCATGATAATTGAG-----CAGATCGCT------TTTCG-----GAGCGATGAATCGTT-TGAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAG-GGTATTGGCC-TACGGT-GACTATAACGGG-TGACGGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATGTGGACTC-CACGAGGTAGTGA-CGAGAAATATCAATGC--GGGGCGC---TTCGCGTCT-TGCTATTGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGAAGCGTATG--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGTGTGGGAGC-----CCAGGCCTCGGTGC-------------------GAATGT--------GCCTT------GTATTGCCTTGCGGCTC-----------------------------------CTTTGCCATCCTCGTCTGAGCAAT---------------------CAGGCAGTCA-TTCACTGTAATCAAAG--CAGAGTGTT-CCAA-GCAGGCC-----GTAGGGCCGGTATGT---TTATTATGGGATGATCAGATAGGACTC-GGGTGCT-----------------------------------ATTTGGTTGGTT--TG-CACATCTGAGTAATG-ATTAATAGGAAC-AGTC--GGGGGTATCCGTATTTAGGAGCT--AGAGGTGAAATTCTT--GGATTTCCGA-AAGACGAACTACAGCG-AAGGCATTTACCAAGCATGTTTTC-ATTAATCAA-GAACGAAA-GTCTGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAG-ACCGTAAACGATGCCGACTTGCG--ATTGCGGGTG--GCTTG-------TAT-------TGGGCCTCCGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-TAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCGGCCTACTAA-ATAGCCGGG--CGTATGGCGAC---ATATGTG--TTTGTGGCTTCTTAGAGGGACATGTTC-GGTTTA--CGAGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAGCGGGTCTTTGTTGT----------GTTTACTCACAGCGTTGCTTTGTC--GGAAGGCAT-GGC--TAATCCTTTGAACGCCCATCG-TGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGGTCCGATGAAACCATGGGTCTACCTTTTGAGCGTTTGTTC------GCGATGGAGGTGGGAAC---TCGGGTG-AATCTTATTGTTTAGAGGAAGGTGAAGTCGTAACAAGG---------------------------------- Aurantiochytrium_sp._N1_27 -------------------------------------TACGCTCG-TCTCAAAGACTAAGCCATGCATGTGTAAGTATAAG-CGA----ATAC-TGTGAAACTGCGAACGGCTCATTATATCAGTTATAATTTCTTCGGTAGTTTC---------TTTACTGGATACTTGCAGTAATTCTAGAACTAATACATGCTGT-AAGGGCCCGACTGCTTGCG---GGA---GGGCCGCACTTATTATAATTG---AAGCCAACTTTATTGGTGA-GTCATGATACTTTGGTGAGTCATGATAATTCCGCCGCCCTGGTCGCCTT-----TTTG------AGCGATGAATCGTT-TGAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAG-TGTATTGGAC-TACGGT-GACTATAACGGG-TGACGGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCTCAAGGAAGGCAGCAGGCGCGT--AAATTACC-CAATGTGGACTCCATCGAGGTAGTGAGCGAGAAATATCAATGA-CGGGGCAC---TTCGTGTCT-TGCTATTGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAAGCTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TCTAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGCGTGGGAGC-----CCTGGCCTTTGCGC-------------------GAATGCG------CTCTGTTTGCTGTGTGGCTCCTCTGCCAT----------------------------------------CCTCGCCAGCCTTTGGTTG-------------------------GCGTCA-TTCACTGTAATTAAAG--CAGAGTGTTCCCAAAGCAGGTCGTATGAT-----CTGGGAGT---TTATTATGGGATGATCAGATAGGACTC-GGGTGCT----------------------------------ATTTT-GTTGGTT--TG-CACATCTGAGTAATG-ATTAATAGGAAC-AGT----GGGGTATTCGTATTTAGGAGCT--AGAGGTGAAATTCTT--GGATTCCGAA--AGACGAACTACAGCG-AAGGCATTTACCAAGCATGTTTC--ATTAATCAA-GAACGAAA-GTCT-GGGATCGAAGATGATTAGATACCATCGT---AGTCTAG-ACCGTAAACGATGCCGACTTGCG--ATTGCGGGC---GTTTG-------TAT-------TGGACCTTCGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGG--CTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-TAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCGGCCTACTAA-ATAGCGACGG--GTATGGCGAC---ATACCTG---GGTCTGCTTCTTAGAGGGACATGTTC-GGTTTA--CGAGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAACGGGTCTTTTCGCT------------GCTCGCAGCGAGTTGCTTTGCC--GGAAGGCAT-GGC--TAATCCTTTCAACGCTCATCG-TGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGGTCCGATGAAACCATGGGATGACCTTTTGAGCGTTTATTC------GCGATGGAGTCG---------------------------------------------------------------------------------------- Aurantiochytrium_sp._NIOS_4 AATTCGGCTTAACCTGGTTGAT-CCTGCCAGTCGCCCTACGCTCG-TCTCAAAGACTAAGCCATGCATGTGTAAGTATAAGCGAA--TTATAC-TGTGAAACTGCGAACGGCTCATTATATCAGTTATAATCCCTTCGGTAGTTCCT--------TTACACGGATACCTGCAGTAATTCTGGAATTAATACGTGCTGT-ACGGGCCCGACT---TTCG--GGGA---GGGCCGCACTTATTAGGTCTA----AGCCAACG-------------------TTATTGGTGAGTCATGATAATTGAG-----CAGATCGCT------TTTCG-----GAGCGATGAATCGTT-TGAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAG-GGTATTGGCC-TACGGT-GACTATAACGGG-TGACGGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATGTGGACTC-CACGAGGTAGTGA-CGAGAAATATCAATGC--GGGGCGC---TTCGCGTCT-TGCTATTGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGAAGCGTATG--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGTGTGGGAGC-----CCAGGCCTCGGTGC-------------------GAATGC--------GCCTT------GTCTTGCCTTGCGGCTC-----------------------------------CTTTGCCATCCTCGTTTTTCGTAA--------------------GAAAGGCGTCA-TTCACTGTAATCAAAG--CAGAGTGTT-CCAA-GCAGGCC-----GTAGGGCCGGTATGT---TTATTATGGGATGATCAGATAGGACTC-GGGTGCT----------------------------------ATTTT-GTTGGTT--TG-CACATCTGAGTAATG-ATTAATAGGAAC-AGTC--GGGGGTATCCGTATTTAGGAGCT--AGAGGTGAAATTCTT--GGATCTCCGA-AAGACGAACTACAGCG-AAGGCATTTACCAAGCATGTTTTC-ATTAATCAA-GAACGAAA-GTCTGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAG-ACCGTAAACGATGCCGACTTGCG--ATTGCGGGTG--GCTTG-------TAT------TGGGCACTCCGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTAAAG--GAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-TAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCGGCCTACTAA-ATAGCCGGG--CGTATGGCGAC---ATATGTG--TTTGTGGCTTCTTAGAGGGACATGTTC-GGTTTA--CGAGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAGCGGGTGATTTATGG-----------TCTTTGACTGTAGTTGCTTTGTC--GGAAGGCAT-GGC--TAATCCTTTGAACGCCCATCG-TGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGGTCCGATGAAACCATGGGACTACCTTTTGAGCGTTTGTTC------GCGATGGAGGTGGGAAC---TCGGGTG-AATCTTATTGTTTAGAGGA----------------------------------------------------- Aurantiochytrium_sp._SEK209 ---------------------------------------------------AAGATT-AGCCATGCATGTGTAAGTATAAG-CGA--TTATAC-TGTGAAACTGCGAACGGCTCATTATATCAGTTATAATTTCTTCGGTAGTTTCT--------TTACATGGATACCTGCAGTAATTCTGGAATTAATACATGCTGT-AAGGGCCCGACTGCTTGCG---GGA---GGGCCGCACTTATTAGAATTG---AAGCCAAC-------------------TTTATTGGTGAGTCATGATAATTTCG-----CAGATCGCTCT-----TTTG------AGCGATGAATCGTT-TGAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAG-TGTATTGGAC-TACGGT-GACTATAACGGG-TGACGGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-AC?TCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATGTGGACTC-CACGAGG?AGTGA-CGAGAAATATCAATGC--GGGGCCA---CTCG?GTCT-TGCTATTGGAATGAAAGCAATGTAAAACCCTCATCAAGGATCAA-CTG?AGGGCAAGTCTGG?GCCAGCAGCCGCGGAAATTCCAGCTCCAAAAGCGTATG--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGCGTGGGAGC-----CCTGGCCTTTGCGC-------------------GAATGCG------CTCTGTTTGCTGTGGGGCTCCTCTGCCAT----------------------------------------CCTCGCCAGCCTTTTGGTT------------------------GGCGTCA-TTCACTGTAATTAAAG--CAGAGTGTT-CCAA-GCAGGTCGTATGAT-----CTGGATGT---TTATTATGGGATGATCAGATAGGACTC-GGGTGCT----------------------------------ATTTT-GTTGGTT--TG-CACATCTGAGTAATG-ATTAATAGGAAC-AGTT--GGGGGTATTCGTATTTAGGAGCT--AGAGGTGAAATTCTT--GGATTTCCGA-AAGACGAACTACAGCG-AAGGCATTTACCAAGCATGTTTTC-ATTAATCAA-GAACGAAA-GTCTGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAG-ACCGTAAACGATGCCGACTTGCG--ATTGCGGGGC--GTTTG-------TAT-------TGGACCCTCGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-TAGGAT-GAC-AGATGA--GAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCGGCCTACTAA-ATAGCGACGG--GTATGGCGAC---ATACCTG---GGTCTGCTTCTTAGAGGGACATGTTC-GGTTTA--CGAGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAACGGGTCTTTTCGCT------------GCTCGCAGCGAGTTGCTTTGCC--GGAAGGCAT-GGC--TAATCCTTTCAACGCTCATCG-TGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGGTCCGATGAAACCATGGGATGACCTTTTGAGCGTTTATTC------GCGATGGAGGTCAGAAC---TCGGGTG-AATCTTATTG-TTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGAA---------------------- Aurantiochytrium_sp._SEK217 ---------------------------CCAGTAGCCCTACGCTCG-TCTCAAAGACTAAGCCATGCATGTGTAAGTATAAGCGAA--TTATAC-TGTGAAACTGCGAACGGCTCATTATATCAGTTATAATCCCTTCGGTAGTTCCT--------TTACACGGATACCTGCAGTAATTCTGGAATTAATACGTGCTGT-ACGGGCCCGACT---TTCG--GGGA---GGGCCGCACTTATTAGG-TCT---AAGCCAACG-------------------TTCTTGGTGAGTCATGATAATTGAG-----CAGATCGCT------TTTCG-----GAGCGATGAATCGTT-TGAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAG-GGTATTGGCC-TACGGT-GACTATAACGGG-TGACGGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATGTGGACTC-CACGAGGTAGTGA-CGAGAAATATCAATGC--GGGGCGC---TTCGCGTCT-TGCTATTGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCA?CA?CCGCGGTAATTCCAGCTCCAGAAGCGTATG--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGTGTGGGAGC-----CCAGGCCTCGGTG?-------------------GAATGC--------GCCTT------GTATTGCCTTGCGGCTC-----------------------------------CCTTGCCATCCTCGTTTTTCTTTT--------------------GAAG?ACGTCA-TTCACTGTAATCAAAG--CAGAGTGTT-CCAA-GCAGGCC-----GTAGGGCCGGTATGT---TTATTATGGGATGATCAGATAGGACTC-GGGTGCT----------------------------------ATTTT-GTTGGTT--TG-CACATCTGAGTAATG-ATTAATAGGAAC-AGTC--GGGGGTATCCGTATTTAGGAGCT--AGAGGTGAAATTCTT--GGATTTCCGA-AAGACGAACTACAGCG-AAGGCATTTACCAAGCATGTTTTC-ATTAATCAA-GAACGAAA-GTCTGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAG-ACCGTAAACGATGCCGACTTGCG--ATTGCGGG??--GCTTG-------TAT-------TGGGCTTCCGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-TAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCGGCCTACTAA-ATAGCCGGG--CGTATGGCGAC---ATATGTG--TTTGTGGCTTCTTAGAGGGACATGTTC-GGTTTA--CGAGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCC-TTA?ATG-TTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAGCGGGTCTTTGTTGT----------GTTTACTCACAGCGTTGCTTTGTC--GGAAGGCAT-GGC--TAATCCTTTGAACGCCCATCG-TGCTGGGGCTAAATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGGTCCGATGAAACCATGGGACTACCTTTTGAGCGTTTGTTC------CCAATGGAGGGGGGAAC---TCGGGTG-AATCTTATTGTTTAAAGGAAGG?GAAGTCGTAACAAGGTTTCCGTAGGTGA?CCT?GCGGAA?GG------- Aurantiochytrium_sp._SEK218 ------------------------CTGCCAGTAGCCCTACGCTCG-TCTCAAAGACTAAGCCATGCATGTGTAAGTATAAGCGAA--TTATAC-TGTGAAACTGCGAACGGCTCATTATATCAGTTATAATCCCTTCGGTAGTTCCT--------TTACACGGATACCTGCAGTAATTCTGGAATTAATACGTGCTGT-ACGGGCCCGACT---TTCG--GGGA---GGGCCGCACTTATTAGG-TCT---AAGCCAACG-------------------TTCTTGGTGAGTCATGATAATTGAG-----CAGATCGCT------TTTCG-----GAGCGATGAATCGTT-TGAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAG-GGTATTGGCC-TACGGT-GACTATAACGGG-TGACGGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATGTGGACTC-CACGAGGTAGTGA-CGAGAAATATCAATGC--GGGGCGC---TTCGCGTCT-TGCTATTGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGAAGCGTATG--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGTGTGGGAGC-----CCAGGCCTCGGTGC-------------------GAATGC--------GCCTT------GTATTGCCTTGCGGCTC-----------------------------------CTTTGCCATCCTCGTTTTTCTTTT--------------------GAAGAACGTCA-TTCACTGTAATCAAAG--CAGAGTGTT-CCAA-GCAGGCC-----GTAGGGCCGGTATGT---TTATTATGGGATGATCAGATAGGACTC-GGGTGCT----------------------------------ATTTT-GTTGGTT--TG-CACATCTGAGTAATG-ATTAATAGGAAC-AGTC--GGGGGTATCCGTATTTAGGAGCT--AGAGGTGAAATTCTT--GGATTTCCGA-AAGACGAACTACAGCG-AAGGCATTTACCAAGCATGTTTTC-ATTAATCAA-GAACGAAA-GTCTGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAG-ACCGTAAACGATGCCGACTTGCG--ATTGCGGGTG--GCTTG-------TAT-------TGGGCTTCCGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-TAGGAT-GAC-AGATGA--GAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCGGCCTACTAA-ATAGCCGGG--CGTATGGCGAC---ATATGTG--TTTGTGGCTTCTTAGAGGGACATGTTC-GGTTTA--CGAGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCC-TTAAATG-TTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAGCGGGTCTTTGTTG?----------GTTTACTCACAGCGTTGCTTTGTC--GGAAGGCAT-GGC--TAATCCTTTGAACGCCCATCG-TGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGGTCCGATGAAACCATGGGACTACCTTTTGAGCGTTTGTTC------GCGATGGAGGTGGGAAC---TCGGGTG-AATCTTATTGT------------------------------------------------------------- Bacillaria_paxillifer ----------AACCTGGTTGAT-CCTGCCAGTAGTCATACGCTCG-TCTCAAAGATTAAGCCATGCATGTCTAAGTAT--A-AAT-CTTTTAC-TTTGAAACTGCGAACGGCTCATTATATCAGTTATAGTTTATTTGATAGTCC---CTTA---CTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATG-CGT-CAATACCCT------TCTG---------GGGTAGTATTTATTAGA-TTG---AAACCAAC-CT----TCGG----GG--TGATGTGGTGATTCATAATAAGCTTG-----CGGATCGCA-TGGC--GTAT--GCC-GGCGATGGATCATT-CAAGTTTCTGCCCTATCA-GCTTTGG-ATGGTAG-GGTATTGGCC-TACCAT-GGCTTTAACGGG-TAACGGGAAATTAGGG-TTTGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTGACAC-AGGGAGGTAGTGA-CAATAAATAACAATGC-CG-GGCCT-TTGT-AGGTCT-GGCAATTGGAATGAGAACAATTTAAATCCCTTATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGGATTTGTGGC-TGTCGCG-----TGCGGCGTGACA---------CTTT--------TGTGT----T---ATCGCT----TGCT-T-GCGTC--GCCAT-CC------TTGGGTGGA---------ACC-T--GTG-TGGCA-TTAGGT-TGTCGTGC----AGGGG------------ATGCCCATCA-TTTACTGTGAAAAAAT--TAGAGTGTT-CAAA-GCAGGC---TTAT--GCCGTTGAATAT--ATTAGCATGGAATAATAAGATAGGACCT-TGGTACT----------------------------------ATTTT-GTTGGTT--TG-CGCACCGAGGTAATG-ATTAATAGGGAC-AGTT--GGGGGTATTCGTATTCCATTG-T-CAGAGGTGAAATTCTT--GGATTTTTGG-AAGACGAACTACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACAAGGG--ATTGGCGGA---GTCTC------GTTT--------TGTCTCCGTCA-GCACCTTA-TGAGAAATCACAAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GAAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGT-GAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCCCTGCCTGCTAA-ATAGCTTAC--CGAGTGAATGT-TCACTGGGT-----GAAGCTTCTTAGAGGGACGTGCAT-TCTATTAGATG-CAGGAAGATAGGGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TCCTGGGCCGCACGCGCGCTACACTGATGCATTCAACGAGTT------------------------------TA-ACCTTGGCT--GAGAAGCCT-GGG--CAATCTTTTGAACGTGCATCG-TGATAGGGATAGATTATTGCAATTATTAATCTTGAACGAGGAATTCCTAGTAAACGCAGATCATCAATCTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAGCCTCGGGATTGTGGCGAGTTCCCT-TTAT---TGGGAGTTTGTCGCGAGAAC---TTGTCTA-AACCTTATCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAA-CCT-GCAGAAGGATCAAGC Japonochytrium_sp._ATCC_28207 ---------------------------------------------------AAGACTAAGCCATGCATGTCTAAGTATAAG-CGA-TTTATAC-GGTGAAACTGCGAACGGCTCATTAAAACAGTTATAGTTTCTTTGAAAATGT---TTGA---TTAGATGGATACTTGTGGCAAATCTAGAAATAATACATG-CTT-TAGGGCCCGACT---TTTG---GGA--AGGGCTGCATTTATTAGA-TAT---AAACCAATACCTC---TCG----GGGTTGTTTTGGTGATTCATAGTAACTAGG-----CGAATCGCAGAGGT--GTTTGTGCC-GGCGATG-TTCATT-CAAGTTTCTGCCCCATCA-ATTGTCG-ATGGTAG-GGTATTGGCC-TACCAT-GATTGTTACGGG-TGACGGAGAATCAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGC--AAATTACT-CAATGTCAATTC-GACGAAGTAGTGA-CGAGAAATAACAGTGGGGTGGGCTA--AGCCTACTCT----TTCTGTAATGAGAGCAATCTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAACTCCAGCTCCGGTAGCGTGTA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAAGTATTGGT-AGGACGGACCAGGCTTTTCGGC-----------------------GAATGCTGAGGTATGCTTT-----TGTGTTTGATCTGGCCAT-------GGTTGCTCGT---------------------TTGCGCCTTTGGGCGTGGGT------------------------GGGCATCA-TTTACTGTAAAAAAAT--TAGAGTGTT-TCAA-GCAAATC--GTAT---GGTTGGAATAG--AGTAGTATGGAATAATAAGATAGGACTT-TGTTGCT----------------------------------ATTTT-GTTGGTT--TG-CACATCAAAGTAATG-ATTAACAGGGAC-AGTT--GGGGGTATTCGTATTTGGTTG-T-CAGAGGTGAAATTCTT--GGATTTACAA-AAGACGAACAACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA--CCGTAAACGATGCC-ACTTGCG--ATTGTCCGATGTTTTTT------TTT------AATAGACTTGGGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGA-ACTTAAA-GGAATT-ACGGAAGGGCA--CCACCA-GGAG--TGG-GCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCT--GTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGTACGTG-CTATGGTGAC----ATAGTGG----CGAGACTTCTTAGAGGGACATTTCG--GTTTT-ACCGGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGGATTCAACGAGTATGTGTTGT----TTGTTTAACGATGAATGACGGTCCTAGACA--GGAATGTCC-GGG--CAATCTTTTAAATGTCCATCG-TGATGGGGCTAGATTTTTGCAATTCTTAATCTCCAACGAGGAATTCCTAGTA-------G-CATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGATCCGGTGAAATCTTCGGATCCTGTTGTTTTGCGTTTGTT----CGTGTGATGACGGGAAAAG---TTGAGTA-AACCTTATCGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAG-TGA--CCT-GCA------------ Labyrinthula_sp._AN_1565 --------------CTGGTGAT-CCTGCCAGTAGTCATACGCTCG-TCTCAAAGATTAAGCCATGCATGTCTAAGTACAAG-CAC--TTGTAT-TGTGAAACTGCGAATGGCTCATTAAAACAGTTATAGTTTATTTGATAAAT-----TT----CTACATGGATAACCGTAGTAATTCTAGAGCTAATACATG-------AGTCCGCA--------------A-----GGAGCATTTATTAGA-CAT----TACCAACACGGGCAACCG-----T--ATTCAAGGTGAGTCATAATAACTAAG-----CATATCGTG---------------CAAACGAAGAATCATT-CAAGTTTCTGACCTATCA-GCTGTAG-ATGGTAG-AGTATTGGCC-TACCAT-GGCGTTCACGGG-TAACGGAGAATTAGGG-TTCGGTTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGC--AAATTACC-CAATCCTGACAC-GGGGAGGTAGTGA-CAAGAAATAACAATAC--GAAACC----ACTTGGTTT-TGTAATTGGAATGAGTACAATGTAAAACCTTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAAATTCTAGACAACGG-------------CCGCA------------------------------------ATTGTTTCAATCGCAGGCTTGAGTCTATTC-------TCACGAAGAA---------------GCTATCGCTCATTAACTTGGGTGGTAGCGGAG----------------ACGTGTCG-TTTACTGTGAACAAAT--TAGGGTGTT-TAAA-GCAGACC---TCTGTT----TGCATAC--ATTAGCATGGAATAATTAGATATGACTT-TGGTTGT----------------------------------ATTTT-GTTGGTGACTG-----CCAGAGTAATG-ATTGATAGGAAC-TGTC--GTGGGTATTCGTATGAGCATG-T-CAGAGGTGAAATTCTT--GGATTTTGAT-CAGACGAACTACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACTAGGG--ATTGGTGAAC--GTAGA------ATAA----------ACGTCATCA-GTACCTCG-CGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCG-GACATGAG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-ATGATTTTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTGATTCC-GTTAACGAACGAGACCTCAGCCTGCTAA-ATAGGCAGC---GCATTCTTG-----AATGTG-----ATGGCTTCTTAGAGGGACTTTCCG-GGTCTA--CCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACAATGACAGAGTCAGCGAGCTC--------------------------------TCCTGTATC--GAAAGGTATGGGG---AATCTTTTCAGTCTCTGTCG-TGATGGGGCTAGACCCTTGTAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCAGGTCATTAACCTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAGTCT------------------------------------------------------------------------------------------------------------------------------------ Labyrinthula_sp._L59 --------------------AT-CCTGCCAGTAGTCATACGCTCG-TCTCAAAGATTAAGCCATGCATGTCTAAGTACAAG---CACTTGTAT-TGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAAAACCA--------CTACATGGATAACCGTAGTAATTCTAGAGCTAATACATG------CAAACCC-------TTCG-----------GGGGCATTTATTGGA-TAC----AACCAACACTCGA--------------AAGCTGGTGAGTCACGATAAATTAG-----CATATCGCG----------------TAGCGATGAATCATT-CAAGTTTCTGCCCTATCA-GCTGTAG-ATGGTAG-AGTATTGGCC-TACCAT-GGCGTTAACGGG-TAACGGGGAATTAGGG-TTCGGTTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGC--AAATTACC-CAATCCTGACAC-GGGGAGGTAGTGA-CAAGAAATAACAATAC--GGAGCCT----TATGGTTT-TGTAATTGGAATGAGTACAATCTAAAACCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAAATTTTAGCGCGGTGAGCCCTCTACAATGTAGCAGC-------------------GGCTCTCCGGGCTAATACTCG--CAAAGAAGCCTGTGCTCAT--------------------------------------TAACTTGGGCGCAGGTTGAGT------------------------TGCGTCG-TTTACTGTGAACAAAT--TAGGGTGTT-TAAA-GCAGGCC-------TACGTTTGAATAC--ATTAGCATGGAATAATGAGATATGACTT-TGGTCGT-----------------------------------ATTT-GTTGGTGACTG-----CCGGAGTAATG-ATTGACAGGAAC-TGTT--GTGGGTATTCGTATGAGCATG-T-CAGAGGTGAAATTCTT--GGATTTTGAT-CAGACGAACTACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACTAGGG--ATTGGTGGAT--GTGAAA----------------ACGACATCATCA-GTACCTCG-TGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCG-GACATAAG-TAGGATTGAC-AGATTG-AGAGCTCTTTC-ATGATTTTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTACTAA-ATAGTCCGC---GCATTTTCGC----AATGTG-----ATGACTTCTTAGAGGGACATTTCG-GTTCTA--CCGAAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACAATGACAGAATCAACGAGTT-------------------------------CATCCTTTGCT--GACAAGCAC-AGG--TAATCTTTTCAGTTTCTGTCG-TGATGGGGATAGACCCTTGTAATTGTTGGTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATTAACTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAGTCTTCGGACCGCTGCGCGTCCTCT----------GGAAGGCGCAACGGGAAG---TTGAGTA-AACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTTGC-------------- Labyrinthula_sp._L72 ---------TTACCTGGTTGATTCCTGCCAGTAGTCATACGCTCG-TCTCAAAGATTAAGCCATGCATGTCTAAGTACAAG---CACTTGTAT-TGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAAAACCG--------CTACATGGATAACCGTAGTAATTCTAGAGCTAATACATG-----CAATTCCTGGCAA--------------CAGGAGGCATTTATTGGA-TAT----AACCAACACGGC--CTAG----CCGAAAACCTGGTGAGTCACGATAAGTTAG-----CATATCACG---------------TATGTGATGAATCATT-CAAGTTTCTGCCCTATCA-GCTGTAG-ATGGTAG-AGTATTGGCC-TACCAT-GGCGTTAACGGG-TAACGGGGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGC--AAATTACC-CAATCCTGAAAC-GGGGAGGTAGTGA-CAAGAACTAACAATAC--GGAGCCT----TTTGGTTT-TGTAATTGGAATGAGAACAATCTAAAACCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAAATTTTAGGTCGGGAACCGGCTGCTTTCGCACGCT--------------------GCGTTCCTGAACTGATACTCG--CAAAGAAGCTTTCACCCAT--------------------------------------TAGTTTGGGTGTCTGCCGAGT------------------------TGCGTCG-TTTACTGTGAACAAAT--TAGGGTGTT-TAAA-GCAGGCC-------TACGTTTGAATAC--ATTAGCATGGAATAATGAGATATGACTT-TGATTGT----------------------------------ATTTT-GTTGGTGACCG-----TCAAAGTAATG-ATTGATAGGAAC-TGTT--GTGGGTATTCGTATGAGCATG-T-CAGAGGTGAAATTCTT--GGATTTTGAT-CAGACGAACTACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTT-ACCCTAAACTATGCCGACTAGGG--ATTGGTGAATGTATTCA-----------------ATGACATCATCA-GTACCTCG-TGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAA--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCG-GACATAAGTAGGCATTGAC-AGATTG-AGAGCTCTTTC-ATGATTTTATGGG-TGGTGG-T-T???GCC-GATC?GAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTACTAA-ATAGACCTG---GCATTTTCAT----AATGTC----GAGGACTTCTTAGAGGGACTTTTCG-GTTCTA--CCGAAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACAATGACAGAATCAGCGAGTT-------------------------------CATCCTTTGCC--GACAGGCAC-AGG--TAATCTTTTCAGTTTCTGTCG-TGATGGGGCTAGACCCTTGCAATTGTTGGTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATTAACTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAGTCTTCGGACCGAAGTGCATCCTTC---------GGGACAGCACAGCGGGAAG---TTGAATA-AACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGAT-------------------------------- Labyrinthula_sp._f_Sap_16_1 ----------------------------------------------TTTGAAACCATTAGGCA-GCCCGTCTAAGT?CAAG-CAC--TTGTAT-TGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAAAA-----TCA---CTACATGGATAACCGTAGTAATTCTAGAGCTAATACATG-CGAATTATTCTGAGC-------------AATCAGAATGTATTTATTAGA-ACG---AAACCAATACAGCTTGCTG-------TTCTTTTGGTGACTCATGATAAATTTA-----CCTATCGCG---------------TAAGCGATGGATCATT-CAAGTTTCTGCCCTATCA-GCTGTCG-ATGGTAG-GGTATTGGCC-TACCAT-GGCGTTAACGGG-TAACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTGACAC-GGGGAGGTAGTGA-CAAGAAATAACAATAC--GGGGTCT--TTC--GATCT-TGTAATTGGAATGAGTACAATTTAAAACCGTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGTGTAGGCAA-----------CC--------------------------------------TCTTTTAAAGATGTGTTGCCTT--GCCTTTCT-------CACAGGGAATC-------------CTTTCGGTA--TTAATTTACTGAAT----------------TGAAGATCTGTGT?G-?TTACTG?GAACAAAC--TAGAGTGTT-GAAA-GCACGC-----AAAAGCT--TGAATA---AATAACATGGGAAAAAAACAAAAGCGTT?CCATAAT----------------------------------ATTGTGGGG?G?G---ACCAGGCCGTTGATAAA-CATAACAGAACC-AGTAC-GTGGATCTTCG?ATGAGCATG-T-?AGAGG?GAAATTC?T--G?AT?T?GCT-CA?ACCAACTAC?GCG-AA?GCAT?CATCAAGGATGTT??C-?TTAATCA?-GAACGAAA-G?TAGGGGATCGAAGATGA??AGAT?CCATCG?---?GT?TTA-ACC?TAAACTATGCCGACTAGGG--AT?GG?GAAAGTATTTA-------------------GACTTCATCA-GTACCTTA-TGAGAAATCA-AAGTCTTTGGGTTCTGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGT-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GATCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-G?TAACGAACGAGACCTCA-CCTGCTAA-ATAGTTCGC---TTATTCGTAA---GAATATT-----CCAGCTTCTTAGAGGGACATTTCG-GGTTTA-CCCGGAAGGAAGTTTGAGGGCA-TAACAGGTCTGTGATGCCC-TTAGATG-T?CTGGGCC-CCCGCGCGCTACAATGACCAATTCAACAAGCTT--------------------------------TT??TGGTC--G?CAGACCT-GGA--TAATCTTC-AAATATTGTC?G--GGTGGGGCTAGCCCCTT??A-TTGTGGGTCT?CAAC-AGGAATT?CTAGT?AAC?CA?????T-AACTTGC?TTG?TACC--??CCTGCCTTT--GACACACCGCCCG?C?-ACCT?CC?A--T-GGATGA?T----------------------------------------------------------------------------------------------------------------------------------------------- Oblongichytrium_minutum --------------TGGTTGAT-CCTGCCAGTAGTCATACGCTCG-TCTCAAAGATTAAGCCATGCATGTCTAAGTATAAG-CGA-CTTATAC-TGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGTAA---CTTT---CTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATG-CAC-TAAGGCCTGACT---TTTG--TGGA--AGGGCTGTATTTATTAGA-TAC---AAACCAATGCGGTGCTTGC---ACCGGTATTGTGGTGAGTCATAGTAACTAAG-----CGAATCGTA-TGGC--CTTTGCGCT-GACGATGAATCATT-CAAGTTTCTGCCCTATCA-GCTGTCG-ATGGTAG-GGTATTGGCC-TACCAT-GGCGTTAACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTAATAC-GGGGAGGTAGTGA-CAAGAAATAACAATAC--GGGGC-C--TAT--GGTCT-TGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAATGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGGATTTCTGAC-AGGAGCG-----ACCGGTCCGATCCT-----------------TTGGGTCG--A--G-TACTTT------GTGTTGTCTCTAGTCATCC-------TTATGGAGAACG-------------CTCGTGGTA--TTAAGTTATCGTGA----GTGGG------------AACCATATCG-TTTACTGTGAAAAATT---A-AGTGTT-TAAA-GCAGGC----AAT-CGCTG-TGAATAC--GTTAGCATGGAATAATAAGATAGGACTT-TGGTACT----------------------------------ATTTT-GTTGGTT---TACATACCAAGGTAATG-ATTAAGAGGGAC-AGTT--GGGGGTATTCGTATTTAATTG-T-CAGAGGTGAAATTCTT--GGATTTATGA-AAGACGAACTACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCTTAAACCATGCCGACTAGGG--ATTGGTGGAC--GTTAA------TTGA-------ACGACTTCATCA-GCACCTTA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCG-GACATAGT-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTGCTAA-ATAGTATGCG-CTTTC---TTTGGAAAGCGTA------AGACTTCTTAGAGGGACATTTCG--GTTTT-ACCGAAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGAATTCAACGAGTT----------------------------TATA-ACCTTGGCT--GAGAAGCCTGGGG--TAATCTTTTAAACGTTCATCG-TGATGGGGCTAGATTATTGCAATTATTAATCTTCAACGAGGAATTCCTAGTACACGCAAGTCATCAGCTTGCATGGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACTTACCGA-TT-GAATGGTCCGGTGAAAACTTTGGACCGTGACTTTGCCTTTCTTTCG-GGAAAGCGTTGTCGTGGGAAG---TTGTTTA-AACCTTATCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAG-TGAA-CCT-GC------------- Oblongichytrium_multirudimentale ------------CCTGGTTGAT-CCTGCCAGTAGTCATACGCTCG-TCTCAAAGATTAAGCCATGCATGTCTAAGTTTAAG-CAA-TTTAAAC-TGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGTAC---TTTA---CTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATG-CGT-CAACGCCCGACTG--CTTG--CGGA--AGGGCCGTATTTATTAGA-TTT---AAACCAATGCGGT--TTCG---CCCGGTATTGTGGTGAGTCATAATAACTAAG-----CGAATCGTA-TGGC--CTTG-TGCC-GACGATGAATCATT-CAAGTTTCTGCCCTATCA-GCTGTCG-ATGGTAG-GGTATTGGCC-TACCAT-GGCGTTAACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTAACAC-GGGGAGGTAGTGA-CAATAAATAACAATAC--GGGGCCA-TTTTG--GTCT-TGTAATTGGAATGAGTACAATATAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGGATTTCTGAC-AGGAGCG-----ACCGGTCTCGAATC-----CTTCGT--------GGTTCG---TGTTTACTTT-----GTGTCCGTCTCTAGTCATCC-------TTACGGAGAACG-------------TGTGTGTCA--TTAAGTTGGCGTGC----ATGGG------------AACCGTATCG-TTTACTGTGAAAAAAT--TAGAGTGTT-TAAA-GCAGGC-----AATCGCTG-TGAATAC--ATTAGCATGGAATAATAAGATAGGGCTT-TGGTACT----------------------------------ATTTT-GTTGGTT--TG-TATACCAAGGTAATG-ATTAAGAGGGAC-AGTT--GGGGGTATTCGTATTTAATTG-T-CAGAGGTGAAATTCTT--GGATTTATGA-AAGACGAACTACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACTAGGG--ATTGGTGGAC--GTTA-------TTTG------AACGACTTCATCA-GCACCTTA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCG-CTTAATTTGACTCAACACGGG-GAAACTTACCAGGTCCA-GACATAGT-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTGCTAA-ATAGTATGCC-TTTTC---TCACGAAAGGGTA-----CTGACTTCTTAGAGGGACATTTCG--GTTTT-ACCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGAATTCAACGAGTT----------------------------TATA-ACCTTGGCT--GAGAAGCCT-GGG--TAATCTTTTAAATGTTCATCG-TGATGGGGATAGATTATTGCAATTATTAATCTTCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAATCTTTGGACCGTGACTTTGTCTTGCTTTCGGGCGAGACGCTGTTGTGGGAAG---TTGATTA-AACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAG------------------------- Oblongichytrium_sp._7_5 --------------------------------------------------AAAGATTAAGCCATGCATGTCTAAGTATAAG-CAA-CTTATAC-TGCGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGTAC---TTTT---CTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATG-CAGTCAAAGCCCGACTG--CTTGCAGGAA---GGGCTGTATTTATTAGA-TAT---AAACCAATGCGGG--TTTA---CCCGGTATTGTGGTGAGTCATAATAACTAAG-----CGAATCGTA-TGGC--CTTG--CGCCGACGATGAATCATT-CAAGTTTCTGCCCTATCA-GCTGTCG-ATGGTAG-GGTATTGGCC-TACCAT-GGCGTTAACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTAACAC-GGGGAGGTAGTGA-CAAGAAATAACAATAC--GGGGCCT---TT--GGTCT-TGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAATGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGGATTTCTGACAGGAGCGA------CCGGTCCGAGCCTTC-----------------GGGTTCG----TGTACTTT------GTGTTGTCTCTAGTCATCCT-------TATGGAGAGCG-------------TGTCTTTCA--TTAATTTGTTGGGCATGGG----------------ATCCATATCG-TTTACTGTGAAAAAAT--TAGAGTGTT-CAAA-GCAGGC-----AATCGCTG-TGAATAT--ATTAGCATGGAATAATAGGATAGGACTTTGGTTACT----------------------------------ATTTT-GTTGGTT--TG-CATACCAAGGTAATG-ATTAAGAGGGAC-AGTT--GGGGGTATTCGTATTTTAATTGT-CAGAGGTGAAATTCTT--GGATTTATGA-AAGACGAACTACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACTAGGG--ATTGGCGATC--GTTAT------TTAT-------ACGACCTCGTCA-GCACCTTA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCG-GACATAGT-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTGCTAA-ATAGTATGCG-TTTTCTCACGA---AAGCGTA------AGACTTCTTAGAGGGACATTTCG--GTTTT-ACCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGAATTCAACGAGCT------------------------------TTAACCTTGGCT--GAGAAGCCT-GGG--TAATCTTTTGAACGTTCATCGGTGATGGGGATAGATTATTGCAATTATTAATCTTCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTG-------------------------------------------------------------------------------------------------------------------------------------------------------- Oblongichytrium_sp._8_7 --------------------------------------------------AAAGATTAAGCCATGCATGTCTAGGTAT??G-CAA-CTTATAC-TGCGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGTAC---TTTT---CTACATGGATAACCGTAGTAATTCTAGAGCTAATACATG-CGT-CAAAGCCCGACTG--CTTG--CGGA--AGGGCTGTATTTATTAGA-TAT---AAACCA?TGC?GGGTTTAC--CCCGGTATTGTAGGTGAGTCATAATAACTAAG-----CGAATC?GTATGGC--CTTG--CGCCGACGATGAATCATT-CAAGTTTCTGCCCTATCA-GCTGTCG-ATGGTAGGGGTATTGGCCCTACCATGGGCGTTAACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTAACAC-GGGGAGGTAGTGA-CAAGAAATAACAATAC--GGGGCCT---TT--GGTCT-TGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAATGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGGATTTCTGACAGGAGCGA------CCGGTCCGAGCCTTC-----------------GGGTTCG----TGTACTTT------GTGTTGTCTCTAGTCATCCT-------TATGGAGAGCG-------------TGTCTTTCA--TTAATTTGTTGGGCATGGG----------------ATCCATATCG-TTTACTGTGAAAAAAT--TAGAGTGTT-CAAA-GCAGGC-----AATCGCTG-TGAATAT--ATTAGCATGGAATAATAGGATAGGACTTTGGTTACT----------------------------------ATTTT-GTTGGTT--TG-CATACCAAGGTAATG-ATTAAGAGGGAC-AGTT--GGGGGTATTCGTATTTAATTG-T-CAGAGGTGAAATTCTT--GGATTTATGA-AAGACGAACTACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACTAGGG--ATTGGCGATC--GTTAT------TTAT-------ACGACCTCGTCA-GCACCTTA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCG-GACATAGT-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAAACCTCAGCCTGCTAA-ATAGTATGCG-TTTTCTCACCG--AAAGCGTA------AGACTTCTTAGAGGGACATTTCG--GTTTT-ACCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGAATTCAACGAGCT------------------------------TTAACCTTGGCT--GAGAAGCCT-GGG--TAATCTTTTGAACGCTCATCG-TGATGGGGATAGATTATTGCAATTATTAATCTTCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTG-------------------------------------------------------------------------------------------------------------------------------------------------------- Oblongichytrium_sp._SEK347 ---------------------------CCAGTAGTCATACGCTCG-TCTCAAAGATTAAGCCATGCATGTCTAAGTATAAG-CAA-CTTATAC-TGCGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGTAC---TTTT---CTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATG-CGT-CAAAGCCCGACTG--CTTG--CGGA--AGGGCTGTATTTATTAGA-TAT---AAACCAATGCGGG--TTTA---CCCGGTATTGTGGTGAGTCATAATAACTAAG-----CGAATCGTA-TGGC--CTTG--CGCCGACGATGAATCATT-CAAGTTTCTGCCCTATCA-GCTGTCG-ATGGTAG-GGTATTGGCC-TACCAT-GGCGTTAACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTAACAC-GGGGAGGTAGTGA-CAAGAAATAACAATAC--GGGGCCT---TT--GGTCT-TGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAATGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGGATTTCTGACAGGAGCGA------CCGGTCCGAGCCTTC-----------------GGGTTCG----TGTACTTT------GTGTTGTCTCTAGTCATCCT-------TATGGAGAGCG-------------TGTCTTTCA--TTAATTTGTTGGGCATAGGGA---------------TCCATATCG-TTTACTGTGAAAAAAT--TAGAGTGTT-CAAA-GCAGGC-----AATCGCTG-TGAATAT--ATTAGCATGGAATAATAGGATAGGACTT-TGGTACT----------------------------------ATTTT-GTTGGTT--TG-CATACCAAGGTAATG-ATTAAGAGGGAC-AGTT--GGGGGTATTCGTATTTAATTG-T-CAGAGGTGAAATTCTT--GGATTTATGA-AAGACGAACTACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACTAGGG--ATTGGCGATC--GTTAT------TTAT-------ACGACCTCGTCA-GCACCTTA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCG-GACATAGT-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTGCTAA-ATAGTATGCG-TTTTCTCACGA---AAGCGTA------AGACTTCTTAGAGGGACATTTCG--GTTTT-ACCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGAATTCAACGAGCT------------------------------TTAACCTTGGCT--GAGAAGCCT-GGG--TAATCTTTTGAACGTTCATCG-TGATGGGGATAGATTATTGCAATTATTAATCTTCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAATCTTTGGACCGTGGTATCGTCTTGCTTTCGGGCAAGACTTTGCCGTGGGAAG---TTGATTA-AACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAG------------------------- Ochromonas_danica ----------AACCTGGTTGAT-TCTGCCAGTAG-CATACGCTTG-TCTCAAAGATTAAGCCATGCATGTCTAAGTATAAG-CAATCTTATAC--GTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTCTTTGATGGTC----CTTG---CTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATG-CAG-CAATCCCTGAC----TTAG----GA--AAGGGTGTACTTATTAGA-TAGA---AACCAAT-GGGG--GCAA--CCCT--TTGTTTGGTGATTCATAGTAATTTT------CGGATCGAT-C-----TTCG----G-ATCGATGCATCATT-CAAGTTTCTGCCCTATCA-GCTTTGG-ATGGTAG-GGTATTGGCC-TACCAT-GGCATTAACGGG-TAACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAAATGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATCCTGACAC-AGGGAGGTAGTGT-CAATAAATAACAATGT-TG-GGCC--TTCG--GGTCT-GACAATTGGAATGAGAACAATTTAAATCCCTTATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAAATTCTGAT-TTCGGAT-----GTCGGTCGGCCC---------CAAG--------GGGTTA---GT---ACCGT------CT-G-TTCGG-AATCAT-CCT------CGAGAG--GAA-------CA-C---GTCTGTCA-TTCAGT-TGATGGG----CGTG---GGA---------TTCTCGTCT-TTTACTGTGAGTAAAC--TAGAGTGTT-CAAA-GCAGAC--ATCAT--GTCATTGAATAC--GTTAGCATGGAATAATAAGATAGGACCT-TGGTCT-----------------------------------ATTTT-GTTGGTT--TG--ACTCCAAGGTAATG-ATTAATAGGGAC-AGTT--GGGGGTATTCGTATTCAATTG-T-CAGAGGTGAAATTCTT--GGATTTATGG-AAGACGAACTACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCATAAACTATGCCGACTAGGG--ATTGGTGGAC--GTT--------GTAA-------TTGACTCCATCA-GCACCTTA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GAAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-GAAACTTACCAGGTCCA-GACATAGT-GAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCCCTGCCTGCTAA-CTAGTCGTC--TGAATGCCTAG---GCATTGA--GATCCGACTTCTTAGAGGGACTTTTGG-TGACTA-ACCA-AAGGAAGTTAGGGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TCCTGGGCCGCACGCGCGCTACACTGACACATGCAGCGAGTT------------------------------CT-TCCTTGTCC--GAAAGGTCT-GGG--TAATCTTGTCAATGTGTGTCG-TGATAGGGATAGATTATTGCAATTATTAATCTTGAACGAGGAATTCCTAGTAAATGCGGGTCATCAGCTCGCGTTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGATTCGGTGAAACTTTCGGACCGTGGTTCTTGCCAC-TTCG---GTGGTGAGAATCGTGGAAAG---TTATTTA-AACCTCATCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAA-CCT-GCGGAAGGATCATTA Quahog_parasite_X --------------------------------AGTCATACGCTCA-AGTCAAAGATTAACCCATGCATGTGCAAGTATAAA---CATTTATAC-TGTGAAACTGCGAACGGCTCATTATATCAGCTATAGTCTATTTGGTAATGT----CTA---CTACTTGGATACTCGTAGTAATTCTAGGGTCAATACATG-CAT-AAATGCCCAACTT--TTCG----GA--CGGGCAGTATTTATTTGA-TAT---AAACCAATCGCTTCTGGCG--------TTTTGTGGTGATTCAAAGTAACTAAG-----CGGACCGCAGTGCCTTTTGG-----CGGCGGTGGACCATT-CGAGTTTCTGCCCTATCA-GTTGTCG-TAGGTAG-TGTATTGGAC-TACCTA-GACCTTTACGGG-TGACGGAGAATTGGGG-TTCGATTCCGGAGAAGA-AGC-CTGAGAGACGGCTACT-ACATCCAAGGA-AGGCAGCAGGGGCGC--AAATTACC-CAATGGTGACAC-GCCGAGGTAGTGA-CAACCAATATCGTTGC---GGACCC--TTATGGGTTT-TGCTA-TGAAATGAGTGCAATCTAAAATACTCAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCGTTAGCGTATA--TTAAATTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGTAGGAGTGA-----CCTGGCCTTTGAC--------------------GAATGTCAATGTTTGCTGT------GTGTCATCTCTGGCCATCCT-----------------------------------CGGCC--TGCTTTTAGTAGGC--------------------------CGTCA-TTTACTGTAAAAAAAT--TAGAGTGTT-TCAA-GCATTTTGTATGA-----AAAGAATAT--ATTAGTATGGAATAATAAGATAGGACTT-TGGTGCT----------------------------------ATTTT-GTTGGTT--TG-CACACCAAAGTAATG-ATGAATAGGGAC-AGTT--GGGGGTATTCGTATTTAATTG-T-CAGAGGTGAAATTCTT--GGATTTATGA-AAGACGAACTACTGCG-AAGGCATTTACCAAGGATGTTTTC-ATTGATCAA-GAACGAAA-GTATGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAT-ACTTCAAACTATGCCGACTTGCG--ATTGTCTGGT-GGTGTT------TTTT--------GGCCCCAGGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGATTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-GAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTACTAA-ATAGTACTGC-TTTTCGCAAGA----AAGGTA-----GAGACTTCTTAGAGGGACATTTCG-GGTTTA--CCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGGATTCAACAAGTTTACTATTT-----------------TATAGTTGTCCTTGGTC--GGAAGGCCT-GGG--TAATCTTTTAAATGTCTATCG-TGATGGGGCTAGATTTTTGCAATTATTAATCTCTAACGAGGAATTCCTAGTAAGCGCAAGTCATCAACTTGCACTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAATCTTCGGATTCTGCATTTTGTTCTTTATT----GGGCAGTTTGCGGAAAAAG---TTGAGTG-AACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTCTCC----------------------------- Schizochytrium_aggregatum --------------------------------------------------AAAGATTAAGCCATGCATGCGATAGTA-TAGTTGG--TAAT-C-AGCGAAACTGCGAACGGCTCATTATATCTGTTATAATTCCCATGATTGTGCG--TTGT---GTAGACGGATACATGTGGCAAATCTAGAATCAATACGTGTCTTGGAGGTCCCGAACT--TTTGTGGGAAGGGA-C-TC-A-TTATTT---TACCCTAAACCAGT--AGGCTCTCG--G-GCCTTGTTTCGGTGAGTCATAGTAATTGAG-----CGAATCGCATAGCC--CTCG---GGCGGCGATGAATCATT-CAAGTTTCAGCCCCATCA-GTTGTCG-ACGGGAG-GGTATTGGCC-TCCCGT-GACCGTTACGGG-TGACGGGGAATTAGGG-TTCGAGTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACTGCAAGTTCTACAG-AACGAAGTAGTGA-CGAAAAATAACAGTGA---GTGCGCTGTGCGTAATCT---CGACTGAAATGAGAGCAATTTAAAACCCCCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCCCGGTAATTCCAGCTCCAATAGCGTATA--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TCGAACGTGTGGCGTGCGCG-------CGGGTCCGTCGG--------------------GGGGCCGAATGCC--TCCGAGCAGCGACTCGCGCGGTGCCAG----------T--------------------------CTGGCACTT-TTTGAGGTG-----------------------------CCTCT-TTCACGGTAAAAAAAT--TAGGGTGTT-TCAAGCAAAGGTTGATAT------TGGAATAT--GATAGTATGGGATGATGAGATAGGCCGT-TGGCGGT----------------------------------ATTTT-GTTGGTT--TG-CGCGTTGGCGGAATG-ATGAAGAGGGAC-AGTT--GGGGGTATTCGAATTCTAGTG-T-CAGAGGTGAAATTCTT--GGATTACTAG-AAGGCGAACGACTGCG--AAACATTTACCAAGGATGTTTTC-ATTGATCAA-GAACGAAA-GTATGGGGATCGAAGATGATTAGATACCATCGT---AGTCCAT-ACCGTAAACGATGCCGACTCGCG--ATGGTCCCCTGGCT---------CTAG-------TGGCGGGGGGCG-GCA-CGCA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCCACACGGG-GAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCCCGTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTGATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGTGCGCG-TTGTGGCGACACAGTGAGAGG-------CACTTCTTAGAGGGACACTTTG-GGTTTA--CCAGAGGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTTGCTTTG---------TC--G---TACGACAACGTCCTGGGCC--GGAAGGTTT-GGG--TAATCGTGTGAATACCAGTCG-TGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTA--CACCGCCCGTCGCACCTACCGA-TT-GAACGTTCCGGTGAGAC-TTCGGAGGGCACGATGTTCCTGGCGACAGGACGTG-------------------------------------------------------------------------------------------------- Schizochytrium_sp._KK17_3 -----------------TTGAT-CCTGCCAGTAGTCATACGCTTG-TCTTAAAGATTAAGCCATGCATGCGATAGTATTAGTTGG--TAATAC-AGCGAAACTGCGAACGGCTCATTATATCTGTTATAATTCCCATGATTGTGCG---TTG--TGTAGACGGATACATGTGGCAAATCTAGAATCAATACGTG-CTT-GGAGGCCCGACT---TTTG--GGGA---GGGCCGCACTTATTAGACCTA----AACCAGTAGGCT--CTCG---GGCCTTGTGATGGTGAGTCATAGTAATTGAG-----CGAATCGCATAGCC--CTCG---GGCGGCGATGAATCATT-CAAGTTTCAGCCCCATCA-GTTGTCG-ACGGGAG-GGTATTGGCC-TCCCGT-GACCGTTACGGG-TGACGGGGA-TTAGGG-TTCGATTCCGGAGAGGGCAGCTCTGAGAGACGGCTACC-ACATCCAAGGAGAGGCAGCAGGCGCGT--AAATTACTGCAAGTCTTACAG-AACGAAGTAGTGA-CGAGAAATAGCAGTGA-GGTCGCGCTGTGC-GTATCT---CGACTGAAATGAGAGCGATTTAAAACCCCCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--CTAAAGTTGTTGCA-GTTAAAAAGCTCGGTAAGGTCCGAATGTATGGTTGGTGTGGC--GTGTCGGTGGGGGGGTT------------------GAATGG---------CCTGGCGGACCGGTGGCCAGGTGGCGCGGC---------------------------------CGAGTCGGGCAGCCCTGCGGGGG-------------------GGCGTGGCCCCTTCCCCGTGTAAAAAAATA-GAGGGTTTT-CACAACCAAGA-----GGTTGTATTGGAATAT--GATAGTATGGGATGATGAGATAGGCCGT-TGGCGGT----------------------------------ATTTT-GTTGGTT--TG-CGCGTTGGCGGAATG-ATGAAGAGGGAC-AGTT--GGGGGTATTCGAATTCTAGTGGT-CAGAGGTGAAATTCTT--GGATTACTAG-AAGGCGAACGACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTGATCAA-GAACGAAA-GTATGGGGATCGAAGATGATTAGATACCATCGT---AGTCCAT-ACCGTAAACGATGCCGACTCGCG--ATCGTTTCCCGGCTCTTG----------------AAGCGGGAGGCG-GCAGCGCA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-GAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTGATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGTGCGCG--TTGTGGCGACACAACGTAGG-----AGTACTTCTTAGAGGGACACTTTG-GGTTTA--CCAGAGGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTGTTTCTTGT-----------TCTTTGGGATGAGTTCCTGGGCC--GGAAGGTTT-GGG--TAATCGTGTGAATACCAGTCG-TGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGTTCCGGTGAGACCTTCGGAGGGCACGTTGTTCCTGGCGAC----AGGAGTTCGTGGCCAAAGT----TGAGCA-AACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGG---------------------------------- Schizochytrium_sp._N4_103 -------------------------------------TACGCTTG-TCTTAAAGACTAAGCCATGCATGCGATAGTATTAGTCGG--TAATAC-AGCGAAACCGCGAACGGCTCATTATATCAGTTATAATTCCCATGATGGTGCG----TCGACGTAGACGGATACATGTGGCAAATCTAGAACCAATACGTG-CAC-GGCGGCCCGACGGC-TTCG---------GGAGGGCCCTTATTTGATTTG----AACCAATACAGGCTCTGG-------CTGTCATGGTGATTCATAGTAATTGAGC----CGCATGGCC-------CTCG---GGCGGCGATGAATCATT-CAAGTTTCTGCCCCATCA--GTGTCG-ACGGGAG--GTATTGGCC-TCCCGT-GACCGTTACGGG-TGACGGGGAATTAGGG-CTCGAGTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGCAAGGCAGCAGGCGCGT--AAATTACTGCAAGTGTGACAG-AACGAGGTAGTGA-CGAGAAATAGCAAGGT-----GCGCTGTGC-GTATCT---CGACTGAAATGAGAGCGATTTAAAACCCCCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--CTAAAGTTGTTGCA-GTTA-AAAGCTCG-TAG---TCGAACGTGTGGCGTGCGCGCG---TGTCCGTCGGGGGGC-------------------GAATGC---------CCGTCG---AGCAGCGACTCGCGCGCT-----------------------------------GCCAGTCAGGCACTCCCGAGAAAG-----------------------TGGCACTT-CTCACTGTAAAAAAAT--TAGGGTGTT-TCAA-GCAAAG-----GTTGATATTGGAATAT--GATAGTATGGGATGATGAGATAGGCCGT-TGGCGGT----------------------------------ATTTT-GTTGGTT----GCGCGTTGGCGGAATG-ATGAAGAGGGAC-AGTT--GGGGGTATTCGAATTCTAGTG-T-CAGAGGTGAAATTTT---GGATTACTAG-AAGGCGAACGACT-CG-AAAGCATT-ACCAAGGATGTTTC--ATTGATCAA-GAACGAAA---TATGGGATCGAAGATGATTAGATACCATCGT---AGTCCAT-ACCGTAAACGATGCCGAC---GG--ATCGCCCCTTCCCTAAT------------------TGGCGGGGGCG-GCAGCGCA-TGAGAAATCA-AAGTCTTTGGG-TCCGGGGGGAG-TATGGTC-C-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGG--CTGCGGCTTAATTTGACTCAACACGGG-GAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTGATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGTGCGCG--TTGTGGCGACACAGTGCTGG------GCACTTCTTAGAGGGACACTTTG-GGTTTA--CCAGAGGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTTGGGCGTTG---------------------CCGGTCCTGGGCC--GGAAGGTTT-GGG--TAATCGTGTGAATACCAGTCG-TGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGA-TTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTAC-CACCGCCCGTCGCACCTACCGA-TT-GAACGTTCCGGTGAGAC-TTCGGAGGGCACGATGTTCCTGGCGAC----AGGACGTG---------------------------------------------------------------------------------------------- Schizochytrium_sp._SEK210 -------------------------------CGGTCATACGCTTG-TCTTAAAGATTAAGCCATGCATGCGATAGTATTAGTTGG--TAATAC-AGCGAAACTGCGAACGGCTCATTATATCTGTTATAATTCCCATGATTGTGCG--TTGT---GTAGACGGATACATGTGGCAAATCTAGAATCAATACGTG-CTT-GGAGGCCCGACT---TTTG--GGGA---GGGCCGCACTTATTAGA-CCT---AAACCAGTAGGCT--CTCG---GGCCTTGTGATGGTGAGTCATAGTAATTGAG-----CGAATCGCATAGCC--CTCG---GGCGGCGATGAATCATT-CAAGTTTCAGCCCCATCA-GTTGTCG-ACGGGAG-GGTATTGGCC-TCCCGT-GACCGTTACGGG-TGACGGGGAATTAGGG-TTCGAGTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACTGCAAGTTT-ACAG-AACGAACTAGTGA-CGAGAAATAGCAGTGA--GGTGCGCTGTGC-GTATCT---CGACTGAAATGAGAGCGATTTAAAACCCCCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TCGAACGTGTGGTGTGTGTGC-------GGGTCCGTCGA?-------------------GGGTGA--------ATGCCTGTCGAGCAG?GACTCGTGCACT---------------------------------------GCCAGTCTGGTATGTCTGCA------------------AGGACATGCCTCT-TTCACTGTAAAAAAAT--TAGGGTGTT-TCAA-GCAAAG-----GTTGATATTGGAATAT--GATAGTATGGGATGATGAGATAGGCCGT-TGGCGGT----------------------------------ATTTT-GTTGGTT--TG-CGCGTTGGCGGAATG-ATGAAGAGGGAC-AGTT--GGGGGTATTCGAATTCTAGTG-T-CAGAGGTGAAATTCTT--GGATTACTAG-AAGGCGAACGACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTGATCAA-GAACGAAA-GTATGGGGATCGAAGATGATTAGATACCATCGT---AGTCCAT-ACCGTAAACGATGCCGACTCGCG--ATGGTCTCTCGGCTCTTG----------------AAGCGGGAGGCG-GCAGCGCA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-GAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTGATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGAGTGCG--TTGTGGCGAC---ACAGTGA-----CATTCTTCTTAGAGGGACACTTTG-GGTTTA--CCAGAGGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTT?AGGTGGC-------------TTCCAGCCGTCGTCCTGGGCC--GGAAGGTTT-GGG--TAATCGTGTGAATACCAGTCG-TGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGTTCCGGTGAGACCTTCGGAGGGCACGTTGTTCCTGGCGAC----AGGACGTCGTGGCCAAAGT----TGAGCA-AACCTTAACG-TTA?AGGAAGGTGAA?TCGTAACAAGGTTTCCGTAGGTGAA-------------------- Schizochytrium_sp._SEK345 ----------------------------------TCATACGCTTG-TCTTAAAGATTAAGCCATGCATGCGATAGTATTAGTTGG--TAATAC-AGCGAAACTGCGAACGGCTCATTATATCTGTTATAATTCCCATGATTGTGCG--TTGT---GTAGACGGATACATGTGGCAAATCTAGAATCAATACGTG-CTT-GGAGGCCCGACT---TTTG--GGGA---GGGCCGCACTTATTAGA-CCT---AAACCAGTAGGCT--CTCG---GGCCTTGTGATGGTGAGTCATAGTAATTGAG-----CGAATCGCATAGCC--CTCG---GGCGGCGATGAATCATT-CAAGTTTCAGCCCCATCA-GTTGTCG-ACGGGAG-GGTATTGGCC-TCCCGT-GACCGTTACGGG-TGACGGGGAATTAGGG-TTCGAGTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACTGCAAGTTT-ACAG-AACGAAGTAGTGA-CGAGAAATAGCAGTGA--GGTGCGCTGTGC-GTATCT---CGACTGAAATGAGAGCGATTTAAAACCCCCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TCGAACGTGTGGTGTGTGTGC-------GGGTCCGTCG??-------------------GGGTGA--------ATGCCTGTCGAGCAGCGACCCGTGCACT---------------------------------------GCCAGTCTGGTATGTTTGCA------------------AGGACATGCCTCT-TTCACTGTAAAAAAAT--TAGGGTGTT-TCAA-GCAAAG-----GTTGATATTGGAATAT--GATAGTATGGGATGATGAGATAGGCCGT-TGGCGGT----------------------------------ATTTT-GTTGGTT--TG-CGCGTTGGCGGAATG-ATGAAGAGGGAC-AGTT--GGGGGTATTCGAATTCTAGTG-T-CAGAGGTGAAATTCTT--GGATTACTAG-AAGGCGAACGACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTGATCAA-GAACGAAA-GTATGGGGATCGAAGATGATTAGATACCATCGT---AGTCCAT-ACCGTAAACGATGCCGACTCGCG--ATCGTCTCTCGGCTCTTG----------------AAGCGGGAGGCG-GCAGCGCA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-GAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTGATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGAGTGCG--TTGTGGCGAC---ACAGTGA-----CATTCTTCTTA{GT}AGGGACACTTTG-GGTTTA--CCAGAGGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTCTTGGTGGC-------------TCTGAGCCGTCGTCCTGGGCC--GGAAGGTTT-GGG--TAATCGTGTGAATACCAGTCG-TGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGTTCCGGTGAGACCTTCGGAGGGCACGTTGTTCCTGGCGAC----AGGACGTCGTGGCCAAAGT----TGAGCA-AACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCC----------------------------- Schizochytrium_sp._SEK346 -------------------------------CGGTCATACGCTTG-TCTTAAAGATTAAGCCATGCATGCGATAGTATTAGTTGG--TAATAC-AGCGAAACTGCGAACGGCTCATTATATCTGTTATAATTCCCATGATTGTGCG--TTGT---GTAGACGGATACATGTGGCAAATCTAGAATCAATACGTG-CTT-GGAGGCCCGACT---TTTG--GGGA---GGGCCGCACTTATTAGA-CCT---AAACCAGTAGGCT--CTCG---GGCCTTGTGATGGTGAGTCATAGTAATTGAG-----CGAATCGCATAGCC--CTCG---GGCGGCGATGAATCATT-CAAGTTTCAGCCCCATCA-GTTGTCG-ACGGGAG-GGTATTGGCC-TCCCGT-GACCGTTACGGG-TGACGGGGAATTAGGG-TTCGAGTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACTGCAAGTTT-ACAG-AACGAAGTAGTGA-CGAGAAATAGCAGTGA--GGTGCGCTGTGC-GTATCT---CGACTGAAATGAGAGCGATTTAAAACCCCCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCA?CAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TA?---TC?AACGTGTGGTGTGTGTGC-------GAGTCCGTCGA?-------------------GGGTGA--------ATGCCTGTCGAGCAGCGACTCGTGCA---------------------------------------CTGCCAGTCTGGTATGTCTGCA------------------AAGACATGCCTCT-TTCACTGTAAAAAAAT--TAGGGTGTT-TCAA-GCAAAG-----GTTGATATTGGAATAT--GATAGTATGGGATGATGAGATAGGCCGT-TGGCGGT----------------------------------ATTTT-GTTGGTT--TG-CGCGTTGGCGGAATG-ATGAAGAGGGAC-AGTT--GGGGGTATTCGAATTCTAGTG-T-CAGAGGTGAAATTCTT--GGATTACTAG-AAGGCGAACGACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTGATCAA-GAACGAAA-GTATGGGGATCGAAGATGATTAGATACCATCGT---AGTCCAT-ACCGTAAACGATGCCGACTCGCG--ATGGTCTCTCGGCT?TTG----------------AAGCGGGAGGCG-GCAGCGCA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-GAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGT?TGG-TTGATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGAGTGCG--TTGTGGCGAC---ACAGTGA-----CATTCTTCTTAGAGGGACACTTTG-GGTTTA--CCAGAGGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTTTTGGTGGC-------------TTCGAGCCGTCGTCCTGGGCC--GGAAGGTTT-GGG--TAATCGTGTGAATACCAGTCG-TGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGTTCCGGTGAGACCTTCGGAGGGCACGTTGTTCCTGGCGAC----AGGACGTCGTGGCCAAAGT----TGAGCA-AACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGGAA--------------------- Thraustochytriidae_sp._BS1 --------------------------------------------------AAAGATTAAGCCATGCATGTCTAAGTATAAG-CAA--TTGTAC-TGTGAAACTGCGGACGGCTCATTATATCAGAAATAATTTATTCAGTAGTGT----T-----TTCATTGGATACCTGCGGTAATTCTGGAATTAATACATG-CTT-AAAGGCTCAACTT--TTTG----GA--CGAGCTGCATTTTTTAGA-AAT---AAATCAATAGCCT---TCG----GGTTTTGTTTGGTGATTCATAAAAACTAAG-----CGAATCGCAGT?GCT-CTTG--TAGCGGCGATGAACTGTT-CAAGTTTCTGCCCCATCA-AGTTTAG-TTGGTAG-GGTATTGGCC-TACCAA-GCTTATAACGGG-TGACGGAGAATTAGGG-TTTGATTCCGGAGAGGG-GGC-CTGAGAGACGGCTACC-ACATCTAAGGA-AGGCAGCAGGCGCGC--AAATTACC-CAATCCTGACTC-AGGGAGGTAGTGA-CGAGAAATAGAAATGC--AGAGCCA---ATTTGGTTT-TGCTATTTCAATGAGAGAAATCTAAAAACCTCAACGAGGATCAA-CTGGAGGGCAAGCCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGAAGCGTATA--CTAACGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTTGTCGGAGTGA-----CCTGGCCTTTAGC--------------------GTATGC-------TATTGTTGCCGTGTGTTGTCTCTAGCAAT-------------------------------------CCTGCCTCTTCTTTCGAGGGGG-------------------------GGCTCA-TTTACTGTAAAAAAAT--TAGAGTGTT-TCAA-GCAAAA------AGTATTTTGGAATAT--AATAGTATGGAATAATAAGATAGGACCT-TGTTACT----------------------------------ATTTT-GTTGGTT--TG-TATAACTAGGTAATG-ATTAATAGGGAC-AATT--GGGGGTATTCGTATTTAGTTG-T-CAGAGGTGAAATTCTT--GGATTTACGA-AAGACGAACAACTGCG-AAGGCATTTATCAAAGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACAGTAAACTATGCCGACTTGCA--ATTGTCCCAT--GTTGT------TTAT---------GACGGGGGCA-GCGGCACA-TGAGAAATCA-AAGTCTTAGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCG-GACATTGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCAATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCCGCCTATTAA-ATAGTACTG--GGTATGGTAAC---ATACCTA-----GAGACTTCTTAGAGGGACAGTTCG-GGTTTA--CCGGATGGAAGTTGGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGAGTTCAACGAGTTTACCACAT-------------------TTGTGGTTCTCCTTTTGCGGAAGCAACGGG--TGATCTTTTAAACGCTTATCG-TGATGGGGCTAGAGCTTTGCAATTATTGCTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTG-------------------------------------------------------------------------------------------------------------------------------------------------------- Thraustochytriidae_sp._BS2 --------------------------------------------------AAAGATTAAGCCATGCATGTCTAAGTATAAG-CAA--TTGTAC-TGTGAAACTGCGGACGGCTCATTATATCAGAAATAATTTATTCAGTAGTGT----T-----TTCATTGGATACCTGCGGTAATTCTGGAATTAATACATG-CTT-AAAGGCTCAACTT--TTTG----GA--CGAGCTGCATTTTTTAGA-AAT---AAATCAATAGCCT---TCG----GGTTTTGTTTGGTGATTCATAAAAACTAAG-----CGAATCGCAGTGCT--CTTG--TAGCGGCGATGAACTGTT-CAAGTTTCTGCCCCATCA-AGTTTAG-TTGGTAG-GGTATTGGCC-TACCAA-GCTTATAACGGG-TGACGGAGAATTAGGG-TTTGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCTAAGGA-AGGCAGCAGGCGCGC--AAATTACC-CAATCCTGACTC-AGGGAGGTAGTGA-CGAGAAATAGAAATGC--AGAGCCA---ATTTGGTTT-TGCTATTTCAATGAGAGAAATCTAAAAACCTCAACGAGGATCAA-CTGGAGGGCAAGCCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAGAAGCGTATA--CTAACGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTTGTCGGAGTGA-----CCTGGCCTTTAGC--------------------GTATGC-------TATTGTTGCCGTGTGTTGTCTCTAGCAAT-------------------------------------CCTGCCTCTTCTTTCGAGGGGG-------------------------GGCTCA-TTTACTGTAAAAAAAT--TAGAGTGTT-TCAA-GCAAAA------AGTATTTTGGAATAT--AATAGTATGGAATAATAAGATAGGACCT-TGTTACT----------------------------------ATTTT-GTTGGTT--TG-TATAACTAGGTAATG-ATTAATAGGGAC-AATT--GGGGGTATTCGTATTTAGTTG-T-CAGAGGTGAAATTCTT--GGATTTACGA-AAGACGAACAACTGCG-AAGGCATTTATCAAAGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACAGTAAACTATGCCGACTTGCA--ATTGTCCCAT--GTTGT------TTAT---------GACGGGGGCA-GCGGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCG-GACATTGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCAATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCCGCCTATTAA-ATAGTACTG--GGTATGGTAAC---ATACCTA-----GAGACTTCTTAGAGGGACAGTTCG-GGTTTA--CCGGATGGAAGTTGGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGAGTTCAACGAGTTTACCACAT-------------------TTGTGGTTCTCCTTTTGCGGAAGCAACGGG--TAATCTTTTAAACGCTTATCG-TGATGGGGCTAGAGCTTTGCAATTATTGCTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTG-------------------------------------------------------------------------------------------------------------------------------------------------------- Thraustochytriidae_sp._C9G ------------------------------------ATACGCTTG-AGTCAAAGATTAAGCCATGCATGTGTAAGTTTAAATCAA-TTTAAAC-GATGAAACTGCGGACAGCTCATTACACAAGAGAGAATCTATTTGGTAGTGT---TTTA--TACGATAGGATATCTGTTGTAATTCAAGAGTTAATACTTA-CATTAAAGACCCAACTT--TCTG----GA--CGGGTTGTATATATTAGATTTA----AACCAACCAGGGTGACCT------GTTAATATGGTGATTCATAATATCTAAG-----CGGATCGCAGTGACTTTTAG----TCGGCGATGAGCCAAC--GACTTTCTTCCCCATCA-AGTTTAG-ACTGTAG-GGTAGTGGCC-TACAGT-GCTTGTTACGGG-TGACGGAGAATTAGGG-TTTGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGC--AAATTACC-CCATGGTGACAT-GCCGAGGTAGTGA-CAACTAATATTATTGC---GGACCA--TTTTTGGTTT-TGCTA-TGAAATGAGTGCAATTTAAAATACTCAACGAGGATCAA-TTGAAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTTCAATAGCGTATG--TACACGTTGTTGCA-GTTAAAACGCTCG-TAG---TTGAATTTCTGGTAGAAGTGA-----CCAAGCCTTTGAC----------------------------------GTAATGTCAATGTTTTGCTTTGTGTCAC----------TTTGGCCA------------------TCCTAGATTAAAATTTACTTTTT-----------------------AATCTTCA-TTTACTGTAAAAAAAT--TAGAGTGTT-TAAA-GCATTTCGTATGA-----AAAGAATAT--ATCTGTATGGAATAATAAGATAGGACTT-TGGTGCT----------------------------------ATTTT-GTTGGTT--TG-CACACCAAGGTAATG-ATTAATAGGGAC-AGTT--GGGGGTATTTGTATTTAATTG-T-CAGAGGTGAAATTCTT--GGATTTAATA-AAGACAAACAACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAT-GAACGAAA-GTTTGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAA-ACAGTAAACTATGCCGACTTGCG--ATTGTTTGATGGTGTTT------TTAA------TTTGCCACAAGCA-GCAGCATA-TGAGAAATCATAAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGATTGAAACTTAAA-AGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCG-GACATAAG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTTTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGTTTGAATTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCGGCCTACTAA-ATAGTAATGC-TTTGAGCAATCAAGGTAGTTT-------GACTTCTTAGAGGGACATTTCG-GGTTTA--CCGGAAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGGTATCAACAAGTTTTTATATA----------TTTTATTATATAATTTCCTTGATC--GGAAGGTCT-GGG--TAATCTTTTAAATCACCATCG-TGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAATCTTCGGAGTTTGATTTTTTGGATTTATT----TTTAAAAGATTGAGCAAAG---TTGAGTA-AACCTTATCATTTAGAGGAAGGTGAAGTCGTAACAAGGTCTCC----------------------------- Thraustochytriidae_sp._Fng1 -----------------------------------------------------------------------------TAAG---CTTTTGTAC-TGTGAAACTGCGAACGGCTTATTATACCAGTTATCGTCTATTGGATAGTGT----TTC---TTAGATGGATATCTGCAGTAATTCTGGAGCTAATACATG-CTT-AGAGGGGCGACTT--TTTG---GGA---GCCCTGCATTTGTTAGA-TTAC---AACCAAC------------------ATTCATTGGTGATTCATAACAACTTAG-----CGGACCGCAGTGCC---TTG---AGCGGCGGTAAATCCTT-CGAGTTTCTGCCCCATCA-GCTGTTG-ACGGTAG-CGTAACGGGC-TACCGT-GGCTTTCACGGG-TAACGGAGAATCAGGG-TTTGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATTCTGATAC-GGAGAGGTAGTGA-CGAGAAATAGCAAGGC--GCGGCCC--TTC--GGGTTGTGCTATTGCAATGAGTGCGATGTAAAGTTCCCAACGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--CTAACGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATGTGTGGTGGGTGTTGA----CCGTGTCTGTGCC-----------------------------------TTGT------GCACTGTTTCACAGTGT------------------------------------CAATGCCTGCTATTCTGAGGAGC------------------TCTGCTCCTCTCA-TTTACTGTAAACAAAT--TAGAGTGTT-TCAA-GCAGGC----TGTAAGCC--GGAATAT--ACTAGTATGGAATAATAAGATAGGACTTTTGGTCTA------------------------------------CTT-GTTGGTT----CTAACCAAGAGTAATG-ATGAATAGGGAC-AGTT--GGGGGTATTCGTATTTACATG-T-CAGAGGTGAAATTCTT--GGATTTTGGA-AAGACGAACAACTGCG-AAAGCATTTACCATGGATGTTTTC-ATTAATCAA-GAACGAAA-ACTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCCTG-GTAGTAAACTATGCCGACTTGCG--ATTGCAAGGT--GTCTT------TTAT-------TTGACTCTTGCA-GCAGCACC-TGAGA-ATCA-AAGTCTTTGGGGTCTGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCTTGCGGCTTAATTCGACTCAACACGGG-AAAACTTACCAGGTCCG-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTACTAA-ATAAGACGCG-TTATGGCGACA---TAGCGTG------AGCTTTCTTAGAGGGACATTTCG-GGTTTA--CCGGAAGGAAGTGTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGACATGTTGAACAAGTTTTTTTCTT---------TTTTGAAAAGAGAAAGTCCTTATCC--GGAAGGATT-GGG--TAATCTTTTGAAACCATGTCG-TGATGGGGCTAGATTCTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGATCCGGTGGACTCGTTGGATATGTAAATTGGATGAAAGTTTGATGTAGCGTAG--------------------------------------------------------------------------------------------- Thraustochytriidae_sp._H1_14 ----------------------------------CCCACTGACGC-TGTCTCAAGCCTAGTCATGCATGTCTAAGTATAAA--GGACTTATAC--TCTGAACTGCGAACGGCTCATTATATCAGTTATAGTTCCTTTGATAGTGAAG--------TTAGATGGATACTTGTGGCAAATCC---GCCCATACATG-CTT---GAGCCCGACT---TTTG--GGGA---GGGCCGCATTTATTTGA-TTA----AACCAATAGCCT--CTCG----GGGTTGTTTGGGTGAGTCAGAATAAGTCAG-----CGAACCTTT-------GGTA----ACGAAGGTGAATCATT-CGAGTTTCTGCCCCATCA-GTTGTCG-ACGACAC-GGTATTGACC-TGTCGT-GACTGTCACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACT-CAATGTTAAATG-GACGAAGTAGTGA-CGAGAAATAACAATGT----GGATCGCTTATGCGTTT-TACAATTGTAATGAGAGCAGATTAAAGGGGTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATGC----TA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TGGAGTATATCATATCTTGAG--------GTTTTGGCCTT----------------------------------TTAAA----CACGTGGCCCCGAAAAAA-----------GAGAAA----------------------CTCTTCTCTCTCTGAGAGAA-------------------------AAAACA---TACTGGGAAAAAAAATTAGAGTGCA-CAAC-GCGGGGTGTGTGG-----GGTGAATAT----AGGTATGGAATAATGAGATAGGACTT-TGTTGTT----------------------------------ATTTT-GTTGGTT--TG-CATGGCAAGGTAATG-ATTAATAGGGAC-AGTT--GGGGGTATTCGTATTACGATG-T-CAGAGGTGAAATTCTT--GG----CTGA-AAGACGAACAACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCGTAAACAATGCCGACTTGCG--ATTGTGTCGCTCTTGTT------TTGA------ATAGGGCGGTGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-GAAACTTACCAGGTCCG-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCG-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAATGTCGT-TTTTTTTGATTAAAAGGCGTA-------TGTTTCTTAGAGGGACATTTCG-GGTTTA--CCGGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACAAGTTTTTTTATC-------------ATTTCATAATTTTCCTTGGTA--GGAATGCCT-GGG--TAATCTTTTGAACGCCGATCG-TGATGGGGCTAGATTTTTGCAATTGTTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCACCTTGCATTGATTAC-CGCCCTGCCCTTTGTACACACCGGCCGTCGGACCTACCGA-TT-GAACGATCCGGTGAGACCTTGGGATTGCTTGTATTTTTTTTAACG----AAAGGATGTAGGCGAGAAC---TTGAGCA-AACCTTATCGTTTAGAGGAAGGTGAA-TCGTACAAGGTTCCGTGTGAACCGC-------------------- Thraustochytriidae_sp._NIOS_6 -------------------------TGCCAGTCGTCATACGCTGG-TCTCAAAGATTAAGCCATGCATGTCTCAGTGTAAGCGAG---TACAC-GGTGAAACTGCGAACGGCTCATTATATCAGTTATAGTTTGGTTGATAGTGAAA--TTA--GCTAGACGGATACATGTGGCAAATCTAGAATCAATACGTG-CTT-GGAGGCCTGACT---TTTG---GGA--AGGGCTGCATTTATTTGAGTATTATAAACCAATGGCGT--TTCG---GCGTGTTTTTGGGTGAATCAGAATAACTGTG-----CGAATCATTGC-----TTTTAATGGTAGTGATGAATCAAG-TAAGTTTCTGCCCCATCA-GTTGTGG-ACGGTAG-TGTATTGGAC-TACCGT-GACGATGACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACA-TAAACTTGGTACTAAGGATGTAGTGA-GTAGAAATAGCAGTGA--GGTGCATGTATGTGTATCT---CTACTGAAATGAGAGCGATTTAAAACCCCCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTAGGGTATGGGGGTG---GATTGGTTTGGGGAT-------------------GAATGTT-CCCAAAATTCTA----TGTCCACCACCCTGCCAT--------------------------------------TCTGAGGTTGTTTTCTTAAAT----------------------AACCTCTCT-TTCACTGTAAAAAAAT--TAGGGTGTT-TCAA-GCAAAGAATGTAAT-----TGGAATAT--GATAGTATGGGATGATAAGATAGGCTCT-AGGTGCT----------------------------------ATTTT-GTTGGTT--TG-TACACTTGGAGAATG-ATTAACAGGGAC-AGTT--GGGGGTATTCGTATTTACATG-T-CAGAGGTGAAATTCTT--GGATTTTGGA-AAGACGAACAACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCGTAAACTATGCCGACTTGCG--ATTGTTCACT--GTTCA------CAAT-------AAGACATGAGCA-GCAGCACA-TGAGA-ATCA-AAGTCTT--GGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGTAGTA--TATATAGTAAT---ATATGTA-----TAGACTTCTTAGAGGGACATTTCAGGTATTTTACTGGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGACTGGTTCATCGAGTTATTGACGC-----------TATTATGGCGTTGTTCCTTTACT--GGAAAGTAT-GGG--TAATCTTTTAAAAACCAGTCG-TGATGGGGCTAGATTCTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAACTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGTTCCGGTGAGATCTTTGGAGAATGTTTAATGATATGGTAA---CATGTTTTAAATATTTAAAG---TTGTTCA-AACCTTAACATTTAGAGGAAGGTGAAGTCGTAACAAGGAAGCCGAATT------------------------ Thraustochytrium_aggregatum ----------------GTTGAT-CCTGCCAGCTGTCATTTGCTCG-TCTAAAAGATTAAGCCATGCATGTCTAAGTATAAA-CTA-ATTATAC-GGTGAAACTGCGAACGGCTCATTATATCAGTTATAGTTTCTTTGATAGTGTATTTCTATATCTATTTGGATAACTGTGGCAATTCTAGAGCTAACACATG-CTTTC-GAGTGGGACTT--TTTG---GTA---CCACTGCATTTATTAGA-TTTTG-AAGCCAACG-------TAA---------AA-TTGGTGATTCATGATAACTTTG-----CGAATCGCAGTAGCGTCTTG-TACGCGGCGATGAATCATT-CAAGTTTCTGCCCCATCA-GCTGTCG-ATGGTACGG-TATTGGCC-TACCAT-GGCTTTCACGGG-TGACGGAGAATTAGGG-TTTGATTCCGGAGAGGA-CGC-TTGAGAGACGGCGACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACC-CAATGGGGACTC-CCCGAGGTAGTGA-CAAGAAATAAAAATGA--GGAGCGC-TTTGC--GTTT-TTCAATTTGAATGAGAGAATCGTACAATCCTCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAACTCCAGCTCCAATAGCAAATA--TTAGAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCCGATAGTCTTTG----------GCCGTGTCTTT------------------GGTCTC---G--TACCGT-------AGATTAATTGTGCCAA-----------GATGAT---------------------CGTCCTCTATGGTTAGTGAT------A---------------GTCATAGTCG-TTTACTGTAAAAAAAAC-TGGAGTGTT-TAAC-GCATTTC--TTTG--GGAAAGGTACAT--ATTAGTATAGGATAATTAGATAGGACCTGTGATTCT-T---------------------------------A--TGGTTGGTTTGTG---AGTCATGGTAATG-ATTAATAGGGAC-AATC--GGGGGTATTCGAATTTAATTG-T-CAGAGGTGAAATTCTT--GGATTTAAGA-AAGTCGAACTACTGCG-AAGGCATTTACCAAGGATGTTTTC-ATTAATAAA-GAACGAAA-GTTAGGGG?????????????????????????---???????-???????????????????????--???????????????--------?------------???CTGGGCA-GCAGCACA-TGAGAAATCAAA-GTTTTT-GGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGC-TGCGGCTTAATTCGACTCAACACGGG-AAAACTTACCAGGTCCAAGACATAGT-AAGGATTGACCAGATTGGAGAGCTCTTTC-TGGAT-CTATGGG-TGGTGG--GCATGGC--GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTACTAA-ATAGTGGTGC-ATATTGTGAG----ATATGTGATTTGATCGCTTCTTAGAGGGACATTTCG-GGTTTA--CCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-CTAGATG-TTCTGGGCCGCACGCGCGCTACAATGACAGATTCAACAAGTCCGGTAGTG-----G-GCTCTG-TGC-CTATTATTACTTTTCC--GAGAGGAAT-GGT--TAATCTTCTAAATGTCTGTCG-TGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTA--CACCGC-CGTCGCAC-TACCGA-TT-GAACGGTCT-ATGAAATTTCGGAT------------------------------------------------------------------------------------------------------------------------------- Thraustochytrium_aureum ------------CCTGGTTGAT-CCTGCCAGTAGTCATACGCTTA-TCTCAAAGATTAAGCCATGCATGTCTAAGTATAAAGG---CTTATAC-TCTGAAACTGCGAACGGCTCATTATATCAGTTATAGTTTCTTTGATAGTGTT--TTTT---CTACATGGATACTTGTGGCAAATCTAGAAACAATACATG-CGT-ACAGGCCTGACT---TTGG--GGGA---GGGCTGCATTTATTTGA-CTT---AAGCCAATACCCC---TCG----GGGTTGTTTTGGTGATTCAGAATAACTGAG-----CGAATCGCATAG----CTTTCGGGC-GGCGATGAATCATTTCAAGTTTCTGCCCCATCA-GCTGTCG-ATGGTAG-GGTATAGGCC-TACCAT-GGCTGTCACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACT-CAATGTTGACTC-GACGAAGTAGTGA-CGAGAATTAACAATGC--GGAGCGC---TCAGCGTTT-TGCAATTGGAATGAGAGCAATGTAAAAGCCTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAACCTCTGGT-AGGGCCGACCTTGGCGCGCGG-T----------------------GAATGCCGCG---TCGTTTAGAAGCGTCGTGCCCG--GCCAT------------------------------------CCTCCCC---CGGTCTTTTGGGC----------------------TGGGGGTCG-TTTACTGTAAAAAAAA--TAGAGTGTT-CCAA-GCAGGGG--GTAATATCC-CGGTATAT--AGTAGTATGGAATAATGAGATAGGACTT-TGGTACT----------------------------------ATTTT-GTTGGTT--TG-CATGCCAAGGTAATG-ATTAAGAGGGAC-AGTT--GGGGGTATTCGTATTTAGATG-T-CAGAGGTGAAATTCTT--GGATTTTCGA-AAGACGAACTACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCGTAAACTATGCCGACTTGCG--ATTGTCCGGC--GTCGC------TTTT-----AGATGACCTGGGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCG-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGTGGCC--GTTATGGCGAC---ATAGCGG-----TGAACTTCTTAGAGGGACATTTCG-GGTATA--CCGGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACGAGTATTTGTTTTTTTCTCATTTTGGGAGGGGGCAGAGTCCTTGGCC--GGAAGGTCT-GGG--TAATCTTTTGAATGCCGATCG-TGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAGACGCAAGTCATCAGCTTGCATCGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGATCCGGTGAGACCTTGGGATTCTGTTGTGGCTGAT-TCAT---TTTGGCTGCGATGGGAGAAC---TTGAGCA-AACCTTATCGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAG-TGAA-CCT-GC------------- Thraustochytrium_kinnei ----------AACCTGGTTGAT-CCTGCCAGTAGTCGTACGCTTG-TTTCAAAGGTTAAGCCATGCATGTCTCAGTGTAAA-CTC-ATTGCAC-AGTGAAACTGCGAACGGCTCATTAAATCGGTTCTAGTCTCCAGAGTGGTGTTTTCAAT---CTAAATGGATACTTGTGGCAAATCTAGAAACAATACATG-CTT-GGAGGCCTGACGGTGTTTTCACTGA--AGGGCTGCATTTATTTGA-TGTTA-GGACCAA--TACCTT-TCGGGGGTG---ATTCGGGTGATTCAGAGTAACTATG-----CGAACCGCAGTGGC--TTTT-AGTC-GGCGGTGACTTTAT--GAGGTTCTGCCCTATCAGGCTTTGC-AACGGG--TA-TTGTCCT-TTGCA--ACCGGTCACGGG-TGACGGAGAATCAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACT-CTATGCCAACGC-GGCGAAGTAGTGA-CGAAAAATAGGACTGG-GT-AGCGC--TTT-GCGTTA-TCTTTGTCCAATGAGAGCAATGTAAAAGCCTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTACA--CTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TCTAATGTATGGG-AGTTGTG-------GGGTGGGTGTTT--------GGTT----GG-TTTTG---CC---GACTAG----ACAA-T-ACTCG-CTCCGC-TTCCCGC-TTGTTTTGC-------------------TCTCT---TTTCT-AG---------------------------AAGGCAAATGTTTCACTGTAAGTAAAA--CAACTCGCT-CAACAGCAAGG---TTA---TC--TTGATATGA-ATTAGTATGGGATGATGAGATAGG-CTC-GGTCCGT----------------------------------ATTTT-GTTGGTT-TTA-GTGGTCTGAGA-ATG-ATGAAGAGGGAC-AATT--GGGGGTATTCGTATTTACATG-T-CAGAGGTGGAATTCTT--GGATTTTGGA-AAGACGAACTAATGCG-AAAGCATCTACCAAAGATGTTTTC-ATTGATCAA-GAACGAAA-GTTTGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAA-ACCATAAACTATGCCGACTTGCG--ATTGTTTTGT--GTCA-------TTTA-------ATGAGCAGAGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGCGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGTGGTG--TCTATG-GCGA--CATAGGTG-----ATTGCTTCTTAGAGGGACATTTCGGT-TTT--ACCGGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGATTTCAACGAGTTGTTTATGTTGCTGTTTTTGGCAA-----TATT-TCCTTGTCC--GTTAGGTCT-GGG--TAATCTTTTGAATGGTCATCG-TGATGGGGCTAGATTTTTGCAATTTTTAATCTCCAACGAGGAATTCCTAGTAAACGCGAGTCATCAGCTCGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGTTCCGGTGAGACCTTTGGATCTGCTGATGTGGGGC-GCAA--GCCTTGTTGTTGGCGGAGAAA---TTGAGCA-AACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAA-CCT-GCAGAAGGATC---- Thraustochytrium_pachydermum -------------------GAT-CCTGCCAGTAGTCATACGCTCA-GGTCAAAGATTAAGCCATGCATGTGTAAGTATAAA-CTA-ATTATAC-GGTAAAACTGCGGACGGCTCATTATATCAGTTAGATTTTCTATGGTAATGTAA-TTAA---TTAGGTGGATAACCGAGGTAATTCTTTGGCTAATACATG-GGT-AAAAGTTCAACTGCTTTACGGCAGA--CGAACTGCACTTATTAGA-TTT---AAACCAAT-CATGGTAACA------TGTTGAATGATGATTCATAATAATTAAG-----CGAATCGCAGTGTC---TTTATGAC-GGCGATA-AACCTT-GAACTTTCTGCCCTATCA-GTTGTCG-ATTGTAG-GGTAGTGGCC-TACAAT-GACTTTAACGGG-TGACGGAGAATTGGGG-TTCGATTCCGGAGAGGA-GGC-CTTAGAGACGGCCACC-ACATCCAAGGA-AGGCAGCAGGCGCGC--AAATTACC-CAATGGTGGAAT-GCCGAGGTAGTGA-CAATTAATATTATCGC--AGAGCCAATTTT--GGTTTTG--TTATGAAATGAGTGCAATTTAAAACTCTCAACGAGGATCAA-TTGAAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTTCAATAGCGTATA--TTAATGTTGTTGCA-GTTACAAAGC-CG-TAG---TTTAATTTCTGTT-AGGATTG-----GCCTGGCC----------------------------TTTGACGTAATGCATT------GTTTTGCTGGGGGCTAT--------TATCTGGACA------------------TCCTGAA--TTTTTTTTTCGAA-----A----------------AAAATTCTCA-TTAACTGTGAAAAAAT--TAGAGTGTT-TAAA-GCATACC--GTAATGGTA--GGAATAT--TTCAGTATGGAATTACAAGATAGGATTT-TGATTTT----------------------------------ATTTT-GTTGGTTTGTG---AATCAAAATAATG-ATTAATAGGGAC-AGTT--GGGGGTATTCGTATTTAATTGCT--AGAGGTGAAATTCTT--GGATTTATGA-AAGACGAACTACTGCG-AAGGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACTATAAACTATGCCGACTTGCG--ATTGTTTAAT-GGTGTT------TTTT--------GGCCATAAACA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCG-CTTAATTTGACTCAACACGGG-AAAACTTACC--GTCCA-GACATGAG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTTTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCTCAGCCTACTAA-ATAGTAATAT-TTTAAGC-AAT---TAAGGTA-----TAGACTTCTTAGAGGGACATTTCG-GGTTTA--CCGGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGGATTCAACAAGTTTTATTTAAAA----TTTATTTTATAAATTTTT-TCCTTGATC--GGAAGGTCT-GGG--TAATCTTTTAAATGTCTATCG-TGATGGGGCTAGA-TTT-GCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAATGGTCCGGTGAAATCTTCGGATTTTGCACATATTGATTTATT-----TCATTTTGAGCAGAAAAA--GTTGAGTA-AACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTCTCCGTAG-TGAA-CCT-GCA------------ Thraustochytrium_striatum ------------------TGAT-CCTGCCAGTAATCATATGCTTG-TCTCAAAGATTAAGCCATGCATGTCTAAGTATAAG-CGA-TTTATAC-TGTGAAACTGCGAACGGCTCATTATATCAGTTATAGTTTCTTTGATAGTG----TTTT---TTAGATGGATACTTGTGGCAAATCTAGAAACAATACATG-CTT-ATAGGCCCGACTT--TTAG---GGA---GGGCTGCATTTATTTGA-TAT---AAACCAATACCT---TTCG----GGGTTGTTTTGGTGATTCAGAATAACTAAG-----CGAACCGCAGTGGC--CTTTGTGCC-GGCGGTGAATCATT-CAAGTTTCTGCCCCATCA-GCTGTCG-ACGGTAG-TGTATTGGAC-TACCGT-GGCCATCACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACT-CAATGTTGACTC-GACGAAGTAGTGA-CGAGAAATACACATGC--GGTGCAC---TCAGTGTAT-TGCAATGTGAATGAGAGCAATGTAAAAGCCTCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCATATA--TTAACGTTGTTGCA-GTTGAAAAGCTCG-TAG---TTGAACTTTTGGTATGGGCGACCTGGCCTTGGGCGCATGC----------------CTTGGTTTT--------GCCGT------GTGTCGGACCTGGCCATCCT-----------------------------------TCACATTTCTATTTTTTGGG-----G------------------TGTGATCA-TTTACTGTGAGTAAAC--TGGAGTGCT-CAAA-ACAAGACGTTTGT-------TTGGTACATCAAAGCATGGAATAATAAGATAGGACCT-GGTTACT----------------------------------A-TTT-GTTGGTT--TG-CATAGCTAGGTAATG-ATTAACAGGGAC-AGTT--GGGGGTATTCGTATTTAATTG-T-CAGAGGTGAAATTCTT--GGATTTATGA--AGACGAACGACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCGTAAACTATGCCGACTTGCG--ATTGTCCGAT--GTTC-------GTAA-------TGGACTTGGGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGTTTAG--TGTATCGCAAGATACTGTTTC------TGGCTTCTTAGAGGGACATTTCG-GGTTTA--CCGGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCC-CACGCGCGCTACACTGATGAATTCAACGAGTTTTTTTG-------TTTCTTTGGAAATAAAATG-TCCTTGATC--GGAAGGTCT-GGG--TAATCTTTTGAATGTTTATCG-TGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGGTCCGGTGAAATCTTGGGATTTGTCGTATGTGGCTTTATT-------GTCTTGTATGACGAAGAACTTGAGTA-AACCTTACCGTTTAGA-------------------------------------------------------- Ulkenia_profunda_29 -------------CTGGTTGAT-CCTGCCAGTAATCATACGCTTG-TCTCAAAGATTAAGCCATGCATGTGTAAGTATAAA-GGATTTAATAC---TGAGACTGCGAACGGCTCAAGACAACAGTTATCGTTTCTTTGATAGTGT---TTTG---TTAGATGGATACTTGTGGCAAATCTAGAAACAATACATG-CTT-GAAGGCCTGACTT--TTAG---GGA---GGGCTGCATTTATTTGA-TTG---AAACCAATACCT---TTCG----GGGTTGTTTGGGTGAGTCAGAATAACTAAG-----CGAATCGCA-------TTTG------GGCGATGAATCATT-CAAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAG-TGTATTGGAC-TACCGT-GACAGTAACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACT-CAATGTCAATTC-GACGAAGTAGTGA-CGAGAAATAACAATGA--GGAGCGC--ATC-GCGTTT-CTCGATTGGAATGAGAGCAATTTAAAAACCTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAACTGTTGAT-GTGAGTGC--GATACTTTCGGGAT---------------------GAATGT--C-----TCGAGATGGCGTGTTGTGCTTGTGTCATAC-------------------------------------TTCATTTG-GTTTTTT-GC-----A----------------TG-AT-ATCG-TTTACTGTAAAAAAAT--TAGAGTGT--CCAA-GCAGGAT--GTATG-TCC--GGAATAT--AGTAGTATGGAATAATAAGATAGGACTT-TGGTACTAT---------------------------------T-TTGGTTGGTT---G-TATACCAAGGTAATG-ATTAATAGGGAC-AGTT--GGGGGTATTCGTATTTAGATG-T-CAGAGGTGAAATTCTT--GGATTT-CGA-AAGACGAACAACTGCG-AAAGCATTTACCAAGGATGTT-TC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCGTAAACTATGCCGACTGGCG--ATTGTCTCTTTATCTT-------ATA---------AGAGGGAGGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-GAAACTTACCAGGTCCG-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGCGTTG--TGAATGGTGACATTCATGATG-------AGCTTCTTAGAGGGACATTTCG-GGTTTA--CCGGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACGAGTTTTTCTTGT------TCTTTTAGGAATGAGAAG-TCCTTGGCC--GGAAGGTCT-GGG--TAATCTTTTGAACGCCGATCG-TGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGATCCGGTGAGACCTTGGGATTCTATGTTGATTGATTTATT---TTGATTGATG--------------------------------------------------------------------------------------------- Ulkenia_profunda_KMPB_N_3077 ----------AACCTGGTTGAT-CCTGCCAGTAATCGCACGCTGG-TCTCAAAGACTAAGCCATGCATGTCTAAGTTTAAG-CA--ATTAAAC-GGTGAAACTGCGAACGGCTCATTAAATCAGTTATAGTTCCTTTGAAAATGTTT-TCAT---TTAGGTGGATACTTGTGGCAAATCTAGAACTAATACATG-CAT-AACGGCCCGACT---TTTG---GGA--AGGGCTGCATTTATTAGC-ATT---AAACCAAT-ACCTC-TTCG-GGGGT--TGTTTTGGTGATTCATAATAACTAAG-----CGAATCGCAGATGC--TTCG--GCA-GGCGATG-TTCATT-CAAGTTTCTGCCCCATCA-ATTGTCG-ATGGTAG-GGTATTGGCC-TACCAT-GATTGTTACGGG-TGACGGAGAATCAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGC--AAATTACT-CAATGTCAATTC-GACGAAGTAGTGA-CGAGAAATAACAGTGG-GG-TGGGC--TTC-GCCTAC-TCTTTCTGTAATGAGAGCAATCTAAAAACCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAACTCCAGCTCCGGTAGCGTGTA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAAGTATTGGT-AGGGCTG-----A-----CCTGAT--------CTGGCG-------GTGAAT---G----CCGCTA----GT-------------------------TTTTCAGTG---------TCG-T--GCC-TGGCCATCCTTTCCGTTTTCTTTTTAAGG-------------AATGGGATCA-TTTACTGTAAAAAAAT--TAGAGTGTT-TCAA-GCAAGTT--GTATTAACT--GGAATAT--AGTAGTATGGAATAATAAGATAGGACTT-TGATACT----------------------------------ATTTT-GTTGGTT--TG-TATATCAAGGTAATG-ATTAACAGGGAC-AGTT--GGGGGTATTCGTATTTGGTTG-T-CAGAGGTGAAATTCTT--GGATTTACAA-AAGACGAACAACTGCG-AA-GCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCGTAAACGATGCCGACTTGCG--ATTGTCCGAT--GTTTG------TTAT-------AAGACTTGGGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGC-TCAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGTACGC--GTTATG-GTAA-CATAGCAGT-----GAGACTTCTTAGAGGGACATTTCG-GGTTTA-CCGG-AAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATGGATTCAACGAGTATTGTTCTATGCTTTTCGGAGTGTGGGATG----TCCTGGGCA--GGAATGTCT-GGG--TAATCTTTTAAATGTCCATCG-TGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGATCCGGTGAAATCTTCGGATTCTGTCATGTTGC---CTTTTATTAGTGGTATGACGGGAAAAG---TTGAGTA-AACCTTATCGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAA-CCT-GCAGAAGGATC---- Ulkenia_radiata --------------TGGTTGAT-CCTGCCAGTAATCATACGCTTG-TCTCAAAGATTAAGCCATGCATGTGTAAGTATAAA-GGATTTAATAC---TGAGACTGCGAACGGCTCAAGACAACAGTTATCGTTTCTTTGATAGTGT---TTTG---TTAGATGGATACTTGTGGCAAATCTAGAAACAATACATG-CTT-GAAGGCCTGACT---TTTG--GGGA---GGGCTGCATTTATTTGA-TTG---AAACCAATACCT---TTCG----GGGTTGTTTGGGTGAGTCAGAATAACTAAG-----CGAATCGCA-------TTTG------GGCGATGAATCATT-CAAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAG-TGTATTGGAC-TACCGT-GACAGTAACGGG-TGACGGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGT--AAATTACT-CAATGTCAATTC-GACGAAGTAGTGA-CGAGAAATAACAATGA--GGAGCGC--ATC--GGTTTTCTCGATTGGAATGAGAGCAATTTAAAAACCTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAACTGTTGAT-GTGAGTGC--GATACTTTCGGGAT---------------------GAATGT--C------CGAGATGGCGTGTTGTGCTTGTGTCATTTTCAT---TTGCGTTT---------------------T----------------------------------------------GATCA-TTTACTGTAAAAAAAT--TAGAGTGT--CCAA-GCAGGAT--GTATG-TCC--GGAATAT--AGTAGTATGGAATAATAAGATAGGACTT-TGGTACT-----------------------------------ATTT-GTTGGTT--TG-TATACCAAGGTAATG-ATTAATAGG-AC-AGTT---GGGGTAT-CGTATTAGAGT----CAGAGTG--------------------A-AAGACGAACAACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCGTAAACTATGCCGACTTGCG--ATTGTCTCTTTATCTT-------AT----------AGAGGGAGGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-GAAACTTACCAGGTCCG-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGCGTTG--TGAATGGTGACATTCATGATG-------AGCTTCTTAGAGGGACATTTCG-GGTTTA--CCGGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACGAGTTATTCTTGT------TCTTTTAGGAATGAGAAG-TCCTTGGCC--GGAAGGTCT-GGG--TAATCTTTTGAACGCCGATCG-TGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATC-GCTTGCATTGATTAC-GTCCCTGCCCTTTGTA-ACACCGCCCGTCGCACCTACCGA-TT-GAACGATCCGGTGAGACCTTGGGATTCTATGTTGATTGATTTATT---TTGATTGATGT-------------------------------------------------------------------------------------------- Ulkenia_visurgensis ------------CCTGGTTGAT-CCTGCCAGTAATCGCACGCTTG-TCTCAAAGACTAAGCCATGCATGTCTAAGTATAAG-CGA-TTTATAC-GGTGAAACTGCGAACGGCTCATTAAAACAGTTATAGTTTCTTTGAAAATGT---TTGA---TTAGATGGATACTTGTGGCAAATCTAGAAATAATACATG-CTT-TAGGGCCCGACT---TTTG---GGA--AGGGCTGCATTTATTAGA-TAT---AAACCAATACCTC---TCG----GGGTTGTTTTGGTGAT-CATAGTAACTAGG-----CGAATCGCAGAGGT--GTTTGTGCC-GGCGATG-TTCATT-CAAGTTTCTGCCCCATCA-ATTGTCG-ATGGTAG-GGTATTGGCC-TACCAT-GATTGTTACGGG-TGACGGAGAATCAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ACATCCAAGGA-AGGCAGCAGGCGCGC--AAATTACT-CAATGTCAATTC-GACGAAGTAGTGA-CGAGAAATAACAGTGGGGTGGGCTA--AGCCTACTCT----TTCTGTAATGAGAGCAATCTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAACTCCAGCTCCGGTAGCGTGTA--TTAAAGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAAGTATTGGT-AGGACGGACCAGGCTTTTCGGC-----------------------GAATGCTGAGGTATGCTTT-----TGTGTTTGATCTGGCCAT-------GGTTGCTCGT---------------------TTGCGCCTTTGGGCGTGGGT------------------------GGGCATCA-TTTACTGTAAAAAAAT--TAGAGTGTT-TCAA-GCAAATC--GTAT---GGTTGGAATAG--AGTAGTATGGAATAATAAGATAGGACTT-TGTTGCT----------------------------------ATTTT-GTTGGTT--TG-CACATCAAAGTAATG-ATTAACAGGGAC-AGTT--GGGGGTATTCGTATTTGGTTG-T-CAGAGGTGAAATTCTT--GGATTTACAA-AAGACGAACAACTGCG-AAAGCATTTACCAAGGATGTTTTC-ATTAATCAA-GAACGAAA-GTTAGGGGATCGAAGATGATTAGATACCATCGT---AGTCTTA-ACCGTAAACGATGCCGA-TTGCG--ATTGTCCGAT--GTT--------TTTTTATTGAATAGACTTGGGCA-GCAGCACA-TGAGAAATCA-AAGTCTTTGGGTTCCGGGGGGAG-TATGGTCGC-AAGGCTGAAACTTAAA-GGAATTGACGGAAGGGCA--CCACCA-GGAG--TGGAGCCTGCGGCTTAATTTGACTCAACACGGG-AAAACTTACCAGGTCCA-GACATAGG-AAGGATTGAC-AGATTG-AGAGCTCTTTC-TTGATTCTATGGG-TGGTGG-TGCATGGCC-GTTCTTAGTTGG-TGGAGTGATTTGTCTGG-TTAATTCC-GTTAACGAACGAGACCACAGCCTACTAA-ATAGTACGT--GCTATGG-TGA--CATAGTGG----CGAGACTTCTTAGAGGGACATTTCG--GTTTT-ACCGGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCC-TTAGATG-TTCTGGGCC-CACGCGCGCTACACTGATGGATTCAACGAGTATGTGTTGT---TTGTTTAACGATGAATGACGG-TCCTAGACA--GGAATG-CC-GGG--CAATCTTTTAAATGTCCATCG-TGATGGGGCTAGATTTTTGCAATTCTTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGATCCGGTGAAATCTTCGGATCCTGTTGTTTTGCGTTTGTT----CGTGTGATGACGGGAAAAG---TTGAGTA-AACCTTATCGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAG-TGAA-CCT-GCAG----------- Uncultured_thraustochytrid ----------------GTTGAT-CCTGCCAGTAGCCATATGCTCGGTCTCAAAGATTAAGGCATGCATGTGTAAGTATAACGCGA--TTGTTC-TGTGAGACTGCGAACGGCTCATTATATCAGTAATAATTTCTTCGGTAGTTT---CTTT----TATATGGATACCTGCAGTAATTCTGGAAATAATACATGCTGT-AAGAGCCCGACT----TTG---------GGGCTGCACTTATTAGA-TTG---AAGCCGAT-------------------TTTATTGGTGAATCATGATAATTGAG-----CAGATTGACTT-----TTTT------GTCGATGAATCGTT-TGAGTTTCTGCCCCATCA-GTTGTCG-ACGGTAG-TGTATTGGAC-TACGGT-GACTATAACGGG-TGACGGAGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACC-ATATCCAAGGA-TAGCAGCAGGCGCGT--AAATTACC-CACTGTGGACTC-CACGAGGTAGTGA-CGAGAAATATCGATGC--GAAGTGGTATGC---GTTT-TGCTATCGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCACAGGCCGCGGTAATCCCAGCTCCAGAAGCATATGCGTAAACGTTGTTGCA-GTTAAAAAGCTCG-TAG---TTGAATTTCTGGCATGGGCGA------CCGGTGCTTTCCC-------------------TGTAATGGGGATTGATTGTC----TGTGTTGCCTT-AGCCAT-----------------------------------CTTTCTCATGTCATTTTGGTTAGA------------------------GAAATCT-TCCACTGTAATCAAAG--CATAGTGTC-CCAA-GCAGGTCGTATGAC-----CGGTATGT---TAATTATGGGATGATAAGATAGGACTG--GGTCTCTA----------------------------------TTTGGTGGGTT---GGCACGCCTGAGTAATG-GTTAATAGGAAC-AGTT--GGGGGTATCCGTATTTAGGAGCT--AAAGGTGAAATTCTT--GGATTCCCGA-AAGACGAACTACAGCG-AAGGCATTTACCAAGCATGTTTTC-ATTAATCAA-GAACGAAA-GTCTGGGGATCGAAGATGATTAGATACCATCGT---AGTCTAG-ACCGTAAACGATGCCGACTTGCG--ATTGTTGGGTGCTTTTTATAGGGCCCC-----------CGCCCCCCAGCAGCACA-TGAAAAACCAAAGTCTTTTGGGTTCCCGGGGGGAGTATGGCCCCAAGGGCAGAAACTTAAA-GGATTCAACGGAAGGGCCACCCACCAGAGACGTTGGAGCCCGCGGCTTAATTTAACTCAACACGGGAAAAACTCACCAGGCCCAGATCATAGG-TAGGATAGAA-AGATTGAGACGCCCTCTCATAGATTCTATGGG-TGGGGG-CGCATGCCC-GCTCTTAGTGGG-GGGAGAGATTTGTCTGGGTTAATTCC-GTTAACGAACGAGACCTCGGCCTACTAA-ATATTGCCGGGCGTATGGCAAC---ATATGTACGTTTGTAACTTCTTAAAGGGACATGTCC-GGTTTA-CCGAGAAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCC-TTAAATG-TTCTGGGCCGCACGCGCGCTACACTGATGGGTTCATCGGGTCTTTAGTTG------TAATTTTTGGAAATTGCGTCGCTTGGTC--GGAAGGCCT-GGC--TAATCCTTTGAACGCCCATCG-TGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATAC-GTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGA-TT-GAACGGTCCGATGAAACCCATGGGATGTTT?TGTTTGGATTCATTTTTGG----------------------------------------------------------------------------------------------------- ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 18S_rDNA) = N: 1-2135; CODONPOSSET CodonPositions (CHARACTERS = 18S_rDNA) = N: 1-2135; END; BEGIN TREES; TITLE Tb8480; LINK TAXA = Taxa1; TRANSLATE 1 Ulkenia_profunda_KMPB_N_3077, 2 Ulkenia_profunda_29, 3 Thraustochytrium_striatum, 4 Thraustochytrium_pachydermum, 5 Thraustochytrium_kinnei, 6 Thraustochytrium_aureum, 7 Thraustochytrium_aggregatum, 8 Thraustochytriidae_sp._NIOS_6, 9 Thraustochytriidae_sp._H1_14, 10 Thraustochytriidae_sp._Fng1, 11 Thraustochytriidae_sp._C9G, 12 Thraustochytriidae_sp._BS2, 13 Thraustochytriidae_sp._BS1, 14 Schizochytrium_sp._SEK346, 15 Schizochytrium_sp._SEK345, 16 Schizochytrium_sp._SEK210, 17 Schizochytrium_sp._N4_103, 18 Schizochytrium_sp._KK17_3, 19 Schizochytrium_aggregatum, 20 Quahog_parasite_X, 21 Ochromonas_danica, 22 Oblongichytrium_sp._SEK347, 23 Oblongichytrium_sp._8_7, 24 Oblongichytrium_sp._7_5, 25 Oblongichytrium_multirudimentale, 26 Oblongichytrium_minutum, 27 Labyrinthula_sp._L72, 28 Labyrinthula_sp._L59, 29 Labyrinthula_sp._f_Sap_16_1, 30 Labyrinthula_sp._AN_1565, 31 Japonochytrium_sp._ATCC_28207, 32 Bacillaria_paxillifer, 33 Aurantiochytrium_sp._SEK218, 34 Aurantiochytrium_sp._SEK217, 35 Aurantiochytrium_sp._SEK209, 36 Aurantiochytrium_sp._NIOS_4, 37 Aurantiochytrium_sp._N1_27, 38 Aurantiochytrium_sp._KH105, 39 Aurantiochytrium_sp._FJN_10, 40 Aurantiochytrium_sp._BURABQ_133, 41 Aurantiochytrium_mangrovei, 42 Aurantiochytrium_limacinum, 43 Aplanochytrium_stocchinoi, 44 Aplanochytrium_sp._SC1_1, 45 Aplanochytrium_sp._PR15, 46 Aplanochytrium_sp._PR1_1, 47 Aplanochytrium_minutum, 48 Aplanochytrium_kerguelense, 49 Uncultured_thraustochytrid, 50 Ulkenia_visurgensis, 51 Ulkenia_radiata; TREE Fig._2 = [&R] (((((48,(((47,44),46,45),43)),((30,(28,27)),29)),(((((((31,50),1),(((19,(((14,16),15),18)),17),8)),((6,(5,((2,51),9))),3)),(((42,40),(41,49)),(((33,34),(36,38)),((35,37),39)))),(10,(12,13))),(7,((4,11),20)))),((26,25),(22,(24,23)))),32,21); END;