#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 11, 2021; 22:29 GMT TreeBASE (cc) 1994-2008 Study reference: Bell C. 2007. Phylogenetic Placement and Biogeography of the North American Species of Valerianella (Valerianaceae: Dipsacales) based on chloroplast and nuclear DNA. Molecular Phylogenetics and Evolution, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1852] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=107; TAXLABELS Centranthus_calcitrapae Centranthus_calcitrapae_Crete Centranthus_lecoqii Centranthus_macrosiph Centranthus_ruber Centranthus_sieberii Fedia_cornucopiea Nardostachys_jatamansii Patrinia_gibbosa Patrinia_scabiosa Patrinia_triloba Patrinia_villosa Plectritis_brachystema Plectritis_congesta Plectritis_macrocera Triplostegia_glandulifera Valeriana_acutiloba Valeriana_adscenden Valeriana_albonervata Valeriana_apiifolia Valeriana_arborea Valeriana_aretoides Valeriana_arizonica Valeriana_asarifolia Valeriana_barbareifolia Valeriana_bracteata Valeriana_bryophilla Valeriana_bulbosa Valeriana_californica Valeriana_candolleana Valeriana_celtica Valeriana_ceratophyla Valeriana_chaerophylla Valeriana_clematis Valeriana_coartata Valeriana_connata Valeriana_densiflora Valeriana_dioica Valeriana_edulis Valeriana_fauriei Valeriana_flaccidis Valeriana_gallinae Valeriana_henrici Valeriana_hirtella Valeriana_interupta Valeriana_kawakamii Valeriana_laurifolia Valeriana_mexicana Valeriana_microphylla Valeriana_minutiflora Valeriana_montana Valeriana_naidae Valeriana_niphobia Valeriana_nivalis Valeriana_occidentalis Valeriana_officaina Valeriana_palmeri Valeriana_pauciflora Valeriana_pilosa Valeriana_pinnatifida Valeriana_plantagina Valeriana_polemonifolia Valeriana_prionophy Valeriana_procera Valeriana_pyramidalis Valeriana_pyrenaica Valeriana_rigida Valeriana_robertiana Valeriana_rumicoidea Valeriana_rzedowski Valeriana_scandens Valeriana_scouleri Valeriana_secunda Valeriana_selerorum Valeriana_sitchensi Valeriana_sorbifolii Valeriana_stenophylla Valeriana_stenoptera Valeriana_supina Valeriana_tanacaetifolia Valeriana_texana Valeriana_tomentosa Valeriana_trichosto Valeriana_triphylla Valeriana_tripteris Valeriana_tuberosa Valeriana_urticifolia Valeriana_urticifolia2 Valeriana_urticifolia3 Valeriana_wallrothi Valerianella_amarella Valerianella_carinata Valerianella_cornata Valerianella_dentata Valerianella_discoidea Valerianella_eriocarpa Valerianella_florifera Valerianella_locosta Valerianella_locusta2 Valerianella_microcarpa Valerianella_muricata Valerianella_pumela Valerianella_radiata Valerianella_steriocarpa Valerianella_texana Valerianella_umbilicata Valerianella_vesicaria ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2003] TITLE Combined; LINK TAXA = Taxa1; DIMENSIONS NCHAR=3528; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Centranthus_calcitrapae TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACGCGTTCAAAA-CCGCGGGGTCCCGG------CCCCCGTGC---CGC--GGC---CTCGAA-GGGCGCGGG-ACTGCAAAGACCC--GCGT----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATTACGA-CGGAAGGGGAGCGCGCACGTCCGTCCGGCCCGTTCGCGGCGCCCGACG---GCCGAGCGCCGACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCGCCCC-TCCGGGGTGCGTCGCGC-GGA-CGGGGGCGC-GGAAGATGGCCTCCCGCGATCGC-TTC------GATCCCGGCTGGCCCA-AAACAA--TGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--CTTCGCGCCGTTTCTATC-CCCG-CCTC-CGGGCGG-CGAAC-CGACCCT--CGCGCGAC-GTCC-T-----------------------CGAGACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA-CGTAGTTTAATTATTGATTA------TTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA--GGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTA-ATTTAATTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTACACGAGTGAATTCTCTATTTTTT-TATGAATCCTAA-TTATTTTTTG-CCATTTTTTATAAAAA------TGG----A-TAG-TA-----TATTA---TCCATTTTGAAATGGAAATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTAGAAC-GAA--GATAAACCA------TAAAAAAAA------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGTACTATGCATCATTT-GATAACC-CCCCAAATTCTCT-ACTCTTCA-AATTTTAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAATATATTTATGCACTTGC-TCATGATCAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTA-CTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCAAAAACA----------AACAAAGG-CTAAAATCACAAAAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTA-AAAC---AGGGATAT------------------ACGCATTAAAATACTATAGATT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAACC-ATAT-------GG----------ACTCCTCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAG---------TTATCTTTCTCATTCACCCTACTCTTTATCTTTTACAAA-GAGATCCGAGTGAAA-AT--GTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGCGCATCTTTACGTAAGCGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--TAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAG------------------------------------------------------TCCGCCCCCA-GCGAGGA-CTATTATTTAG-ATTAGTCAATCTATTTTTGACTGTTTTTTC------------------------?GAACATATGTCA-GTGAA--------ATACTATGCATTTT--------CATTATAATGAAAGAAAAAATA-----A-TGAA-A-GAAAAAAAAA--AAA-A-A-AAGA-GAGAAATAAAGCCC-CCTTGCTAG?CCA-A-----------------------------GG--GGGATTT------------TGT?TTTT-------TTTTT---TTCAAAAA-----CTCATATAC--------------ACTAAGAACAGGTC-TTATCC-ATT-GTAGCTGGAG-CTTTCAA-------------------------------------------------- Centranthus_calcitrapae_Crete TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACGCGTTCAAAA-CCGCGGGGTCCCGG------CCCCCGTGC---CGC--GGC---CTCGAA-GGGCGCGGG-ACTGCAAAGACCC--GCGT----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATTACGA-CGGAAGGGGAGCGCGCACGTCCGTCCGGCCCGTTCGCGGCGCCCGACG---GCCGAGCGCCGACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC-CCGCCCCT-CCGGGG-TGCGTCGCGC-GGA-CGGGGGCGC-GGAAGATGGCCTCCCGCGATCGC-TTC------GATCCCGGCTGGCCCA-AAACAA--TGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--CTTCGCGCCGTTTCTATC-CCCG-CCTC-CGGGTGG-CGAAC-CGACCCT--CGCGCGAC-GTCC-T-----------------------CGAGACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA-CGTAGTTTAATTATTGATTA------TTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA--GGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTA-ATTTAATTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTACACGAGTGAATTCTCTATTTTTT-TATGAATCCTAA-TTATTTTTTG-CCATTTTTTATAAAAA------TGG----A-TAG-TA-----TATTA---TCCATTTTGAAATGGAAATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTAGAAC-GAA--GATAAACCA------TAAAAAAAA------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGTACTATGCATCATTT-GATAACC-CCCCAAATTCTCT-ACTCTTCA-AATTTTAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAATATATTTATGCACTTGC-TCATGATCAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATGAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTAACTGTGTT-----GGTAAAAAAAATCCTTCTTCAGAAA{AC}{GT}AA-----------------------------------------------------------------------------------------------------------------------------------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAACC-ATAT-------GG----------ACTCCTCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAG---------TTATCTTTCTCATTCACCCTACTCTTTATCTTTTACAAA-GAGATCCGAGTGAAA-AT--GTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGCGCATCTTTACGTAAGCGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--TAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAG------------------------------------------------------TCCGCCCCCA-GCGAGGA-CTATTATTTAG-ATTAGTCAATCTATTTTTGACTGTTTTTTC------------------------?GAACATATGTCA-GTGAA--------ATACTATGCATTTT--------CATTATAATGAAAGAAAAAATA-----A-TGAA-A-GAAAAAAAAA--AAA-A-A-AAGA-GAGAAATAAAGCCC-CCTTGCTAG?CCA-A-----------------------------GG--GGGATTT------------TGT?TTTT-------TTTTT---TTCAAAAA-----CTCATATAC--------------ACTAAGAACAGGTC-TTATCC-ATT-GTAGCTGGAG-CTTTCAA-------------------------------------------------- Centranthus_lecoqii TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGGGTCCCGG------CCCTCGTGC---CGC--GGC---TCCGAA-GGACGCAGG-ACTGCAAAGACCT--GCGG----------CCGCA---AACACAACCCCGACGCAAACCGCGTCAAGGAACATTACAA-CGGAAGGGG--CGCGCTCGTCTGTTCGGCCCGTTCGCGGCGCCCGACA---GCCGAGTGTCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCG-CCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-TGTGTTGCGC-GGA-AGGGGGAGC-GGAAGATGGCCTCCCGCGATCCC-GTT------GATCTCGGCTGGCCCA-AAACAC--TGTCCCCCGGAGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--TTTCGCGCCGTTTCTCTC-CCCGTCTTC--GGGTGG-CGAAT-CGACCCT--CACGCGCC-GTCC-T-----------------------TGAGACGG--TGCTCCGAATGAAGTGATG?????GTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTTTCCGAATCAGTATTCAAA--------CTTG-GTTTATTA------TTGAAACGGAGT------?AAGTGAATTC?TTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA--GGAAAGAAAAAGCAA-CGAGC-TTCTGT--T?TTA-A-----TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTT?C?CGAGTGAATT?T?TATTTTTT-TATGAATCCTAA-TTATTTTTTG-CC?TTTTTTATAAAAA------?GG----A-TAG-TA-----TATTA---TCCATTTTGGAATGGAAATGTGTGT?TAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAG?G?GGTTAGGTTGAAAAAA?AAAGGGTTTCTAACCATCTTGTTTTGTT?T-?TTAGAAC-GAA--GATAAACCA------TAAAAAAAAA-----CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGTACTATGCATCATTT-GATAACC-CCCCAAATTCTCT-ACTCTTCA-AATTTGAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAATATATTTATGCAC?TGC-TCATGATCA?---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAAACCTA-CTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCACAAAAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGTAGAAACCTA-AAAC---AGGGATAT------------------ACGCATTAAAATACTATAGATT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAACC-ATAT-------GG----------ACTCCTCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAG---------TTATCTTTCTCATTCACCCTACTCTTT-------ACAAA-GAGATCCGAGTGAAA-AT--GTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAGCATCTTTACGTAAGCGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--TAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGAGAATGGTCGGGATAGCTC---------------------------------------------------TCCGCCCCCA-GCGAGGA-CTATTATTTAG-ATTAATCAATCTATTTCTGACTGTTTTTTC-----------------------?AGAACATATGTCA-GTGAA--------ATACTATGCATTTT--------CATTATAATGAAAGAAAAAATA-----A-TGAA-A-AAAAAAAAA---AAAAAAAAAAGA-GAGAAATAAAGCCC-CCTTGCTAGACCA-A-----------------------------GG--GGATTTTTGTCCTTTT--TTGTT---------------T---TTCAAAAA-----CTCATATAC--------------ACTAAGAACAGGTC-TTATCC-ATTTGTAGCTGGAG-C??CAAGAGCAGC?AAAT?T?G----------------------------------- Centranthus_macrosiph TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGGGTCCCGG------CCCTCGTGC---CGC--GGC---CTCGAA-GGGCGCGGG-ACTGCAAAGACCG--GTGT----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATTACGA-CGGAAGGGG--CGCGCTCGTCCGTTCGGCCCGTTCGCGGCCCCCGACG---GCCGAGCGTCGACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTGG?CTCTTGCATC???GAAAAACGT?GCAAA?TGCGGAACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGAGTCGACCCCCT-T-CAC-GCCTC--CCCCTTA-TCGGGG-TGTGTTGCGC-GGA-AGGGGGTGCTGAA-GATGGCCTCCCTC?ATCCC-GTT------GATCTCGGCTGGCCCA-AA-CAC--TGTCCCCC??AGGC?GACGTCACGGA?AGTGG?GGTCG--AAT---AAGCCCT?T--TTTCCCGCCG-GTTT?TA-TCCCGT?TT-C?GGTGG-?G?AT-CGACCCT--CACGCCCC-GT?C-T-----------------------TGAGACGG--TGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA--------CGTA-GTTTATTA-GATTATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA--GGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTA-A-----TTA-GAATGATT-CCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTACACGAGTGAATTCTCTATTTTTT-TATGAATCCTAA-TTATTTTTTG-CCATTTTTTATAAAAA------TGG----A-TAG-TA-----TATTA---TCCATTTTGAAATGGAAATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTAGGTTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTAGAAC-GAA--GATAAACCA------TAAAAAAAAA-----CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGTACTATGCATCATTT-GATAACC-CCCCAAATTCTCT-ACTCTTCA-AATTTT--TTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAATATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAGTAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATTCATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTTAAATCGCAGAATTTA---TTAGTATGAAACCTA-?TAAGTAAGACCTT?CAA-TTCAGAGAACCC?TGAAATTAATAAAAATGGGCAATCCTGAGC?AA?TCCGGTTTTTGTTTCC?AAAACCA----------ACCAAAGG-TTAAATTCACAAAAAA-GGATAGGTGCAGAGACTCAACG?AAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ACGCATTAAAATACTATAGATT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTA-G-AAATCGTG-AGGG-TCCAAGTCCCTCTA-TCCCCAAAAA-CCC-ATAT-------GG----------ACTCCTCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAG---------TTATCTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT--GTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-CGTG-ACAAATGCGCATCTTTACGTAAGCGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--TAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC-------------------------------------TCA-CTTGGCTACATTCGCCCCCG-CGAGGGA-CTATTATTTAG-AATAGTCA-ATCTATTTTTGACTGGTTTTT----------------------CAAGAACATATGTCA-GGGAA--------ATACTATGCATTTT--------CATTATAATGAAAGAAAAAATAATGAAAGAA-AAAAAAA---------AAAA-AGAGAAA--------TAAAGCCCCCCTGCTAGACCC---A--------------GG--GGGATTTTTTGT-------CTTTTTT----------TTT-T---------------TCAAAAAC----TC-ATATAC--------------ACTAAGAACAGGTC-TTATCC-ATTTGTAGC-GGAG-CT-CA?GAGCAG-TATATCACA----------------------------------- Centranthus_ruber TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGGGTCCCGG------CCCTCGTGC---CGC--GGC---TCCGAA-GGACGCAGG-ACTGCAAAGACCT--GCGG----------CCGCA---AACACAACCCCGACGCAAACCGCGTCAAGGAACATTACAA-CGGAAGGGG--CGCGCTCGTCTGGTCGGCCCGTTCGCGGCGCCCGACA---GCCGAGTGTCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--TCCAC-GCCTC--CCCCTCA-TCGGGG-TGTGTTGCGC-GGA-AGGGGGTGC-GGAAGATGGCCTCCCGCGATCCC-GTT------GATCTCGGCTGGCCCA-AA-CAC--TGTCCCCCGGAGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--TTTCGCGCCGTTTCTCTC-CCCGTCTTC--GGGTGG-CGAAT-CGACCCT--CACGCGCC-GTCC-T-----------------------TGAGACGG--TGCTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTTTCCGGATCAGTATTCAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CT-CCATTAATT-ATA--GGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTA-A-----TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT-TATGAATCCTAA-TTATTTTTTG-CCATTTTTTATAAAAA------TGG----A-TAGGTA-----TATTA---T?CATTTTGGAATGGAAAAGGGTCTTAAAAAGAAACCAG?ATATT-GATCAAAACA-TTTCCCAAATC-----AAAAGCCGGGTA?GGGTGGAAAAATAAAAGGTTTCTAACCATCTTGGTTTTGTAT-CTTAGAAC-GAA--GATAAACCA-------CCAA-AAA------CAGA-GAA---TT-AGAG-TCT-GT?G-ATAA--CTCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------TTT-AGA-------AAGACA---AAT-AATATTTTGTTTTGACTGT-CCGCACTATCCATCATTT-GATACCC-CCTCAAATCCTCT-ACTCTTCG-TAT--AAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAATATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAGTAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATTCATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTTAAATCGCAGAATTTA---TTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACACTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCACAAAAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ACGCATTAAAATACTATAGATT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGGT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AA?TCGT?-AGGG-TTCGAGTCCCTCTA-TCCCCAAAAA-CCC-ATA?-------GG----------AC?CCCC?ATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAG---------TTATCTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT--GTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAGCATCTTTACGTAAGCGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--TAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGAGAATGGTCGGGATAGCTC-------CAGGGATTC?CAAA?CCACTGCC--TTGATCCA-CTTGGCTACATCCGCCCCCG-GCTAGGA-CTATTATTTAG-ATTAATCA-ATCTATCTATGACTGTTCTTG----------------------AAAGAACATATGTCA-GTCAA--------ATACTATGAAAAAT--------ACTATTAATTCAATTAAAAATT------AAA-TAAATAA---------AAAA-GGAGCAA--------TAAGGCCCTCTTGATAGACCA---A--------------GA--GGGAATTTTT---GCTCCCTTTTTTTA------GTTTT----------TTTT---TTCAAAAA-----CTCATATAC--------------ACTAAGAACGGGTC-TTATCC-ATTTGTAGA-GGAG-CTTCAAGAGCAGCTAGGTCTAGAGGGAAGATT------------------------- Centranthus_sieberii TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGGGTCCCGG------CCCTCGGCC---GCG---GC---TCCGAA-GGACGCAGG-ACTGCAAAGACCT--GCGG----------CCGCA---AACACAACCCCGACGCAAACCGCGTCAAGGAACATTACAA-CGGAAGGGG--CGCGCTCGTCTGTTCGGCCCGTTCGCGGCGCCCGACA---GCCGAGTGTCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCT--CCAC-GCCTC--CCCCTCA-TCGGGG-TGTGTTGCGC-GGA-AGGGGGTGC-GGAAGATGGCCTCCCGCGATCCC-GTT------GATCTCGGCTGGCCCA-AAACAC--TGTCCCCCGGAGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--TTTCGCGCCGTTTCTCTC-CCCGTCTTC--GGGTGG-CGAAT-CGACCCT--CACGCGCC-GTCC-T-----------------------TGAGACGG--TGCTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTTTCCGGATCAGTATTCAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CT-CCATTAATT-ATA--GGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTA-A-----TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT-TATGAATCCTAA-TTATTTTTTG-CCATTTTTTATAAAAA------TGG----A-TAGGTA-----TATTA---T?CATTTTGGAATGGAAAAGGGTCTTAAAAAGAAACCAG?ATATT-GATCAAAACA-TTTCCCAAATC-----AAAAGCCGGGTA?GGGTGGAAAAATAAAAGGTTTCTAACCATCTTGGTTTTGTAT-CTTAGAAC-GAA--GATAAACCA-------CCAA-AAA------CAGA-GAA---TT-AGAG-TCT-GT?G-ATAA--CTCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------TTT-AGA-------AAGACA---AAT-AATATTTTGTTTTGACTGT-CCGCACTATCCATCATTT-GATACCC-CCTCAAATCCTCT-ACTCTTCG-TAT--AAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAATATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAGTAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATTCATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTTAAATCGCAGAATTTA---TTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACACTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCACAAAAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ACGCATTAAAATACTATAGATT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGGT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AA?TCGT?-AGGG-TTCGAGTCCCTCTA-TCCCCAAAAA-CCC-ATA?-------GG----------AC?CCCC?ATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAG---------TTATCTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT--GTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAGCATCTTTACGTAAGCGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--TAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGAGAATGGTCGGGATAGCTC-------CAGGGATTC?CAAA?CCACTGCC--TTGATCCA-CTTGGCTACATCCGCCCCCG-GCTAGGA-CTATTATTTAG-ATTAATCA-ATCTATCTATGACTGTTCTTG----------------------AAAGAACATATGTCA-GTCAA--------ATACTATGAAAAAT--------ACTATTAATTCAATTAAAAATT------AAA-TAAATAA---------AAAA-GGAGCAA--------TAAGGCCCTCTTGATAGACCA---A--------------GA--GGGAATTTTT---GCTCCCTTTTTTTA------GTTTT----------TTTT---TTCAAAAA-----CTCATATAC--------------ACTAAGAACGGGTC-TTATCC-ATTTGTAGA-GGAG-CTTCAAGAGCAGCTAGGTCTAGAGGGAAGATT------------------------- Fedia_cornucopiea TCGATTCCTGCAATCGCAGAA-CGACCC-GCGAACACGTTTTAAAACCGCGGAGCGCCGG------CCTTCGGGC---CG---CGT---CCCGAA-GGACGCGGG-GTTTATTAAACTCCCGCGG----------CCGCCTTTAACCCAACCCCGGCGCAAACCGCGTCAAGGAACATGAAAAACGGAAGGGG--CGCGCCTGCCCGCACGGCCCGTTCGCGGCGCCGGTCG---GGCGAACGCCGTCCCCTCCGAAAGAAAAACACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TTCCCCGTCTT----C-----AAAA--------C-CG--GGCAGGGGGGCGC-GGAGGGTGCCCTCCCGGGTCCTTTGAAAAA--AGAACGCGGCTGGCCCA-AAACACTCAGTCCCCCGGCGGCGGACGTAGCGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--TTTTGGGCCGCGG{CG}CCTC-CCCGTCCTC-CCGGCGG-CAGAA-AGACCCG--AAGGCG{AC}G-CCCC-GTCTT---TTTA--AAAATAAAAAACGGCCGGCGCGCTCCGAATGAAGTGATGGATTCGTCTATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTCGAAAGGAAATGGGTGGAAAAAACAGCATGTCGTATCAACAAAGAGTTTTGAGAATATTT-------------TT-CCGGGTCGGTATTCAAA--------TTT---------------ATCGAAACGGATT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCCAATGGATAAATGGATAGAGATAGCGCCCTGTGG-CTCCAATTAATT-AGA-GGGAAAGAAAAAGCA--CCAGC-TTCTGT--TCTTAA------TTA-GAATGATT?CCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGGAGAATTTTTCCTAAGAGTGAATTCTTCATTTTTG-AATGAATCCTAA-ATTTTTT--AACCACTCG-GTAATAAA------TGG----A-TAA-TA-----TATTT---TCCATTTTGGACTGGAAACGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTCCATTCATAAAATAAAGGGTTTCTAACCACTCTGTTTTGCTAT-CTTATAAC-GAA--GATAAACCA------CCAAAAA--------CAGA-GAA---TT?AGAG-TCT-GT?G-ATAAC-TC-TA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------TTT-AGA-------AAGACA---AAT-AATATTTTGTTTTGACTGT-CCGCACTATCCATCATTT-GATACCC-CCTCAAATCCTC--ACTCTTCGTAAATCACTTTCAAATGCGGCAATTCCAAAGATATTTAAAGATGGGTGGATCTAACCAACACT-ACTTTTTGAATCCACTTATATTTCAGGAGTATATTTATGTCCTTGC-TCATGATCATGGTTTAAATAGAGCACATTTGTTGGAAAATGCAGGGTATGACAATAAATATAGCTTACTAGCTGTGAAACGTTTAATTTCTCGAATGTATCAAAAGAACCCTTTTGTTTTTTCTGTTA------AGCATTCTAATCTCATTTGGGTGCGCAATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGATTTTCGGTCATTGTAGAAATTCCATTTTCTCTACGATTTTTCCCTTTCTTAGAAAAGAAAGGGAGAGTCAAATCTCAGAATTTA----TGGTATGGAAACCTACCAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAAAAAAAT-GGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCGGAAAACA------AGCGAACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTAACTGTGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACCAAATCGATCACTCCCT---AGTCTGATCGATC-TTTTGAAGAAC----CGATTA-ATCGCACAAGAATAAAGAGAGAGTCCCATTCTACATGCCAATA--------CCGGCA-AAAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGA{CT}TTT{AT}G-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCT-ATAT-------GG----------AGTCCCTAATTATTTAGC------------------TTT------------------------GTTT------------------------------------------------------AGTGAAA-AT--ATTTTTTTCTTA---------AGTCTTATGATCTAAAATAATA-CGTGTACAAACGAGCATCTTTACGT-AAGGAATCCCGATA----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCACTAAATT---GCTGGATCAGGATAAGACTTTGTAAGACCCCTTCAGTTGCCATAGACCCGAGTTATCTATCAAAATGATGGTTCAGGATCGACCATGGTCGGGATAGCTC--CGCGGCAGGGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAGGA-CTATGATTTA-GATTAATCA-AGCTATTTGTAACTGTTTTTTTTTCAAGTTCTAACTGTTTTTTCAAGAACATATGTCA-GTTAA--------ATACTATGCATTTG--------CATTCTA----------ATGAAAGAAA------GAAAAA---------AGAG-AAAT-----------AAAG-CCCCCTTCATAGACCAAGGGAGAATTATTT----------CTCTTTTTTCTTTTATAG-----------------------------------ATTAAAA------CTAATAGAC--------------ATTACGAACAGGTC-TTACCC-ATTTGTAGATG-AG-CTTCAAGAGCAGCTAGGTCTAGAGGAAAGTTATGAGC-ATTACGTTCTATTTAACA- Nardostachys_jatamansii TCGAAACCTGCACG-GCAGAA-CGACCC-GCGAACACGTTG-CAC-ACGGGGA-CACCGG------GCGACCGGG---CGT----C---TCCCAC-GGACGCGGA-GCCGATGGGACCC--GAGG----------CCGCC---AACCCAACCCCGGCGCGATCCGCGTCAAGGAAAAGGAAAA-CAGGAGGGC--AGCGCGAGCCCGTGCGTCCCGTCCGCGGCGTC-GCCG---?GCGAGCG-CGACCCCC-TGTAACAAA--CACAA-ACCACTATCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTTGCCAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-GCCCC-GCCTC--CCG--C-----GGA-GGAGGCGCGC-GGC-GGGGGGCGC-GGACAATGGCCTCCCGCGCCCCC----------GGGCACGGCTGGCCCA-AAACAC--AGTCCCCCGGCGGCGGACGTCACGACGAGTGGTGGTCG--AAA---CAGCCCTCT--TATCGCGTCGTGACCCGA-CCCGTCCGC-CGGGCGG-CCAAG-GGACCCT--GTCGCGCC-GTCC-A-GTC-----------------------AC?G--CGCTCCGAATGAAGTGAGGGATTCGTCCATACCATCGGTAAAGTTTGGAAGACCGCG-ACTGATCCGGAAAGGGAATGGATGGAAAAAATAGCATGTCGTATCAACGAAGAGTTCTGAGAATATTTC--------ACTCTTTCCGAATCAGTAT-AAAAC-------CTT--TTTTAAT-----TA-TGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGAATAAATGGATAGAGATAGAGCCCTATGG-CTTCAATTAATT-ATA-GGGAATGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAA-----TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTGTTAG-TG-CCTGATACGGGAAGGGCTTTTCCCACGAGTGAATTCTTTCTTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTCT-TTATTAATA-----TATT---A-TGA--A-----TAATA---TT-ATTCAGGAATGGAGACGTGTGTCTAAAAGAAAC-AGTATATT-GATTAAAACA-TTTCCAAAATC-----AAAAGAGCGGTTGGGTTGAAAAAATAAAGGATTTTTAACCACCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACC-------ATAAAAAAA------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TC-TA-CTTAGAT-CCGA-GGTATCTA-TTCGTTTCTTATTTGTT-ATT-------AAGACA---AAA-A-TACCTTGTTTTGACTGTATCGCACTATGCATCATTT-GATAACC-CCAAAAATCCTCT-ACTTTTTA-A--TAGAATTCAACAAATAGAATTCCAAAGATCTTTAAAGATAGATGGGTCTCAACACCACT-ACTTCTTATATCCACTTATCTTTCAGGAGTATATTTATGCATTTGC-TCATGATCATGGTTTAAATAGAGCGCATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTATTTGTGAAACGTTTAATTACTCGAATGTATCAAAAGAATCGTGTGCTTTTTTCTGTTAAGCATTCTAACCAAAATGCATTTTTGGGGCGCAATAAGAGTTTTGATTCTCAAATGATATCAGAGGGATTTGCAGTCATTGTAGAAATTCCATTTTCTCTACGATTCCTTTCTTCCTTAGAAAAGAAAGGGAGAGTCAAATCTCAGAATTGA---TTGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTAGTTTTCCGAAAACAAACAAAGGTTCAGAA-AG-CTAAAATAAA--AAAG--GATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGACTGTGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGATAAACCTATAAAC---ATAGATAT------------------ACGCATTGAAATACTATAGACT-CTACCAAATTTTTAATGACGACCCGAATCCGTATTATCAAAAT----------------GGGAGAATAGT-TGTGAAGTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGCCTGATAGATC-TTTTGAAGAAC----TGATTA-ATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATGTCAATACCGGCA-ACAATGAAATT-TATAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAT-------GG----------ACTCCCTAATTATTTATC------------CTCTACCTTT-TATCCTTTT--TTGTTAGCGGTTCAAAATTAGTTATCTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT--GTTTTTCTCTTATC----ACAAGTCTTGTGATCTAAGATAATA-CGTGTACAAATGAGCATCTTTAAGT-AAGGAATCCCGATT----TGAATGATTCATGGTGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGACGATCCAAGAAATT---CCCGGACCAGGATAAGACTTTG-AATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGGATGCAGCGGCGGGAATGGTCGGGATAGCTC--------------------------CTGC-CT---GTCC-CTAGGCTC--TCCGCCCCCG-GCTAGGA-CTATTATTTA-GATTAATCA-ATCTATCTATGACTGTTCTTT----------------------CAAGAACATATGTTA-GTCAA--------ATACTATTAAAAAT--------ACTTTTAAATA-----TAAATAAAAA-------A-AAAA---------AAAA-AGGGCTA--------TAAGGCCCT?TTGA?AG?CCA---A--------------G?--GGG?A?????G?T-CC---CC??TTTTTT-G?TTTTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAACGGGTCATTATCC-ATTTGTAGA-GGAG-CTTC?AGAGCAGCTAAGTCTAGAGGGAAGTTATGAGC-ATTACGTTCTATTTAACA- Patrinia_gibbosa TCGAAACCTGCACA-GCAGAA-CGACCC-GCGAACACGTTCGTAC-ACGGGGA-CTCCGG------CCGCCCGGC--CGGT---GC---TCCCAT-GGTTGCGGC-GCCGTCCGG-CTCC-GCGA----------CCGCA---AACCGAACCCCGGCGCGATCCGCGCCAAGGAACAACAGAT-CAGGAGGCG--AGCGCCAACCCAGCCGGCCCGTTCGCGGCGCGGGCTG---GGAGAACG-CGATCCCC-CGGAAGAAA--CACAA-ACGATTCTCGGCAACGGATATCTCGGTTCTCGCTTCAATGAAAAACGTAGCGAATTGCGATATTTGGGGTGAATTGCAA----------------AATCCGTTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-T-AAACCCGGC--TTTCGCA-CGAAGG-----CGGCGC-GGC-GGGGGGAGC-GGACAATGGCCTCCCGTGTCCCC----------GGGCTCGGCTGGCCTA-AAATCG--AGTCCCC-GACGGCGGACGTCACGGCGAGTGGTGGTCA--AAA---CAGCCCTTT--TATCGCGCCGGGCGTTTT-CCAGTAGGC-CGGGCGA-CCAAC-GCACCCT--GACGCGCC-GTCT-T-----------------------CC-GACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTGGAAGACCGCG-ACTGATCCGGAAAGGGAATGGATGGAAAAAATAGCATGTCGTATCAACGAAGAGTTCTGAGAATATTTC--------ATTCTTTCCGGATCAGTAT-AAAAC-------CTTG-TTTTAAT-----TATGGAACCGGAGT------AAAGTGAAT----TCAATTTCA-GTTGGGTCGAATGAATAAATGGATAGAGATAGAGCCCTATGG-CTTC-ATTAATT-ATA-GGAAAAGAAAAAGCAA-CGAGC-TTCTGC--TCTTAA------TTT-GAATGATTGCCCGATCTAATTAGAC-GTTAAAAATATATTAG-TG-CCTGATACGGGAAGGGCTTTTCCCACGAGTGAATTCGTTATTTTTT-AACGAATCCTAA-TTATTCCCAT-TC-TTTA----TTATTA-----TTA----T-GAA-TA-----TTTTA-------TTTTGAAATGGAGATGTGTGTTTAAAAGAAAC-AGTATATT-GATAAAAAAT-TTTCCAAAATC-----AAAAGAGCGATTCGGTTGAAAAAATAAAGGATTTCTAACCACCCTATTTTGTTAT-CTTATAAC-GAA--GATAAATCA------TAGAAAAA-------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TC-TA-CCTAGATACCGA-GGTATCTA-TTCGTTT-------CTT-ATTTC---TTATAAGATT-AAAGAATACCTTGTTTTGACCGTATCGCACTATGCATCATTT-GATAACC-TCCCAAATCCTGT-ACTTTTGG-TATAGAATTTGAAATGGAGGAATTTCAAAGATATTTAAAGATAGATGGGTCTGAACAACACT-ACTTTTTATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCGCATTTCTTGGAAAATGTAGGGTATGACAATAAATCTAGCTTACTAGTTGTGAAACGTTTAATTACTCGAATGTATCAAAAGAATCATTTGATTTTTTCTGG{GT}{AT}AGGGTTCTAACCAAAATATACTTTTTGGGCGCACTGAGAATTTTGATTCTCAAATGATAT{CT}AGAGGGATT{GT}{GT}CAGTCATTGTAGAAATT{CT}{AC}{AT}TTTTCT{CT}TACGATTACTATCTTCCTTAGAAAATAAAGGGAGAGTCAAATCTCATAATTTA---TTGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTCGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTCTAGTTTTCCGAAAACAAACAAAGGTTCAGAA-AG-CTAAAATCAA--AAAG--GATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACTGTGTTGTGTTGGTAGAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGATAAACCTATAAAC---ATAGATAT------------------ACGCATTGAAATACTATAGACT-CTACCAAATGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------CGGAGAATGGT-TGTGAAGTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATAGATC-TTTTGAAGAAC----TGATTA-ATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATA--------TCGGCAGACAAGGAAATT-TATAGTAAGAGGAAA-TCC--TCG-CTTTAG-AAATCGT?-GGAC-TTGAAATCCCTCTA-TCCCCAAAAAACCC-ATAT-------GG----------ACTCCCTAATTATTTACC------------CTCT-CCTTT-TATCCCTTT--TTGTTAGCGGTTCAAAATTCATTATCTTTCTCTTTGACCCT------ACTCTTTTACAAA-GAGATCTGAGCGGAA-AT--GTTTTTCTCTTATC----ACAAGTCTTGTGATCTAAGATAATA-CGTGTACAAATGAACATCTTTGAGT-AAGGAATCCCCATT----TGAATGATTCATGGTCAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAAGAAATT---CCAGGACCAGGATAAGACTTTGTAATACCCTTTGAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGGATGCAGCGTCGGGAATGGTCGGGATAGCTC-----------------CAAATCCACTGCC--TTGATCCA-CTTGGCTACATCCGCCCCCT-ACTAA-------TATTTT---------------------GATCGTTCTTT----------------------CAAGAACATATGGCA-GTCAA--------ATGCCGTTAAAT------------------------------AAAAAA----------------------GGAG-CAAT-----------AAGGCCC-TCTTGATAGACCAAGAG-------------------GGGTTTTTTGC--TCC----CCTTTTAT-TTGTATTTTTTTTT-----------TTCAAAAA-----CTCATATAC--------------ACCAAGACCAGATC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAGGTCTAGAGGAAAGTTATGAGC-ATTACGTTCATGCATAACT Patrinia_scabiosa TCGAAACCTGCACA-GCAGAA-CGACCC-GCGAACATGTTCGTAC-ACGGGGA-CGCCGG------CCGCGAGGC--CGGT---GC---TCCCAT-GGTAGCGGT-GCCTTCCGG-CTCC-GCGA----------CCGCA---AACCGAACCCCGGCGCGATCCGCGCCAAGGAACAAGAAAT-CAGGAGGCG--AGCGCCAACCCAGCCGGCCCGTTTGCGGCGCGGGCTG---GGCGAACG-C-GGCCCACCGGAAGAAA--CACAA-ACGACTCTCGGCAACCGGAATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC---AAA--CCCG--CTTC-CA-AAGAAG-T---CGGCGC-AGC-GGGGGGAGC-GGACAATGGCCTGCCGGGTCCCC----------GGGCTCGGCTGGCCTA-AAATCG--AGTCCCC-GGCGGCGGACGTCACGACGAGTGGTGGTCG--AAA---CAGCGCTCT--TATCGCGTCGTGCGTTTC-CCCGTCGAT-CGGGCGA-CCAAG-TGACCCT--GACGCGTC-GTCT-T-----------------------C--GACGG--CGCTCCGAATGAAGTGAGGGATTCGTCCATACCATCGGTAAAGTTTGGAAGACCGCG-ACTGATCCGGAAAGGGAATGGATGGAAAAAATAGCATGTCGTATCAACGAAGAGTTCTCAGAATATTTC--------ATTCTTTCCGGATCAGTAT-AAAAC-------CTTG-TTTTAAT-----TATTGAAACGGAGT------AAAGTGAAT----TCAATTTCAAGTTGGTTCGAATGAATAAATGGATAGAGATAGAGCCCTATGG-CTTCAATTAATT-ATA-GGGAAAGAAAACCCCC-CACCC-TTCTTT--TCTATTT-----C---CACTCATCGCCCCTTCTATTAATAT-GTTAAAA-CTAATTAG-TC-CCTG-CTCCGGACCGCCTTTTCCCCCGAGTGAATTCGTTATTTTTT-AACGAATCCTAA-TTATTGCCAT-TC-TTTA-TAATTATTA-----TAA----T-ATT-AT-----ATTAA---TATATTTTGAAATGGAGATGTGTGTTTAAAAGAAAC-AGTATATT-GATAAAAAAA-TTTCCAAAATC-----AAAAGAGCGATTGGGTTGAAAAAATAAAGGATTTCTAACCACCCTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAGAAAAA-------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TC-TA-CCTAGAT-CCGA-GGTATCTA-TTCGTTT-------CTT-ATTTC---TTATAAGA---AAAGAATACCCTGTTTTGACTGTATCGCACTATGCATCATTT-GATAACC-CCCCAAATCCTCT-ACTTTTGG-TATAGAATTTCAAATGGAGGAATTTCAAAGATATTTAAAGATAGATGGGTCTCAACAACACT-ACTTCTTATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGTGCATTTGTTGGAAAATGTAGGGTATGACAATAAATCTAGCTTACTATTTGTGAAACGTTTAATTACTCGAATGTATCAAAAGAATCATTTGATTTTTTCTGGTAAGGGTTCTAACCAAAATATACTTTTTGGGCGCACTAAGAATTTTGATTCTCAAATGATATCAGAGGGATTTGCAGTCATTGTAGAAATTCCATTTTCTCTACGATTACTATCTTCCTTAGAAAATAAAGGGAGAGTCAAATCTCAGAATTTA---TGGGTATGAAA?CCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGAAATTAATAAAAATGGGCAAT-CTGAGCCAAATCCGGTTTTAGTTTTCCGAAAACAAACAAGGGTTCAGAA-AG-CTAAAATCAA--AAAG--GATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACTGTGTTGTGTTGGTAGAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGATAAACCTATAAAC---ATAGATAT------------------ACGCATTGAAATACTATAGACT-CTACCAAATGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAGAATGGT-TGTGAAGTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATAGATC-TTTTGAAGAAC----TGATTA-ATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATA--------CCGGCA-ACAAGGAAATT-TATAGTAAGAGGAAAATCCG-TCGTCTTTAG-AAATCGTG-AGGG-TTCAAGT-CCTCTA-TCCCCAAAA{AC}ACCC-ATAT-------GC----------ACTCC-TAATTATTTATC------------CTGT-CCTTT-TATCCCTTT--TTGTTAGCGGTTCAAAATTCATTATCTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGCGGAA-AT--GTTTTTCTCTTATC----ACAAGTCTTGTGATCTAAGATAATA-CGTGTACAAATGAACATCTATGAGT-AAGGAATCCCCATT----TGAATGATTCATGGTCAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-GTTTTGAAGATCCAAGAAATT---CCAGGACCAGGATAAGACTTTGGAATACCCTTTCAGTTGACATAGACCCGAGTTATCTATCAAAATGAGGATGCAGGGCCGGGAATGGGTCGGATAGCTC----------GGGATTCACAATCCACTGCC--TTGATCCA-CTTGGCTACATCCGCCCCCT-ACTAA-------TATTTT---------------------GATGGTTCTGT----------------------CAAGAACATATGTCA-GTCAA--------ATACTGATAAAT------------------------------AAAAAA----------------------GGAG-CAAT-----------AAGGCCC-TCTTGATAGACCAAGAG-------------------GGGTTTTTTGC--TCC----CCCT--------TTTTTTTT--------------TTCAAAAA-----CTCATATAC--------------ACCAAGACCGGATC-TTATCC-ATTTGTAGATGGAG-TT?CAAGAGCAGCCAGGTCTAGAGGAAAGTTATGAGC-ATTACGTTC-TATTTAACA Patrinia_triloba TCGAAACCTGCACA-GCAGAA-CGACCC-GCGAACACGTTCGTAC-ACGGGGA-CTCCGG------CCGCCCGGC--CGGT---GC---TCCCAT-GGTTGCGGC-GCCGTCCGG-CTCC-GCGA----------CCGCA---AACCGAACCCCGGCGCGATCCGCGCCAAGGAACAACAGAT-CAGGAGGCG--AGCGCCAACCCAGCCGGCCCGTTCGCGGCGCGGGCTG---GGAGAACG-CGACCCCC--GGAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCAAA--CCCG--CCATTTG-CAC-GA-A-GGCGGCGC-GGCGGGGGGGAGC-GGACAATGGCCTCCCGTGTCCCC----------GGGCTCGGCTGGCCTA-AAATCG--AGTCCCC-GGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAA---CAGCCCTCT--TATCGCGCCGTGCGTTTT-CCAGTTGGC-CGGGCGA-CCAAA-CGACCCT--GACGCGCC-GTCT-T-----------------------CC-GACGG--CGCTCCGAATGAAGTGAGGGATTCGTCCATACCATCGGTAAAGTTTGGAAGACCGCG-ACTGATCCGGAAAGGGGATGGATGGAAAAAATAGCATGTCGTATCAACGAAGAGTTCTGAGAATATTTC--------ATTCTTTCCGGATCAGTAT-AAAAC-------CTTG-TTTTAAT-----TATTGAACCGGAGT------AAAGTGAAT----TCAATTTCAAGTTGGGTCGAATGAATAAATGGATAGAGATAGAGCCCTATGG-CTTCAATTAATT-ATA-GGAAGAAAAA---CAA-CGAGC-TTCTGT--TCTTAAT-----TTG-AAATGATTTCCCGATCTAATAACAA-GTTAAAACTCTATTAG-TG-CCTG-TACGGGAAGGGCTTTTCCCACGAGTGAATTCGTTATTTTTT-AACGAATCCTAA-TTATTGCCAT-T--CTTT-ATTA--TT-------------A-TTA-TT-----AATAT---TCTATTTTGAAATGGAGATGTGTGTTTAAAAGAAAC-AGTATATT-GATCAAAAAA-TTTCCAAAATC-----AAAAGAGCGATTGGGTTGAAAAAATAAAGGATTTCTAACCACCCTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA-------AGAA-AAA------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TC-TA-CCTAGAT-CCGA-GGTATCTA-TTCCGTTCTTATTTCTT-ATA----------AGA---AAAGAATACCTTGTTTTGACTGTATCGCACTATGCATCATTT-GATAACC-CCCCAAATCCTGT-ACTTTTTA-A--TAGAATTCAAATGGAGGAATTTCAAAGATATTTAAAGATAGATGGGTCTGAACAACACT-ACTTTTTATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCGCATTTCTTGGAAAATGTAGGGTATGACAATAAATCTAGCTTACTAGTTGTGAAACGTTTAATTACTCGAATGTATCAAAAGAATCATTTGATTTTTTCTGGTAAGGGTTCTAACCAAAATTCTTTTTGGGCGCGCACTGAGAATTTTGATTCTCAAATGATATCAGAGGGATTTGCAGT{AC}ATTGTAGAAATTCCATTTTCTCTACGATTACTATCTTCTCTAGAAAATAAAGGGAGAGTCAAATCTCATAATTTA---TTGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTAGTTTTCCGAAAACAAACAAAGGTTCAGAA-AG-CTAAAATCAA--AAAG--GATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACTGTGTTGTGTTGGTAGAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGATAAACCTATAAAC---ATAGATAT------------------ACGCATTGAAATACTATAGACT-CTACCAAATGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAGAATGGGTTGTGAAGTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATAGATC-TTTTGAAGAAC----TGATTA-ATCGGACGAGAATAAAGATAGAGTCCCATTCT-CATGTCAATA--------TCGGCA-ACAAGGAAATT-TATTGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGGA-GGGT-TC-AAATCCCTCTA-TCCCCAAAAAACCC-ATAT-------GG----------ACTCCCTAATTATTTACC------------CTCT-CCTTT-TATCCCTTT--TTGTTAGCGGTTCAAAATTCATTATCTTTCTCTTTGACCCT------ACTCTTTTACAAA-GAGATCTGAGTGGAA-AT--GTTTTTCTCTTATC----ACAAGTCTTGTGATCTAAGATAATA-CGTGTACAAATGAACATCTTTGAGT-AAGGAATCCCCATT----TGAATGATTCATGGTCAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAAGAAATT---CCAGGACCAGGATAAGACTTTGTAATACCCTTTGAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGGATGCAGCGTCGGGAATGGTCGGGATAGCTC----------GGGATTCACAATCCACTGCC--TTGATCCA-CT-TGGTACATCCGCCCCCT-ACTAA-------TATTTT---------------------GATCGTTCTTT----------------------CAAGAACATATGTCATGTCAA--------ATGCCGTTAAAT------------------------------AAAAAA----------------------GGAG-CAAT-----------AAGGCCC-TCTTGATAGACCAAGAG-------------------GGGTTTTTTGC--TCC----CCTTTTAT-TTGTTTTTTTT--------------TTCAAAAA-----CTCATATAC--------------ACCAAGACCAGATC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAGGTCTAGAGGAAAGTTATGAGC-ATTACGTTC-TATTTAACA Patrinia_villosa TCGAAACCTGCACA-GCAGAA-CGACCC-GCGAACACGTTCGTAC-ACGGGGA-CGCCGG------CCGCGAGGC--CGGT---GC---TCCCAT-GGTAGCGGT-GCCGTCCGG-CTCC-GCGG----------CCGCA---AACCGAACCCCGGCGCGATCCGCGCCAAGGAACATGAAAT-CAGGAGGCG--AGCGCCAACCCAGCCGGCCCGTTCGCGGCGCGGGCTG---GGCGAACG-CGACCC-ACCGGAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC---AAA--CCCG--CTTC-CA-ACGAAG-T---CGGCGT-CGC-GGGGGGAGC-GGACAGTGGCCTCCCGAGTCCCC----------GGGCTCGGCTGGCCTA-AAATCG--AGTCCCC-GGCGGCGGACGTCACGACGAGTGGTGGTCG--ATA---CAGCCCTCT--TATCGCGTCGTGCGTTTC-CCCGTCGAC-CGGGCGA-CCAAG-TGACCCT--GACGCGTC-GTCT-T-----------------------CC-GACGT--CGCTCCGAATGAAGTGAGGGATTCGTCCATACCATCGGTAAAGTTTGGAAGACCGCG-ACTGATCCGGAAAGGGAATGGATGGAAAAAATAGCATGTCGTATCAACGAAGAGTTCTGAGAATATTTC--------ATTCTTTCCGGATCAGTAT-AAAAC-------CTTG-TTTTAAT-----TATTGAAACGGAGT------AAAGTGAAT----TCAATTTCAAGTTGGGTCGAATGAATAAATGGATAGAGATAGAGCCCTATGG-CTTCAATTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAT-----TTG--AATGATTGCCCGATCTAATTAGAC-GTTAAAAATATATTAG-TG-CCTGATACGGGAAGGGCTTTTCCCACGAGTGAATTCGTTATTTTTT-AACGAATCCTAA-TTA----TTC-CCATTCT-TT-ATTA-------TTA----T-TAT-GA------ATAT---TTTATTTTGAAATGGAGATGTGTGTTTAAAAGAAAC-AGTATATT-GATAAAAAAT-TTTCCAAAATC-----AAAAGAGCGATTCGGTTGAAAAAATAAAGGATTTCTAACCACCCTATTTTGTTAT-CTTATAAC-GAA--GATAAATCA------TAGAAAAA-------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TC-TA-CCTAGATACCGA-GGTATCTA-TTCGTTTCTTATTTCTT-ATA----------AGATT-AAAGAATATCTTGTTTTGGCCGTATCGCACTATGCATCATTT-GATAACC-CCCCAAATCCTCT-ACTTTTGATTATAGAATTTCAAATGGAGGAATTTCAAAGATATTTAAAGATAGATGGGTCTCAACAACACT-ACTTCTTATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCGCATTTGTTGGAAAATGTAGGGTATGACAATAAATCTAGCTTACTATTTGTGAAACGTTTAATTACTCGAATGTATCAAAAGAATCGTTTTTTTTTTTCTGGTAAGGGTTCTAACCAAAATATACTTTTTGGGCGCACTAAGAATTTTGATTCTCAAATGATATCAGAGGGATTTGCAGTCATTGTAGAAATTCCATTTTCTCTACGATTACTATCTTCCTTAGAAAATAAAGGGAGAGTCAAATCTCAAAATTTAC--TTGGTATGAACCCTTA?TAAGTGAGACCTT?CAAATTCAGAGAACCCCTGGAATTAATAAAAATGGGCATTCCTGAGCCAAATCCGGTGTTAGTTTTCCGAAAACAAACAAGGGTTCAGAA-AG-CTAAAATCAA--AAAG--GATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACTGTGTTGTGTTGGTAGAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGATAAACCTATAAAC---ATAGATAT------------------ACGCATTGAAATACTATAGACT-CTACCAAATGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAGAATGGT-TGTGAAGTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATAGATC-TTTTGAAGAAC----TGATTA-ATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATA--------CCGGCA-ACAAGGAAATT-TATAGTAAGAGGAAA-TCCG--CGACTT-AG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAT-------GG----------ACTCCCTAATTATTTATC------------CTCT-CCTTT-TATCCCTTT--TTGTTAGCGGTTCAAAATTCATTATCTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGCGGAA-AT--GTTTTTCTCTTATC----ACAAGTCTTGTGATCTAAGATAATA-CGTGTACAAATGAACATCTTTGAGT-AAGGAATCCCCATT----TGAATGATTCATGGTCAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAAGAAATTCCAAGGGGACCAGGATAAGACTTTGTAATACCCTTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGGATGCAGCGTCGGGAATGGTCGGGATAGCTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Plectritis_brachystema TCGATGCCTGCAAGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CCGCGGAGCCGTGC------CCCCTTGGG---AGTTCGGC---CCCGAA-GGAAGCGGGGACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCCCGCCTATCTGGCCCGTTTGCGGTGCTGGATT---TTCGGGTGCCAACCCCTCTGAGAAAAAA-CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGGCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCTTGCAAA--CCCCTCAACCGGGG-GTCGGCATGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCACCCCC-ACC------GGGCGCGGCTGGCCCA-AATCGC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---ACGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCG-TCTC-CGGGTGG-CGAAA-CGACCCC--TTCGTGCG-GTCC-TT--------------------AGG---ACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGACGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTGTT-CCGGATCCGTAT-CAAA--------CTTG-TTTTAAT-----TATTGAAACCGAGTTAAGTTAAAGTGAATGCATTCAATTTCAAGTTGGGTCAAACGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTACA-----TTA-GAATGATTTCCCGATCTAATAACAA-GTTAAAACTCTATTAG-TG-CCTGATACGGGAAGAG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCGTTTT--ATAAAAA------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGATTTCTAATCATCTTGTTGGTTTAT-CTTATAAG-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-ACCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTG-CTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA--ATTAAAATGCAA-TGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAATATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGGCAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTTAAATCGCGGAATTTA---TTAGTATGGAACC?TACTAAGTGAGACCTTC--AATTCAGAGAACCCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGCTTTTGTTTTCGGAAAACA----------AACAAAAG-CTACAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATCGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTCTAAAC---AAGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTA-TGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTTTTTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAACT-TAGAGTAAGAGGAAAATCCG-TTGACTT--A-GAATCGTG-AGGG-T-CAAGT--CTCTA-TCCCCAAAAA-CCC-ATAT-------GG-----------CTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAG---------TTATCTTTCTCATTCACCCT------ACTCTTTGACAAA-GAGATCCGAGTGAAA-AT--GTTTTTTTCTTATC----ACAAATCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATTA---TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAAATCCAATAAATT---GCCGGATGAGGGTAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAAACTGCAGCGGTGGGAATGGTCGGGATAGCTC-----CAAGGGGATTCACAAATCCACTGCC--TTGAGCC--CTAGGCTACATCCGCCCCCA-GCGAGGA-CTCTTAGTTAGGATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTGAA--------ATACTATGCATTTT--------CATTAGAATGAAAGAAAAAAAG--------------------------------------------------CCC-CCTTACTAGAA-AGCTAGAAAGG-TA---AG-------------GG--GGGATTTTGTCTA-CC---TGTTTTTT-------TTTTT---TTCAAAAAC----CCC?TTTCC--------------CCTAAAATTAGGCC-TTACCC-TTTTGCAAA?GGGG-CTCCAAGAGTACCTAATCCTAGAGGGAAGTTTTGACC-ATTACGTTCTATTTAACA- Plectritis_congesta TCGATGCCTGCAAGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CCGCGGAGCCGTGC------CCCCTCGGG---AGTGCGGC---CCCGAA-G-AACCGGGGACCGTAAGGACCCC-GCGC----------CCGCT---AACACAACCCCGGCGCAAACCGCGTCAAGGAGCATGACAA-CGGAAGGGG--CGCGCCCGCCTATCTGGCCCGTTTGCGGTGCTGGATT---TTTGGGTGCC-ACCTCTCTGAGAAAAA--CACAC-AACA-TCTCCGACACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------TATCC-GCGAA-----------------CCA-TCGAGTCTTTGAACGCA-GTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCTTGCCAA--CCCCCCA-ACTGGG-GTCGGCACGC-GGC-GGGGGGCGC-GGACTTTGGCCTCCCGCACCCCC-ACC------GGGCGCGGCTGGCCCA-AATCGC--GGTCCCCTGGCGGCGGACGTCCAGGCGAGTGGTGGTCG--AAT---ACGTCCTCT--TTTCGCGCCGTGGCCTTC-CCCGTCT-C-CGGGTGG-CGAAA-CGACCCA--GTCGTGCG-GTCC-TT--------------------AGG---ACGG--CGTCCTGAATGAACTGATGGATTCGTCCATACCATCGGTAAAGTTTTGACGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTGTT-CCGGATCCGCATTCAAA--------CTTC-TTTTAAT-----TATTGAAACGGAGTTAAGTTAAAGTGAATGCATTCAATTTCAAGTTGGGTCAAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTA-A-----TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAACTCTATTAG-TG-CCTGATACGGGAAGAG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT--ATAAAAA------TGG----A-TAA-TATAATATATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGATTTCTAATCATCTTGTTGGTTTAT-CTTATAAG-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-ACCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTTAAATGCAAATGGAGGAATTTAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATTGTTTAAATAGAGCACATTTTTTGGAAGATATAGGGTATGACCATAAATATAGTTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CGAACCAAAATGTCTTTTGGGGGCGCCATAAGAGTTTTGATTTTCAAAGGATATCAGAGGGGTTTTCAATCATTGTAGAAATTCCATTTTCGCTACGATTCTTATCTTTCG-AGAAACGAAAGGGAGAGT-AAATCG------------CTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAA-TGGGCAATCCTGAGCCAAATCCGGCTTTTGTTTTCGGAAAATA----------AACAAAAG-CTACAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATCGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTCTGAAC---AAGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTTTTTCCATATTGAAGAAAGAATCGA-ATATTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAACT-TAGAGTAAGAGGAAAATCCG-TTGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCC-ATAT-------GG----------ACTCTCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAG---------TTATCTTTCTCATTCACCCT------ACTCTTTGACAAA-GAGATCCGAGTGAAA-AT--GTTTTTTTCTTATC----ACAAATCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAAATCCAATAAATT---GCCGGATGAGGGTAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAAACTGCAGCGGTGGGAATGGTCGGGATAGCTC------------------------CCTGCC--TTGA?CCC-ATTGGCTACATCCGCCCCC?-GCGAGGA-CTCTTAGTTAG-ATTAATCA-ATCTAAT-------------ATATCATGACATGTATATATATTCAAGAACATATGTCA-GTGAA--------ATACTATGCATTTT--------CATTAGAATGAAAGAAAAAAAG--------------------------------------------------CCC-CCCTACTAGAA-AGCTAGAAAGG-TA---AG-------------GG--GGGATTTTGTCTA-CT---TGTTTTTT-------TTTTT----TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGGG-CTTCAAGAGTAGCTAAATCTAGAGGGAAATTATGAGC-ATTACGTTCATGCAAAACT Plectritis_macrocera TCGATGCCTGCAAGCGCAGAA-CGACCC-GCGAACATGTTTAAAA-CCGCGGAGCCGTGC------CCCCTCGGG---AGTTCGGC---CCCGAA-GGAAGCGGGGACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCCCGCCTATCTGGCCCGTTTGCGGTGCTGGATT---TTCGGGTGCCAACCCCTCTGAGAAAAAA-CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCTTGCAAA--CCCCTCAACCGGGG-GTCGGCACGCCGGC-GGGGGGCGCCGGACGATGGCCTCCCGCACCCCC-ACC------GGGCGCGGCTGGTCCA-AATCGC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---ACGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCT-C-CGGGTGG-CGAAA-CGACCCC--TTCGTGCG-GTCC-TT--------------------AGG---ACGG--CGCTCCGAAT?AAGTAAG?ATTTCGTCCATACCATCGGTAAAGTTTTGCCGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTGTT-CCGGATCCGTATTCAAA--------CTTG-TTTTAAT-----TATTGAAACGGAGTTAAGTTAAAGTGAATGCATTCAATTTCAAGTTGGGTCAAACGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTACA-----TTA-GAATGATTTCCCGATCTAATAACAA-GTTAAAACTCTATTAG-TG-CCTGATACGGGAAGAG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCGTTTT--ATAAAAA------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGATTTCTAATCATCTTGTTGGTTTAT-CTTATAAG-GAA--GATAAACCA------TAAAA-AAA------AGAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-ACCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTG-CTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA--ATTAAAATGCAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGCTTTTGTTTTCGGAAAACA----------AACAAAAG-CTACAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATCGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTCTAAAC---AAGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTA-TGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTTTTTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAACT-TAGAGTAAGAGGAAAATCCG-TTGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAT-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAG---------TTATCTTTCTCATTCACCCT------ACTCTTTGACAAA-GAGATCCGAGTGAAA-AT--GTTTTTTTCTTATC----ACAAATCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATTA---TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAAATCCAATAAATT---GCCGGATGAGGGTAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAAACTGCAGCGGTGGGAATGGTCGGGATAGCTC--------------------ATCCACTGCC--TTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTAGTTAG-ATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTGAA--------ATACTATGCATTTT--------CATTAGAATGAAAGAAAAAAAG--------------------------------------------------CCC-CCTTACTAGAA-AGCTAGAA-GG-TA---AG-------------GG--GGGATTTTGTCTA-CT---TGTGTTTT-------TTTTT-----CAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGGG-CTTCTAGAGTAGCTAAATCTAGAGGGAAGTTATGAGC-ATTACGTTCTATTTAACA- Triplostegia_glandulifera TCGAAACCTGCCCA-GCAGAA-CGACCC-GCGAACACGTTCAAACACGGG-GAAACCCGGATCGGGCGCGCGAGCTCCCGGCCGGCAATCCCGCGCGGGCGCGGC-GCCGTCAAGGCTCC-GCGG----------CCGCC---AACCGAACCCCGGCGCGATCCGCGCCAAGGAACA--AGAA-AAAAGGAGG--CGCGCTCCCCC-------CCGTCCGCGGGGACGG--G---G-----CGCCG-----TCCTAAAAGAA--CACAA-ACGACTCT-GGCAACGGATATTTT?GCTCTCGCATCGATGAAAAACGTAACGGAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCAGCAC--CCCGC--GTCCCCG-AGGGGC-CGCGTG--GC-GGA-GGGGGGTGC-GGAAAATGGCCTCCCGTTCCCCC----------GGGCGCGGCCGGCCCA-AAATTG--AGTCCCCCGGCGGCGGACGTCACGACGAGTGGTGGTCG--AAAC--G-TCCCTCT--TATCGCGTCGTGCGGTTC-TCCGCCGTC-CGGACGGCCAAAG-CGACCC---TGCGCGCA-GTCT-TC--------------------C-G---ACTG--CGCTCCGAATGAAGTGAGGGATTCGTCCATACCATCGGTAAAGTTTGGAAGACCGCG-ACTGATCCGGAAAGGGAATGGATGGAAAAAATAGCATGTCGTATCAACGAAGAGTTCTGAGAATATTTC--------ATTCTTTCCGGATCAGTAT-AAAA-------CCTTG-TTTTA-T-----TATTGAAACGGAGT------AAAGTGAAT----TCAATTTCAAGTTGGGTCGAATGAATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATAAGGGAAAGAAAAAGCAC-CGAGC-TCCTGT--TCTTAAA-----TTAAGAATGATTTCCCGATCTAATAATAAAGTTAAAAATTTATTAG-TG-GCTGATACGGGAAGGGCTTCTCCCACGAGTGAATTCTTTATTTTTTTAACGAATCCTAA-TTATTACCAT-TCTTTTT-TATA-----------------T-TAT-TA------------TTATATAAT-GGCTGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATAAAAA-A-TTTCCAAAATC-----AAAAGAGCGATTGGGTTGAAAAAATAAAGGATTTCTAATCACCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCAATGAAATAGAAAAAC-------AGAGGA----TAGAGAA-TCT-GTTG-ATAAG-TC-TA-CCTATAT-CCGA-GGTATCTA-TTCGTTT-------CTT-ATTT-ATT--ATAAGA---AAAGAATAGCTTGTTTT-ACTGTATCGCACTATGCATCATTT-GATAACC-CCCCAAATCCTCT-ACTTTT-G-GTTAAAATATCAAATGGAGGAATTCCAAAGATATTTAAAGATAGATGGGTCTCAACAACACT-ACTTCTTATATCCACTTATCTTTCAGGAGTATATTTTTGCACTTGC-TCATGATCATGGTTTAAATAGAGCGCATTTGTTGGAAAATGTAGGGTATGACAATAAATCTAGCTTACTCTTTGTGAAACGTTTAATTACTCGAATGTATCAAAAGAATCATTTGATTTGTTCTCTTAAAGATTCTAACCAAAATACGTTTTTTGGACGCAATAAGAATTTGGATTCTCAAATGATATCAGAGGGATTTGCAGTCATTCTAGAAATTCCATTTTCTTTCCAATTACTATCTTCCTTAGAAAAGAAAGGGAGAGTCAAATCTCATAATTTA---TTGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCCGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCAG------TTTTCCGAAAACAAACAAGGGTTCAGAA-AG-CTAAAATCAA--AAAG--GATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGACTGTGTTCTGTTGGTAGAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGATAAACCTATAAAC---ATAGATAT--------------------------------------------------------------------------------------------------------------------------------------AGAAACATAGATATAGGCATTGATCAAATCATTCACTCCAT---AGTCTGATAGATC-TTTTGAAGAAC----TGATTA-ATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATA--------CCGGCA-ACAATGAAATT-TATAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-GTAT-------GG----------ACTCCCTAATTATTTATC------------CTCT-CCTTT-TATCCTTTT--TTGTTAGCGGTTCAAAATTCATTATCTTTCTCATTCACACT------ACTCTTTTACAAA-GAGATCTGAGCGGAA-AT-G-TTTTTCTCTTATC----ACAAGTCTTGTGATCTAAGCTAATA-CGTGTACAAATGAACATCTTTGAGT-AAGGAATCCCCGTT----TGAATGATTCATGGTCAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTC-CTTTTGAAGATCCAAGAAATT---CCAGG{AC}CCTGGATAAGACTTTGTAATACCCTTTCAATTGACATAGACCCGAGTTATCTAGAAAAATGAGGATGCAGCGTCGGGAAGGGTCGGGATAGCTC-CG?GGCAGGTGGA?TCACAAA?CCACTGC-CTTGATCCA-CTTGGCTACATCCGCCCCC-------TA-CTAGTATTTA-GATTAATCA-AAATATTTA?GATTGTTCTTT----------------------CAAGAAAATATATAA-GTCAA--------ATACTATTAAAT------------------------------AAAAAG----------------------GGAG-CAAT-----------AATCCCCCTCTTCTTCTATGAAGAG-------------------GGCGTTATTGC--TCC----TTTTTTA-----TTTTTTTT--------------TTCAAAAA-----CTCATATACT-------------ACTAAGGCCGGGTC-TTATCC-CATTTTTAGAGGAG-CTTCTAGAGCAGCTAGGTCTAGAGGGAAGTTATGAGC-ATTACGTTC-TATTTAACA Valeriana_acutiloba TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGGC-----CCCTCGGGC---CGT--GAC---TCCGAA-GGACGCGGG-ACCGAAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATTATAA-CGGAAGGGG--CACGCTGGCCCGTTTGGCCCGTTAGCGGTGCCGGCCG---GGCGAGCGTCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGGGTCGCCCCCC--TCCCC-CCCTC--CCCCTCA-TCGGGG-CGTGGCGTGC-GGC-GGGGGGAGC-GGACGATGGCCTCCCGCGCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTTACGGCGAGTGGTGGTCG--AAT---AAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGTGG-CGAAT-CGACCCA--TACGCGTT-GTCC-AC--------------------GAG---ACTG--CGCTCCGAATGAAGTGATCCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTCG-GTTTAAT-----TATGGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAA-----TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TTCAAAA-------TGA----A-TAA-TA-------------TCCATTTTGAAATGGAAATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCTAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGACTTTCTAACCATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAACA------GAG-GAT----AGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCAA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCCCAAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCACATTTGTTGGAAAATGTAAGCTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAAGGATTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATT-TTATCTTTC-TAGAAACGAAAGGAGAAGTCAA-TCGCGGAATTACG--------------------------------ACGAATTCAGAGACCCCGTGGAAATAATAAAGATGCGCAAT-CTGAGCCAATTCCGGTATTTGTATTCGAAAAACA----------AGCAAAGC-GTAAAATCA---GAAA-GGATAGGTGCAGAGACTCGACGGAAGCTGTTCTAACAAATAAAGTGGACTGG-TA-----GATAAAAAGAATCCTTCCATAGAAACTACAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATCCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCATTC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGCGTCCCATTCTCCATGCCTATG--------CCGGAT-AC-ATGA-CTT-TAGAGTAAA-GAAAA-TCCG-TC-ACTTGAT-CTGGCGCTGAGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAACC-ATAT-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTT-CTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCCATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCCGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC----------------CCCCAATCCCCTGC-CCTGAGCCC-CTTGGCTACATCCGCCCCCC-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTT-----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAAA--------GGAG-AAAT-----------AAAG-CCCCCTAGCTAGACT----------------CAGGG--GGGA-TTTTTTCT--------CCCTTTTTTTTTTCTTTT-T---------------TCACAAA-----CTCATATAC--------------ACTAAGAACGGGT--TTATCC-ATTTGTAGAGGGAG-CTTCAAGAGCAGCTAGGTCTAGAGGGAAATTATGAGC-ATTACGTTCTGGAG----- Valeriana_adscenden TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCCGG------CCCTCGGGC---CGT--GGC---TCTGAA-GGACGCGGG-ACCGTTAGGACCCC-GCGG----------CTGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCTGGTCCGTTCGGCTCGTTCGCGGTGCCGGCCT---TGCGAGCGTCAACCCCTCTGAGAAATA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGATAATGGCCTCCCGCACCCCC-ATC------GGGCGCGGCTTGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTTG--AAT---AAGCCCTCT--GTTCGCGCTGTGGCCCTT-CCCGTCTTT-CGGGTGG-CGAAT-CGACCCA--GATGCGCG-GTTC-AC--------------------AAA---ACGG--?GCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCCGTATTAAAATTTGAAA-CTTG-GTTTAAT-----TATGGAAACGGAGT------AAAGTGAATTCATTCAATTTCCAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATTATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTA-AATGAATCCTAA-TTATTTTTTG-CCCTTTC-CAAAAAAAA-----TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTTCCAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGGTTTGTTAT-CTTATAAC-GAA--GATAA?CCA-------TAAA-AAA-------G?G-GAT---TAGAGAG-TCTTGTTG-ATAAG-TCCTA-CTTAGAT-CCGG-GGTATCT?-TTTGTTT-------CTT-ATT-------ATGCCA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATA?CC-CCTCAAATCCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATT---------------------------------ACTAATTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTTGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGGGATTTAAATCGCGGAATTTA---TTAGTATGGAAACCCACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAGAAAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT--TTATTAGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G--TTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTT-ACGT----AGATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCTGAGT-ATCAAGCAAAATGAG?ATG{CT}AGA----------------------------ATGGTGAA-TTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAA---------------------GGGGGTTTCTCC---------TTTTT--------CTTTT-T---------------TCAAAAA-------CATATACACTAAGAAATATACACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CT-CAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTTATT------- Valeriana_albonervata TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGTGCCCCGG------CCCTCGGGC---TGT--GGC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCTG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGATAA-CGGAAGGGG--CGCGCTGGCCCGTTTGGCCCGTTCGCGGTGCCGGTCG---GGCGAGCGCCAGCCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTA--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGGTGGCCTCCCGCCCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAT--TGTCCCCCGGAGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGTGG-AGAAT-CGACCCA--GACGCGCG-GTCC-AC--------------------GAG---ACGG--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCGACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTTTAATGAATCCTAA-TTATTTTTTG-CCATTTA-AAAA-AAA------TGG----A-TAA-TA-----TAGTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAA---------GAGGAT---TAGGGAG-TCT-GTTG-ATAAG-TCCTA-CTTAAAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAA-----------------------------------------------------------------------------------------------------------------------------------------CCTTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCGACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT--ATATTAGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC------------GATTCACAAATCC?CTGC-CTTGAGCC?-CTTGGCTACATCCGCCCCCA-GCGGGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGAC-----------------CAAGG--GGAGGTTTTTTCT-CC-----TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGAGGGAA-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTCATGCATAAC- Valeriana_apiifolia TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-TTGCGGTGTCCCGG------CCCTCGGGC---TGT--GGC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAACCCGCGTCAAGGAACATGACAC-GGAAGGGGG--CGTGCCGTCCCGTTTGGCCCGTTCGCGGTGCCGGTCG---GGCGAGCGCCGACCCCTCTGAGAAAAC--CACAA-ACGACTCTCGGCACGGAATATCTCGCTTCTCCCATCGATGAAGAACATAGCGAAATGCGATCCTTGGTGAGA-TTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--TCCCC-GTCTC--CCCCTCC-TACGGG-TGCGACGTGC-GGC-AGGGG-CGC-GTACGATGGGCTCCCGCGCCGAC-ATC------GGGTGCGGCTGGCCCAGAAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTG-TCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCTCC-CGTC--TTT-CGGGCGG--AGAT-CGACCCA--GACGC?CC-TCC?-AC--------------------AAG---ACGC--GTTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGCGATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCCGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTAA-AAAA--AAA-----TGG----A-GAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAA--------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACCACCCTCAATTCTCG-ACT-TTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCGCATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTC?AA---------------------------------------CTAACCAAA?TGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAATCGAAAGGGAGAGTCAAATCGCGTAATTTA---TTAGTATGGAACCCTACTAAGTGAGAACTTACAAATTCAGAGAACCCCTGGAATTAATAAAAATGGACAATCCT-AAGCCAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGT-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAGCGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATATTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGAAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGA-C----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACA-TGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGGGTTCAAGTCCCTCTA-TCTCCAAAAAACCC-ATAC-------G-----------ACTCCCCAATTATTTATC-----------------CTTT--CTTATTTTT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGGGGGAATGGTCGGGATAGCTC---CCGCTGTGGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAAA------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAAGG--------------------GGGATTTTT-CTCCTT------TTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTACGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTTTA-------- Valeriana_arborea TCGATGCCTGCATGCGCAGAA-CGACCA-GCGAACACGTTCAAAA-CAGCGGAGCCCCGG------CTCTCGGGC---CGT--GGC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGC----------CCGAA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGTGCTGGCCCGATTGGCCCGTTTGCGGTGTCGGCCG---GGCGAGCGCTAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--TCCCC-GTCTC--CCCCACA-TCGGGG-CGCGGCATGC-GGC-GGGGG-TGC-GGACGATGGCCTCCCGTACCCAC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCTCTC-CCCGTCTTC-CGGGCGG-CGAAT-TGACCCA--GACGCGCG-GTCC-AC--------------------GAG---ACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTG--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAT-----TTA-GAATGATTTCCCGATCTAATAATAT-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATAAA-AA-A----------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTAAGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATG?AAACCTACTAAGT-AGAACTT-CAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATTCGGTTTTTGTTTTCGGAAAACA------AACAAACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG--CGACTTTAG-AAATCGTG-AGGG-TTCGAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGAAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC---CGCATGGTGAATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGATTGG-TA-A-----------GGG--GGGATTTTTTCTACTT-----TTTTT--------CTTTTTT---------------TCAAAAA-----CTCATATAC--------------ACTAAAAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTGTAGAGGGAAATTATGAGC-ATTACGTTCATGCATA--- Valeriana_aretoides TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCCGG------CCCTCGGGC---TGT--GAC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCACTGGCCCGTTTGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGCCTACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGCCTTT-ATC------AGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCAACGGACGTCACGGCGAGTGGTGGTTGCAAAT---AAGCCCTCTCTGTTCGCGTCGTGGCCCTC-CCCGTCTTC-CGGGTGG-CGAAT-CGACCCA--GACGCGCT-GTTC-TC--------------------GAG---ACGG--CGCTCCGAATGAAGTGATGGATTTGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATGGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGAAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTT--AATGAATCCTAA-TTATTTTTTG-CCATTTC-A-AAAAAAAA----TGG----A-TAA-TA-----TATTA---TCCATTTGGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAA--------AGAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTGGTTT-------CTT-ATT-------ATGACA---ATT-ATTATCTTGTTTTGACTGTACTGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGGGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTGGC-TCATGATCATGGTTTAATTAGAGCACATTTATTTGAAAATGTAGGGTATGACCATTAATATAGCCTGCTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTTGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTTGATCATGGAAGATATTCCATTTTCTCTACAATCTTTATCTTTCTTAGAAACGGAAGGGGAAGTTAAATGCCGGAATT---------------------------------TTTCAAATTCACAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTGAG-AAATCGTG-AGGG-TTCAGTCCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-CTTTTCTTTATTTATCCTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-GTTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGC--------------------------------GTGGATTCACAAATCC?CTGC-CTTGAGCCC-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAAATATTAA-ATACTAT-CATTAT--------CATTATA----------ATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAA-CCCCCTTGCTAGATTG----------------------GGGTGTTTCTCCT-TT-----TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------CCTAAGAATAGGTC-TTATCC-ATTTGTAGATG-AG-CTTCA-GAGCA---------------------------------------------- Valeriana_arizonica TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGGC-----CCCTCGGGC---CGT--GAC---TCCGAA-GGACGCGGG-AGCGAAAGGACCCC-GCGG----------CCGCA---AACACAAGCCCGGCGCAAACCGCGTCAAGGAACATTATAA-CGGAAGGGG--CACGCTGGCCCGTTTGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGTCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AA-TCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--TCCCC-GTCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGAGC-GGACGATGGCCTCCCGCGCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCTCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGTGG-CGAAT-CGGCCCA--TACGCGTC-GTCC-AC--------------------GAG---ACTG--CGCTCCGAATGAAGTGATCCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTCG-GTTTAAT-----TATGGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAG------CCCTATGG-CTTCCATTAATT-GTA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAA-----TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGGGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT---------------------------------------------------GAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGACTTTCTAACCATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAACA------GAG-GAT----AGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CC------------TTGTTTT-------CTT-ATT-------ATGACA---AAT-AAAATCTTGTTCCGGCTGTATCGCACTATGCATCATTT-GATAACC-CCCCAAATTTTCTCTCTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCAATTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCACATTTGTTGGAAAATGTAAGCTATGACGATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAAGGATTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTACG--------------------------------ACGAATTCAGAGACCCCGTGGAAATAATAAAGATGCGCAAT-CTGAGCCAATTCCGGTATTTGTATTCGAAAAACA----------AGCAAAGC-GTAAAATCA---GAAA-GGATAGGTGCAGAGACTCGACGGAAGCTGTTCTAACAAATAAAGTGGACTGG-TA-----GATAAAAAGAATCCTTCCATAGAAACTACAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATCCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCATTC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGCGTCCCATTCTCCATGCCTATG--------CCGGAT-AC-ATGA-CTT-TAGAGTAAA-GAAAA-TCCG-TC-ACTTGAT-CTGGCGCTGAGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAACC-ATAT-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTT-CTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCCATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCCGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC-CGCGCATGGTGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTT-----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAAA--------GGAG-AAAT-----------AAAG-CCCCCTAGCTAGACT----------------CAGGG--GGGA-TTTTTTCT--------CCCTTTTTTTT--CTTTT-T---------------TCACAAA-----CTCATATAC--------------ACTAAGAACAGGTT-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTCATGCATAACT Valeriana_asarifolia TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAATA-CTGCGGAGCCCCGG------CCCCTCGGG--TCGT--GAC---TCCGAA-GGACGCGGG-CCGTAAGGACCCC--GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATTATAA-CGGAAGGGG--CGCGCTGGCCCGTTCGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGCCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGCGGAC-GATGGCTTCCCGCGCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--ACT---AAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGTGG-CGTAT-TGACCCA--CACGCGCT-GTCC-A-----------------------CGAGACTG--CGCTCCG-??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--TTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTTCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCCGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAACC-ATAT-------GG----------ACTCCCCAATTCTTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Valeriana_barbareifolia TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-TCACGGTGCCTCGG------CCCTCGGGC---TGC--GGC---TCCGTA-GGACGCGGG-ACCGCAAGGACCCC-GCGA----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGA-AA-CGTAAGGGG--CGCGCTTTCCCGTCAGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGCCGACCC-TCGGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCTC-GCCAC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGTCCAC-ATC------GGGCGCGGCTGGCCCA-AAACTC--GGTCCCCCGACGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CTCGTCCTT-CGGGTGG-CGATT-CGACCCT--GTTGCGCT-GTCT-A---------------------GAG---ACAG--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCGACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGAAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTG-AATGAATCCTAA-TTATTTTTTG-CCATTT--TTTAAAAC------TGG----A-TAA-TA-----TATTA---TCCAGTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGCATCTA-TTTGTTT-------CTT-ATT-------ATGACC---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTAAAATTCTCG-ACTCTTCA-AATGGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGACTATATTTATGCACTTGC-TCATGATCATG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACCGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATCCTCAGTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCA-TG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAGTCCC-TCTA-TCCCCAAAACACCC-ATAT-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCGTATT----TGAATAATTTATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGAATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAATTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC-----------GAATTCCCAAATCC?CTGC-CTTGAGCCC-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA------AAAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCA-----------------AGGG-GGAGATTTTTTCT-CC-----TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTT----------- Valeriana_bracteata TCGATGCCTGCATGCGCAGAA-CAACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCTGA------CCCTCGGGT---CGT--GGC---TTCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCACTGACCCGTTTGGCCCGTTCGCGGTGCCGGTCG---GTCGAGCGCCAACCC-TCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAAGCATTAAGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC---CTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCTCCCCG-GGCTCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCAACGGACGTCTCGGCGAGTGGTGGTTG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-TCCTCCTTC-CGG-TGG-CGAAT-CGACCCA--AACGCGCT-GTCC-TC--------------------AAG---ACGG--CGCTCCCAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTGGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATGTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAAAAAAA-----TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTGGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCAT{CG}ATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGAAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATGCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAAT--------------------TGTAAACCTACTAAGTGATAACTTTGATATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTGGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCGAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATACAGTCCCATTCTACATGCCAATG--------CCGTCA-ACAATGATATT-TAGAGTAAGAGGAATATCCG-TCGACTTCAG-AAATCGTG-ACGG-TTCAAGTCCCTCTA-TCCCCAACAAACCC-ATAC-------GG----------ACTCCTCAATCATATATC-----------------CTTCT-CTTATCATT-------ACCGTAGTCAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAGA-AT-GTTTTTTTTCTTATC----ACAAGTCTTATGATATAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGACTAATTCATGATGAATATCATTAC------TCATACTGAGACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATCAATT---ACCGTATGAGGATAACACTTTGTAATACCCCTTCAGTTGACATACACCCGAGTTATCTCGCAGAATGAGAATGCAGCGGTGGCCATGGTCGGCAAGTTCA------TGGGTGAATTCACAAATCCACTG?-CCTGAGCCA-CTTGACTAC-TCCGCCCCCACGCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTTCACATTTTCATTATA----------ATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCT-GCTAGATTGGTCAAG----------------GGGGGTTTCTAC---------TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATACACTAAGAC------ACTAAGAATAGGTC-TTATCC-ATT-GTAGA-GGAG-CTGTA-GAGCAGCTAAGTGTAGAGGGAGAATATGAGC-ATTACGTT----------- Valeriana_bryophilla TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACGAGTTAAAAA-TCGCGGTGCCTCGG------CCCTCGGGC---TGC--GGC---TCCGAA-AGACGCGGG-ACCGTCAGGACCCC-GCGA----------CCGCA---AACACAACCCCGGCGCTAACCGCGTCAAGGAACATGAAAA-GGGAGGGGG--CGCGCT-GCCCGTTTGGCCCGTTCGCGGTGCCGGTCG---GGCGAGCGCCAGCCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCC-GTGCA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--TCTC--GCCTC--TCCCTCA-TCGGGA-AGCGGCGGGG-GGC-GGGGGGGAT-GGACTATGGGCTCCCGCCCCCCC-ATC------GGGTGGGGGTGGGCGG-AATGAC--TGTAACGCGGCGGCGGGAGGGAGGACGAGTGGGGGAGG--ATG---AGTGA-TCT--GTTCGTGTGGTGGCGCTG-CGGGACTCT-CCGGCGG-TGAAG-GGGCGAG--AAGAGCTG-TAC--AC--------------------GAG---ACGG--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAATTGAATGAATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATTATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAAAAA-------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GGA--GATAAACCA------TAAAAAAA--------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATGGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTACATAGACCACATTTATTGCAAAATGAGGGCTATGACAATAAATATAGCTTACTAGTCGTGAAACGTTTAATTACTCAAA---------------------------------------CCAACCAAATTTCATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAATCGAAAGGGAGAGTCAAATCGCGTAATTTA---TTAGTATGAAA?CCTACTAAGTGAGAACTTTCACATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATTTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATCCTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAC-AAATCGT{GT}-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGAATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAATTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC-------GTGGAGATTCACAAATCC?CTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAAGG------------------GGGGGATTTTTTCTACTT------TTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTAGCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTTTA-------- Valeriana_bulbosa TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CTGCGGAGCACCGG------CCCCCGGCC----GT--GGT---TCCGAG-GGATGCGGG-ACCGCAAGGACCTC-GCGT----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-TGGAAGGGG--CGCGCTGGCCTGTTCGGCCCGTTTGCGGTGCCGGTCG---GGGGAGCGTCAGCCCCTCT-ATAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAG-CCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCCC--GCCCTCA-TCGGGG-TGCGGCGTGC-GGC-TGGGGGTGC-GGACGATGGCCTCCCGCGTTCCG-ATC------GGGTGCGGCTGGCCCA-AAACAG--TGTTACCCGGCGGCGGACGTCACGGCGAGTGGTGGTTG--AAT---AAGCCCTCT--GTTCGCGCCGGGGCCCTT-CCCGCCTTC-CGGGGGG-CGAAA-CGACCCA--GAAGCGCAAGTCC-AC--------------------GAG---GCGG--CGCTCGAAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAATGGAGT------AAAGCGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTAAAAA-TTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACAAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCAT----AAAAAAAA------TGG----A-GAA-TA-----TATTC---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GAT?AACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATATATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTTATGGAAAATGTAGTGTATGACAATAAATATAGCTTACTAGTTGTGAAACGGTTAATTACTCGAA---------------------------------------CTACCCAAAATTTCTTTTTGGGGCGCCATAAGGGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATCTTCTCTCCGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATGAAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGAAAT-AATAAAAATGGGCAT--CTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCAATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCA-TG--------CCGGCA-ACAATG-AAT--TAGAGTACGAGAAATCTCGC-TTGATCTGGG-AAATCGCG-AGGG-GTCAAGTCCCTCTA-TCCCCAAACAACCC-ATAT-------GG----------ACTCCC-A-ATATTTAGC-----------------CTTTT-C-TATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGAGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCGGT-GACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGGGGGAAAGGTCGGGATAGCTC----------------------------GC-CCTGACCCC-CTGGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATCTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CA-GAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAAAA--------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCA----------------------GGGGGTTTCTAC---------TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAGGAGCAGCTAAGTCTAGAGGGAAATTATGAGG-ATTAT-------------- Valeriana_californica TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGGC-----CCCTCGGGC---CGT--GAC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATTATAA-CGGAAGGGG--CGCGCTGGCCCGTACGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGTCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCC-GTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTGGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGT-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGTGGC-GAAT-CGACCCA--TACGCGCT-GTCC-AC--------------------GAG---ACCG--CGCTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTCA-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGT{CT}GAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-{AG}GGAAAGAAAAAGCAC-CGACC-TTCTGT--TCTAAA------TAA-GAATGATT-CCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG----------------------------------------------------CCATTTTGAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAATA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGACTTTCTAACCATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAAC-------AGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCAA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGAGA---AAA-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACT-CCCCAAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAACGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAATCAAAATGCATTTTGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCCGAAGGATTTTCGATCATTGTAGAAATTCCATTTTCTCTAGAATTCTTATCTTTCTTCGAATCGAAAGGGAGAGTCAAATCGGGGAATTTA---TTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTG-AATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCG-TGAGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACC--ATAT-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAACATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCCATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC--CGCGGCAGGGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAG-----------AAAG-CCCC---CCTAGACTTA-GA----------CTCAGG--GGGGATTTTT---GCTCCCCTTTTTTT-------CTTTT-T---------------TCACAAA-----CTCATATAC--------------ACTAAGAACAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGAAAATTATGAGC-ATTACGTTCTATTTAACA- Valeriana_candolleana TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-TCGCGGTGCCCCGG------CCCTCGGGC---CGT--GGC---ACCGAA-GGACGCAGA-ACCGTAAGGATCC--GCGA----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATAACAA-CGAAAGGGG--CGTGCTGGCCCGATAGGCCCGTTCGCGGTGCCGGTCG---GGCTAGCGCTAACCCTTCTGAGAATAA--CACAA-ACGACTCTCGGCAACAGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAG-CCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCACA-TCGGGG-AGCG-CGTGC-GGC-AGGGGGCGC-GGAAGCTGGCCTCCCGCGCCCTC-ATC------GGGTGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGCGG-CGATT-CGACCCT--TACGCGCT-GTCC-AC--------------------GAG---ATGG--CGTTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTG--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATGAATT-TTA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA-----ATTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAA-AAAA-----TGG----A------------TATTA---TCCATTTTGAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAAAA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGCTTTCTAACCATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCAA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCCCAAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAGCTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTACCCAAAATGCATTTTGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAATCGAAAGGGAGAGTCAAATCGCGTAATTTA---TTAGTATGAAA?CCTACTAAGTGAGAACTTCAAATTTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTCCTATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGTGTT-----GCTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAT---ATAGATAT------------------ATGCATTGAAATATTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAACTCATTCCCTCCAT---AGTCTGATAGA-C-TCTTGAAGATC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCTATG--------TTGACATAGACCCGAGTT-TAGAGTAAGAGGAAAATCCG--CGACTTTAG-AAATCGTG-AGGG-TTCGAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCGCCCT------ACTCTTTTACAAA-GAGATCCGAGGGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGAATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGGGGGAATGGTCGGGATAGCTC---CCCATTGGAGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAAA------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAAGG-------------------GGGAATTTTTTCTACTT------TTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CT-CAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTT----------- Valeriana_celtica TCGAAGCCTGCAAGCGCAGAA-CGACCC-GCGAACACGTTCACAC-GCTCGGAGCTCCGG------CCCACCGGC---CGG--CGT---TCCGAA-GGACGCGGG-ACCGTTCGGCCCC--GCGT----------CCACA---A-CCCAACCCCGGCGCAAACCGCGTCAAGGAACATGATAA-CGGAAGGAA--CGCGTTAGCCCGTCCGGCCCGTTCGCGGAGCTG-CCG---GGCGAGCGCG--CCCCTCTAAGAAAAA--CACAA-CCGACTCTCGGCACGGAATATCTCGGCTCTAGCATCAATGAAGAAGGTAGCGAAATGCGATACTTGGTGTGAATAGCAG----------------GATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGT-GCGCCCGAAGCCACTAG-CCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--GCCCC-GCCTC--CCTCCAA---------GGGGCGCTC-GGC-GAGGGGCGC-GGAAGATGGCCTCCCGCGGCCTC-A-C------GGACGCGGCTGGCCCA-AAACCC--TGTCCCCCGGCAGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--CTTCGCGCCGTGGCAATG-CCCGTCTTC-CGGGCGG-CGAAA-CGACCTA----------------------------------------------------------ATGAAGTGAGGGATTCGTCCATACCATCGGTAAAGTTTGGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTGAGAATATTTG--------ATTTTTTCCGGATCAGTATAAAAA--------CTTG--TTTAAT-----TA-TGAAACGGAGT------AAAGTGAATTCATTCAATTTAAAGTTGGGTCGAATGAATAAATGGATAGAGATAGAGCC-TATGG-CTTCGATTA-TT-ATA-GGAAGAAAGAAAGCA--CGAGC-TTCTGT--TCTTAAT------TA-GAATGATTTCC-GATCGATTTC----GTTAAAAGT--ATTAG-TG-CCTGAGACGG--AAGG--CTTTCCACGAGTGAATTCTTTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTCT-TTATATATATTATATAA----A-TAA-TA--------TATGATTCATTTTGGAATGGAGACGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAA-TC-----AAAAGAGCGGTTGGGTTGAAAAAATAAAGGGTTTCTAATCACCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAC-------AGAGGA----TAGAGAG-TCT-GTTG-ATAAG-TCTC--CTTAGAT-CCGA-GGTATCTA-TTTGTTTCTTATTTCTT-ATT-------AAGACA---AAG-AATATCTTGTTTTGACTGTATCGCACTATGTATCATTT-AATAACC-CCCAAAATCCTCT-ACTCTTCA-AATCGAA-TTGAAATGGAGGAATTCCCAAGATATTTAAAGATAGATGGGTCTCAACAACACT-ACTTCTTATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTG?TGGAAAATGTAGG-TATGACAATAAATATAGCTTACTAG?TG?GAAACG?TTAATTACTCGAA---------------------------------------TGTATCAAAA-GAATC-------------------------------------------------------------------------------------------------------------------------------------TTGGTATGGAAC-TTACTAAGTGAGAACTTTCAA-TTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATAAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGACTGTGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGATAAACCTATAAAC---AGGGATAT------------------ACGCATTGAAATACTATAGACT-CGACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGGT-TGTGAAGTAATTCCATATTGAAGAAAGTATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATCCTTTTGAAGAAT----GGATTA-ATCGCACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA--CCCGTAT-------GG----------ACTCCCTAATTATTTATC-----------------CTTTC-CTTATTATG-CTTTGTAGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTGTTTTACAAA-GAGATCCGAGTGAAA-AT-G--TTTTTTCTTATC----ACAAGTCTTGTGATCTAAGATAATA-CGTGTACAAATGAGCATCTTTACGT-AAGGAATCCC-------------GATTCATGATGAATATAATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAAGAAATT---ACCGGATCAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGCGGGAATGGTCGGGATAGCTC---------GTGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCG-GCTAGGA-CTATTATTTA-GAT-----------ATTTATGACTGTTCTTT----------------------CAAGAACATATGTCA-GTCAA--------AGACTATTCAAATT--------CATT------------CAAGAAAAAA---------ATAA---------AAAA-GGAGCA-------------GCCCCCATGATAGACCA---A--------------GA--GGGGATTTTT---GCTCC-TTTTTTAT---------TTT-T---------------TCAAAAAC----TC-ATATAC--------------ACTAAGAACAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAGACGTAGCTAG---TAG----------------------------------- Valeriana_ceratophyla TCGATGCCTGCATGCGCAGAA-CGACCT-GCGAACACGTTCAAAA-CTGCGGTG-CCCGG------CCCTCGGGC---TGT--GGC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGATAA-CGGAAGGGG--CGCGTTGGCCCTTTTGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGTGAGCCCATCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATAAAAAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCT-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGGTGGCCTCCCGCGCCCTC-ATC------GGGCGCGGCTGGCCCA-AAACAC--TGTCCCCCGGAGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGTGCCGTGGCCCTC-CCCGTCTTT-CGGGCGG-CGAAT-CGACCCA--GATCGCGCGGTCC-AT--------------------GAG---ACGG--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCGACTGATCCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCGACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTTTAATGAATCCTAA-TTATTTTTTG-CCATTTT-TAAAAAA-------TGG----A-TAA-TA-----TAGTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAA--------GAG-GAT---TAGGGAG-TCT-GTTG-ATAAG-TCCTA-CTTAAAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTATCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTAGAAACGAAAGGGGAGAGTCAAATCGCGGAATTTAC--TTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCGACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT--ATATTAGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC--CGCGCATGGGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCA-----------------AGG-GGAGGTTTTTTCTCCTT------TTTT--------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTTCATGCATACA Valeriana_chaerophylla TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCCGG------C----------------------TCCGAA-GGACGCGGG-ACCTCAAAGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAGACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCCCGCCCGTCAGGCCCGTTCGCGGTGCCGGTCG---GTCGGGCGCCGACCCCTCTGATAAATAATCACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCG-TCTCC--CCCTTCT-TCGGGG--GAGCCGTGA-GGC-GGGGGGCGC-GGACGATGGCCTCCCG-CTCCCG-AAC------GGGCGCGGCTGGCCCA-AAACAC--GGTGCCCCCGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGTGGCACGT-CCCGTCCTC-CGG-CGG-CGAAT-CGACCTT---ACGCGCG-GTCC-AA--------------------GAG---ACGG--CGCTGTGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCGGTATTAAAA--------CTTG-GTTTAAT-----TAGTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCTGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTC-CCATTT--TTTTTAA-------TGG----A-TAA-TA-----TATTA---TCCAGTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTATTTTGTTAT-CTTATAAT-ATAACGAAGAGCCA------TAAAAAAAA-----AAGAG-GAT---TAGAGAG-TCT-GGTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------CTGACA---AAA-AATATCTGGTTTTGACTGTACCGTA-TATGCATCATTT-GATAACC-CCT-GAATTTCTA-GCTCTTCA-AATT-GAATTCAAATGGAGGAATTCCAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTTTCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTCACCAAAATACATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCACTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGCACTTA---TTAGTATCGAAACCTACTAAGTGAGAACTTTCAAATTCAACGAACCCCTGCAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA------AACACACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGCAGCTGTTCTAACAAATACAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCTATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CGACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGCAAAATGCT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAACAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCTTC-TACATGCCAATG--------CAGGCA-ACAATGAAATT-TAGAGTAGCAGGA-AATACG-TCAACTAAAC-AATTCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAC-TAATAC-------GG----------ACTCC-CCATTCTTTATC-----------------CTTTT-CTTATTTTA------TCGCAGTATT-----------CTTTCTCACTCACCCG------ACTCTTCTACAAA-GAGATCCGAGTGTAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATTATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAAGAATCCTATT-----TGCATAATTCATGATAATATACATTAT------TCATCCTGAAACTTA--CAAAGTGCTT-CTTCTGAAGATCCAATCAATC---ACCGGATTAGTATAAGCCTTTGTAATACCCTCTCAGTTGGGCTAGCGCCCAGTTATCACGCAAAT--AAAATGCGGCGGGGGAGGTGCGCAT---------CGCGCATCGTGGATTCACAAATCCACTGC-CTTGATCCA-CTTGGCTA{CG}ATCCGCCC-AA-GA{CG}AAG------TATGTA-GATTACTAA-A-AGATTTTTGGTTTTTCTTT----------------------AAA----TTAAACAA-AATAT--------GTAA-GTAACAT------------------------------AACAAA----------------------GGAG-CAAT-----------AGCG-CCCTCTTGCTAGAACAAGAAA------------------GGGATTATTGC--TCC----TTTGC-------TTATTTAG--------------TTTTTTAA-----CTCGTATAC--------------ACTAAAGCCCGGTC-TTATCC-ATTTGTAGATGGAG-CTTCA-GAGCAGCTAGGTTCAGAGGGAGGTGATGAGC-AGTACGTTCATGCATAAC- Valeriana_clematis TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGATCCCCGG------TCCTCGGGC---CGT--GGC---TCTGAA-GGATGCGGG-ACCTTTAGGTTCCC-GTGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CAGAAGGGG--CGTGCTGGCACGTTTGGCCCGTTCGCGGTGCCGGACT---GGCGAGCTCCAACCCCTCTGAGAAAAA--CACAA-ACGACT-TCGGAAACGGATATTTCGGCTCTTGCATCGATGAAGAACGTAGGAAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCATCGCCCCCC--TCCCC-ACCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC--GGGGGCGC-GGACGATGGCCTCCCGCGTCCTC-ATC------GGGCGCGGTTGGCCCA-AAACAC--GGTCCCCCGACGGCAGGCGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGCCTCTC-CCCGTCTTT-CGGGCGG-CGAAT-CGACCCA--GACGCGCT-GTCT-AC--------------------GAG---ACAG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCTTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAC-CGAGC-TTCTGT--TCTTAA------TAA-GAATGATTTCCCCATCTAATAATAG-GTTAAAAATTTATTAG-TG-CCTGATACCGGAAGGGGTTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATT-A-AAAA-AAAA-----TGG----A-TAA-TA-----TATTC---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTT-GTTAT-CTTATA-C-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCTTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGT-CCGCACTATGTATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTTAAATTCAAATGGAGGAATTTAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGAGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATGGAACCTTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAAAAACCTATAAAT---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAA-TCCG-TTGATTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------CGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-GTTTTTTTTCTTATC----ACAAGTCTTATGATCTCAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAACGGTGGGAATGGTCGGGATAGCTC-GGGGGCAGGTGGATTCACAAATCCACTGC-CTTGAGCCC-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GAAAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------AGGAGAAAT-----------AAAG-CCCCCTTGCTAGACCA-----------------AGGG-GGGG-TTTCTCC---------TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-------------------- Valeriana_coartata TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-TTGCGGAGCCCCAG------CCCTCGGGC---CGT--TGC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GTGG----------CCGCA---AACACAACACCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAATGGG--TGCGCTGGCCCGTTTGGCCCGTTCGCGGTGCCGG-------GCGAGCGCCATCCCTCTGAAGATTAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCTCCC-TCCCC-GCCTC--CCTCTCA-TCGGGG-CACGGCGTGC-GGC-GGGGGGCGC-GGATAATGGCCTCCCGTGCCTCT-ATC------GGTG-CGGCTGGCATA-AAACAC--GGTCCCCCGGCGGAGGACGTCACGGCGAGTGGTGGTCG--AAA---AAGCCCTCT--GTTCACGCCGTGGCCCTC-TCTGCCTTT-CGGGTGG-CGAAT-CGACCCA--GACGCGCG-GTCC-AC--------------------GAG---ACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCCGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAC-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGGAAGGGTTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCAA-----AAAAAAAA-----TGG----AGTAA-TA-----TATTC---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATACCC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ATTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTGTTTTGGGGGCGCCAGAAGAGTTTTGATTCTCAAAGGATATCAGAGGCGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATGGAAACCGTCTAAGTGAGAACTTCCAAATTCAGAGAAACCCGGGATTTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGTAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCTAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGGATTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCTT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-GTTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAAATTGAATATAATTATTCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATAAGAATGCAGCGGTGGGAATGGTCGGGATACCTC------ATGGTGTATTCACAAATCCACTGC-CTTGATCCA-CTTGGCTACATCCGCCCCAA-GAGAAG------TATGTA-GATTACTTACAAAGATTTTTGGTTTATCTTT----------------------AAAA---TTAAACAA-AATAT--------GTAA-GTACCAC------------------------------AACAAA----------------------GGAG-CAAT-----------AGCG-CCTCGTTGCTAGAACAAGAAA------------------GGGATTATTGC--TCC----TTTGT-------TTATTTA----------------TTTTTAA-----CTCGTATAC--------------ACTAAAGCCCGGTC-TTATCC-ATTTGTAGATGGA--CTCAA-GAGCAGCTAGGGTCAGAGGGAGGTTATGAGC-ATTACGTTCATGGCTA--- Valeriana_connata TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CTGCGGAGCACCGG------CCCCCGGCC----GT--GGT---TCCGAG-GGATGCGGG-ACCGCAAGGACCTC-GCGT----------CCGCA---AACACAACCCCGGCGCAAACCGCGATCAGGAACATGACAA-TGGAAGGGG--CGCGCTGGCCTGTTCGGCCCGTTTGCGGTGCCGGTCG---GGGGAGCGTCAGCCC-CTCTATAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGGCTGGGCGTCACGCATCGCGTCGCCCCCCCCTCCCC-GCCCCCGCCCCTCA-TCGGGGT-GCGGCGTGC-GGCTGGGGGGTGC-GGACGATGGCCTCCCGCGTTCCG-ATC------GGGTGCGGCTGGCCCA-AAACAG--TGTTACCCGGCGGCGGACGTCACGGCGAGTGGTGGTTG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGCCTAC-CGGGTGG-CGAAA-CGACCCA--GAAGCGCAAGTCC-AC--------------------GAG---GCGG--CTCTCCGAATGAAGGGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATGGAAACGGAGT-------AAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTACGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAACGATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-GG-GCTGATACGGGAAGGG-TTTT-CCACGAGG-AATTCTCCATTTTTT--ATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAAAAAAA-----TGG----A-GAA-TA-----TATTA---TCCATTTTGGAAAGGAGATGTGGGTCTAAA-GAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGT-GAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GT-G-ATAAG-TCCTA-CTTAGAT-CCGA-GG-ATCTA-TTTTTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACGGGACCGCACTATGCATCATTT-GATAACC-CCTCCCATTCTCG-ACTCTTCA-AATGAAAATCTAAG-GGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCTCTTATCTTTTAGGAGTATATTAATGC-CCTGC-TCATGATCATGGTTTAAATAGAGCCCATTTATTGGAAAATGTGGGGTATGAAAATAAATATAGCTTGCTAGTGGTGAACCGTTTATTTACTCGAA---------------------------------------CTAACCAAAATTTATTTGGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATGGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATGGAAACCTACTAAGTGAGAACTTCAGAATTCAGAGAAGCCCTGGAATTAATAAAAATGGGCAATC?TGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------A{AG}CAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCAATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTTGTGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATG-AAT--TAGAGTAAGAGGAAAATCCG-TCGACTTTTG-AAGTCCTG-AGGG-TTCAAGTCCCTCTA-TCCCCAACAAAGCC-ATAT-------GG----------ACTCCCTCATTACCTAGC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC--------------------------CTGC-CCTGAGCCC-CTCGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAAG----------GAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAAG--------------------GGGGGTTTCTCC---------TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATT-GTAGAGGGGGGCTTCAGGAGCAGCTAAGTCTAGAGGGAAATT-------------------------- Valeriana_densiflora TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-TCACGGTGCCTCGG------CCCTCGGGC---TGG--GGC---TCCGAA-GGACGCGGG-ACCGCAAGGTCCCC-GCGA----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGA-AA-CGGAAGGGG--CGCGCTTTCCCGTCAGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGCCGA-CCCTCTGAGAAAAT--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCTC-GCCAC--CCCTCA--TCGGGG-TGCGGCGTGC-GGCAGGGGGGCGC-GGACGATGGCCTCCCGTGCCCAC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGTCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGTGG-CGATT-TGACCCA--GACGCGCT-GTTC-TA--------------------GAG---ACAG--CGTTTCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCGACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTAG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TTTTAAA-------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACC---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATGGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAAGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATCCTCAAAGGATATCAG--------------------------------------------------------------------------------------------TTGAGCCTTACCCGTTACGCGTACTAACTGAGGCCACAGTCCAATTAAGGAAATAGGTGGAAAGGGGCGATCCTGAGGCCAATCCGGTTTTTGTGTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACTAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAATCTTCAGAAAAGAAAGGAGAAACCTATGGGC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCCACTGATTAATGACGAACCGAATTTGGATTATCAACAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATCCTCATTGATCAAATTATTCACTCCTT---AGTCTGATCAATT-CTTTGAAGAAC----TGATTA-ATCGAACGAGAATTAAGATAGAGTCCCATTCTACATGCCAAGG--------CCGGCC-ACAATGAA-TT--AGAGTAAGAG-AA-ATCCG-TCGACTTGAG-AAATCGGGAGGGG-GTGA-GTGCCTGT--TCCCCAAAAAACCC-ATAC-------GG----------ACTCTCCAATTATTTATC-----------------CTTTT-CTTATTATT------TAGCGGAATTAT---------CTTTCTCATTCACCCT------ACTCTTTTCCAAA-GAGACCCGAGGGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TG-GTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATCATGTAAATTA--CCGAATGAGGATCTTTGAAGATCCAATAAATT---ACCGGAGGAGGAGGAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGGGGGAAGGGTCGGGATAGCTC--------------------AATCCCCTTC-C-TGAGCCC-CTGGTATACCTCCGATCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAA----------------GGG--GGGATTTTTTCTACTTTTTTATTTTTT-------TTTTT-T---------------TCAAAAA-----CTCATATAC--------------CCTAAGAATAGGTC-TTAGCC-ATTTGTAGATGGAG-CTTCACGCGCCGCT------------------------------------------- Valeriana_dioica TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGGT-----CCCTCGGAC---CGT--GAC---TCCGA--AGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCACACCGCGTCAAGGAACATTATAA-CGGAAGGGG--CGCGCTGGCCCGTATGGCCCGTTCGCGGTGCCGGCCG---GGTGAGCGCTAACCC-TCTGAGAAAA---CACAA--CGACTC-CGGCACGGTATGTCTCTGGTTTTGCTTGGATTATTAACGTAACGAAATGCGATACT-GGTGTGAATTGCAG----------------AATCC-GTGA------------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGAGTCGCCCCCA--TCCCC-GCCTC--CCCCTCA-CCGGGG-CGCGGCGTGC-GGA-GGGGGGCGC-GGACGATGGCCTCCCG-CGCCCC-ATC------GGGCGCGGCTGGCCTA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---ATGTCCTCT--GTTCACGCCGTGGCCCTC-CCCGTCTCC-CGGGTGG-CGAAT-TGACCCA--TACGCGCC-GTCC-AC--------------------GAG---ACTG--CGCTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTT-GAAGACCGCG-ACTGATCTGGAAAGGAAATGGATAGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTG--------ATT-TTTCCGGATCAGTATT-AAA--------CTTG-GTTTAAT-----TA-TGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAA-----TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAA-TTTATTAT-TG-CCTGATACG-GCAGGG--TTTTTCACGAG?GAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATATT-TTCAAAA-------TGG----A-TAA-TA-------------TCCATTTTGAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGCTTTCGAACCATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAAC-------AGCGGA----TAGAGAG-TC-----------G-TCCTA-CTTAGAT-CCAA-AGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCCAAAATTCTCT-ACTCTTCA-AAATGAAATTCAAATGGAGGAATTC?AAAGATATTTAAAGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCACATTTGTTGGAAAATCTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGAGGCGCCATAAGAATTTTGATTCTCAAAGGATATCAGAAGGATTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAA-TGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACTACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGGT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAACTCCCTCTA-TCCCCAAAAAA-CC-ATAC-------GG----------ACTCCCCAATTAGTTATC-----------------CTTTT-CTTATTATT-------AGCGGAATTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAACATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTGA--CAAAGTCTTT-CTTTTGAAGATCCAGTAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC--------TGTGGATTCACAAATCCACTGC-CTTGAGCCC-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAATGAA-------AGAAAAA--------GGAG-AAAT-----------AAAG-CCCC---CCTAG-------A----------CTCAAG--GGGGATTTTT---GCTCCTTTTTTTTTT------CTTTT-T---------------TCAAAAA-----CTCATATAC---------------CTAAGAACAGGTC-TTATCC-ATT-GTAGATGA---CTTCAAGAGCAGCTAGTCAGAAGGGAAAATTATGAGA-TTTAGGTTTCTGG------ Valeriana_edulis TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CCGCGGAGTCC-GG------CCCTCGGGC---CGC--GGC---TCCGAA-GGACGCGGGGACCGTGAGGAAACC-GCGT----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CACGCTGGCCCGTTCGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGACAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCC-GTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GTCTC--CCCCTTA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGTCCCC-ATC------GGACGCGGCTGGCCTA-AAACAC--GGTCCCCTGGAGGCGGACGTCACGGCGAGTGGTGGTCG--AGT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGCGG-CGAAT-CGACCCA--GACGTGCT-GTCC-AC--------------------GAG---ACGG--TGCTCCGAATGAGGGGAGG-ATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATT-TTTCCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTGATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCT------------------A-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGGGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTA-AAAAAAAAA-----TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAA--------AGAGGAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GACAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-TCTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCGCATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCCGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAAGGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATGGAACC-TACTAAGTGAGA-CTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAACCA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT------------------GAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTT-AGGG-TTCAAGTCCCTCTA-TCCCC-CAAAACC--ATATGGACTACGG----------ACTCCCCAATTATTTATA------------------TTTTTCTTATTATT-------AACGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTT-------GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATATAAGATAATA-TATGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAAT-CAGGATGAATATCATT--------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGACAATGCAGCGGTGGGAATGGTCGGGATAGCTC----------GGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAAA------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGA-----------------CCAAGG--GGGGATTTTT-CTACTTTTTT-------------ATTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGTAG-CTTCAAGAGCAGCTGAGTCTAGAGGGAAATTATGAGG-ATTACG------------- Valeriana_fauriei TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCCGGC-----CCCTCGGGC---CGC--GAC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATTACAA-CGGAAGGGG--CGCGCTGGCCCGTTCGGCCCGTTCGCGGTGCCGACCG---GGCGAGCGCCGACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCA-CGGATATGTCGGTTCTCGCAT?CATGAA?AA?GAACC??AATGCG{CT}T?CTTGATG?GAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGT?ACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--TGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AA----AAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGCGG-CGAAT-CGACCCA--TACGCGCC-GTCT-AC--------------------GAG---ACGG--CGCTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTT--------ATT-TTTCCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-AAG-GG-AAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAATCTTAATTA-GAATGATT-CCCGATCTAATAATAA-CGTTAAAATTTTTTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TTCAAAA-------TGA----A-TAA-TA-------------TCCATTTTGAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAA-CA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGACTTTCTAACTATCTTGTTTTGTTAT-CTTATAACTGAA--GATAAACC-------TAAAA-AAC-------AGAGGA----TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCAA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGGCTGTACCGCACTATGCATCATTTTGATAACC-CCA-AAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGGCAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAAGGATTTTCGATCATTGTAGAAATTCCATTTGCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA--------ATGGA{AC}CC?TACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAACACA----------GGCTCAGG-CTAAAATCGA--TAAG--GATAGGTGCAGAGACTCAC-G-AAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAA-TCCG-TCGACTTTAG-AAATCGTT-AGGG-TTCGAGTCCCTC{AT}A-TCCCCT??TA{CT}-CC-ATA?-------GG------------AC?-CC-CCATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAACATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGGTCCAATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC--GGGGGCAGGGGATTCACAAATCC?CTGC-CTTGAGCC?-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATTTCATTAT--AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCC---CCTAGA-----------------CTCAGG--GGAAATTTTT---TCTCCTTTTTTTTTT------CTTTG-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAACAGGTCTTTATCCCATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGG{AT}ATTTTATGAGC-ATTACGTTCTATTTAACA- Valeriana_flaccidis TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGGC-----CCCTCGGGC---CGC--GAC---TCCGAA-GGACGCGGG-GCCGAAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATTATAA-CGGAAGGGG--CGCGCTGGCCTGTTCGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGCCGACCCCTCTGAGAAAAG--CACAA-ACGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTATCGAAATGCTATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCGGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGT-GGC-GGGGGGTGC-GGACGATGGCCTCCCGCTCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AATAATAAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGTGG-CGAAT-CGACCCA--TGCGCGCT-GTCC-AC--------------------GAG---ACCG--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATT-TTTCCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTG-AATGAATCCTAA-TTATTTTTTG-CCATTTC-CAAAAAA-------TGG----A-GAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAATCA------TAAAAAAA---------GAGGAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATTATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGCAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCCAAGGATATCAGAAGGGTTTTCGATCATTGAAGAAAATCCATTTTCTCTACAATTTTT?TC?TTCTTA?AACCGAAAGGGAAAGTCAAATCCCGGAATTT?---TTAGTATGAAAC-GTAGTAAGTGAGAACTTTCAAATTCAGAGAAACCGTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAG-ACA----------AACAAAGG-CTAAAATAAA--AAAA-GGATAGGTGCAGAGGCTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATATAAACTTCAGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TTATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ATAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AA?TCGT?-AGGG-TTCGAGTCCCTCTA-TCCCC????AC-CC-ATA?-------GG----------AC?CCCC?-ATTTTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGA-AATA-CGTGTACAAATGAACATCTTTACGT-AAGGAATCCCTATT-----------TGAATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCTTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC-GGGGGCAGGTGGATTCACAAATCCAATGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTGAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAA----------GGAG-AAAT-----------AAAG-CCCCC----TAGA-----------------CTCAGG--GGGGCTTTTT---TCCCCTTTTTTT-CT------TCTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAACAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGCCATTACGTTCAT-------- Valeriana_gallinae TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTGAAAA-TCACGGTGCCTCGG------CCCTCGGGC---TGC--GGC---TCCGAA-GGACGCGGG-ACCGCAACGACCCC-GCGA----------CCGCA---AACACAACTCCGGCGCAAACCGCGTCAAGGAACTTGA-AA-CGGAAGGGG--CGCGCTTTCCCGTCAGGCCCGTTCGCGGTGCCTGCCG---GGCGAGCCCCGACCC-TCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCTTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCTC-GCCAC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-AGGGGGCGC-GGACGATGGCCTCCCGCGCCCAC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGACGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCCTT-CGGGTGG-CGATT-CGACCCA--GACGCGCT-GTTC-TA--------------------GAG---ACAG--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-TCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTTAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTTAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-AAAA--AA------TGG----A-TAA-TA-----TTTTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAA-AAA-------AGAGGAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATGGAAATTCAATGGAGGAAATCCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTACCCAAAATGTATTTT----------------------------------------------------------------------------------------------------------------------------------------ATGGAAACCTACTCAGTGAGAACTATCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCC---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAACGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATTTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATCCTCATTGATTCAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCATTCCTACATGCCAATG--------CCGGCC-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAGTTCC-TCTA-TCCCCAAAAA--CCCATAC-------GG----------ACTCCCCAATTATT-ATC-----------------CTTCT-CTTATTATT-------AGCGGAATTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCAT-----------------------------------CATGTAAATT---ACCGAATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAATTATCTAGCACAATGAGAATGCAGCG-TGGGAATG-TCGGGATAGCTC-----CATGTGGCCTTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAAA------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGAC-----------------CAAGG--GGGGATTTTTTCT-------------A-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTAGCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGGTTT--------- Valeriana_henrici TCGATGCCTGCATGCGCAGAA-CGACCT-GTGAACACGTTTAAAA-CCGTGGAGCCCTGG------CCCTCGGGC---CGT--GGC---TCCGAA-GGACGCAGG-ACCGTAAGGACCCT-GTGG----------CCTCG---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-TGGAAGGGG--CGTGCTTGCCCGTTTGGCCCGTTTGCGGTGCCGAGCG---AGC-AGC----ACCCCCCTGAAGATAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGCGAA-----------------CCA-TCGAGCTTTTGAACGCAAGTTGCGCCC-AAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGTGTCGCCCCCCC-TCCCC-GTCTC--CCCTTCA-TCGGGG-CACGGGGTGC-GGG-GGGGGGTGC-GGATAATGGCCTCCCGCGGCTCT-ATC------GGAG-CGGCTGGCCTA-AAACAC--GGTCCCCCGGGGGAGTATGTCAGGGCGAGGGGGGGTCG--AAT---AAGCCCTCT--CTTCACGCCGTGGCCCTC-TCTGTCTTC-TTGGTGG-CAAAT-CGACCCA--GACGCGCG-GTCC-AC--------------------GAG---ACAG--CGCTCCGACTGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAGCAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCCATATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCC-TATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT--ATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAAAAA-------AAAGGGGA-GAC-TA-----TATTA---TCCATTTGGGAAGGGGGAAGGGGGTCTAAAAGAAAC-AGTATATG-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTAAGGTGGAAAAAATAAAGGGTTTCTAACCATCT-GTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTCCCGCCCTATGCATCATCT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCCCT-ATTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTGTTTTGGGGGCGCCAGAAGAGTTTTGATTCTCAAAGGATATCAGAGGTGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATGGAAAC?TACTAAGTGAGAACTGTCGAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCTAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCA-TG--------CCGGCA-ACAATG-AAT--TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCTT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-GTTTTTTTTCTTATC----CCAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATGAATATCATTATTCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATAAGAATGCAGCGGGGGGAATGGTCGGGATAGCTC-------------------------TCTCC-TCTGACCCCTCTTGGCTACATCCGCCCC-A-GCGAG-A-CTCTTATTTA-GATTAATCA-ATCTATTTCGGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAGGGGATTATTCAGATCAGAC--TAGAACTCCTATA-TT-----TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAG-AGCAGCTAAGTCTAGAGGGAAATTATGAGG-ATTTTGGGTTTACAAA--- Valeriana_hirtella TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGTGCCCCGG------CCCTTGGGC---CGT--GGC---TCCGAA-TGACGCGGG-ACCGTTAGGACCCC-GCTT----------CTGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAAGGG--CGCGCTGGCCCGTTCGGCCCGTTTGCGGTGCCGGACT---TGCGAGCGTTAACCCCTCTGAGAAATA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGGCCA-----------------CCAATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAG-CCGAGG-CACGCCTGCCTGGGCGTCACGCATCGTGTCGCCCCCCC-TCCCT-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGTGC-GGATAATGGCTCCCCGCGCCCCC-ATC------GGGCGCGGCTGGCCTA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTTG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGTGG-CGAAT-CGACCCA--GATGCGCG-GTTC-AC--------------------AAG---ACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAGCAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTTTCCGGATCCATATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCAGTAATTA-ATA-GGGAAAGGAAAAGCCA-AGAGC-TTCTGT--TCTTAA-------TA-GAATGATTTCCCGATCTAATAATAA-GGTAAAAATTGGTTAG-AGGCCCGATACGGGAAGGGGTTTTTCCACGAGGGAATTCTCCATTTTTTTAATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAAAAAAAAA---GGG----A-GAC-TA-----TATTA---TCCATTTGGGAAGGGAGATGGGGGTCTAAAAGAAAC-AGAATATG-GATAATAACT-TTTCCAAAATC-----AAAAGCGCGGTAAGGTGGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TGT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTATTT-GTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAAGGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACGGCACT-ATTTCTTGTATCCTCTTATCTTTCGGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAGTATGAA-AACTACTAAGTGAGAGCTGTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA--CA-TG-AATG-TAGAGTAAGAGGAAAATCCG-TCG-CCTTAGGAAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT--TTATTAGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-GTGTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGGGGGAATGGTCGGGATAGCTC--------------------AATCCCCTGC-CTTGAGCCC-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAAGG-------------------GGGGGTTTCTCC---------TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTT?TAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTAGGGAG-ATTA--------------- Valeriana_interupta TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTATAA-CTGCGGAGCACCGG------CCCTTGGGC---TGT--GGC---TCCGAA-GGACGCGGG-ACCTTTAGGACCCC-GCGG----------CCGCA----ACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGTGTCGGCCCGTTCGGCCCGTTCGCGGTGCCGGCCG---GGC-AGCGCCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TC-CT-CGCGC--CCCCTGA-ATGGGTTCGCGGCGTGT-GGC-GGGGGGAGC-GGACGATGGCCTCCCGCGCCCCC-ATC------GGTCGCGGCTGGCCTA-AAACTA--TGTCCCCCGGCGGCGGACGTCACGGCGAGGGGTGGTCG--AAT---AAGCCCTTC--TGTCGCGCCGGGTCCCTC-CCCGTCTTC-CGGGCGG-CGAAT-CGACCCA--AATGGGGG-GTCC-TA--------------------GAG---ACGG--GGCTCGCAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAA-TGGATAGAGATAGAGCC-TATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-CG-GCTGATACGGCAGGGA-TTTT-CCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCAT----AAAAAAA-------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTT-GTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCCTCAATTCTCG-ACTCTTCA-AATTGAAATTTCAATGGAGGAATTCAAAAGATATTTTAAAGATAG?GGGTCTGAACAGCACT-ACTTCTGGTATCCACTTATCTTTTCAGAGTATATTTATGCACTTGC-TCATGATCATGGTTTATATAGAGCACATTTATTTGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTATTCGAA---------------------------------------CTAAACAAAATGTATTTTGGGGGCGCCATTAGAGGTTTTATTCT---------------------------------------------------------------------------------------------------------TTAGTATGAAAAC?TACTAAGTGAGAACGTTCAGATTCAGAGAAACCCTGGAATTAATAAAATGGGGCA-TCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGA-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACCATAGACT-CTACCA-CCGATTAACGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAACGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCCCTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCCTTCTAC-TGCCATTG--------CCGGCA--CA-TG-AAT--TAGAGTAAGAG-AAAATCCG-TCGCCTTAGG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACC--ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATTTTATTATAGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCGTTTACAAA-GAGATCCGAGGGAAA-AT-GTTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATGGGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGGGGGAATGGGCGGGATAGCTC-----------------CCCAATCCCCCTT-CCTGAGCCC-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAA-----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAAGG-------------------GGGGGTTTCTCC---T-----TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATT-GTAGATGGAG-CTTCAG-AGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTAAGGTTTC-------- Valeriana_kawakamii TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGAAGCCCCGGC-----CCCTCGGGC---CGC--GAC---TCCGAA-GGACGCGGG-ACCGAAAGGACCCC-GTGG----------CCGCA---AACACAAACCCGGCGCAAACCGCGTCAAGGAACATTATAA-CGGAAGGGG--CGCGCTGGCCCGTTCGGCCCGTTCGCGGTGCCGGCTG---GGCGAGCGCCGACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCA-CGGATATCTG?GATCTCGG?TCTATGA??AACG?AA-AAAATGCGA?ACTTGGTGCGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCTCCCCC-ATT------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGG?GGCGGACGTCACGGCGAGTGGTGGTCG--AATAATAAG?TCTCT--GTTCGCGC?GTGGCCCTA-CCCGT?TTC-CGGGTGG-CGAAT-CGACCCA--TGCGCGCT-GTCC-TC--------------------GAG---ACCG--CGTTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCCGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTT--------ATT-CTTCCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAACCCTATGG-CTTCCATTAATT-ATA-GGG-AAAGAAAAGCAA-CGAGC-TTCTGT--TCTTAAA-----TTA-GAATGATT-CCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TTCAAAA-------TGG----A-TA-----------TTA---TCCATTTTGAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGATTTCTAACCATCTTGTTTTGTTAT-CTTAGAAT-GAA--GATAAACA-------TAAAAAAACA-------GAGGAT----AGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCAA-GGTATCTA-TTTTTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGCT-------------------------------------------------------------------ATGGAGGAATTCAAAAGATATTTAAAAAGAGCTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAAGGATTTTCGATCATTGTAGAAATTCCATTTTCTCTACGACTCGTATCTTTCTTAGAAACGAAAGGGAGATTCAAATCGCGGAATTTA---TTAGTATG?AACCCTACTAAGTGAGACCTTTCAAATTCAGAGAACCCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAACCA----------ACCAAAGG-CTAAAATAAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATATAAACTTCAGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTTTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TTATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCT-CATGCCAATG--------CCGGCA-ATAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AA-TCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAACC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAACATCTTTACGT-AAGGAATCCCTATT-----------TGAATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCTTTCAGTTGA-ATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC----CGCATGTGGATTCACAAATCC?CTGC-CTTGAGCCT-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GAGAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCC----TAGA-----------------CTCAGG--GGGGATTTTT---TCCCCTTTTTT--CT------TCTTA-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAACAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTGTAGAGGGAAATTATGAGC-ATTACGTTCGTGCATA--- Valeriana_laurifolia TCGATGCCTGCATGCGCAGAA-CGACAC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGG------TCCTCGGGC---CGT--GGC---TCTGAA-GGATGCGGG-ACCTTTAGGTTCCC-GTGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CAGAAGGGG--CGTGCTGGCACGTTTGGCCCGTTCGCGGTGCCGGACT---AGCGAGCTCCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCATCGCCCCCC--TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC--GGGGGCGC-GGACGATGGCCTCCCGCGTCCTC-GTC------GGGCGCGGTTGGCCCA-AAACAC--GGTCCCCCGACGGCAGGCGTCACGGCGAGTGGTGGTCG--AAT---TAGCCCTCT--GTTCGCGCCGTGCCCCTC-CACGTCTTT-CGGGCGG-CAAAT-CGACCCA--GGCGCGCT-GTCT-AC--------------------GAG---ACAG--CGCTTCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TAA-GAATGATTTCCCGATCTAATAATAT-GTTAAAATTTTATTAG-TG-CCTG-AACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATT-A-AAAA-AAAA-----TGG----A-TAA-TA-----TATTC---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTTCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGGTTCTAACCATCTTGGTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGTATCATTT-GAAAACC-CCTCAAATTCTCG-ACTCTTAA-AATTGAAATTCAAAAGGAGGGAATTAAAAGATATTTAAAGATAGGGGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTGGC-TCATGTTGATGGGTTAAATAGAGCACATTTATTGGAAAAGGTAGAGTATGACAATAAATATAGCTTACTAGTTGGGAAAGGTTTTATTAATCGAA---------------------------------------CTAAACCAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATGGAACCTTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAAAAACCTATAAAT---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACCGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATATTCGTTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TTGATTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------CGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-GTTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC-GGGGGCAGGTGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTGCATCCGCCCCCA-GCGGGGA-CTCTGATTAA-GATTAATCA-ATCGATGTTTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------GATGAAAGAA-------ATAAAAA--------GGAG-AAAT-----------ATAG-CCCCCTTGCTAGACCA-----------------CGG--GGGGGT-----TACTC-----TCATAT-------GCTCT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TATTCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-------------------- Valeriana_mexicana TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-TCACGGTGCCCCGG------CCCTCGGGC---CGC--GGC---TCCGCA-GGACGCGGG-ACCGCAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCTCTCCCGTCGGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGCCGA-CCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATAAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAG---------------AAATCCCGTGAA----------------ACCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGCAGGGGGGCGC-GGACGATGGCCTCCCGCGCCAAC-ATC------GGCGTGGC-TGGCTCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCCTT-CGGGTGG-CGATT-AGACCCA--ACACGCGCCGTCC-----------------------GAG---AGAC-GGCGTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCGACGAAGAGTTCTTAGAATATTTT--------CTTTTT-CCGGATCAGTATTAAAATTAAAA--CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATATAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAA{GT}GATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTA-AATGAATCCTAA-TTATTTTTTG-CTATTTT-TTAAAAA-------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-TTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAA?CGAAGGGGAGAGTCAA?TCGCGGAATT?AC--TTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATCCATTAAAATACTATAGATT-CTACCAACTGATTAATGACGACCCGAATTTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATT{GT}ATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT--AGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CCTTTTCTT-ATTATTAGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTAATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGAATGAGGATAAGACTTTGTAATACCCTTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC-------------------AAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATATCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAAA--------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCA-----------------AGG-GGGGATTTTTTATCCTT------TTT----------TTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAAGAGGAAAT--------------------------- Valeriana_microphylla TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGTGCCCCGG------CCCTTGGGC---CGT--TGC---TCCGAA-GGACGCGGG-ACCGTTAGGACCCC-GCTT----------CTGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCTGGCCCGTTCGGCCCGTTTGCGGTGCCGAACT---TGCGAGCGTTAACCCCTCTGAGAAATA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGTGTCGCCCCCCC-TCCCT-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGATAATGGCCCCCCGCGCCCCC-ATC------GGGTGCGGCTGGCCTA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTTG--AGT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGTGG-CGAAT-CGACCCA--GATGCGCG-GTTC-AC--------------------GAA---ACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTT--CCGGATCCGTATTAAAATTAAAAA-CTTG-GTTTAAT-----TATGGAAACGGAGT------AAAGTGAATTCATTCAATTTAAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATTATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTT--CAAAAAAAAA----TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAA--------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAATTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGGGAGTCAAATCGCGGAATTTA----TT?CC?G?AAACG?A??---TGAGAACTTTGAAATCCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGCTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAC-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAA-TCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-----ATAGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G--TTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGCATAGCTC-------------ATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAACTAGAC---CA-----AGG--GGGGGTTTCTCC---------TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATACACTAAGAAATATACACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTTATG------- Valeriana_minutiflora TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCCGGC-----CCCTCGGGC---CGC--GAC---TCCGAA-GGACGCGGG-ACCGAAAGGACCCT-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATTATAA-CGGAAGGGG--CGCGCTGGCCCGTTCGGCTCGTTCGCGGTGCCGGCCG---GGCGAGCGCTGACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCT-GGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGAC{AG}ATGGCCTCCCGCTCTCCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AATAATAAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGTGGC-GAAT-CGACCCA--TGCGCGCT-GTCC-AC--------------------GAA---ACCG--GGTTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTT--------ATT-TTTCCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAGCGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATTTATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAA-----TTA-GAATGATT-CCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTTTTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TTCAAAA-------TGG----A-TAA-TA-------------TCCGTTTTGAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGCTTTCTAACCATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAAC-------AGAGGA----TAGAGAG-TCT-GTTG-ATAA-GTCCTA-CTTAGAT-CCAA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGT-CCGCACTATGCATCATTT-GATAACC-CCG-AAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAAGGATTTTCGATCATTGTAGAAATTCCATTTGCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATC?--GGATT?----TTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATAATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACA-TGAAATT-TAGAGTAAGAGGAAA-TCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAACC-ATAT-------GA----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGCGTACAAATGAACATCTTTACGT-AAGGAATCCCTTTT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCGGCGGGGGGAATGGTCGGGATAGCTC-----------GGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACA?CCGCCCCCA-GCGAGGA-CTATGATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAAA--------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGA-----------------CTCAGG--GGGGCTTTTT---GCTCCTTTTTTTT--------CTTTT-T---------------TCAAAAA-----CTCATATACT-------------ACTAAGAACAGGTC-TTATCCCATTTGTAGAGGAGC-TTCT-AGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTCTATTTAACA- Valeriana_montana TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGG------CCCTCGGGC---CGT--GGC---TCTGAA-GGACGCGGG-ACCGTAAGGGCCC--GCGA----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGAAAGGGG--CGCGCTAGCCCGTTCGGCCCGTCCGCGGTGTCGGTCG---GGCGAGCGCCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCC--GCTTC--CCCTTCA-TCGGGG-CGCGGCGCGT-GGC--GGGGGCGC-GGACAATGGCCTCCCGCATCCCA-ATC------GGGCGCGGCTGGCCCA-AAACAC--AGTCCCCCGGCGGCGGACGTCACGGAGAGTGGTGGTCG--AAT---TAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGCGG-T-AAT-CGACCCA--TACGCGCT-GTCC-AC--------------------AAC--GATGG--CGCTTCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------CTT-TTTCCGAATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGA------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GGGAAA--AAAAGCAA-CGAGC-TTCTGT--TCTTAAT------TA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-CAAAAAA-------TGG----A-TAA-TA-----TATTATCATCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAGCA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAC-------AGAGGA----TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTATTT-GTTT-------CCT-ATT-------ATGCCA---AAT-C-TATCTTGTTTTG-CTG?ACCGCACTATGCATCATTT-GATAACC-CCCAAAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTTGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGCAAGGGAGAGTCAAATCGCGGAATTTA---TTAGATGGAACCTT--CTAAGT-AGA-CTTTCAA-TTCAAGAA--CCCTG?A-TTAATAAAA-TGGGCA-TCCTTAAGC?AATCCGG?TTTTGTTT--CCGAAACC----------AACAAGGG-TTAAATTAA---AAAAAGGATAGG-GCA-AGACTCA-CGGAAGCTGTTCTACCAA-TAGAGTTG-CTGGGT------GGTAAAA-GAATCCTTCCATAGAA-CTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ACGCATTAAA----TATAGACT-CTACCAACTGATTAATGACGACCCGAATCTCTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACA-TGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTT--A-GAATCGTA-GGGG-TCCA-GTCCCTCTA-TCCCCAAACAAACC-ATAT-------GG----------ACTCCCCAATTATTTATT-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC--------------------AATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTAT{GT}ATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CA-GAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------A-AAAAA--------GGAG-AAAT-----------AAAG-CCCCCTTCCTAG-------A----------CCAAGG--GGGGATTTTT---ACTCCTTTTTTT---------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAACAGGTCCTTATCC-TTTTGTAAA?GGGG-CTTCAAGAGCAGC-------------------------------------------- Valeriana_naidae TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGATCCCCGG------TCCTCGGGC---CGT--GGC---TCTGAA-GGATGCGGG-ACCTTTAGGTTCCC-GTGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CAGAAGGGG--CGTGCTGGCACGTTTGGCCCGTTCGCGGTGCCGGACT---GGCGAGCTCCAACCCCTCTGAGAAAAA--CACAA-ACGACT-TCGGAAACGGATATTTCGGCTCTTGCATCGATGAAGAACGTAGGAAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCATCGCCCCCC--TCCCC-ACCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC--GGGGGCGC-GGACGATGGCCTCCCGCGTCCTC-ATC------GGGCGCGGTTGGCCCA-AAACAC--GGTCCCCCGACGGCAGGCGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGCCTCTC-CCCGTCTTT-CGGGCGG-CGAAT-CGACCCA--GACGCGCT-GTCT-AC--------------------GAG---ACAG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TAA-GAATGATTTCCCGATCTAATAATAT-GTTAAAATTTTATTAG-TG-CCTG-AACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATT-A-AAAA-AAAA-----TGG----A-TAA-TA-----TATTC---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTTCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGGTTCTAACCATCTTGGTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGTATCATTT-GAAAACC-CCTCAAATTCTCG-ACTCTTAA-AATTGAAATTCAAAAGGAGGGAATTAAAAGATATTTAAAGATAGGGGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTGGC-TCATGTTGATGGGTTAAATAGAGCACATTTATTGGAAAAGGTAGAGTATGACAATAAATATAGCTTACTAGTTGGGAAAGGTTTTATTAATCGAA---------------------------------------CTAAACCAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TAAGTATGCAAACTTACTAAGAGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCTATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TTGATTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------CGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-GTTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAACGGTGGGAATGGTCGGGATAGCTC-GGGGGCAGGTGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCA-----------------AGG--GGGGATTTTTTCTACT-----T-TTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-------------------- Valeriana_niphobia TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCCGG------CCCCCGGGC---CGA--GCC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGTCGGCCCGTTCGGCCCGTTCGCGGTGCCAGTCG---GGCGAGCGCCGACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTCTCCCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGCCTCC-ATC------GGCCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCAGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGACCCTC-CCCGTCCTT-CCGGCGG-CGAAT-CGACCCA--GACGCGCT-GTCC-TC--------------------AAG---ACAG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAT-----TTA-GAATGATTTCCCGATCTAATAATAT-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATG{AT}ATCCTAA-TTATTTTTTG-CCATTT---AAAAAAAAA----TGG----A-TAA-TA-----TATT----CTCCATTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGTATCATTT-GATAACC-CCTCAGATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTTAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGGAAATGTAGAGTATGACAATATATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTTACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---------TG?AACCCT-CTAAGT-AGACCTT-CAAATTCAGAGAACCC-TGGAATTAATAAAAATGG-CAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------AGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TTGACTTGAG-AAATCGTG-ACCG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CATTTTCTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-GTTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAG-----ATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC--------TGGGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAAATATTAA-ATACTATGCATTTT--------CATTATA----------ATGAAAGAATGAAAGAAAAAAAA--------GGAG-AAAT-----------AAAA-CCCCCTTGCTAGATTG----------------------GGGTGTTTCTCCT--------TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTCTGGATACA-- Valeriana_nivalis TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGG------CCCCCGGGC---CTT--GGC---TCCGAA-GGACGCGGG-ATCGTACGGAACCC-GCGG----------CCGCA---AACACAAACCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCTGTCCCGTTTGGCCCGTTCGCGGTGCTGGACG---TGCGAGCGCCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCAGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGTGCTCAC-ATC------GGACGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--TTTCGCGCCGTGGCCC------GTCTTC-CGTGCGG-CAAAT-CGACCCA--ATTGCGCG-GTCC-AC--------------------GAG---ACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCATTAAAAAA--CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTATAATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAAAAAAAA----TGG----A-GAA-TA-----TATTA---TCTATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAA--------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATGAAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATTTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGATTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATT-TTATCTTTC-TAGAAACGAAAGGGAAG---------------------TTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTTTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC-CGCGCATGGTGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTAAGATTAATCA-ATCTATTTATGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAAGG-------------------GGGGG-TTCTAC--TCA------TTTT-------CTTTT-T---------------TCAAAAA-----CTCATATACACTAAGAAATATACACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTTCATGCATAAC Valeriana_occidentalis TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGGC-----CCCTCGGGC---CGT--GAC---TCCGAA-G-ACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATTATAA-CGGAAGGGG--CGCGCTGGCCCGTACGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGTCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGGAACGGAGTTTTTTGGT-TCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAG-CCGAGG-CACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCCTCCCC-GCTCC--CCCCTCA-TCGGGG-CGCGGCGTGT-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGCCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGTCCTCT--GTCCGCGCCGTGGCC-TC-CCCGTCTTC-CGGGTGG-CGAAT-CGACCCA--TACGCGCT-GTCC-AC--------------------GAG---ACCG--CGCCCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTG--------ATTTTT-CCGGATCAGTATTAAAA--------CTCA-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA-----ATTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTT----------------------------------------------------TGCCATTTTGAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAATA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGACTTTCTAACCATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAAC-------AGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCAA-GGTATCTATTT-GTTT-------CTT-ATT-------ATGAGA---AAA-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACT-CCCCAAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAACGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCCGAAGGATTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTCGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA--CTAAGTATG-AAACCTACTAAGTGAGAACTTTCAA-TTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AGCAAAGG-CTAAAATCAA--AAAA-GGATAGATGCAGAGACTCAACGGAGGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAAACTATAAAC---AGGAATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCCGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTC--TGATCAAATCATTCCCTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCCTTCTACATGCCCATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAATGCCG-TCGACTTTAG-AAATCGTGCAGGG-GTCAAGTCCCTCCT-TCCCCCAAAAAACC-ATAT-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAACATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCCATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGCTGGA-ATGGTCGGGATAGCTC--GCGCCCGGGAGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAG-----------AAAG-CCCC---CCTAGACTTA-GA----------CTCAGG--GGGGATTTTT---GCTCCCCTTTTTTT-------CTTTT-T---------------TCACAAA-----CTCATATAC--------------ACTAAGAACAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGAAAATTATGAGC-ATTACGTTCGGCATAACA- Valeriana_officaina TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCCGGC-----CCCTCGGGC---CGC--GAC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATTACAA-CGGAAGGGG--CGCGCTGGCCCGTTCGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGCCGACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGGC-GCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--TGTCCCCCGGCGGCGGACGTCACGGACAGTGGTGGTCG--AA----AAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGCGG-CGAAT-CGACCCA--TGCGCGCC-GTCC-AC--------------------GAG---ACGG--CGCTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTTGTATCAACGAAGAATTCTTAGAATATTTT--------ATT-TTGTCGGATCAGTAT-AAAA-------CCTTG-TTTTAAT-----TATTGAACGGTAGT------ATAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTC-ATTA-TT-ATA-GGGAAAAAAAAAGCAA-CGAGC-TTGTGT--TCTTAAT-----TTA-GAATGATTTCCCGATCTAATAATAA-GTAAAAAAATTATTAG-TGGCCTGATACGGGGAGGG-TT-T-CCACGAGTGTATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTAGA-GGAATTC-TTTTTTAGAATCCAATATTTTTGCATTTTTTAAAATGAATATT-CATTT-GAAA-GGAGATGTGTGTCAAAGAAAGAA---------------------TTATCAAAAATTTCAAAAAAAAGGGGTTAGGTTGAAAAAAAAA--GACTTCTAACT-TCTTGTTTTGT-AT-CTTATAAT-GAA--GAAAAC----------ATAAAAAA-------AGA-GA----T-GAGAG-TCT-GT-G-ATAAG-TTCTA-CT-AGAT-CCAG-GG-ATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGGCTGTACCGCACTATGCATCATTT-GATAACT-CTCAAAATTCTCT-ACTCCTTA-AATTGCATTTCAAATGGAGGAA?TCATAA?ATATTTAAAGAGAAGTGGTTCTGAACAGCACT-ACT?CTTGTATCCACTTATCTTTCAGGAGT?TATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCGCATTTGTTGGAAAATGCA?GGTATGACAATAAATATAGCTTACTAGTTGTAAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAAGGATTTTCGATCATTGTAGAAA?TCCATTTTCTCTACGTTTCTTATCTTTCTTACAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATG?AACCCTACTAAGTGAGAACTTTCAAATTCAGAGAACCCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGA-AAACCG-TCGATTAA---AATTCGTG-AGGGGTTCAGGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GC-TCCCCCATTTTTGCTCCACTATT-ATC-----------------CTTT--CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAACATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGGTCCAATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTA-CTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC--GGGGGCAGGGGATTCACAAATCC?CTGC-CTTGAGCCA-CTTGGGTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATTTCATTAT--AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCC---CCTAG-------A----------CTCAGG--GGAAATTTTT---TCTCCTTTTTTTTTT------CTTTG-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAACAGGTCTTA-TCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGAAATTTATGAGC-ATTACGTTCTATTTAACA- Valeriana_palmeri TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGTGCCCCGGC-----CCCCCGGGC---TGT--GGC---TCCGAA-GGACGCGGG-ACCGTAAAGGCCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCCGGTCCGTTCGGCCCGTTCGCGGTGCCGGCCG---GTCGAGCGCAAGCCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCAC--CCCCTCA-TCGGGG-AGCGGCGTGC-GTTTGGGGGGAGC-GGACGATGGCCTCCCGTGCCCCC-ATC------GGGTGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGTGG-CGAAC-GGACCCA--GACGCGCC-GTCC-AC--------------------GAG---ACGG--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGATGAATTCTTAGAATATTTT--------CTTGTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCA-TTTCTAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAA-GCAA-CGAGC-TTCTGT--TCTAAA------TTA-GAATGATTTTCCGATCTAATAATAA-GTTAAAAGTTTATTATAGG-CCTGATACTGGAAGGA--TTTTCCACGAGGGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TAAA--AAA-----TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGGTTTGACTGTACCGCACTATGCATCATTT-CATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAATGGGAGAAATTCAAAAGATATTTAAAGATAGATGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGG-TCAGGATCATGGTTTTAATAGAGCAACATTATGGGAAAATGTAGGGGATGACAATTAATATTGCTTACTAGTTGTGAAAAGTTTTATTACTGGAA---------------------------------------CTACCCAAAATGTATTTTGGGGCGCCAATAAGAGTTTGGATTCTCAAAGGATATCAGAGGGGTTTTCGAGTTTGGTAGAAATTCCATTTTCTCTAC-----------------------------------------------------TTAGTATAAAAACCTACTAAGAGAGAACTTTCAAATTCAGAGAAACCCTGAAATTAATAAAAATGGGCAATCTTGAGCCAAATCCGGTTTTTGTTTTCGAAAAACA----------AACAGAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAA-TAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAT---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCCCTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAAT--TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGTATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATCAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTGAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC------CGTGGGAATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAAA------AAAA-----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACGCTAGA--C---CA-----A-G--GGGGATTTTTTC-----------CTACTTTTTT-CTTTTTT---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTAAGGTTTCT------- Valeriana_pauciflora TCGATGCCTGCACGCGCAGAA-CGAACCCGCGAACACGTTCAAAA-CTGCGGAGCCCCGGT-----CCCTCGGGA---CGT--GAC---TCCGAC-GGACGCGGG-ACCGTAAGGACCCC-GTGG----------CCGCA---AACACTACCCCGGCGCAAACCGCGTCAAGGAACATCATAA-CGGAAGGGG--AGCGCTGGCCCGTTTGGCCCGTTCGCGGTGCTGGTCG---GGCGAGCGTCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCTCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-TGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCCCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGTGG-CGAAT-CGACCCA--TACGCGCT-GTCC-AC--------------------GAG---ACTG--CGCTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTG--------ATTTTT-CCGGATCAGTATTAAAA--------CTCG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATGAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA-----ATTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT--ATGGATTCTAA-TTAATTTTTG-GCCTTTT-TTGCAATG---------------TAG--A-----TATGA---GCCATTTTGAAA?GGA?ATGCG?GCCTAATATA?CC-AGTATCTT-AGA{GT}CGCGA--TTGCCGAAATC-----ATAAGC?C?GTCAGCCGAC?AGAT??AGGGCTCTCTAACCGTCTAGTTTCGTTAT-CTTATCAG-TGG--GATGAGCCT------TGTTGATCAG-------AG-G{AC}T---AC-AGAG-TCT-CG{AT}G-ATACT-A{CT}CT?-CTT?GAT-CCAG-GGTA{AT}C{AT}A-TT?GCTT-------?TT-ATG-------A??GCA---{AC}CG-{AC}ACATCTGGTTTTGA{CG}TGAAC?CCCCTATGTCTCA?TT-ATT?A{AC}C-CCCCAA?TCC{CT}CT-GCTCTTCA-GGTGGGAATTC{AC}AATG{AG}?GG{AT}ATTC{CG}AAAAA?T?-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAG-ATGAAACC?TACTAAGTGAGACTTTC-AAATTCAGAGAACCC?TGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAACCA----------ACCAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTAT--------ACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-AT{AT}GAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-AAAATGAAATT-TAGAGTAAGAGGAAAATCCG--CGACTT-AG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCCAAAAAACC-ATAG-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTAGAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTAGCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAACATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCCATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC--CGCGGCAGGGGATTCACAAAT?CCCTGC-C?T??GCCC-CTTGGG?ACA?CCGCCCCCA-GCGAGGG-CTATTATTTATGATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAA-----------AAAG-CCCC---CCTA-------GA----------CTCAGG--GGGGATTTTG---CCCCTTTTTTTTTT-------CTTTT-T---------------TCACAAA-----CCCATATACT-------------ACTAAGAACAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGAAAATTATGAGC-ATTACGTTCTATTTAACA- Valeriana_pilosa TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCCGG------CCCTCGGGC---CGT--GGC---TCTGAA-GGACGCGGG-ACCGTTAGGACCCC-GCGG----------CTGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCTGGTCCGTTCGGCTCGTTCGCGGTGCCGGCCT---TGCGAGCGTCAACCCCTCTGAGAAATA--CACAA-ACGACTCTCGGCAACGGATATCTAGGCTCTCGCATAGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCC-GTGAA-----------------CCA-TCGAGTCTGTGAACGCAAGTTGCGCCCGAAGCCATTATGCCGAGG-CACGCCTGCCTGGGCGTCACGCATCGTGTCGCCCCCCC-TCCC--GCCTA--CGACTCA-TCGGG--CGCGGCGTGC-GGC-GGGGGGCGC-GGATAATGGCCTCCCGCACCCCC-ATC------GGGCGCGGCTTGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTTG--AAT---AAGCCCTCT--GT-CGCGCTGTGGCCCTC-TCCGTCTTT-CGGGTGG-CGAAT-CGACCTA--TGCGCG----TTC-AC--------------------AAG---ACG---CGCTCGA-ATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTT--CCGGATCCGTATTAAAATTTCAAA-CTTG-GTTTAAT-----TATGGAAACGTTGT------AAACTA{AC}{AG}TTCATTCA-TTTCCAGTTGGGTCGAATGGATAAATG-ATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-CGGAAAAGCAAAGCAA-CAAGC-TTCTGT--TCTTAA------TTA-CAATAATTTCCCAATCTAATAATAA-GTTAAAAATTGATTAG-TG--CTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTA-AATGAATCCTAA-TTATTTTTTG-CCATTT------------------G----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAA-AAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAA-----------------------------------TGGATGGAACC?TATT-AGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA----AAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAACAATCCTTCCATAGAAACTTCAGAAAACAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTTATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGTAAAATGAT-TGTGAATTGATTCCATATTGAATAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCATCATAGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT--TTTTTAGCGCAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGT-----------------ATGGTGAATTCACAAATCCATGC--CTTGAGCCA-CTTGGCTATCTCCGCCCCCA-CC-AGAA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAA----------GGAG-AAAT-----------AA-G-CCCCCTTGCTAGACCA-----------------GGG--GGG--TTTCTCC----------TTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTA------GGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTCATGGCT---- Valeriana_pinnatifida TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CTGCGGATCACCGG------CCCCCGGGC---CG---GGT---TCCGAA-GGACGCGGG-ACCGTAAGGACCCT-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGATAA-CGGAAGGGG--CGCGTTGGCCCGTTCGGCCCGTTTGTGGTGCCGGCCG---GGCGAGCGCCAACCTCTGTAAAAAAAA--CACAA--CGACTCTCGGCAACGGATA-CTGGTTTCTGGCAAGACATGAGGAC-TAGCGAAAT{GT}C{AG}ATA{AC}TTGGAG{CT}GAA{AT}TGCAGCTAACTGTGAATTGAGAATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--TCCCC-GTTTC--CCCCTCA-TCCGG--TGCCACCTGC-GGC-GGTGGGCGC-GGACGATGGCCTCCCGCGCTCCG-ATT------GGTTGCGGCTGGCCCAAAAACAC--TGTTTCCCGGCGGCGGACGTCACGGCGAGTGGTGGTAG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCAGCCTTT-AGGGCGAGCGATA-CGACCCA--GACGCGCA-GTCC-AC--------------------GAG---ACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCGTCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAGCGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATGGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAG-AAAAACA--CGAGC-TTCTGT--TCTTAA------TTA-GAATGCTTTCCCGATCTAATAATAA-GTTATAAATTTATTAG-TG-CCTG-TACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTA-AAAAAAAA-A----TGG----A-GAA-TA-----TATTC---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTT-CTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA------AGAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTATCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCATATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATTTATTTTTGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATTATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA-------------------------------------------------------------------------------------TCCGGTTTTTGTTTTCGGGAAACC----------AACAAAGG-CTTAAATCA---AAAA-GGATAGG?GCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTTCATAGAA?CTTCAGAAAAGAAAGGAGAGACCTTT?AAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTTATTGATCATATCATTCACTCCAT---AGTCCGATCAATC-TTTTGAAGAAC----TGATTA-ATCGATCGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-CCAATGAAATT-TAGAGTAAGAGGAAAATCCA-------------------------------------CTA-TCCCCAAAAAAACC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GATATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGGGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAG{AC}AAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTCCCGCGCATGTGGA-TTCACAAATCC?CTGC-CTTGAGCCT-CTTGGCTACATCCGCCCCA--GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAAA------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGAC-----------------CAGGG--GGGTA-TATTCC--TA-----TTTTTT--------ATTTTT---------------TCAAAAA-----CTCATATACC-------------CCTAAGAATAGGTC-TTATCC-TTTCGTAGATGGAG-CTACA-GAGCAGCTAA----------------------------------------- Valeriana_plantagina TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGG------CCCTAGGGC---CGT--GGC---TCTGAA-GGACGCGGG-ACCGTTAGGACCCC-GCGG----------CTGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCTGGTCCGTTCGGCTCGTTCGCGGTGCCGGCCT---TGCGAGCGTCAACCCCTCTGAGAAATA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTA-GCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGATAATGGCCTCCCGCACCCCC-ATC------GGGCGCGGCTTGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTTG--AAT---AAGCCTTCT--GTTCGCGCTGTGGCCATT-CCCGTCTTT-CGGGTGG-CGAAT-CGACCCA--TATGCGCC-GTTC-AC--------------------AAG---ACGC--CGCTCCGAAAGGAGTGGAGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACGGATCTGGAAAGGGAATGGGTGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCCGTATTAAAATTTGAAA-CTTG-GTTTAAT-----TATGGAAACGGAGT------AAAGTGAATTCATTCAATTTCCAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTA-AATGAATCCTAA-TTATTTTTTG-CCATTTC-A--AAAAAA-----TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAA--------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTAT{ACG}CACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCA{AG}AGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGGGAGTCAAATCGCGGAATTTA---TTAGTATGGAAACCTACTAAGTTAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT--TTATTATCGGAGTTAT---------CTATCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGTAA-AT-GTTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTATACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATCAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTCCAGTTGACATAGACCCGAGTTATCTAGCAAAATAAGAATGCAGCGGTGGGAATGGTCCGGATAGTC----CCTTGTTGAA-TTCACCATCCCACTGC-CTTGACCCC-CTTCGCTCCCTCCCCCCCCA-CCGAGCA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTGA-GTTAA--------ATACTAGGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTCGCTAGACCAA---------------------GGGGGTTTCTCC---------TTTTT--------CTTTT-T---------------TCAAGAA-----CTCATATACACTAAGAAATATACACTAAGAATAGTGC-TTATCC-TTTTGTAGATGGAG-CTACAAGAGC-GCCAAGT--------------------------------------- Valeriana_polemonifolia GCGAAGCCTGCATGTGCAGAA-CGACCC-GCGAACACGTTGAAAA-CCGCGGTGCCCCGG------CCCTCGGGT---CGT--GGC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCTGGAACGTTCGGCCCGTTTGCGGTGCCGGCCG---GGCAAGCGCCAACCTGTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAATTGCAGAATCCCGTGAACCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCTTCA-TATTGG-CGAGGCGTGC-GGC-GGGGGGCGC-GGACAATGGCCTCCCGCGTCCCC-ATC------GGGCGCGGCTGGCCCA-AATCAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---TAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGCGG-CAAGT-TGACCCA--GACGCGCA-GTCC-AC--------------------GAG---ACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------CTTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTACGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATGA---AAAAAAA------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATATGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA------AGAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGTATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATTTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTGTCTTAGAAACGAAAGGG------------------------------?GAGG?A?GGCTAAGAT?CT--CCCAATTTACAG???CCTT--GGAA??AATAAA?ATGG?CAATCCTGAGCCAAATCCGGTTTTTGTTTA?GGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTTT----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGGAAGGAGAACCCTATAAA-----------------------------------TTAAAATACTAT?GACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATTAAGATAGAGGTCCCATTTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGGAAATCCG-TTGACTTTTT------------------------------------AAAAACC--AT-C-------GG----------ATTCCCCAATTATTTATC-----------------CTTTT-ATTATTATT-------TGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-GGTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGAGTAAGATTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAG{AC}AAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC------CAGTGGGATTCACAAATCCCCTGC-CTTGAGCCC-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGA----CCAAG----------------GGGGGTT-CTAC---------TTTTTT-------ATTTT-T----------------C-AAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-TTT-GTAGATAGAG-CTTCA-GAGCAGCTAAGTCTAGAGGGGAATTATGAGC-ATTACGTT----------- Valeriana_prionophy TCGATACCTGCACGCGCAGAA-TGACCC-GCGAACACGTTCAAAA-CAGCGGAGTCCCGG------CCCTCGGGC---CGC--GGC---TCCGAA-GGACGCGGG-ACCGTGAGGAACCC-GCGT----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CACGCTGGCCCGTTCGGCCCGTTTGCGGTGCCGGCCG---GGCAAGCTGCAACCCCTCTCAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GTCTC--CCCCCTA-TCGGGG-CGCGGCGTGC-GGT-GGGGGGCGC-GGACGATGGCCTCCCGCGTCCCC-ATC------GGACGCGGCTGGCCTA-AAACAC--GGTCCCCCGGAGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGCGG-CGAAT-CGACCCA--GACGCGCT-GTCC-AC--------------------GAG---ATGG--TGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTTCCCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCTCTATGG-CTTCCAGTGATT-ATA--------AAAAAGCAA-CGAGC-TTTTGT--TCTTAAT------TA-GAATTATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-AAAAAAA-------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTTTATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAA--------AGAGGAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTTCCGCCCTTTGGATCATTT-GAATAAC-CCTCAAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCGCATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAATTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCCGAGGGGTTTTCGATCA?TGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAAGGAAAGGGAGAGTCAAATCGCGGAATTTA----TAGTATGGAAACC?A?TAAGTGAGAACTTCA-AATTCAGAAAA-CCCTGGAATTAATAAAA-TGGGCAATC?TGAGCCAAATCCGGTTTTTGTTTTC?GAAA?CA-----------AAAAAGG-CTAAAATC----AAAA-GGATAGGTGCAGAGACTCA?CGGA-GCTGTTCTAACAA-TAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGA?AAGAA-GGAGAAACCTATAA-C---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-?AGAGTAAGAGGAAAATCCG-TCGACTTT?G-AAATCGTG-GG---GTC?AGTCCCTCTA-TCCCCAGAAAACC--??AC-------GG-----------GTCCCC??TTATT???C-----------------CTTTT-CTTATTATT-------AGCGG?GT?AT---------CTTTCTCATTCACCCT------ACTTTTTTACAAA-GAGATCCGAGTGAAA-TGTG-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTG--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATCAGGATAAGACTTTGTAATACCCCTTCAGTTGACGTGGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGG-----------------------------GATTCACAAATCCACTGC-CTTGAACCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CT-TGATTTA-GAATAATCA-ATCTATTTTTGACTGTTTTTT----------------------CAAGAACATATGTGA-GATAA--------ATACTATGCATTTT--------CATTCT----------AATGTGAGAAA------ACAAAAGTGGGA-GTAAAG-AAATTAGGGCAATTGAAAG-CCCCCTTGCTACA-----------------CCAAGG--GGGGATTTGT-TTACTTGTTT-------------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-------------------- Valeriana_procera TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCACGGAGTCCCGG------CCCTCGGGC---CGC--GGC---TCCAAA-GGACGCGGG-ACCGTGAGGAACCC-TCGT----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CACGCTGGCCCGTTCGGCCCGTTCGCGGTGCCGGTCG---AGCCAGCGCCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GTCTC--CCCCTTA-TCAGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGATGATGGCCTCCCGCGTCCCC-ATC------GGACGCGGCTGGCCTA-AAACAC--GGTCCCCCGGAGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGCGG-CGAAT-CGACCCA--GACGCGCT-GTCC-AC--------------------GAG---ACGG--TGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATT-TTTCCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTGATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAT------TA-GAATGATTTCCCGATCTAATAATAA-GGTTAAAATTTATTAA-GG-CCTGATACTGGAAGGA--TTTTCCACGAGGGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TAAAAAA-------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAA--------AGAGGAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTATCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCGCATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCCGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAAGGAAAGGGAGAGTCAAATCGCGGAATTTAC--TTGGTATGGAAAC-TACTAAGTGAGAACTTATCAATTCAGAGACACACTGGAATTCATAAAAATGGGCGATCCTGAGCCA------GTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTCAAATCA---AAAA-GGATAGGTGCAG-----------AAGCTGTTCTAACAAATGGAGTTTACTGTGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAGAT---ATACGCAT------------------ATGCATTAAAATACTATAGACT-CTACCAAATTCTTAATGACGACCCGAATCTGTATTATAAAAAT----------------GGGAGAA------GTTAAGTTCTTCCATATTGAAGAAAGAATCGA-ATACTCATTGATAAACTCATTCACTCCAT---AGTCTGATAGATC-TTTTGAAGATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGAAATT---CCAGGACCAGGATAAGACTTTGTAATACCCTTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGACGATGCATCGACGGGAATGGTC------------------------------ACTCCCCTGC-CTTGAGCCC-CTTGTCTAC-TCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTCT----------AATGAAAGAAA------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGA-----------------CCAAGG--GGGGATTTTT-CTACTTTTTT-------------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-A------------------ Valeriana_pyramidalis TCGAAGC-TGCATGCGCAGAA-TGACCC-GCGAACACGTTGAAAA-CCGTGGTGCCCCGG------CCCTCGGGT---CGT--GGC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACGCAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CTTAAGGGG--CGTGCTGGAACGTTCGGCCTGTTCGCGGTGCCGGCCG---GGCGAGCGCCACCCTGTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGG-CACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCCTCCAC-GCCTC--CACTTCA-TATGGG-CGAGGCGTGC-GGC-GGGGGGTGC-GGACAATGGCCTCCCGCTTCCCC-ATC------GGGTGCGGCTGGCCCA-AAACAC--GATCCCTCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---TAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGCGG-TAAGT-TGACCCA--GACGCGCA-GTCC-AG--------------------GAG---ACAG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTG--------ATTTTT-CCGGATCAGTATTCAAA--------CTTGGCTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTTCATTTCCAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTTCAGTAATT-ATA-GGGAAA--AAAAGCA--CGAGC-TCCTGG--TCTTAA-------TA-GAATGGATTTCCGATCTAATAAATA-GTTATAAAATTATTA--GGGCCTGATACGGCCAGGG-TTTT-CCACGAGGGAATTCTCCATTTTT--AATGAATCCTAA-TTATTTTTTG-CCATT-----AAAAAAAA----GGG----A-TAA-TA-----TATTC---TCCATTTTGGAATGGAGATGGGTGTCGAAAAGAATC-AGTAT{AG}{GT}G-{GT}ATCAAAA{CT}ATTTTCCAAAATA-----TACAAAG{CG}GGTTAGGG{GT}GAAAAAATAAGGGGTTTCTAACCATCTTGTTTTGTTATTCTTTTAAC-GTA--GATAAACCA------TAATACAAA------GGAG-GAT---AAAAGAG-TCT-GTTGGATAAG-TCCTA-CTTAGAT-CAGA-GGTATTTAATTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTATCG-ACTCTTCA-AATTGAAATTCAAATGGGGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCATATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATTTATTTTTGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATTATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA-------------AACCTACTAAGTGAGA--CTTCGAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAGATCCGGTTTTTGTTTTCGGAACACA------GGCTCACATCGG-CTAGGATAG---GAGA-GGATAGGTGCAGAGACTCAG-GGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAAAAACCTATAAAT---AGGGATAT------------------ATGCATTAAAATACTATAGGCT-CTCCCA-CCGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCCTATTGAAGAAAGAATCGA-ATACTCGTTGATCAAATCATTCCCTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCC-TTCTACATGCC-ATG--------CCGGCA-ACAATGAAATT-TAGAGTAGCAGGA-AATACG-TCAACTAAAC-AATTCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACC-AATAC-------GG----------ACTCCCCCATTATTTATC-----------------CTTCT-CTTATTATT-------CGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGGGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGGGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT--ACCCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGG?GGGAATGGTCGGGATAGCTC----------TGCATTCACAAATCCACTGC-CTTGATCCA-CTTGGCTACATCCGCCC-AA-GAGAAG------TATGTA-GATTACTAA-ACATATTTTTGGTTTTTCTTT----------------------AAA----TTAAACAA-AATAT--------GTAA-GTAAAAT------------------------------AACAAA----------------------GGAG-CAAT-----------AGCG-CCCTCTTGCTAGAACAAGAAA------------------GGGATTATTGC--TCC----TTTGT-------TTATTTA---------------TTTTTTAA-----CTCGTATAC--------------ACTAAAGCCCGGTC-TTA?CC--TTTGTAGA-GGAG-CTTCA-GAGCAGCTAGGTTCAGAGGGAGGTGATGAGC-AGTACGTTCATGCATAAC- Valeriana_pyrenaica TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGG------CCCTCGGGC---CGT--GGC---TCTGAA-GGACGCGGG-ACCGTAAGGACCC--GCGA----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-C?GAAGGGG--CGCGCTAGCCTGTTTGGCCCGTTCGCGGTGCTGGTCA---AGCGAGCGCCAA-CCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCACCGGATGTATCTGGTCTGGATCGGATGAAGAACGTACGGA--TGCGATACTTGGTGTGAATTGCAG----------------GATCC-GTGAA------------------CA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGT{CG}ACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCTTCA-TCGGGG-CGCGGCGCGT-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCATCCCA-ATC------GGGCGCGGCTGGCCCA-AAACAC--AGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTG-TCG--AAT---TAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTTTTC-CGGGCGG-TAGAA-TGACCAA--T--GCGCT-GTCC-AT--------------------GAG---ATGG--GGCCTCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTCGAATATTTT--------CTT-TTTCCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGA-CTTCCATTAATT-ATA-GGGGAAAAAAAAGCAA-CGAGC-TTCTGT--TCTTAAT------TA-GAATGATTTCCCGATCTAATAATAA-GT-AAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TTAAAAA-------TGG----A-TAA-TA-----TATTATCATCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAGCA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGAGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAA-GAA--GATAAACCA------TAAAAAAAC-------AGAGGA----TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCCAAAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTCAAGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCAAA---------------------------------------CTAACCAAAATGCATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTTTCTTTCTTAGAAACGCAAGGGAGAGTCAAATCGCGGAATTTA----------------------------------------------------GGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ACGCATTAAA----TATAGACT-TTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGACTCGA-ATACTCATTGATCAAATCATTCACTCCAT---ACATAGTCTGATCGTTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGGC-ACAATG-AAAT-TAGAGTAAGGCGGGAATGGT-CGGGATAGAG-AAATCGTG-AGGG-{GT}TCAAGTCCCTCTT-TCCCCAAAAAA-CC-ATAT-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGGTAT---------CTTTTTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGAGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-CGTGTACAAACGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGCGGGAATGGTCGGGATAGCTC--------------TTCACAAATCCCCTGC-CTTGAGCCC-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAAA--------GGAG-AAAT-----------AAAG-CCCCCTTGCTAG-------A----------C-CAGG--GGGGATTTTT---GCTCCTTTTTT----------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------CCTAAGAACAGGTC-TTATCC--TTTGTAGATGGAG-CTTC-AGAGCAGCTAAGTCTAGAGGGAGATTAT------------------------ Valeriana_rigida TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCCGA------CCCTCGGGC---CGT--GAC---TCCGAA--GACGCGGG-ACCATAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACACGACAA-CGCAAGGGG--CGCACTGGCCCGATCG---------CGGTGCCGGTCG---GGCGAGCGCCTACCCCTTTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCTGGGGCGTCACGCATCGCGTCGCCCCCTC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGCCTCC-ATC------AGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCAACGGACGTCACGGCGAGTGGTGGTTG--AAT---AAGCCCTCT--GTTCGCGTCGTGGCCCTC-CCCGTCTTT-CGGGTGG-CGAAT-CGACCCA--GACGCGCT-GTCC-TC--------------------AAG---ACGG--CGCTCCGAGAGGAGTGGAGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCGGACGGATCTGGAAAGGGAATGGGTGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCCGTATTAAAATTAAAAT-GTTG-GTTTAAT-----TATGGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTT{CT}CAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-GG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAAAAAAA-----TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAA--------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACTGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTTGAAAATGTAGGGTATGACAATAAATATAGCTTATTAGTTGGGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTTGGGGCGCCATAAGAGTTTGGATTCTCAAAGGATATTAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTTTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAGTGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACCACCCCAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCATCATAGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCA-TG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTGAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATCCTTTTCTTTATTTAT-CCTT---CTTATTATT-------AGCGGAGTTAT---------CTTTATCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G--TTTTTTCTTATC----ACAAGTCTTATAATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATAAATATCATTAC------TCATACTAAAACTTA--CAAACTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATCAGGATAAGCCTTTGTAATACCCCT-CAGTT-ACATAGACCC-AGTTATATACCAAA-TACAAA--CACCGTGGAATGTCACCAAACCAT-------CCAGGGTGGATTCACAAATCCACTG--CCTTAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATGTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAACATATTAAATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAA----------GGAG-AAAT-----------AAAG-ACCCCTTGCTAGATT------------------GGG--GTG--TTTCTGC----------TTTTT-------TCTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTACGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTGCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTCATGGCTAC-- Valeriana_robertiana TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-TTGCGGTGTCCCGG------CCCTCGGGC---TGT--GGC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--TGCGCTGGTCCGTTTGGCCCGTTCGCGGTGCCTGCAGG--GACGAGCGTCAACCC-TCTGAGAAAAA--CACAG-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------A-T-CCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCTC-GCCTC--CCCCTCA-CCGGGG-AGTGTCGTGC-GGTTGGGGGGGGC-GGACGATGGCCTCCCGTGCCCCT-ATC------GGGTGCGGCTGGCCCAGAAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTG-TCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGTGG-CGAAT-CGACCCA--GAAGCGCT-GTCC-AC--------------------GAG---ACGC--GTTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGATGAATTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCA-TTTCTAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAA-GCAA-CGAGC-TTCTGT--TCTAAA------TTA-GAATGATTTTCCGATCTAATAATAA-GTTAAAAGTTTATTATAGG-CCTGATACTGGAAGGA--TTTTCCACGAGGGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TAAA--AAA-----TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGGTTTGACTGTACCGCACTATGCATCATTT-CATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAATGGGAGAAATTCAAAAGATATTTAAAGATAGATGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGG-TCAGGATCATGGTTTTAATAGAGCAACATTATGGGAAAATGTAGGGGATGACAATTAATATTGCTTACTAGTTGTGAAAAGTTTTATTACTGGAA---------------------------------------CTACCCAAAATGTATTTTGGGGCGCCAATAAGAGTTTGGATTCTCAAAGGATATCAGAGGGGTTTTCGAGTTTGGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAATCGAAAGGGAGAGTCAAATCGCGTAATTTA---TTAGTATAAAAACCTACTAAGAGAGAACTTTCAAATTCAGAGAAACCCTGAAATTAATAAAAATGGGCAATCTTGAGCCAAATCCGGTTTTTGTTTTCGAAAAACA----------AACAGAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAA-TAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAT---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCCCTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAAT--TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGTATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATCAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTGAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC----------TGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------TATTAT----------AATGAAAGAAA------AAAA-----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGAACAAGG--------------------GGGATTTTTTCTCCTT------TTTT-------CTTTT-T---------------TCAAAA------CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGG------------ Valeriana_rumicoidea TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGTCTTGG------CCCTCGGGC---CGT--GGC---TTCGAA-GGACGCGGG-ACCGTAAGGACCCT-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGTCAA-CGGAAGGGG--CGCGCTGGCCTGTTTGGCCCGTTCGCGGTGCTGGTCA---GGC-AGCGACAGCCTCTCTGAGAATAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAA-TGCGATACTTGGTGTGAATTGCAGC---------------AATCCCGCGCA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCATTAG-CCGAGG-CACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCT-GTCCT--CCCCTTAATCGGGG-CGGGGCGTGC-GGC-GGGGGGCGC-GGACGATGGTCTCCCGCGCCCCA-ATTTCAATTGGGCGCGGCTGGCCGA-AAACAC--AGATCCCCAGAGGCGGACGTCACGGCGAGGGGTGGTCG--AAT---AATGCCTCT--GTTCGCGCCGTGGCCCTC-TC-GTCCTT-CGGGTGG-CGAAT-CGACCCG--GACGCGCG-GTCC-AT--------------------GAGG--ACGG--CGCTACGAATGAGGGGA-GGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATGGAAACGGAGT------AAAG?GAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTACGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT---CTTAA------TTA-GAACGATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-GGG-CTGATACGGGAAGGGGTATTTTCACGAGGGAAT-CTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAAAAAAA-----TGG----A-GAA-TA-----TATTA---TCCATTTTGGAAAGGAGATGTGGGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAAACATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAA--------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGGATCTATTT-TTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGGTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCCTCAATTCTCG-ACTCTCCA-AATGTAAATTCAAAGGGAGGGATTCAAAAGATATTTAAAGATAGGGGGGTCGGAACAGCACT-ACTTCTTGTATCCACCTATCTTTTCGGAGTATATTTATGCCCTGGG-TC-TGATTATGGGTTAA-TAGAGCACATTTTATGGGAAAGGGGGGGTATGGAAATAAATATAGTTTGTTAGTTGGGGAAGGGTTAATTACTCGAA---------------------------------------CTAAACAAAATTTATTTTGGGGGGGCGATAGAAGGTTTGGTTC----------------------------------------------------------------------------------------------------------TTAGTATGGAACCGTACTAAGTGAGAACTTTCAAATTCAGAGAGAGGGTGGAATTAATAAGAATGGGCA-TCCTGAGCCAA-TCCGGTTTTTGTGTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTCTCAAAATTTTGGATTCTCAAAATGGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAACATAGAGTCCCCTTCTACATGCCA-TG--------CCGG-C-ACAATG-AAT--TAGAGTAAGAG--AAATCCGGTCGACTTGAG-AA-TCGGGAGGGG--GTGAGTGCCGTGT-TCCCGCAAAAATA--ATAC-------GG----------AGTTCTCAACTATT-ATC--------------------CTGTCTATTATA--------GCGGCGCTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAA?-GAGATCCGAGGGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TG?GTACAAATGAGCATCTTTACGT-AGGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGAGGAGGAGGAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGGGGGAAGGGTCGGGATAGCGT-----------GATTCCACAAATCCCCTGC-CTTGAGCCC-CTTGGCTACATC-GCCCCCA-GCGAGGA-CTCTTATT-A-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAAA---------GGAG--AAT-----------AAAG-CCCCCTTGCGAGACCA---A-------------GGG--GGG--TTTCTCC---------TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATG----------------------- Valeriana_rzedowski TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-TCACGGTGCCTCGG------CCCTCGGGC---TGC--GGC---TCCGAA-GGACGCGGG-ACCGCAAGGACCCC-GCGA----------CCGCA---AACACAACCCCGACGCAAACCGCGTCAAGGAACATGA-AA-CGGAAGGGG--CGCGCTTTCCCGTCAGGCCCGTTCGCGGTGCCTGACA---GGCGAGCGCCGACCC-TCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCTC-GCCAT---CCCTCA-TCGGGAC-GCGGCGTGC-GGCAGGGGGGCGC-GGACGATGGCCTCCCGCGCCCAA-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGACGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCCTT-CGGGTGG-CGATT-CGACCCA--GACGCGCTGTTCT-A---------------------GAG---ACAG--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTCGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATTGACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCTTATGG-CTTCCAGAAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCATGAGTGAATTCTCCATTTTTG-AATGAATCCTAA-TTATTTTTTG-CCATTT--TTTAAAAA------TGG----A-TAC-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAA-AAA------AGAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACC---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATGGAAATTCAATGGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTTTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTAC-TCATGATCATGGTATAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTACCCAAAATATATTTTGTGCGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGATGTTTTCGATCATAGTAGAAATTCCTTTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATGTA----TAGTTAGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAATTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATTTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATCCTCATTGATCAAATCATTCCCTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAAT--TAGAGTAAGAGGAAAATCCG-TCTACTTTAG-CAATCGTG-AGCT-CACAACTCCCTCTA-TCGCCACAAAGCCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTTTCTTATTATT-------ATGGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGAGAAA-CT-G-TTTTTTTCTCATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACAT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGAATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAATTATCTAGCAAAATGAGAATGCAGCGGTGG-AATGGTCGG-ATAGCT-----------TGGATTCCCCAATCCCCTCC-CCTGACCCC-CTTGGCTACATCGCCCCCCA-GCGAAGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCA----------------AGGG--GGGGATTTTTTC---------TCCTTT-------TTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTAGCC-ATTTGTAGATG-AG-CTTCA-GAGCAGCTAAGTCTAGAGGGAAATTAGGAGG-TTTACGGTTA--------- Valeriana_scandens TCGATACCTGCATACGCAGAA-CGACCC-GCGAACACGTTCAAAA-TCGCGGTGCCCCGG------CCCTCGGGC---CGT--GGC---ATCGAA-GGACGCGGG-ACCGTAAGGAACC--GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAAGATAACAA-CGAAAGGGG--CGCGCTGGCCCTATAGGCCCGTTTGCGGTGCCGGTCG---GTCTAGCGCTAACCCTTTTGAGAATAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCTTTCA-TCGGGG-AGCGTCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCTCCCTC-GTC------GGGTGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGCGG-CGATT-CGACCCA--TACGCGCT-GTCC-AC--------------------GAG---ATGG--CGTTCCGAATGAAGTGATGGATTCGTCCATGTCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCGACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGGCAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGAAAAGAAAA-GCAA-CGAGC-T-CTTT--TCTGAA------TTA-GAATGATTTCCCGATCTAATAATAA-GGAAAAAGTTAATTAG-TA--CCGATAGGGGGAAGGGGTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAA-AAAA-----TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCTAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATTATATATTATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAAGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTCTCTTTCAGGAGTATATTTATGCTCTTGC-TCATGATTATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTTGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAATCGAAAGGGAGAGTCAAATCGCGTAATTTA---TTAGTATGAAA?CCTACTAAGTGAGAACTTCAAATTTCAGAGAAACCCTGAAATTAATAAAAATGGGCATCCCTGAGCCCAATCCGGTTTTTGTTTTCGGGAACCC-------------AAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCACCGAAAGCTGTTCTAACAAATAGAGTTGCCTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGAAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCA-TC-TTTTGAAGAAC----TGATTA-ATCGACCGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG--CGACTTTAG-AAATCGTG-AGGG-TTCGAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAA-GTCTTT-CTTTTGAAGATCCAATAAATT---ACCGAATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGAGGGAATGGTCGGGATAGCTC---------GCGAATTCACAAATCCACTCC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAAAA-----AAAA-----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAAGG-------------------GGGGATTTTTT------------CTAC-------TTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATCGGTC-TTATCC-ATTTGTAGATGGAG-CTTCA-GAGCAGCTA-GTCTAGAGGGAAATTATGAGC-ATTACGTTTA--------- Valeriana_scouleri TGGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGGC-----CCCTCGGGC---CGT--GAC---TCCGAA-G-ACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAA-CCGCGTCAAGGAACATTATAA-CGGAAGGGG--CGCGCTGGCCCGTTTGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGTCA-CCCCTCTGAGAAAA---CACAA-ACGACTC-CGGCA-CG-ATATCTCCGCTTTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------A--TCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCA-GTTGCGCCCGA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAT--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGTGG-CGAAT-CGACCCA--TACGCGCT-GTCC-AC--------------------GAG---ACTG--CGCTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTG--------ATTTTT-CCGGATCAGTATTAAA---------TTCG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAGTGGATAGAGATAGAGCCCTATGG---GCCTTTAATT-GTA-TAGGGGGAAAAGAAAG-AGCCT-TGCTGT--TCTTAG-----ATAG-GAATGATTTCCCGATGTAATAATAA-GTTAAATATTTATTAG-CG-CCTGATACGGGAAGG--TTTTTCCACGAGGGAATTCTCTATTTTT--AATGAATCCTAA-TTATTTTTTG----------------------------------------------------CCATTTTGAAATGGAGATGTGTGTCTAAA-GAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGACTTTCTAACCATCTTGTTTG--TAT-CT-ATAAT-GAA--GATAA-CCA------TAAAAACAG------AGGA-------TAGAGAG-TCT-GT-G-ATAAG-TCCTA-CTTAGAT-C-AA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AA--AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCCCCAATTCTCT-ACTCTTCA-AATAAATGATTCAATGGAGGAATTCAAAAGATATTTAACGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGATATAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATACATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAAGGATTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTTGAAAAGAAAGG---------------------------------------------GTGAGAACTTTCGAATTCAGAGAAACCCTGGAATTCATAAAAATGGGCAATCCTGAGCCA------GTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTCAAATCA---AAAA-GGATAGGTGCAGG----------AAGCTGTTCTAACAAATGGAGTCTACTGTGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAGATATACGCATTGA------------------ATATATTATATTGCTAG--ACT-CTACCAAATTCTTAATGACGACCCGAATCTGTATTATAAAAAT----------------GGGAGA------AGTTAAGTTCTTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAACTCATTCACTCCAT---AGTCTGATAGATC-TTTTGAAGATCCAAGAAATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATG-AATT-TAGAGTAAGAGGAAACGTCG-ACGACTTGTA-GAGTCGTG-AGGG-TTCAGGTCCCG--A-TCCCCGTC----CC-ATAT-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGAGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAACATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCCATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGGGGGAATGGTCGGGATAGCTC-----------------------------------------CTTGCCTACATCCGCCCCCA-GCGAGGA-CTATTATATA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAA----------GGAG-AAAT-----------AAAG-CCCC---CCTAGACT-----------------CAGG--GGGGCTTTTT---GCTCCCTTTTTTTT-------CTTTT-T---------------TCACAAA-----CTCATATAC--------------ACTAAGAACAGGTC-TTATCC-ATTTGTAGATGGAG-CTACAAGAGCAGCTAAGTGTAGAGGGAAA---------------------------- Valeriana_secunda TCGATGCTTGCATGCACACAA-CGACCC-GCGCACACGTTCAAAA-CTCCGGTGCCCCGG------CCCTCGGGC---CGT--GGC---CCCGAA-GCACGCGGC-ACCGTTAGGACCCC-GCTT----------CTGCA---AACACAACCCCGGCGCAAACCGCGTCAACGAACATGACAA-CGGAACGGG--CGCGCTGGCCCGTTCGGCCCGTTGGCGGTGCCGGCCT---TGCCAGCGTCAACCCCTCTGAGAGATA--CACAC-ACGACTATCGGCAACGGATATATCGGCTCTCGCATCGATGAAGAACGTAGCAAAATACGATACTTGGTGTGAATTGCAT----------------AATCCCTTGAA-----------------CCA-TCGAGTCTGTGAACGCAAGTTGCGCCCGAAGCCATTAAGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGTGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGATAATGGCCCCCCGCACCCCC-ATC------GGGTGCGGCTGGCCTA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTTG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGTGG-CGAAT-CGACCCA--TATGACCG-GTTC-AC--------------------AAG---ACGC--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTT--CCGGATCCGTATTAAAATTTAAAA-CTTG-GTTTAAT-----TATGGAAACGGAGT------AAAGTGAATTCATTCAATTTAAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTGTGT--TCTTAA------TTA-GAATTATTTGCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAAAAAAA-----TGG----A-TAA-TA-----TATTA---TCC-TTTTGGAAGGGAGATGTGTGTCTCAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAA-GCGCGGT-AGGTTGAAAAAATAAAGGGGTTCTC-CCATCTTGTTTTGTATT-CTTATATC-GAA--GATAA-CCA------TAAAAAA---------GAG-GAT---TAGAGAG-TCT-GTTC-ATAAG-TCCTT-CTTACAT-CCGA-GCTTTCTA-TTTGTTT-------CTT-ATT-------ATGCCA---AAT-AATATCTTGTTTTGTCTGTCCCGC-CTATGCATCTTTT-GATAACC-CCTCAATTTCTCG-ACTCTTCA-AATTGAAATTCAAATGAAGGAATTCACCAGATATTTAAAGATAGGTGGGTCTGAACAGCCCT-CCTTCTTGTATCC?CTTATCTTTCAGGAGTATATTAATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAGATATAGCTTACTAATTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCCAAATGCATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGAGGAGTCAAATCACGGAATTTA---TTAGTATGGAAACCTACTAAGTTAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGCTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAC-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAT--CCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT--TTATTAGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G--TTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGTC----AATTGGTGGA-TTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCC-A-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAAATTGA----------------AGG--GGGGGTTTCTCC---------TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATACACTAAGAAATATACACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTT----------- Valeriana_selerorum TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACGCGTC-AAAA-TCTCGGTGCCCCGG------CCCCCGGGC---CGC--GGC---TCCGAA-GGACGCGGC-CCCCCAGGGACCC--GCGT----------CCGCA---AACACAACCCCGGCGCAGACCGCGTCAAGGAACATGACGA-CGGAAGGGT--CGCGCTCTCCCGTCCGGCCCGTCTGCGGCGCCGGCCG---GGCGAGCGCCGCCTC-TCTGATAAGGA--CACAG-AGGACTCTCGGGAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGATGAGCGATACTTGGTGTGAAGTGCAG----------------AATCC-GTGCA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGA-GCCATCAGGCCGAGG-CACGCCTGCCTGGGCGTC-CGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-CCGGGG-CCGGGCGCGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGCCCGC-ATC------GGGCTCGGCTGGCCCA-AAACGC--GGTCCCCCGACGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGCCCCC--GGGCGG-CGATT-CGACCCA--GACGCGGT-GTCC-CC--------------------GAG---ACAC--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCGACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGG------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TT-CCTGATACGGGAAGGG-TTTTTCCACGAGGGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-GCATTTC-AAAA----------TGG----A-TAA-TA-----TATTA---TCCATTTTGAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-AAA--GATAAACCA------TAAAAAAA---------GAGGAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTCAA-ATTTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTCTCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATATAGGGTATGACAATAAATATAGCTTATTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTTATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---GCCTAGTATGAACCTACTAAGTGAGAA-CTTCAAATTCAGAGACACCCTGAAATTAATAAAAATGGGCAATCCTGAGCCAACTCCGGTTTTTGTTTTCGGAAAACA-----------AACAAGG-CTAAAATCAA--AAAG--GATAGGTGCAGAGACTCAC-GGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTCTAAAC---AGGGATAT------------------ATGCATTAAAATATTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAG-TGTGAATTGATTCCATATTGAATAAAGAATCCGAATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTT-GAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCTTTCTACCTGCCCATG--------GCGGCA--CA-TGAAATT-TAGAGTAAGAGGAAA-TCCG--CGACTTTAG-AAATCGTG-AGGGGTTC{AG}AGTCCCTCTA-TCCCCAACAAACCC-ATG--------GG----------ACGGCCCAATTATTTATC----------------CCTTT--CTTATTATT-------AGGGGAGTTAT---------CTTTCTCATTCACTCT------ACTCTTTTACAAA-GAGATCCGAGGGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTTAGTT-ACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGGGGGAATGGTCGGGATAGCTC-------GTGGAAATTCACAAATCCCCTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT------------AT----------AATGAAAGAA-------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGAC-----------------CAAGG--GGATTTTTCTCCT----------TTTT-------GTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGG-ATTATGGTTTTTG------ Valeriana_sitchensi TCGATTCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGGC-----CCCTCGGGC---CGT--GAC---TCCGAA-G-ACGCGGG-ACCGTAAGGACCCA-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATCATAA-CGGAAGGGG--CGCGCTGGCCCGTTTGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGCCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAG-CCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCTC--TCCCC-GCCTC--CCCCTCA-TTTGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCC-GGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGTCCTCT--GTTCGCGCCGTGGCCCTC-CC-GTCTTC-CGGGTGG-CGAAT-CGACCCA--TACGCGCT-GTCC-AC--------------------CAG---ACCG--CGCCCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTCG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATG--CTTCCTTTAATT-A-A-GGGAATGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA-----ATAA-GAATGATT-CCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGGG---------------------TCTCTATTTTTT-AATGAATCCTAA-TTAATTTTGG-GCGTTTT-TTC--AAAA-----TGG----A-TAA-TA-------------TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGGTAGGTTGAAAAAATAAAGACTTTCTAACCATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAACA------GAG-GAT----AGAGAG-ACT-GTTG-ATAAG-TCCTA-CTTAGAT-CCAA-GGTATCTA-TTGTTTC-------TTA-ATT-------ATGACA---AAA-AATATCTTGTTTGGACTGTACCGCACTATGCATCATTT-GATAACC-CCCCCAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATATAAAGAGAAGTGGTTCTGAACAGCCCT-ACTTCTTGTATCCACTTATCTTACAGGAGTATATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCACATTTGGTGGGAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGGA---------------------------------------CTAAGCCAAATGCATTTGGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAAGGATTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCGTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTACGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TTTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATG-AATT-TAGAGTAAGAGGAAACGTCG-ACGACTTGTA-GAGTCGTG-AGGG-TTCAGGTCCCG--A-TCCCCGTG----C--ACATT------GG-----------ACTCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------CGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-GTTTTTTTACTTATCAATCACAAGTCTTATGATCTAAGATAATAACGTGTACAAATGAACATCGTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTTTTTTTTGAAGATCCCATAAATT---ACCTGAC{CG}AGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC------------------------------------GCCA-CTTGGCTACATCCCCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTGAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCC---CCTAGACTCA-GA----------CTCAGG--GGGGGTTTTC---GCTCTTTTTTTTTT-------CTTTT-T---------------TCACAAA-----CTCATATAC--------------?CTAAGAACAGGTC-TTATCC-TGTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGAAAATTATGAGC-ATTACGTTCTATTTAACA- Valeriana_sorbifolii TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGTGCCCCGG-------CCCCGGGC---CGT--GGC---TCCGAA-GGACGCGGGGACCGTAAGGATCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGTGCTGGTCCGTTTGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCTCCGACCCCTCTGAAAATAT-TCACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCAC--CCCCAAA-TCGGGG-AGCG-------GCT-GGGGGGCGC-GGACGATGGCCTCCCGTGCCCCC-ATC------GGGTGCGGCTGGCCCA-AAACAC--GGTCCCCCGGAGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGCGG-CGAAT-CGACCCA--CACGCGCT-GTCC-AC--------------------GAG---ACGG--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGACGAATTCTTAGAATATTTT--------CTTTTT-CCGGATCAGTATTAAA---------CTTG-GTTTAAT-----TATTGAAACGGAGA------AAAGTGAATTCATTCAATTTC-AGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAGTG-ATA-TGGAAGAAAAAAGAAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACAGGAAGGG-TTTTTCCACGAGTGAATTCCTCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TAAA--AA------TGG----A-TAA-TA-----TATTA---TCTATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCGAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---ATT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATACCC-CCTCAAATTCTCG-ACTCTTCA-AAT-GAAATTGAATGGGAGGAATTCAAAAGATATTTAAAGATAGGGGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAACAGAGCACATTTATTGGAAAATGTAGGGTATGACCATTAATATAGCTTACTAGTTGTGGAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATTTATTTTGGGGGCGCCATAAGAGGTTTGATTCTCAAAGGATAT-----------------------------------------------------------------------------------------------TTGAC-TGGAAC-GTACT-AGTGAG-ACTTTC-AATTCAGAGAAAC-CTGGAA-TCATAAAAA-GGGCAATCCTGAGCCAGATCTTGTTTGTGTTTACGGAAAACA-------------------ATCCAAGCA---AAAA-GGATAGGGGCAGGGACTGAGCGGGGACTGTTCT-----------------GGGTT-----GGTGAGAAGAATGCTTCGGTAGAAACTTCCCAAAAGACAGGAGAAAACTATAGAGATACGCATGAA-------------------TATGTTAAATTGTTATAAACA-ATACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTAATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCCCTCCAT---AGTCTGATCA-TC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCC-TTCTAC-TGCCTATG--------CCGGCA--C-ATGAA-TT--AGAGTAAGAG-AAA-TCCG-TCG-CCTTAGGAAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CTTCTTCTTATTATT-------AGCAGAGTTAT---------CTTTCTCATTCACCCT------ACTCGTTTACAAA-GAGATCCGAGGGAAA-AT-G-TTTTTTTCTTATC--ACACAAGTCTTATGATCTAAGATAA-A-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGCGGGAATGGTCGGGATAGCTC------------------------------------------------------------A-GCGAGGC-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-------------------ATGCATTTT--------CATTAT----------AATGAAAGAAA------AAAA-----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAAGG-------------------GGGGATTTTTTCTCC-----TTTTTTC-------TTTTT-----------------TCAAAAA-----TTCATATACACTAAG------ACACTAAGAATAGGTC-TTATCC-ATTTGTAGAGGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATT-ACGTTCCTGCAT--- Valeriana_stenophylla TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCCGG------CCCTCGGGC---CGT--GGC---TTCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCACTGGCCCGTTTGGCCCGTTCGCGGTGCCGGTCG---GGCCAGCGCCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-ACCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCTCCCCG-GGCTCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCAACGGACGTCTCGGCGAGTGGTGGTTG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-TCCTCCT-T-CCGGTGG-CGAAT-CGACCCA--AACGCGCT-GTCC-TC--------------------AAG---ACGG--CGCTCCCAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTTATTTTTCTATTTTT-CCGGATCAGTATTCAGTATTAAAA-CTTG-GTTAAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAT-----TTA-GAATGATTTCCCGATCTAATAATAT-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAAAAAA------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTTTATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATACC-GAA--GATAAACCA------TAAAAAAA--------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------TTT-ATT-------ATGACA---AAT-AATATCTTGTTT-GACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG--CTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAAGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTATTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATG?AACCCT-CTAAGT-AGACCTT-CAAATTCAGAGAACCC-TGGAATTAATAAAAATGG-CAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGGAAGGGAGGAATCCG-TTTCCTTTAG-AAATCGT--------TCAAGTCC?TCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATC-----------------CATTTTCTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-GTTTTTTTTCTTATC----ACAAGTCTTATGATCTCAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAA----------------CGCGCATGGTGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCC-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACAAC-TAGA-----------CAA--GGGGGGTTCTAC---------TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTCATGCAT---- Valeriana_stenoptera TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCTGG------CCCTCGGGC---TGC--GAC---TCCGAA-GGACGCGGG-ACCGAAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGA{AT}CATTATAATCGGATGGGG--CGTGTTGGCCCGTTGCGGCC-TTCGCGGTGCTTGCCG---GGTCGGCGCCAACTCCTCTGAGAAAAA--CACAACACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGGACGTAGCGAAATGTGATACTTGGGGTGAATTGGAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAG-CCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-CCCTC--CCCTTCA-TCGGGG-CGTGGCGGGC-GGG-GGGGGGCGC-GGACGATGGCCTCCCGCGCCTCC-ATG------GGCG-TGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGGGAGGGGTGGTCG--AAT---AAGTCCTCT--GTTCGCGCCGGGGCCCTC-CTCGTCTTT-CGGGGGG-CGAAT-CGACCCA--CACGCGCT-GTCC-AC--------------------GAG---ACTG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCGACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGGCAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TA-CCTGATAGGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAAAAA-------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTTTAAC-GAA--GATAAACCA------TAAAAAATAAAAAAAAGAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACAAAAATGTATTTTGTGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAAGGGTTTTCGATCATTGG?AGAATT?CATTTTCCCT?C?ATTCTTATCTTTCCTA?AAACGAAAGGGGAAGTC------------------TTAGTATGGAAACCTACTAAGTGAGA-CTTTCAAATTCAGAGAAACCTTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGA-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTGAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTAATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCC-TTCTACATGCCTATG--------CCGGCA-ACAATGAAATT-TAGAGTAGCAGGA-AATACG-TCAACTAAAC-AATTCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAACCAATC--------GG----------TATCCCCAATTATT-ATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGGGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAACATCTTTACGT-AAGAAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGTAGATCCAATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGGGGGAATGGTCGGGATAGCTC--------CGGAGATTCGCAAATCCCCTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTCTTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCCT--------AAGA-----------CTCAGG--GGGGATTTTT----GCTCCTTTTTTT--------CTTTT-T---------------TCAAAAA-----CTCATATAA--------------ACTAAGAACAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGG-ATTA--------------- Valeriana_supina TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCAGAGCCCCGG------CCCTCGGGC---CGT--GGC---TCTGAA-GGACGCGGG-ACCGTAAGGGCCT--GCGA----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGTGCTAGCCCGTTCGGCCCGTCCGCGGTGCCGGCCG---GGCGAGCGCCA--CCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTA?GCCGAGG-CACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCTC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGCGT-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGTCCCC-ATC------GGACGCGGCTGGCCCA-AAACAC--AGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---TAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGCGG-CGAAT-CGACCCA--GACGCGCT-GTCC-AC--------------------GAG---ATGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------CTT-TTTCCAAATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGA------AAAGTGAATTCATTCAATTTCA-GTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GGA-AAAAAGCAGCAA-CGAGC-TTCTGT--TCTTAAT------TA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG--CTGATACGGGAAGGG---TTTTCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTT--TCAAAAA-------TGG----A-TAA-TA-----TATTATCATCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAGCA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAC-------AGAGGA----TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CCT-ATT-------ATCCCA---AAT-ACTATCTGTTTT-GACTGTACCGCACTATGCATCATTT-GATACCC-CCCAAAATTCTC-TACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAAGTGGTTCTGACCAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAAACTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTTGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTTCTAGAAACGCAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATGGAAACGTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATAAA--AAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ACGCATTAAA----TATAGACT-CTACCAACTGATTAATGACGACCCGAATCTCTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACA-TGAAAT--TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAACCCATAT-------GG----------ACTCCCCAATTATTTATT-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC---------GTGGATTCACAAATCCACTCC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTCCTAG-------A----------CCAAGG--GGGGATTTTT---GCTCCTTTTTTT---------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------CCTAAGAAC-GGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAAATATGA---------------------- Valeriana_tanacaetifolia TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACGAGTTAAAAA-CCGCGGTGCCCCGG------CCCTCGGGC---CGC--GGC---TCCGGA-GGACGCGGG-ACCTCGACGGCCCC-GCGG----------GCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGAAAA-CGGAAGGGG--CGCGCT-GCCCGTCCGGCCCGTTTGCGGGGCCGGTCG---GGACGGCGCCGACCCCTCCGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGCA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC--TACCC-GCCTC--TCCCTCG-TCGGGA-AGC--------GGC-AGGGGGTGC-GGAAGATGGCCTCCCGGCCCCCC-ATC------GGGCGCGGCTGGCCCA-AATCAC--TGTCCCGCGGCGGCGGACGTCACGGCGAGTGGGGGTCG--ATC---GAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGACTTT-CGGGCGG-CGAA--CGACCCA--GAAGCGCT-GTCC-AC--------------------GAG---ACGG--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATGTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTCAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCTCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTC-AAAAAAAAAA----TGG----A-GAA-TA-----TATCC---CTCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GGA--GATAAACCA------TAAAAAAA--------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATGGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTACATAGACCACATTTATTGCAAAATGAGGGCTATGACAATAAATATAGCTTACTAGTCGTGAAACGTTTAATTACTCAAA---------------------------------------CCAACCAAATTTCATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAATCGAAAGGGAGAGTCAAATCGCGTAATTTA---TTAGTATGAAA?CCTACTAAGTGAGAACTTCAAATTTCAGAGAAACCCTGGAATTAATAAAATGGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGAGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCTGAATCTGGATTATCAAAAT----------------GGGAAAATGGT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATG-AAT--TAGAGTAAGAGAATCGTC-G-TCGACTATAG-AAATCGTG-AGGG-AGCAAGTCCCTCTA-TCCCCAAAAAGCCC-ATAC-------G-----------ACTCCCCAATTATTTATC-----------------CTTTTTCTTATTATT-------AGCGGAATTAT---------CTTTATGATTCACCCT------ACTCTTTTACAAA-GAGATCCGAG?GAAG-AT-G--TTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGG?GGGAATGGTCGGGATAGCTC-----------GGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATAA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCAAGG------------------GGGGGATTTTTTCTACTT------TTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAAATC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTCAGATACA--- Valeriana_texana TCGATACCTGCACGCGCAGCA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGTCC-GG------CCCTCGGGC---TGC--GGC---TCCGAC-GGACGCGGG-ACCGTGAGGAACCC-GCGT----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATAACAA-CGGAAGGGG--CACGCTGGCCCGTTCGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGCCTACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GTCTC--CCCCTTA-TCGGGG-CGCGGCGTGT-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGTCCCC-ATC------GGACGCGGCTGGCCTA-AAACAC--GGTCCCCTGGAGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGCGG-CGAAT-CGACCCA--GACGCGCT-GTCC-AC--------------------GAG---ACGG--TGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCGACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA--------CTTG-GTTTAAT-----TATTGAAACCGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCACTTT-TAAAAAA-------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATAGT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAAGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGATATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTA?TTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCCGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAAGGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGTATGAAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAGA-----TTTTGGTTTTCGGAAAACA-----------ACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAC---CGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCC-TTCTACATGCCA-TG--------CCGGCC-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTTAGGG--TTCAAGTCCCTCTA-TCCCC-CAAAACC--ATATGGACTACGG----------ACTCCCCAATTATTTATA-----------------TTTTT-CTTATTATT-------AACGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTT--------GAGATCCGAGGGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATATAAGATAATA-TATGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGACAATGCAGCGGGGGGAAAGGTCGGGATAGCTC---------CGGAATTCACAAATCCACTGC-CTTGAGCCA-CT-GGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAAA------AAAGGATTATAATGAAAGA-AAAAAAAGGAGAAATAAAG-CCCCCTTGCTAGAC-----------------CAAGG--GGGGATTTTT-CTACT-----T-TTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCA-GAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTTTAT------- Valeriana_tomentosa TCGATGCCTGCAAGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTG?GGAGTCCCGG------CCCTCGGGC---CGT--GGC---TCCGAA-GGACGCGGG-ACCGTAAGGACCC--GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCTGCCCCGTTCGGCCCGTTTGCGGTGCCGGCCG---GTTTAGCGCCAACCCCTAAGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCT{CT}GCATCGATAAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGAAGATGGCCTCCCGCGC?C?C-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCA--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGCGG-CGAAT-CGACCCA--GACGCGCG-GTCC-AC--------------------GAG---ACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCGACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGAAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATTATTTCCCGATCTAATAATAA-GTTAAAAATTGATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTG-AATGAATCCTAA-TTATTTTTTG-CCATTT--TTAA--AAAA----CGG----A-TAA-TA-----TATTA---TCCAGTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCGAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACC---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATGGAAATTCAAAGGCAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGCATCATGATCATGGTTTACATAGAGCACATTTATTGGAAA-TGTAGGGTATGAC?ATAAATATAGCTTACTAGTTGTGAAAACGTTAATT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTAGTAGTGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAAAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATTAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACTCCCCAATTATTTATCCTTTCTC----------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATGCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTTAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC--------------------------------------------GGCTACACCGCCCCCCA-GCGAGGA-CTCTGATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATA----------ATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCA-----------------AGG--GGGGTTT-CTACT--------TTTTTC--------TTTT-T---------------TCAAAAA-----CTCATATACACTAAGAAATATACACTAAGAATAGGTC-TTATCC---TTGTAGATG-AG-CTTCA-GAGCAGCTA-GTCTAGAGGGAAATTATGAAC-CATAGGGTT-TAAAAAA-- Valeriana_trichosto TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCCGGC-----CCCTCGGGC---CGC--GAC---TCCGAA-GGACGCGGG-ACCGAAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAATCGCGTCAAGGAACATTATAA-CGGAAGGGG--CGCGCTGGCCCGTTCGGCCCGTTCGTGGTGCCGGCCG---GGCGAGCGCCGACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGTCTCCCGCGCCCCC-ATC------GGGCGCGGCTGGCCCA-AAACAT--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AATAATAAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGTGG-CGAAT-CGACCCA--TGCGCGCT-GTCC-AC--------------------GAG---ACTG--CGCTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTG--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TA-TGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GG--AAAGAAAAGCAA-CGAGC-TTCTGT--TCTTAATTTAA-TTA-GAATGATT-CCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TTCAAAA-------TGG-----------A-----TAATA---TCCATTTGA-AATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGCTTTCTAACCATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAACA-------GAGGA----TAGAGAG-TC-----------G-TCCTA-CTTAGAT-CCAA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACT-TGCATCATTT-GATAACC-CCCAAAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCACT?ATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCACATTTGTTGGAAAATGTA?GGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTC?AA---------------------------------------CTAACCAAAATGCATTTTGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCA?AAGGATTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAA?GGGAGAGTCAAATCGCGGAATTTA------------------ACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGA-TCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGGTGAGGG-TTCAAGTCCCTCTA-TCCCCAAAAAACC--ATATG------G-----------ACTCCCCA-ATATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAACATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC-GGGGGCAGGTGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAA----------GGAG-AAAT-----------AAAG-CCCCC---CTAGA-----------------CTCAGG--GAGGATTTTT---GCTCTTTTTTTTT--------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAACAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGTTCTATTTAACA- Valeriana_triphylla TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CCGCGGAGCCCCCG------GCCCCGGGC---CGT--GGC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGCGCCGGCCCGTTTGGCCCGTTCGCGGTGCCGGGCT---GGCGGGCGCCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGCCCCC-GTC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAA---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGG-CGG-CGAAT-CGACCCA--GACGCGCG-GTCC-AC--------------------TAG---ACGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTAT-AG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATAAA-AA-AAAA-------TGG----A-TAA-TA-----TATTA---TCCATTTTAGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAA-------GAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGT-CCGCACTATGCATCATTT-GATAACC-CCTCAA-TTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTGGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA-----------------TACTAAGT-AGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAA-CCTATAAAC---AGGGATAT------------------ATGCATTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAAACGTT-AGGG-TTCAAGTCCCTCTA-TCCCC{AT}CAAAACC--ATAT-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGAAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC-----------------ACAAATCCACTGC-CTTGAGCCC-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTACGCATTTT--------CATTATATTAT-----AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCA-----------------AGG--GGGATTTTTTCCCCTT------TTTT--------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------CCTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTGTAGAGGGAAATTATGAGC-ATTACGTTCATGCATA--- Valeriana_tripteris TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCAGAGCCCCGG------CCCTCGGGC---CGT--GGC---TCTGAA-GGACGCGGG-ACCGCAAGGGCCT--GCGA----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATGACAA-CGGAAGGGG--CGTGCTAGCCCGTTCGGCCCGTCCGCGGTGCCGGCCG---GGCGAGCGCCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACG------CCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGCGT-GGC-GGGGGGTGC-GGACGATGGCCTCCCGCGTCCCC-ATC------GGACGCGGCTGGCCCA-AAACAC--AGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---TAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGCGT-CGAAT-CGACCCA--GACGCGCT-GTCC-AC--------------------GAG---ATGG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------CTT-TTTCCGAATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGA------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GGGAAA-AAACAGCAA-CGAGC-TGCTGT--TCTGAAT------TA-GAATGATTTCCCGATCTAATAATAA-GGAAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTT--TCAAAAAA------TGG----A-TAA-TA-----TATTATCATCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAGCA-TTTCCAAAATC-----AAAAGCGCGGATAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAAAAAC-------AGAGGA----TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CCT-ATT-------ATGCCA---AAT-ACTATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCCAAAATTCTC-TACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTTGGGGCGCCATAAGAGTTTTGATTCTCCAAGGATATCAGAGGGGGTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTCTTCTAGAAACGCAAGGGAGAGA-------------------TTAGTATG?AACCCTACTAAGTGAGAACTTTCAAATTCAGAGAACCCCTGGAATTAATAAAAATGGGCAATCCTGAGGCAAATCCGGTTTTTGTTTTCCGAAAACA----------AACAAAGGACTAAAATAAA--AAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ACGCATTAAA----TATAGACT-CTACCAACTGATTAATGACGACCCGAATCTCTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCTT-CTACATGCC-ATG--------CCGGCA--CA-TG--AAT-TAGAGTAAGA-GGAAATCCC-TCGACTTTAG-GAATCGTG-AGGG-{GT}TCAAGTCCCTCTT-TCCCCAAAAAACC--ATAT-------GG----------ACTCCCCAATTATTTATT----------------CCTTTT-CTCATTATC-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTAACAA-AGAATCTGAGTGAAA-AT-G-CTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-CGTATACAAATGAGCATAGTTAAGT-----TCTTCCATAT----TGAAGAAAGTAATTCATACTC-ATTTCTC-TACTCATTCTCTACCATAGTCTGATACTAT-CTTTTGAAGATCCAATAAATT---ACCGGACCAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCATCGGCGGA-ATGGTCGG-ATAGCTC-----------------------------C-CTTGAGCCC-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTCCTAG-------A----------CCAAGG--GGGGATTTTT---ACTCCTTTTTTT---------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAACAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGG--------------------------------------- Valeriana_tuberosa TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CTGCGGAGCCCCGGC-----CCCTCGGGT---CGT--GAC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAAACCGCGTCAAGGAACATTATAA-CGGAAGGGG--CGCGCTTGCCCGTTCGGCCCGTTCGCGGAGCCGGCCG---GGCGAGCGCCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGC-GGGGGGCGC-GGACGATGGCCTCCCGCGCCTCC-ATC------GGGCGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--ACT---AAGTCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTC-CGGGTGG-CGAAT-CGACCCA--TACGCGCT-GTCC-AC--------------------GAG---ACTG--CGCTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTT--------ATT-TTTCCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGATATAGAGCCCTATGG-CTTCCATTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAA-----TTA-GAATGATT-CCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TTCAAAA-------TGG----A-TAA-TA-------------TCCATTTTGAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGCTTTCTAACCATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAAC-------AGAGGA----TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCAA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCCAAAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAAGTGGTGCTGAACAGCACT-ACTGCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTTCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCCGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAACC-ATAT-------GG----------ACTCCCCAATTCTTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G-TTTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAGCATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC-----CATGGTGGATTCACAA-TCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTTA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAA----------GGAT-AAAT-----------AAAG-CCCCCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Valeriana_urticifolia TGCATGCATGCATGCGCAGAA-CGAACC-GCGAACACGTTCAAAA-TCACGGTGCACCGGGC----CCCTCGGGC---CGT--GGC---TCCGAA-GGACGCGGCCACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGGCGCAATCCGCGTCAAGGAACATGACAA-CGGAAGGGA--CGCGTTGGCCCGTTAGGCCCGTTCCGGGTGCCGACCG---GGCAAGC{AGT}CCGACCC-TCTGATAAAA---CACAA-CAGACTCTCGACAACGAATATCTCGACTCTCGCATCAATAAAGAACGAAGCAAAATACAATACTTGGTGTTAATTCCAT----------------AATCCCGTAAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCCGAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCTCC-TCCTC--CCCCTTA-TCGGGG-CGCGGCGTGC-GCA--GGGGGCGC-GGACGATGGCCTCCCGCTCC-GC-ATC------GGGAGCGCCTGGCCCA-CCACAC--GGTCCCCCGGCGGCGGATGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGCCTCTC-CCCGTCTTT-CGGGCGG-CGAAT-CGACCCA--GACGCGCT-GTCT-AC--------------------GAG---ACAG--CGCTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCGACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGG------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTACAGTATTT-ATA-GG-AAAGAAAAACACG-AGCTC-GTCTGT--TCTTAA------TTA-GAATGCTTTCCCGATCTAATAATAA-GTTAAACATT-ATTAG-TG--CCGATCCGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTGTTTG-CCATTTT-TTTTAAA-------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-AAA--GATAAACCA------TAAAAAAAA--------GAGGAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTT--------CTT-ATTATATATTATGACA---AAT-AATATCTTGTTT-GACTGTACCGCACTATGCATCATTT-GATA-CC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGGGGAATTCAAAAGATATTTAA-GATAAGTGGGGCTGGACAGCACT-ACTT?TTG?TTTCCCTTCTTTTTCAGGGGTATATTTATGCACTTGC-TCATGATTATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTTGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTA?AAACGAAAGGGAGAGTCAAATCGCGGAATTTA------------------------------------------------------AATAAA--AAAATGGGCAATCCTGAGGCAAATCCGGTTTTTGTTTTCGGGAAACA----------AACAAAGG-CTAAAATCAA--ATAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTAAATGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAA------GAGAAAGCTCTAAAC---AGGGATAT------------------ATGCATTAAAATATTATAGCCT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGATATGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGACCGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-{AC}CAATGAAATT-TAGAGTAAGAGGAAAATCCG-T{CG}GG{AT}TTTAG-AAATCG{GT}GAGGGG--TCCAGTCCCT{CT}T{AT}-TCCCCAAAAAACCC-{AT}TAC-------GG----------{AG}CTCCCC{AC}ATTATTTACC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGTATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATGATGAATACCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAA?ACTTTATAAT?CCCCTTTAGTTGACATAGACCCGAGTTATCTAGCAAAATGA?AATGCAGCGGTGGGAATGGGTCGGATA--------GCCGTGGAGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATGTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT-----------------GAAA------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGAC-----------------CAAGG--GGGGATTTTTTCTAC--------------------TTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTAC-------------- Valeriana_urticifolia2 TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-TCACGGTGCACCGG------CCCTCGGGC---CGT--GGC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCCCGCGG----------CCGCA---AACACAACCCCGGCGCAATCCGCGTCAAGGAACATGACAA-CGGAAGGGA--CGCGTTGGCCCGTTAGGCCCGTTCGCGGTGCCGACCG---GGCGAGCGCCGACC--TCTGATAAAGA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCC-GTGAA-----------------CCA-TCGAGTCTTTGA-CGCAAGTTGCGCCCGAAGCCATTAG-CCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCTCC-GCCTC--CCCCTTA-TCGGGG-CGCGGCGTGC-G-C-AGGGGGCGC-GGACGATGGC-TCCCACTCCCGC-TTC------GGGAGCGGCTGGCCCA-AAACAC--GCTCCCCCGGAGGCGGATGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGTGG-CGATT-CGACCCA--GACGCGCT-GTCC-AC--------------------GAG---ACGG--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCGACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGG------AAAGTGAATTCATTCCATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATA?-GCTAAAAATT-ATTA--GGG-CCGATCCGGGAAGGG-TTTT-CCACGAGG-AATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTT--AAAAAAAA------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-AAA--GATAAACCA------TAAAA-AAA-------AGAGGAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATTATATATTATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAAGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTCTCTTTCAGGAGTATATTTATGCTCTTGC-TCATGATTATGGTTTAAATAGAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTTGGGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGGTTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAATCGAAAGGGAGAGTCAAATCGCGTAATTTA---TTAGTATGGAAACCTACTAAGTGAGAACTATCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGAATGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTCTAAAC---AGGGATAT------------------ATGCATTAAAATATTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACA-TGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG--AGGTTTCCAGTCCCTCTA-TCCCCAAAAAACCC-ATAC-------GG----------ACGCC------CCA-ATC-----------------CTTT--CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGTGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGTATCTTTACGT-AAGGAATTCCTATT----TGAATAATTCATGATGAATACCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTATAATACCCCTTTAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC-CGCGCAGGTGGA-TTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAAA------AAAAA----------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGAC-----------------CAAGG--GGGAATTTTTTCTAC------TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAG--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCCAGAGCAGCTTAGGCTAGAGGGAAATTATGAGG-ATTATGTTCTGT------- Valeriana_urticifolia3 TCGATGCCTGCATGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-TCACGGTGCACCGG------CCCTCGGGC---CGT--GGC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCCCGCGG----------CCGCA---AACACAACCCCGGCGCAATCCGCGTCAAGGAACATGACAA-CGGAAGGGA--CGCGTTTGCCCGTTAGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGCCAACCC-TCTGATAAAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCTCC-GCCTC--CCCCTCA-TCGGGG-CGCGGCGTGC-GGCAGGGGGGCGC-GGACGATGGCCTCCCGCGCCCGC-ATC------GGGAACGGCTGGCCCA-AAACAC--GCTCCCCCGGCGGCGGATGTCACGGCGAGTGGTGGTCG--AAT---AAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCTTT-CGGGTGG-CGATT-CGACCCA--GACGCGCT-GTCC-AC--------------------GAG---ACGG--CGTTCCGAATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGATGAATTCTTAGAATATTTT--------CTTGTT-CCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCAGTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTAAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCCATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTT--TTAAAAAA------TGG----A-TAA-TA-----TATTA---TCCATTTTGGAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TAAAA-AAA------AGAG-GAT---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-CATAACC-CCTCAAATTCTCG-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGATGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGGTTTAAATACAGCACATTTATTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGTATTTTTGGGGC-----------------------------------------------------------------------------------------------------------------------------TTAGTATGGAAACCTACTAAGTGAGAACTATCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATCA---AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGAATGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTCTAAAC---AGGGATAT------------------ATGCATTAAAATATTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGGATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTC?CTCCAT---AGTCTGATCAATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAA-TCCG-TCGACTTTAG-AAATCGGGAGGGG--TCCACTCCCTCTA-TCCCCACAACCCCC-ATCC-------GC----------GCGCCCCAAT-------C-----------------CTTT--CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCCGAGGGAAA-AT-G-TTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-TGTGTACAAATGAGTATCTTTACGT-AAGGAATTCCTATT----TGAATAATTCATGATGAATACCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-C-TTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTATAATACCCCTTTAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGG-GGGAATGGTCGGGATAGCTC----------------------------------GAGCCC-CTTGGCTACCTCCGCCCCCA-GCGAGGA-CTCTTATTTA-GATTAATCA-ATCTATTTCTGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTAT----------AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCCCTTGCTAGACCA----------------AGGG--GGAA-TTTTTTCT-AC-----TTTTTT-------CTTTT-T---------------TCAAAAA-----CTCATATAC--------------ACTAAGAATAGGTC-TTATCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAAGTCTAGAGGGAAATTATGAGC-ATTACGT------------ Valeriana_wallrothi TCGATGCCTGCACGCGCAGAA-CGACCC-GCGAACACGTTCAAAA-CTGCGGAGCCCCGGC-----CCCTCGGGC---CGT--GAC---TCCGAA-GGACGCGGG-ACCGTAAGGACCCC-GCGG----------CCGCA---AACACAACCCCGG{CT}GCAAAC{CT}GCGTCAAGGAACATTATAA-CGGAAGGGG--CGCGCTGGCCCGTTCGGCCCGTTCGCGGTGCCGGCCG---GGCGAGCGCCAACCCCTCTGAGAAAAA--CACAA-ACGACTCTCGGCAACGGATTTCTCGGCTCTCGCATCGATGAAGAACGTAGCCAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-G?CTC--CCGCCCC-TCGGGG-TGCGTCGCGC-GGA-CGGGGGCGCCGGAAGATGGCCTCCCGCGATCGC-TTC------GATCCCGGCTGGCCCA-AAACAC--TGTCCCCCGGAGG?GGACGTAAAGG?GAGTGGTGGTCG--AAT---CAGCCCTCT--CTTCGCGCCGTTTCTATC-CCCGCCT-C-CGGGTGG-CGAAC-CGACCCT--CGCGCGAC-GTCC-TC--------------------GAG---ACGG--CGCTCCGAATGAAGTGATGCATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTT--------ATT-TTTCCGGATCAGTATTAAAA--------CTTG-GTTTAAT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GGGAAAGAAAAAGCAC-CGAGC-TTCTGT--CTTAAAT------TA-GAATGATTTCCCGATCTAATAATAA-GTTAAAAATTTATTAG-TG-CCTGATACGGGAAGGG-TTTTTCCACGAGTGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTTT-TTCAAAA-------TGG----A-TAA-TA-------------TCCATTTTGAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGACTTTCTAACTATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAAC-------AGAGGA----TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCAA-GG-ATCTATTT-GTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGGCTGTACCGCACTATGCATCATTT-GATAACC-CCCAAAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAAGTGGTTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCACTTGC-TCATGATCATGATTTAAATAGAGCGCATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTAAAACGTTTAATTACTCGAA---------------------------------------CTAACCAAAATGCATTTTGGAGGCGCCATAAGAGTTTTGATTCTCAAAGGATATCAGAAGGATTTTCGATCATTGTAGAAATTCCATTTTCTCTACGATTCTTATCTTTCTTAGAAACGAAAGGGAGAGTCAAATCGCGGAATTTA---TTAGGATGAAACCT--ATAAGT-AGA-CCTTCAA-TTCAAAGAACCC?TGGA-TTAATAAAA-TGG?CAATCC?TGAGC?AATCCGGTTTTTGTTTCCGGAAACCA-----------ACCAAAGGCTAAATCCA---AAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAAGCTATAAAC---AGGGATAT----------------------ACTAAAATACTATAGACT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTT-A-GAATCGTA-GGGG-TCCAAGTCCCTCTA-TCCCCAAAAAACCC-ATAT-------GG----------ACTCCCCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAGTTAT---------CTTTCTCATTCACCCT------ACTCTTTTACAAA-GAGATCTGAGTGAAA-AT-G--TTTTTTCTTATCAATCACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGAACATCTTTACGT-AAGGAATCCCTATT----TGAATAATTCATAATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTT-GAAGATCCAATAAATT---ACCAGACGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC--------GGTGGATTCACAAA?CCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCGAGGA-CTATTATTTA-GATTAATCA-ATCTATTT?TGACTGTTTTTT----------------------CAAGAACATATGTCA-GTTAA--------ATACTATGCATTTT--------CATTATTTCATTAT--AATGAAAGAA-------AAAAAA---------GGAG-AAAT-----------AAAG-CCCC---CCTAG-------A----------CTCAGG--GGGAAGGTTG---TCTCCTTTTTTTTT-------CTTTG-T---------------TCAAAAA-----CTCATATAC--------------TCTAAGAACTGGTC-TTATCC-?TTCGTTT?TGGAG-C?GCAAG?GCAGCT?AGCCTAGAGGGAAA?GATGAGC-?TTACGT------------ Valerianella_amarella TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAACCA------------------------------------------------GGACGCGGG-AACGAAAGGACCC--GCGT----------CCGGCG--AACCCAACCCCGGCGCAAATCGCGTCAAGGAAAATGA?AA-CGGAACGGG-GCGCGCTGGCCCGGACGGCCCGTTTGCGGAGCCGGTCG--GGGTGGCGTCTGC?CCGTCTGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGT?GCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-GCACCCGTCTC--CCCAAAA-AAAAGG-GGCGGCGGGC-GGC-GGGGGGCGC-GGACGGTGGCCTCCCGCTTCCCC-T??------GGACGCGGCTGGCCCA-AAACAA--GGTCCCCCGGCGGCGGACGTCGCGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGCGGCCCCT-CCCGTCCTC-CGGGCGG-CGAAA-CGACCCA--ACGGCGC-TCT---------------------------------------------ATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTT???AGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA---CGTAGTTTAATTATTGAT----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GG-AAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAATTTTAATTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TGC-CTGATACGGGAAGGGTTTTTA-CACGAGTGAATTCTCTATTTTTT-TATGAATCCTAA-TTATTTTTTG-CCATTT--TTTATAAAAA----TGG----A-TAG-TA-----TATTA---TCCATTTTGAAATGGAAATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTAGAAC-GAA--GATAAACCA------TAAAAAAAA------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGTACTATGCATCATTT-GATAACC-CCCCAAATTCTCT-ACTCTTCA-AATTTTAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTTGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAATAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGAAGTTAACTGTGTT-----GGTAAAAAGAATCCTTGCATAGAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCG-CTAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTCGTATGATCTAA-----------------------------------------------------------------ATGAGTATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAAATCCAAAAAATT---GCTGGATTAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGTCGGCACTGGTCGGGATAGCTC--GCGCATGGTGGATTCACAA-TCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAGGA-CTATGATTTA-GATGAATCA-ATCTATTTCTAACTGTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTATGCATTTT--------CATTCTA----------ATGAAAGAA------AAAAGA-----------GA---AAG-----------AAAG-CCCCCTTCCTAGACCAAGGGGGTATTTTTTCTCT-----------TTTTTA--TATTTATAGA-------------------------------TTAGGA------CTCGTATA---------AAACCACTTAAA--------------C-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAGGTCTAGAGGGAAGTTATGAGCATTACGTTCATGCATAAC-- Valerianella_carinata TCGATACCTGCAATCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CCGCGGGGCGCCGG------CTTCGGGGC---CGT--CG----TCCCGA-AGGACGCGG-GAACGAAAGGACCC-GCGG----------CCGCC---AACCCAACCC{CG}GGCGCAAACCGCGTCAAGGAACATGATAAACGGAAGGGG--CGCGCGGCTCGCACGGCTCCGTTCGCGGAGACGGACG---GGCGGGCGCCGTCCCCTCTGAAAAAGAAACACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCT--CCCC-GTCTC-------------------------GG-GGA-GCGGGGCGC-GGACGATGGCCTCCCGCTTCCCTCACC------GGACGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCCTC-CGGGCGG-CAGAA-CGACCCA--ACGGCGC-TCG-GCCCGTC-----------------AAAAAGGCGGAGCGCTCCGAATGAAGTGATGGATTCGTCTATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATGTGGAAAGGGAATGGTTGGAAAAAATAGCATGTCGTATCAACGAAGAGTTTTGAGAATATTTT--------ATTTTT-CCGGATCGGTATTCCAA--------TTTT--TTTTGT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCCAATGGATAAATGGATAGAGATAGCGCCCTGTGC-CTTCAATTAATT-AGA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA-----ATTA-GAATGATTTCCCGATCTAATAAGAA-GTTAAAATTTTATTAG-TG-CCCGATACGGGAAGGCTTTTTGCTACGAGTGAATTCCTCATAATTG-AATGAATCCTAA-TTATTTATAA-CCATTC--GTTAATAAA-----TGG----A-TAA-TA-----TATTA---TCCATTTTGGACTGGAAACGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTGCAAAATC-----AAAAGCGCGGGTCCGTTCATAAAATAAAGGGTT-CTAACCACTCTGTTTTGTTAT-CTTATAAC-GAA--GATAAATCA------TTAAAAAA-------CAGA-GAA---TAGAGAG-TGT-GTTG-ATAAG-TC-TA-TTTCGAT-CCGA-GGTATCTA-TTTTTTT-------CTT-ATT-------AAAACA---AAT-AATATCTTGTTTTGACTGTACCGCAGTATGCATCATTT-GATAACC-CCCCAAATCCTC--ACTCTTCGTAAATCGACTTTAAATGGAGGAATTCCAAAGATATTTAAAGATAGGTGGATCTGAACAACACT-ACTTTTTATATCCACTTATCTTTCAGGAGTATATTTATGCCCTTGC-TCATGATCATGGTTTAAACAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGCGAAACGTTTAATTTCTCGGATGTATAAAAAGAATCCTTTTGTTTTTTCTGGTAAGCACTCTAATCAAAATGCATTTTGGGTGCGCAATAACAGTTTTGATTCTCAAAGGATATCAGAGGGATTTTCGGTCATTGTAGAAATTCCATTTTCT---------------TTTTTGGAAAAGAAAGGGAGAGTCAAATCTCGGAATTTA---TTAGTATGAAACCTA-CTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAATCCGGTTTTTGTTTTCCAAAAACA----------AACAAAGG-CTAAAATCACAAAAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTGACTGGGTT-----GGTAAAAAGAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTATAAAC---AGGGATAT------------------ACGCATTAAAATACTATAGATT-CTACCAACTGATTAATGACGACCCGAATCTGTATTATCAAAAT----------------GGGAAAATGAT-TGTGAATTGATTCCATATTGAAGAAAGAATCGA-ATACTCATTGATCAAATCATTCACTCCAT---AGTCTGATCGATC-TTTTGAAGAAC----TGATTA-ATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGCCAATG--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGACTTTAG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAAAACC-ATAT-------GG----------ACTCCTCAATTATTTATC-----------------CTTTT-CTTATTATT-------AGCGGAG---------TTATCTTTCTCATTCACCCTACTCTTTATCTTTTACAAA-GAGATCCGAGTGAAA-AT--GTTTTTTTCTTATC----ACAAGTCTTATGATCTAAGATAATA-CGTGTACAAATGCGCATCTTTACGTAAGCGAATCCCTATT----TGAATAATTCATGATGAATATCATTAT------TCATACTGAAACTTA--TAAAGTCTTT-CTTTTGAAGATCCAATAAATT---ACCGGATGAGGATAAGACTTTGTAATACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGGTGGGAATGGTCGGGATAGCTC---------GTGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAGGA-CTATGATTTA-GATGAATCA-ATCTATTTCTAACTGTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTATGCATTTT--------CATTCTA----------ATGAAAAAA-------AAAGA-----------GTC-CAAG-----------AAAG-CCCCCTTCCTAGACCTAGGGAG----CATTTTTT----------CTCTTTTTTCTTTTATAGA-------------------------------TTAGGA------CTCATATAC--------------ATTACGAACAGGTC-TTACCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAGGTCTAGAGGGAAGTTATGAGC-ATTACGTTCATG------- Valerianella_cornata TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CCGCGGTGCGCCGG------CCTCCGGGC---CGT--CGC---TCCGAA-GGACGCGGG-AACGCAAGGACCC--GCGG----------CCGCC---AACCCAACCCCGGCGCAAACCGCGTCAAGGAATATGATAA-CGGAATGGG--CGCGCGAGCCTGCACGGCCCGTTTGCGGAGACGTGCG---GGCGAGCGCCGACCCGTCTGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATAGCGTCGCCCCCCC-ACCCC-GTCTT--CCCTGCT-AAAGGG-CATG-CGCGC-GGC-GGGGGGCGC-GGACGGTGGCCTCCCGCTTCCCA-AGC------GGACGCGGCTGGCCTA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGTGTCTCTC-CCCGTCCTC-CGGGCGG-CATAA-CGACCCA--ACGGCGC-TCG---------------------------------------------ATGA-GTGATGGATTCGTCTACACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGTTGGAAAAAATAGCATGTCGTATCAACGAAGAGTTTTGAGAAGATTTT--------ATTTTT-CCGGATCGGTATTCAAA--------TTTTTTTATTGG-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCCAATGGATAAATGGATAGAGATAGCGCCCTGTGG-CTTCAATTAATT-AGA-GGGGAAAAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATAATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGAATTTTCCTACGAGTGAATTCCTCATAATTG-AATGAATCCTAA-ATTATTATAA-CCAGTCG-TTAATAAA------TGG----A-TAA-TA-----TATTA---TCCATTTTAGACTGGAAACGTGTGTCTAAAAGAAAC-AGTATATT-GAGCAAAACA-TTTCTAAAATC-----AAAAGCGCGGTTCCGTTCACACAATAAAGGGTTTCTA-CCACTCTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TTAAAAAA-------CAGA-GCA---TAGAGAG-TCT-GTTG-ATAAG-TC-TA-TTTGGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------AAAACA---AAT-AATAGCTTGTGT-GACTGTACCGCAGTATGCATCATAT-GATAACC-CCCCAAATCCTC--ATATTGTATAAATCGACTTTCAATGGAGGAATTTCAAAGATATTTAAAGATAGGTGGATCTGAACAACACT-ACTTTTTATATCCACTTATCTTTCAGGAGTATATTTATGCCCTTGC-TCATGATTATGGTTTAAACAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGCGAAACGTTTCATTTTTCGAATGTATAAAAAGAATCTTTTTGTTTTTTCTGTTA------AGCATTCTAATGCATTTTGGGTGCGCAATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGATTTTCGGTCATTGTAGAAATTCCATTTTCTCTACAATTTTTTTCTTTCTTAGAAAAGAAAGGGAGAGTCAAATCTCGGAATTTA----TGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA--GGAAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTAACTGTGTT-----GTTAAAAAGAATCCTTCCATATAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCT-ATAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTGT-ATGATCTAA-----------------------------------------------------------------ATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---GCTGGATCAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGTCGGCAATGGTCGGGATAGCTC---------GTGAATTCACAAATCCACT-C-CCTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAAGA-CTAGGATTTA-GCTGAATCA-ATCTATTTCTAACTGTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTAGGCATTTT--------CATTCTA----------ATGAAAAAA-------AAAGA-----------GA---AAA-----------AATT-CTCCCTTGGTCTAGGAAGGGGC----CTTTCTTT----------CTCTTTTTTCTTTTAGAGATTT-----TCTTTTATAGATATAG------ATTAGGA------CTCGTATACATTAAA-------CATTACGAACAGGTC-TTACCC-ATTTGTAGATGGAG-CTTCAAGAGCAG-CAG----------------------------------------- Valerianella_dentata TCGATACCTGCACGCGCAGAA-CGACCC-GTGAACACGTTTAAAAACCG?GGCGCTGTGG------CCTCCGGGC---CGT--CGC---GCCGAG-AGACGCGGG-AACGCAAGGACCC--GTGG----------TCGCC---AACCCAACCCCGGCGCAAACCGGGTTAAGGAACATGATAA-CGGAAGGGG--CGCGCGAGCCCGCACGGTCCGTTTGCGGTGCCGGTCG---GGCGAGCGTCGTGCCGTCTGAAAGAA---CACAA-ACGACTTCTGGCAACGGATATTCTGGCTCT-GCATCGATGAAGAACGTA-CGAAATGCGATACTTGGTGTGAATGGCAG----------------ATTCCTGTGAA-----------------CCA-TCGAGTCTTGGAACGCAAGTTGCGCCCGAAGCCATAAGGCGGAGGGCACGCTTGCTTGGGCGTTACGCATGGGGTGGCCCCCCC-ACCCC-GTCTT--TCCTTTT-CGAAGG-GCCGGCGCGC-GG?-GGGGGGCGC-GGACGGGGGCCTCCCGCTTCCCC--AC------GGACGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGG?GAGTGG?GGTCG--AAT---CAGCCCTC---TTTCGCGCCG?GGCCCTT-CCCGTCCTT-CGGGCGG-CAAAA-CGACCCC--ACG-CGC-TCT---------------------------------------------TTGATGTGATGGATTCGTCTATACCATCGGTAAAGTTGGGAAGACCGCG-ACTGATGTGGAGAGGGAATGGTTGGAAAAAATAGCATGTTGTATCAACGAAGAGTTTTGAGAATATTTT--------ATTTTT-CCGGATCGGTATTCCAA--------TTTT--TTTTGT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTGAAGTTGGGTCCAATGGATAAATGGATAGAGATAGCGCCCTGTGC-CTTCAATTAATT-AGA-GGGAAAGAAAAAGCAA-CGAGC-TTTTGT--GCTTAA-----ATTA-GAATGATTTCCCGATCTAATAAGAA-GTTAAAATTTTATTAG-TG-CCCGATACGGGAAGGCTTTTTGCTACGAGTGAATTCCTCATAATGG-AATGAATCCTAA-TTATTTATAA-CCATTCG-TAATAAA-------TGG----A-TAA-TA-----TATTA---TCCATTTTGGACTGGAAACGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTGCAAAATC-----AAAAGCGCGGGTCCGTTCATAAAATAAAGGGTTTCTAACCACTCTGTTTTGTTAT-CTTATAAC-GAA--GATAAATCA------TTAAAAAA-------CAGA-GAA---TAGAGAG-TCT-GTTG-ATAAG-TC-TA-TTGCGAT-CCGA-GGTATCTA-TTTTTTT-------CTT-ATT-------AAAACA---AAT-AATATATTGTTTTGACTG-ACCGCAGTATGCATGATTT-GATAACC-CGCCAAATCCTC--ACTCTGCGTAAATCGACTTTAAATGGAGGAATTGCAAAGATATTTAAAGATAGGTGGATGTGAACAACACT-ACGGTGTATATGCACTGATCTTTCAGGAGTATATTCATGCGCTTGC-TCATGATCATGGTTTATACAGAGCACATGGAT-GGAAAATGTAGGGTGTGACAATTAATATAGCTTACTAGTTGCGAAACGTTTAATTTTTCGGATGTATAAAAAGAATCCTTTTGATTATTCTGGTTGGCACTCTAATCAAAATGCATTTTGGGGGCGCAATTAGCGTTTTGAGTGTTAAAGGGTATCAGAGGGATGTCCGTTCATTGTAGAAATTCCATTTTCT--------------TT-TTTGGGAAAGAAAGGGAGAATCAAATTTGGGAATTTA----TGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCCTAAAACA----------AACAAAGG-CTAAAATCAA--AAAA--GGAAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTAACTGTGTT-----GGTAAAAAAAATCCTTCCATAGAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCT-ATAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTGT-ATGATCTAA-----------------------------------------------------------------ATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAAA{AC}AATT---GCTGGATTAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGTCGGCAATGGTCGGGATAGCTC--GCGCATGGTGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAGGA-CTATGATTTA-GATGAATCA-ATCTATTTCTAACTGTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTATGCATTTT--------CATTCTA----------ATGAAAGAA-------AAAGA-----------GTC--AAG-----------AAAG-CCCCCTTCCTAGACCTAGGGAG----CATTTTTT----------CTCTTTTTTCTTTTATAGA-------------------------------TTAGGA------CTCATATAC--------------ATTACGAACAGGTC-TTACCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAGGTGTAGAGGGAAGTTATGAGC-ATTACGTTCATGCATAA-- Valerianella_discoidea TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CCGCGGTGCGCCGG------CCTCCGGGC---CGT--CGC---TCCGAA-GGACGCGGG-AACGCAAGGACCC--GCGG----------CCGCC---AACCCAACCCCGGCGCAAACCGCGTCAAGGAATATGATAA-CGGAATGGG-GCGCGCGAGCCAACACGGCCCGTTTGCGGAGACGTGCG--GGCGAGCGCTGACCCCGTCTGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GTCTT--CCCTGCT--AAAGG-GCATGCGCGC-GGC-GGGGGGCGC-GGACGGTGGCCTCCCGTTTCCCT-AGC------GGACGCGGCTGGCCTA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGTGGCTCTC-CCCGTCCTC-CGGGCGG-CATAA-CGACCCA--ACGGCGC-TCG---------------------------------------------ATGAAGTGATGCATTCGTCCATACCA???GTAAAGTTTTGAAGACCGCG-ACTGATC?GGAA?GGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA---CTTGGTTTAAT-----------TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGATATAGAGCCCTATGG-CTTCCATTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAA-----TTA-GAATGATT-CCCGATCTAATAATAA-GTTAAAATTTT{AT}TTAG-?GC-CTGATACGGGAAGGGT?TTTCC-ACGAGTGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTT--TTTCAAAA------TGG----A-TAA-TA-------------TCCATTTTGAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGT{GT}GAAAAAATAAAGGCTTTCTAACCATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAA-------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCAA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCCAAAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAAGTGGTGCTGAACAGCACT-AC?GCTTGTATCCACTTATCTTTCAGGAGTATATTTATG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTTGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTAACTGTGTT-----GTTAAAAAGAATCCTTCCATAGAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCT-ATAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTCGTATGATCTAA-----------------------------------------------------------------ATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---GCTGGATCAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGTCGGCAATGGTCGGGATAGCTC--?CGCATGGTGGATTCACAA-TCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAAGA-CTAGGATTTA-GCTGAATCA-ATCTATTTCTAACTGTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTAGGCATTTT--------CATTCTA----------ATGAAAGAA------AAAAGA-----------GA---AAA-----------AATT-CTCCCTTAGTCTAGGAAGGGGCCTTTCTTTCTCT--------------TTTTTCTTTTAGAGA-------TTTTCTTTTATAGATAGAAGA---TTAGGA------CTCGTATACATTA-------AACATTACGAACAGGTC-TTACCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAGGTCTAGAGGAAAGTTATGAGCATTACGTTCATGCATAA?-- Valerianella_eriocarpa TCGATACCTGCACGCGCAGAA-CGACCC-CGGAACACGTTTAAAAACCGCGGCGCTTCGG------CCTCCGGGC---CGT--CGC---GCCGAA--GACGCGGG-AACGCAAGGACCC--GCGG----------CCGCC---AACCCAACCCCGGCGCAAACCGCGTCAAGGAACATGATAA-CGGAAGGGG--CGCGCGAGCCCGCACGGCCCGTTTGCGGTGCCGGTCG---GGCGAGCGTCGTCCCGTCTGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-ACCCC-GTCTT--CCCTTCT-CGAAGG-GCCGGCGCGC-GGC-GGGGGGCGC-GGACGGTGGCCTCCCGCTTCCCC-AGC------GGACGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--TTTCGCGCCGTGGCCCTC-CCCGTCCTCCGGGGCGG-CAAAA-CGACCCA--ACGGGGC-TCG---------------------------------------------ATGAAGTGATGGATTCGTCTATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATGTGGAAAGGGAATGGTTGGAAAAAATAGCATGTCGTATCAACGAAGAGTTTTGAGAATATTTT--------ATTTTT-CCGGATCGGTATTCCAA--------TTTT--TTTTGT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCCAATGGATAAATGGATAGAGATAGCGCCCTGTGC-CTTCAATTAATT-AGA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA-----ATTA-GAATGATTTCCCGATCTAATAAGAA-GTTAAAATTTTATTAG-TG-CCCGATACGGGAAGGCTTTTTGCTACGAGTGAATTCCTCATAATTG-AATGAATCCTAA-TTATTTATAA-CCATTC--GTTAATAAA-----TGG----A-TAA-TA-----TATTA---TCCATTTTGGACTGGAAACGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTGCAAAATC-----AAAAGCGCGGGTCCGTTCATAAAATAAAGGGTT-CTAACCACTCTGTTTTGTTAT-CTTATAAC-GAA--GATAAATCA------TTAAAAAA-------CAGA-GAA---TAGAGAG-TGT-GTTG-ATAAG-TC-TA-TTTCGAT-CCGA-GGTATCTA-TTTTTTT-------CTT-ATT-------AAAACA---AAT-AATATCTTGTTTTGACTGTACCGCAGTATGCATCATTT-GATAACC-CCCCAAATCCTC--ACTCTTCGTAAATCGACTTTAAATGGAGGAATTCCAAAGATATTTAAAGATAGGTGGATCTGAACAACACT-ACTTTTTATATCCACTTATCTTTCAGGAGTATATTTATGCCCTTGC-TCATGATCATGGTTTAAACAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGCGAAACGTTTAATTTCTCGGATGTATAAAAAGAATCCTTTTGTTTTTTCTGGTAAGCACTCTAATCAAAATGCATTTTGGGTGCGCAATAACAGTTTTGATTCTCAAAGGATATCAGAGGGATTTTCGGTCATTGTAGAAATTCCATTTTCT---------------TTTTTGGAAAAGAAAGGGAGAGTCAAATCTCGGAATTTA----TGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCCTAAAACA----------AACAAAGG-CTAAAATCAA--AAAA--GGAAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTAACTGTGTT-----GGTAAAAAAAATCCTTCCATAGAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCT-ATAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTGT-ATGATCTAA-----------------------------------------------------------------ATGAATATCATTAT------TCATACTGAAACTTA--CAAAG-CTTT-CTTTTGAAGATCCAAAAAATT---GCTGGATTAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGTCTGCAATGGTCGGGATAGCTC---------GTGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAGGA-CTATGATTTA-GATGAATCA-ATCTATTTCTAACTGTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTATGCATTTT--------CATTCTA----------ATGAAAAAA-------AAAGA-----------GTC-CAAG-----------AAAG-CCCCCTTCCTAGACCTAGGGAG----CATTTTTT----------CTCTTTTTTCTTTTATAGA-------------------------------TTAGGA------CTCATATAC--------------ATTACGAACAGGTC-TTACCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAGGTCTAGAGGGAAGTTATGAGC-ATTACGTTCATG------- Valerianella_florifera TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CA----------------------------------------------A-GGACGCGGG-AACGCAAGGACCC--GCGG----------CCGAAA--AACCCAACCCCGGCGCAAATCGCGTCAAGGAATATGACAA-CGGAACGGA-GCTCGCGAGCCCGGACGGCCCGTTTGCGGAGCCGGTCG--GGCGAGCGTCTGCCCCGTCTGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-ACCCC-GTCTC--CCCCGAT-AAAGGG-GCGG-CGAGC-GGC-GGGGGGCGC-GGACGTTGGCCTCCCGCTTCCCC-TGC------GGACGCGGCTGGCCCA-AAACAC--TGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGTGGCCCCT-CCCGTCCTC-CGGGCGGCGACGA-CGACCCA--ACGGCGC-TCT---------------------------------------------ATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTT???AGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA---CGTAGTTTAATTATTGAT----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GG-AAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAATTTTAATTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TGC-CTGATACGGGAAGGGTTTTTA-CACGAGTGAATTCTCTATTTTTT-TATGAATCCTAA-TTATTTTTTG-CCATTT--TTTATAAAAA----TGG----A-TAG-TA-----TATTA---TCCATTTTGAAATGGAAATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTAGAAC-GAA--GATAAACCA------TAAAAAAAA------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGTACTATGCATCATTT-GATAACC-CCCCAAATTCTCT-ACTCTTCA-AATTTTAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTTGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAATAATGGGTAATCCTGAGCCAAATCCCGT{GT}TTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGAAGTTAACTGTGTT-----GGTAAAAAGAATCCTTGCATAGAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCC??TCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCT-CTAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTCG?ATGATCT?A-----------------------------------------------------------------ATGAGTATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAAATCCAAAAAATT---GCTGGATTAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCC?AGTTATCTAGCAAAATGAGAATGCAGCGTCGGCACTGGTCGGGATAG---TCGCGCATGGTGGATTCACAA-TCCACTGC-CTTG????A-CTTGGCTACATCCGCCCCCA-GCTAGGA-CT??GATTTA-GATGAATCA-ATCTATTTCTAACTCTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTATGCATTTT--------CATTCTA----------ATGAAAGAA------AAAAGA-----------GA---AAG-----------AAAG-CCCCCTTCCTAGACCAAGGGGGTATTTTTTCTCT--------------TTTTT-----ATAGA-------------------------------TTAGGA------CTCGTATA---------AAACCACTTAAA--------------C-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAGGTCTAGAGGGAAGTTATGAGCATTACGTT??TGCATAA?-- Valerianella_locosta TCGATACCTGCAATCGCAGAA-CGACCC-GCGAACATGTTTTAAAACCGCGGGGCGCCGG------CCTTCGGGC---CGT--CGT---CCCGAA-GGACGCGGG-AACGAAAGGACCC--GCGG----------CCGCC---AACCCAACCCCGGCGCAAACCGCGTCAAGGAACATGAAAAACGGAAGGGG--CGCGCCGGCCCGCACGGCCCGTTTGCGGAGACGGACG---GGCGGGCGCCGTCCCCTCTGAAAAAGAAACACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GTCTC---------------------------GGGGAGCGGGGCAC-GGACGATGGCCTCCCGCTTCCCTCACC------GGACGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCCTC-CGGGCGG-CAGAA-CGACCCA--ACGGCAC-TCG-GCCCGTC-----------------AAAAAGGCGGAGCGCTCCGAATGAAGTGATGGATTCGTCTATACCATCGGTAAAGTTTTGACGACCGCG-ACTGATCTGGAAAGGGAATGGGTGGAAAAAACAGCATGTCGTATCAACGAAGAGTTTTAATAATATTTT--------ATTTTT-CCGGATCGATATTCAAA--------TT---------------TATTGAAACGGAGT------AAATTGAATTCATTCAATTTCACGTTGGGTCCAATGGATAAATGGATAGAAATAGTGTCCTGTGG-CTTGAATTAATT-AGA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGGTTTTTCCTACAAGTGAATTCTTCATTTTTT-AATAAATCCTAA-TTATTTATGA-CCATTCTATTATTAATA-----TGG----A-TAA-TAGTCTATATTA---TCCATTTTAGACTGGAAACGTGTGTCTAAAAGAAAT-AGTATATT-GATCAAAAAA-TTTCCAAAATC-----AAAAGCGCGG?TCCGTTCACAAAATAAAGGGTTTCTAACCACTCTGTTTCTTTAT-CTTATAAC-AAA--GATAAA-CC------CTCAAAAA-------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TC-GA-CTTAGAT-CCAA-GGTATCTA-TTTGTTT-------CTT-ATT-------AAGTCA---AAT-AATATCTTCTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCCCAAATCCTCG-CTCTTCGT-AAATCGCTTTTAAATGGAGGAATTCCAAAGATATTTAAAGATAGGTGGGTCTGAACAACACT-ATTTCTTGTATCCACTTATCTTTCAGGAGTATATTTATGCCCTTGC-TCATGATCATGATTTAAATCGAGCACATTTGTTGGAAAATGCAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGGTTAATTTTTCGAATGTATAAACAGAATCCTTTTGTTTTTTCTGTTAAGCATTCTAATCAAAATACATTTTGGGTGCGCAATAAGAGTTTTGATTCTCAAAAGATATCAGAGGGATTTTCGGTCATTGTAGAAATTCCATTTTCTCTACCATTCTTTTCGTTCTTAGAAAAGAACGGGAGATTCAAATCTCGGAATTTA----TGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATGAA--AAAA--GGAAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTAACTGTATT-----GGTAAAAAAAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCAAATCGATCACTCCCT---AGTCTGATCGATC-TTTTGAAGAAC----CGATTA-ATCGCACAAGAATAAAGATAGAGTCCTATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTTG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCT-ATAT-------GG----------AGTCCCTAATTATATAGC-TTTTTTT------------------------------------------------------------------------------------------------------------CTTTTTTCTTA---------AGTCTTATGATCCAAGATAAGA-CGTGTACAAATGAGCATCTTTACGT-AAAGAATC---ATT-------ATA-TGAATAATTCATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT------GAAGATCCAAGAAATT---ACTGGATCAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTCTCTAGCAAAATGAGAATGCAGCGTCGGCAATGGTCGGGATAGCTC--------AGGGGATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCTA-GCTAGGA-CTAGGATTTA-GATTAATCA-ATCTATTTCTAACTGTTTTTT----------------------CAAGACCGTAGGTCA-GTTAA--------ATACTATGCATTTT--------CATTCTA----------AATAAAAAA-------AAAGA-----------GA---AAT-----------AAAG-CCCCCTTCCTAGACCAAGGAAGGCTTTTTTCTCTATATATTTCTATTTTCTTTTATAAAATTATAATATATTTATATATATATATAATTAAATATTAGAAAATTTTTTCTCTTACATTA---------TATTAAGAACAGGTC-TTACCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTGG-TCTAGAGGAAGGTTATGAGC-ATTCGTTCT---------- Valerianella_locusta2 TCGATACCTGCAATCGCAGAA-CGACCC-GCGAACATGTTTTAAAACCGCGGGGCGCCGG------CCTTCGGGC---CGT--CGT---CCCGAA-GGACGCGGG-AACGAAAGGACCC--GCGG----------CCGCC---AACCCAACCCCGGCGCAAACCGCGTCAAGGAACATGATAAACGGAAGGGG--CGCGCCGGCCCGCACGGCCCGTTTGCGGAGACGGACG---GGCGGGCGCCGTCCCCTCTGAAAGAAAAACACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-GTCTC---------------------------GGGGAGCGGGGCGC-GGACGATGGCCTCCCGCTTCCCTCACC------GGACGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGTGGCCCTC-CCCGTCCTC-CGGGCGG-CAGAA-CGACCCA--ACGGCGC-TCG-GCCCGTC-----------------AAAAAGGCGGAGCGCTCCGAATGAAGTGATGGATTCGTCTATACCATCGGTAAAGTTTTGACGACCGCG-ACTGATCTGGAAAGGGAATGGGTGGAAAAAACAGCATGTCGTATCAACGAAGAGTTTTAATAATATTTT--------ATTTTT-CCGGATCGATATTCAAA-------------TT----------TATTGAAACGGAGT------AAATTGAATTCATTCAATTTCACGTTGGGTCCAATGGATAAATGGATAGAAATAGTGTCCTGTGG-CTTGAATTAATT-AGA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TGC-CTGATACGGGAAGGGTTTTTCCTACAAGTGAATTCTTCATTTTTT-AATAAATCCTAA-TTATTTATGAACCATTC-TATTATTAATA----TGG----A-TAA-TAGTCTATATTA---TCCATTTTAGACTGGAAACGTGTGTTTAAAAGAAAT-AGTATATT-GATCAAAAAA-TTTCCAAAATC-----AAAAGCGCGGTTCCGTTCACAAAATAAAGGGTTTCTAACCACTCTGTTTCTTTAT-CTTATAAC-AAA--GATAAACCC------TCAAAAAA-------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-T-CGA-CTTAGAT-CCAA-GGTATCTA-TTTGTTT-------CTT-ATT-------AAGTCA---AAT-AATATCTTCTTTTGACTGTACCGCACTATGCATCATTT-GATAACCCCCCCAAATCCTCG-ACTCTTCGGACTTTT-----AAATGGAGGAATTCCAAAGATATTTAAAGATAGGTGGGTCTGAACAACACT-ATTTCTTGTATCCACTTATCTTTCA?GAGTATATTTATGCCCTTGC-TCATGATCATGATTTAAATCGAGCACATTTGTTGGAAA-T-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTT?????GG??ACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCGGAAAACA----------AACAAAGG-CTAAAATGAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATAGAGTTAACTGTATT-----GGTAAAAAAAATCCTTCCATAGAAACTTCAGAAAAGAAAGGAGAAACCTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCAAATCGATCACTCCCT---AGTCTGATCGATC-TTTTGAAGAAC----CGATTA-ATCGCACAAGAATAAAGATAGAGTCCTATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTTG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCT-ATAT-------GG----------AGTCCCTAATTATATAGC-TTTTTTT---------CTTTT---------------------------------------------------------------------------------------------------TTCTTA---------AGTCTATTGATCCAAGATAAGA-CGTGTACAAATGAGCATCTTTACGT-AAAGAATC---ATT-------ATA-TGAATAATTCATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT------GAAGATCCAAGAAATT---ACTGGATCAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTCTCTAGCAAAATGAGAATGCAGCGTCGGCAATGGTCGGGATAGCTCTCGCGCATGGTGGATTCACAA-TCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCTA-GCTAGGA-CTAGGATTTA-GATTAATCA-ATCTATTTCTAACTGTCTTGT-----------------TTTTTCAAGACCGTAGGTCA-GTTAA--------ATACTATGCATTTT--------CATTCTA----------AATAAAAAA------AAAAGA-----------GA---AAT-----------AAAG-CCCCCTTCCTAGACCAAGGAAGGCTTTTTTCTCTATATA----TTTCTATTTTCTTTTATAAAATTATAATATATTTATATATATAATTAAATATTAGAAA----ATTTTTTCTCTTACATTA-----TATTAAGAACAGGTC-TTACCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTGG-TCTAGAGGAAGGTTATGAGC-ATTCGTTCT---------- Valerianella_microcarpa TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CA----------------------------------------------A-GGACGCGGG-AACGCAAGGACCC--GCGG----------CCGAAA--AACCCAACCCCGGCGCAAATCGCGTCAAGGAATATGACAA-CGGAACGGA-GCTCGCGAGCCCGGACGGCCCGTTTGCGGAGCCGGTCG--GGCGAGCGTCTGCCCCGTCTGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-ACCCC-GTCTC--CCCCGAT-AAAGGG-GCGG-CGAGC-GGC-GGGGGGCGC-GGACGTTGGCCTCCCGCTTCCCC-TGC------GGACGCGGCTGGCCCA-AAACAC--TGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGTGGCCCCT-CCCGTCCTC-CGGGCGGCGACGA-CGACCCA--ACGGCGC-TCT---------------------------------------------ATGAAGTGATGGATTCGTCTATACCATCGGTAACGTTTTGAAGACCGCG-ACTTATCTGGAAAGGGAATGGTTGGAAAAAACAGCATGTCGTATCAACGAAGAGTTTTTAGAATATTTT--------ATTTTT-CCGGATCGGTATTCAAA---------TTTTTTATTGT-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCCAACGCATAAATGGATAGAGATAGCGCCCTGTGG-CTTCAATTAATT-AGA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-CGC-CTGATACGGGAAGGCTTTTTCCTACGAGTGAATTCCTCATAATTG-GATGAATCCTAA-TTATAT-----CCATCCG-TTAATAAA------TGG----A-TAG-TA-----TATTA---TCCATTTTGGACTGGAAACGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTTCAAAATC-----AAAAGCGCGGTTCCGTTCACAAAATAAAGGGTTTTTAACCACTCTGTTTTGTTAT-CTTATAAC-GAA--GATGAAAAA---------------------CAGA-GAA---TAGAGAG-TCT-GTTC-ATAAG-TC-TA-TTTCGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATA-------ACTTATA--AAT-AATATCTTGTTTTAACTGTACCGCAGTATGCATCATTT-GATAACCCCCCCAAATCCTCT-ACTCTTCGTAAATAGAATTCAAATGGAGGAATTCCAAAGATATTTAAAGATAGGTGGATCTGAACAACACT-ACTTTTTATATCCACTTATCTTTCAGGAGTATATTTATGCCCTTGC-TCATGATC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTTGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAATAATGGGTAATCCTGAGCCAAATCCCGTGTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGAAGTTAACTGTGTT-----GGTAAAAAGAATCCTTGCATAGAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCGGTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCT-CTAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTCGGATGATCTGA-----------------------------------------------------------------ATGAGTATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAAATCCAAAAAATT---GCTGGATTAGGATAAGACTTTGTAAGACCCCTTTAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGTCGGCACTGGTCGGGATAGCTC?CG?GCATGG?GGATTCACAA-TCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAGGA-CTATGATTTA-GATGAATCA-AT?TATTTCAAACTGTTTTTT----------------------CAAGGACAGATGTCA-GTTAA--------ATACTATGTATTTT--------CATTCTA----------ATGAAAGAA------AAAAGA-----------GA---AAG-----------AAAG-CCCCCTTCCTAGACCAAGGGGGCATTTTTTCT?T--------------TTTTT--TTTATAGA-------------------------------TTAGGA------CTCGTATA----CATTA-ATATA-TTAAA--------------C-ATTAGTAGATGGAG-CTTCAAGAGCAG--------------------------------------------- Valerianella_muricata TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAAACCGCGGCGCTTCGG------CCTCCGGGC---CGT--CG{AC}---GCCGAA-GGACGCGGG-AACGCAAGGACCC--GCGG----------CCGCC---AACCCAACCCCGGCGCAAACCGCGTCAAGGAACATGATAA-CGGAATGGG-GCGCGCGAGCCCGCACGGCCCGTTTGCGGTGCCGGTCG--GGCGAGCGTCTGTCCCGTCTGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-ACCCC-GTCTT--CCCTTCT-CGAAGG-GCCGGCGCGC-GGC-GGGGGGCGC-GGACGGTGGCCTCCCGCTTCCCC-AGC------GGACGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--TTTCGCGCCGTGGCCCTC-CCCGTCCTC-CGGGCGG-CAAAA-CGACCCA--ACGGCGC-TCT---------------------------------------------ATGAAGTGATGCATTCGTCCATACCA???GTAAAGTTTTGAAGACCGCG-ACTGATC?GGAA?GGAAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAATTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTAAAA---CTTGGTTTAAT-----------TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGATATAGAGCCCTATGG-CTTCCATTAATT-ATA-GGGAAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAAA-----TTA-GAATGATT-CCCGATCTAATAATAA-GTTAAAATTTT{AT}TTAG-?GC-CTGATACGGGAAGGGT?TTTCC-ACGAGTGAATTCTCTATTTTTT-AATGAATCCTAA-TTATTTTTTG-CCATTT--TTTCAAAA------TGG----A-TAA-TA-------------TCCATTTTGAAATGGAGATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGT{GT}GAAAAAATAAAGGCTTTCTAACCATCTTGTTTTGTTAT-CTTATAAT-GAA--GATAAACCA------TAAAAAAA-------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCAA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGCACTATGCATCATTT-GATAACC-CCCAAAATTCTCT-ACTCTTCA-AATTGAAATTCAAATGGAGGAATTCAAAAGATATTTAAAGAGAAGTGGTGCTGAACAGCACT-AC?GCTTGTATCCACTTATCTTTCAGGAGTATATTTATG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTTGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCCTAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTAACTGTGTT-----GGTAAAAAAAATCCTTCCATAGAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCT-ATAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTCGTATGATCTAA-----------------------------------------------------------------ATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAAAAAATT---GCTGGATTAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGTCTGCAATGGTCGGGATAGCTC--GCGCATGGTG?ATTCACAA-TCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAGGA-CTATGATTTA-GATGAATCA-ATCTATTTCTAACTGTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTATGCATTTT--------CATTCTA----------ATGAAAGAA------AAAAGA-----------GTC--AAG-----------AAAG-CCCCCTTCCTAGACCTAGGGAGCATTTTTTCTCT--------------TTTTTCTTTTATAGA-------------------------------TTAGGA------CTCATATACATTA--------------CGAACAGGTC-TTACCC-ATTTGTAGATGGAG-CTTCAAGAGCAG--------------------------------------------- Valerianella_pumela TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CCGCGGTGCGCCGG------CCTCCGGGC---CGT--CGC---TCCGAA-GGACGCGGG-AACGCAAGGACCC--GCGG----------CCGCC---AACCCAACCCCGGCGCAAACCGCGTCAAGGAATATGATAA-CGGAATGGG--CGCGCGAGCCTGCACGGCCCGTTTGCGGAGACGTGCG---GGCGAGCGCCGACCCGTCTGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATAGCGTCGCCCCCCC-ACCCC-GTCTT--CCCTGCT-AAAGGG-CATG-CGCGC-GGC-GGGGGGCGC-GGACGGTGGCCTCCCGCTTCCCA-AGC------GGACGCGGCTGGCCTA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGTGTCTCTC-CCCGTCCTC-CGGGCGG-CATAA-CGACCCA--ACGGCGC-TCG-TTCCGCA-------------------AGGGACGG--CGCTCCGAATGAAGTGATGGATTCGTCTAGACCATCGGTAAAGTTGTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGTTGGAAAAAATAGCATGTCGTATCAACGAAGAGTTTTGAGAAGATTTT--------ATTTTT-GCGGATCGGTATTCAAA--------TTTTTTTATTGG-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCCAATGGATAAATGGATAGAGATAGCGCCCTGTGG-CTTCAATTAATT-AGA-GGGGAAAAAAAAGCAA-CGAGGCTTCTGT--TCTTAA------TTA-GAATAATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGAGGAATTTTCC-TACGAGTGAATTCCTCATAATTG-AATGAATGCTAA-ATTATTATTAACCAGTCG-TTAATAAA------TGG----A-TAA-TA-----TATTA---TCCATTTTAGACTGGAAACGTGTGTCTAAAAGAAAC-AGTATATT-GAGCAAAACA-TTTCTAAA-TC------AAAGCGCGGTTCCGTC-ACAAAATAAAGGGTTTCTAACCACTCTGTTTTGTTAT-CTTATAAC-GAA--GATAAACCA------TTAAAAAAA------CAGA-GAA---TAGAGAG-TCT-GTTG-ATAAGGTC-TA-TTTGGAT-CCGA-GGTATCTA-TTTGTT--------CTT-ATT-------AAAACA---AAT-AATAGCT-GTTTTGACTGCTCCGCAGGATGCATCATTT-GATAACC-CCCAAAATCCTCT--TATTGTATAAATCGACTTTCACAAGAAGAATTTCAAAGATATTTAAAGATAGGTGGATCTGAACAACACT-ACTTTTTATATCCACTTATCTTTCAGGAGTATATTTATGCCCTTGC-TCATGATTATGGTTTAAACAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGCGAAACGTTTCATTTTTCGAATGTATAAAAAGAATCTTTTTGTTTTTTCTGTTA------AGCATTCTAATGCATTTTGGGTGCGCAATAAGAGTTTTGATTCTCAAAGGATATCAGAGAGATTTTCGGTCATTGTAGCAATTCCATTTTCTCTACAATTTTTTTCTTTCT-AGAAAAGAAAGGGAGAGTCAAATCTCGGAATCTA----TGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTAACTGTGTT-----GTTAAAAAGAATCCTTCCATATAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATG-AATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCT-ATAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTCGTATGATCTAA-----------------------------------------------------------------ATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---GCTGGATCAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGA-TGCAGCGTCGGCAATGGTCGGGATAGCTC------GGTGGGAATTCACAAATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAAGA-CTAGGATTTA-GCTGAATCA-ATCTATTTCTAACTGTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTAGGCATTTT--------CATTCTA----------ATGAAAGAA-------AAAGA-----------GA---AAA-----------AATT-CTCCCTTGGTTTAGGAAGGGGC----CTTTCTTT----------CTCTTTTTTCTTTTAGAGATTT-----TCTTTTATAGATATAG------ATTAGGA------CTCGTATACATTA---------CATTACGAACAGGTC-TTACCC-ATTTGTAGATGGAG-CTTCAAGAGCAGCTGG-TCTAGAGGAAGGTTATGAGC-ATTCGTTCT---------- Valerianella_radiata TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAACCA------------------------------------------------GGACGCGGG-AACGAAAGGACCC--GCGT----------CCGGCG--AACCCAACCCCGGCGCAAATCGCGTCAAGGAAAATGATAA-CGGAACGGG-GCGCGCTGGCCCGGACGGCCCGTTTGCGGAGCCGGTCG--GGGTGGCGTCTGCGCCGTCTGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-GCACCCGTCTC--CCCAAAA-AAAAGG-GGCGGCGGGC-GGC-GGGGGGCGC-GGACGGTGGCCTCCCGCTTCCCC-TGC------GGACGCGGCTGGCCCA-AAACAA--GGTCCCCCGGCGGCGGACGTCGCGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGCGGCCCCT-CCCGTCCTC-CGGGCGG-CGAAA-CGACCCA--ACGGCGC-TCT---------------------------------------------ATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTT???AGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA---CGTAGTTTAATTATTGAT----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GG-AAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAATTTTAATTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TGC-CTGATACGGGAAGGGTTTTTA-CACGAGTGAATTCTCTATTTTTT-TATGAATCCTAA-TTATTTTTTG-CCATTT--TTTATAAAAA----TGG----A-TAG-TA-----TATTA---TCCATTTTGAAATGGAAATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTAGAAC-GAA--GATAAACCA------TAAAAAAAA------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGTACTATGCATCATTT-GATAACC-CCCCAAATTCTCT-ACTCTTCA-AATTTTAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTTGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAATAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGAAGTTAACTGTGTT-----GGTAAAAAGAATCCTTGCATAGAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCG-CTAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTCGTATGATCTAA-----------------------------------------------------------------ATGAGTATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAAATCCAAAAAATT---GCTGGATTAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGTCGGCACTGGTCGGGATAGCTCTCGCGCATGGTGGATTCACAA-TCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAGGA-CTATGATTTA-GATGAATCA-ATCTATTTCTAACTGTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTATGCATTTT--------CATTCTA----------ATGAAAGAA------AAAAGA-----------GA---AAG-----------AAAG-CCCCCTTCCTAGACCAAGGGGGTATTTTTTCTCT-----------TTTTTA--TATTTATAGA-------------------------------TTAGGA------CTCGTATA---------AAACCACTTAAA--------------C-ATTTGTAGATGGAG-CTTCAAGAGCAGCTAGGTCTAGAGGGAAGTTATGAGCATTACGTTCATGCATAAC-- Valerianella_steriocarpa TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CA----------------------------------------------A-GGACGCGGG-AACGCAAGGACCC--GCGG----------CCGAAA--AACCCAACCCCGGCGCAAATCGCGTCAAGGAATATGACAA-CGGAACGGA-GCTCGCGAGCCCGGACGGCCCGTTTGCGGAGCCGGTCG--GGCGAGCGTCTGCCCCGTCTGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-ACCCC-GTCTC--CCCCGAT-AAAGGG-GCGG-CGAGC-GGC-GGGGGGCGC-GGACGTTGGCCTCCCGCTTCCCC-TGC------GGACGCGGCTGGCCCA-AAACAC--TGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGTGGCCCCT-CCCGTCCTC-CGGGCGGCGACGA-CGACCCA--ACGGCGC-TCT----------------------------------------------------------------------------------------------------------------------------AACA?CATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA---CGTAGTTTAATTATTGAT----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GG-AAAGAAAAAGCAA-CGAGC-TTCTGT--T?TTAATTTTAATTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TGC-CTGATACGGGAAGGGTTTTTA-CACGAGTGAATTCTCTATTTTTT-TATGAATCCTAA-TTATTTTTTG-CCATTT--TTTATAAAAA----TGG----A-TAG-TA-----TATTA---TCCATTTTGAAATGGAAATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTAGAAC-GAA--GATAAACCA------TAAAAAAAA------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGTACTATGCATCATTT-GATAACC-CCCCAAATTCTCT-ACTCTTCA-AATTTTAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAATATATTTATGCAC?TGC-TCATGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTTGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAATAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGAAGTTAACTGTGTT-----GGTAAAAAGAATCCTTGCATAGAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCG-CTAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTCGTATGATCTAA-----------------------------------------------------------------ATGAGTATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAAATCCAAAAAATT---GCTGGATTAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGTCGGCACTGGTCGGGATAGCTCTCGCGCATGGTGGATTCACAA-TCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAGGA-CTATGATTTA-GATGAATCA-ATCTATTTCTAACTGTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTATGCATTTT--------CATTCTA----------ATGAAAGAA------AAAAGA-----------GA---AAG-----------AAAG-CCCCCTTCCTAGACCAAGGGGGTATTTTTTCTCT--------------TTTTT-----ATAGA-------------------------TATAGATTAGGA------CTCGTATA---------AAACCACTTAAA--------------C-ATTTGTAGATGGAG-CTTCAAGAGCAG--------------------------------------------- Valerianella_texana TCGATGCCTGCGCTAGCAGAA-CGACCC-GCGAACGCGTTTAAAA-------------------------------------------------A-GAGCGCGGG-AACGCAAGGACCC--GCGT----------CCGCCT--AACCC?ACCCCGGCGCGGATCGCGTCAAGGAATATGACAA-CGGAACGGT-GCGCGCGAGCCCGGACGGCCCGTCTGCGGCCCGGTCGG---GCGAGCGGCCGCCCCGT?TGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCC-TCCCC-G?CTC--CCCCGTT-ACGGGG-GCGG-CG?GC-GGC-GGGGGGCGC-GGACGGTGGCCTCCCGCGTCCC?-TGC------GGACGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCGCGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGCGGCCCCT-CCCGTCCTC-CGGGCGG-CACAA-CGACCCA--ACGGCGC-TCT---------------------------------------------ATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA---CGTAGTTTAATTATTGAT----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GG-AAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAATTTTAATTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TGC-CTGATACGGGAAGGGTTTTTA-CACGAGTGAATTCTCTATTTTTT-TATGAATCCTAA-TTATTTTTTG-CCATTT--TTTATAAAAA----TGG----A-TAG-TA-----TATTA---TCCATTTTGAAATGGAAATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTAGAAC-GAA--GATAAACCA------TAAAAAAAA------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGTACTATGCATCATTT-GATAACC-CCCCAAATTCTCT-ACTCTTCA-AATTTTAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAATATATTTATGCACTTGC-TCATGATCATGGTTTAATAAGAGCACATTTGTTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTTGG?ATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGAAGTTAACTGTGTT-----GGTAAAAAGAATCCTTGCATAGAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCG-CTAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTCGTATGATCTAA-----------------------------------------------------------------ATGAGTATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAAATCCAAAAAATT---GCTGGATTAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGTCGGCACTGGTCGGGATAGCTCTCGCGCATGGTGGATTCACAA-TCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAGGA-CTATGATTTA-GATGAATCA-ATCGATTTCTAACTGTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTATGCATTTT--------CATTCTA----------ATGAAAGAG------AAAAGA-----------GA---AAG-----------AAAG-CCCCCTTCCTAGACCAAGGGGGTATTTTTT--------------CTCTTTTTT----TATAGA-------------------------------TTAGGA------CTCGTATAA---------AACCACTTAAA--------------C-ATTTGTAGATGGAG-CTTCAAGAGCAG--------------------------------------------- Valerianella_umbilicata TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CC----------------------------------------------A-GGACGCGGG-AACGCAAGGACCC--GCGT----------CCGGCG--AACCCAACCCCGGCGCAAATCG{CG}GTCAAGGAATATGACAA-CGGAACGGG-GCGCGCGAGCCCGGACGGCCCGTTTGCGGACCGGTCGG---GCTGGCGGCTGCACCGTCTGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCCACCC--GTCTC--CCCGAAA-AAAGGG-GCGG-CGGGC-GGC-GGGGGG?GC-GGACGGTGGCCTCCCGCTTCCCC-TGC------GGACGCGGCTGGCCCA-AAACAC--GGTCCCCCGGCGGCGGACGTCGCGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGCGGCCCCT-CCCGTCCTC-CGGGCGG-CAAAA-CGACCCA--ACGGCGC-TCG---------------------------------------------ATGAAGTGATGGATTCGTCCATACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGATGGAAAAAACAGCATGTCGTATCAACGAAGAGTTCTTAGAATATTTT--------ATTTTT-CCGGATCAGTATTCAAA---CGTAGTTTAATTATTGAT----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCGAATGGATAAATGGATAGAGATAGAGCCCTATGG-CTTCCATTAATT-ATA-GG-AAAGAAAAAGCAA-CGAGC-TTCTGT--TCTTAATTTTAATTA-GAATGATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TGC-CTGATACGGGAAGGGTTTTTA-CACGAGTGAATTCTCTATTTTTT-TATGAATCCTAA-TTATTTTTTG-CCATTT--TTTATAAAAA----TGG----A-TAG-TA-----TATTA---TCCATTTTGAAATGGAAATGTGTGTCTAAAAGAAAC-AGTATATT-GATCAAAACA-TTTCCAAAATC-----AAAAGCGCGGTTAGGTTGAAAAAATAAAGGGTTTCTAACCATCTTGTTTTGTTAT-CTTAGAAC-GAA--GATAAACCA------TAAAAAAAA------CAGA-GGA---TAGAGAG-TCT-GTTG-ATAAG-TCCTA-CTTAGAT-CCGA-GGTATCTA-TTTGTTT-------CTT-ATT-------ATGACA---AAT-AATATCTTGTTTTGACTGTACCGTACTATGCATCATTT-GATAACC-CCCCAAATTCTCT-ACTCTTCA-AATTTTAATTCAAATGGAGGAATTCAAAAGATATTTAAAGATAGGTGGGTCTGAACAGCACT-ACTTCTTGTATCCACTTATCTTTCAGGAATATATTTATGCACTTGC-TCATGATCATGGTTTAATAAGAGCACATTTGTTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTTGG?ATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCCGTTTTTGTTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA-GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGAAGTTAACTGTGTT-----GGTAAAAAGAATCCTTGCATAGAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCG-CTAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTCGTATGATCTAA-----------------------------------------------------------------ATGAGTATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAAATCCAAAAAATT---GCTGGATTAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGTCGGCACTGGTCGGGATAGCTCT?GCGCATGG?GGATTCACAA-TCCACTGC-CTTGAGCC?--??G??TACATCCGCC?CCA-GCTAGGA-CTATGATTTA-GATGAATCA-A??-ATTTCTAACTGTTTTTT----------------------AAAGAACAGAT?TCA-GTTAA--------ATATTATGC???T---------CAT??AA-----------TCAAAGAA-------AAAGA-----------GA---AAG-----------AAAG-CCCCCTTCCT?-ACCAAGGGGG----???TTTT?--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Valerianella_vesicaria TCGATACCTGCACGCGCAGAA-CGACCC-GCGAACACGTTTAAAA-CCGCGGTGCGCCGG------CCTCCGGGC---CGT--CGC---TCCGAA-GGACGCGGG-AACGCAAGGACCC--GCGG----------CCGCC---AACCCAACCCCGGCGCAAACCGCGTCAAGGAATATGATAA-CGGAATGGG--CGCGCGAGCCTGCACGGCCCGTTTGCGGAGACGTGCG---GGCGAGCGCCGACCCGTCTGAAAGAAA--CACAA-ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG----------------AATCCCGTGAA-----------------CCA-TCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATAGCGTCGCCCCCCC-ACCCC-GTCTT--CCCTGCT-AAAGGG-CATG-CGCGC-GGC-GGGGGGCGC-GGACGGTGGCCTCCCGCTTCCCA-AGC------GGACGCGGCTGGCCTA-AAACAC--GGTCCCCCGGCGGCGGACGTCACGGCGAGTGGTGGTCG--AAT---CAGCCCTCT--GTTCGCGCCGTGTCTCTC-CCCGTCCTC-CGGGCGG-CATAA-CGACCCA--ACGGCGC-TCG-------------------------------------------------AGTGATGGATTCGTCTAGACCATCGGTAAAGTTTTGAAGACCGCG-ACTGATCTGGAAAGGGAATGGTTGGAAAAAATAGCATGTCGTATCAACGAAGAGTTTTGAGAAGATT-----------TTTTT-CCGGATCGGTATTCAAA--------TTTTTTTATTGG-----TATTGAAACGGAGT------AAAGTGAATTCATTCAATTTCAAGTTGGGTCCAATGGATAAATGGATAGAGATAGCGCCCTGTGG-CTTCAATTAATTAAGA-GGGGAAGAAAAAGAAA-CGAGC-TTCTGT--TCTTAA------TTA-GAATAATTTCCCGATCTAATAATAA-GTTAAAATTTTATTAG-TG-CCTGATACGGGAAGGTTTTTTCCTACGAGTGAATTCCTCATAATTG-AATGAATCCTAA-ATTATTATAA-CCAGTCG-TTAATAATAAA---TGG----A-TAA-TA-----TATTA---TCCATTTTAGACTGGAAACGTGTGTCTAAAAGAAAC-AGTATATT-GAGCAAAACA-TTTCTAAAATC-----AAAAGCGCGGTTCCGTTCACAAAATAAAGGGTTTCTAACCACTCTGTTTTGTTAT-CTTATAAC-GAA--GATAA--CA------TTAAAAAA-------CAGA-GAA---TAGAGAG-TCT-GTTG-ATAAG-TC-TA-TTTGGAT-CCGA-GGTATCTA-TT-GTTT-------CTT-ATT-------AAAACA---AAT-AATAGCTTGTTT-GACTGTACCGCAGTATGCATCATT--GATA----CCCAAAATCCTCT--TATTGTATAAATCGACTTTCACAGGAGGAATTCCAA-GATATTTAAAGATAGGTGGATCTGAACAACACT-ACTT-TTATATCCACTTATCTTTCAGGAGTATATTTATGCCCTTGC-TCATGATCATGGTTTAAACAGAGCACATTTGTTGGAAAATGTAGGGTATGACAATAAATATAGCTTACTAGTTGTGAAACGTTTCATTTCTCGAATGTATAAAAAGAATCTTTTTGTTTTTTCTGTTA------AGCATTCTAATGCATTTTGGGTGCGCAATAAGAGTTTTGATTCTCAAAGGATATCAGAGGGATTTTCGGTCATTGTAGAAATTCCATTTTCTCTACAATTTTTTTCTTTCTTAGAAAAGAAAGGGAGAGTCAAATCTCGGAATTTA----TGGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGTAATCCTGAGCCAAATCCCGTTTTTGGTTTCCGAAAACA----------AACAAAGG-CTAAAATCAA--AAAA--GGATGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTAACTGTGTT-----GTTAAAAAGAATCCTTCCATAGAAACTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTA-ATCGCACAAGAATAAAGATAGAGTCCCATTCTACATGCCAATA--------CCGGCA-ACAATGAAATT-TAGAGTAAGAGGAAAATCCG-TCGATTTTCG-AAATCGTG-AGGG-TTCAAGTCCCTCTA-TCCCCAAAAA-CCT-ATAT-------GG----------AGTACCTAATTATTTAGC-----------------CTTTT-----------------------GTTA-------------------------------------------------------GTGAAA-AT--CTTTTTTTCTTA---------AGTTGTATGATCTAA-----------------------------------------------------------------ATGAATATCATTAT------TCATACTGAAACTTA--CAAAGTCTTT-CTTTTGAAGATCCAATAAATT---GCTGGATCAGGATAAGACTTTGTAAGACCCCTTCAGTTGACATAGACCCGAGTTATCTAGCAAAATGAGAATGCAGCGTCGGCAATGGTCGGGATAGCTC-----ATGGGTGAATTCACACATCCACTGC-CTTGAGCCA-CTTGGCTACATCCGCCCCCA-GCTAAGA-CTAGGATTTA-GATGAATCA-ATCTATTTCTAACTGTTTTTT----------------------CAAGAACAGATGTCA-GTTAA--------ATACTAGGCATTTT--------CATTCTA----------ATGAAAAAA-------AAAGA-----------GA---AAC-----------AATT-CTCCCTTGGTCTAGGAAGGGGC----CTTTCTTT----------CTCTTTTTTCTTTTAGAGATTT-----TCTTTTATAGATATAG------ATTAGGA------CTCGTATACATTAA--------CATTACGAACAGGTC-TTACCC-ATTTGTAGCTGGAG-CTTCA-GAGCAGTCAG----------------------------------------- ; END; BEGIN SETS; CHARSET trnL (CHARACTERS = Combined) = 1989-3047; CHARSET psbA (CHARACTERS = Combined) = 3048-3528; CHARSET its (CHARACTERS = Combined) = 1-758; CHARSET matK_intron (CHARACTERS = Combined) = 759-1988; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Combined) = N: 1-3528; CODONPOSSET CodonPositions (CHARACTERS = Combined) = N: 1-3528; END; BEGIN TREES; TITLE Tb8528; LINK TAXA = Taxa1; TRANSLATE 1 Valerianella_texana, 2 Valerianella_steriocarpa, 3 Valerianella_radiata, 4 Valerianella_pumela, 5 Valerianella_muricata, 6 Valerianella_microcarpa, 7 Valerianella_locusta2, 8 Valerianella_locosta, 9 Valerianella_florifera, 10 Valerianella_eriocarpa, 11 Valerianella_discoidea, 12 Valerianella_dentata, 13 Valerianella_cornata, 14 Valerianella_carinata, 15 Valerianella_amarella, 16 Valeriana_wallrothi, 17 Valeriana_urticifolia3, 18 Valeriana_urticifolia2, 19 Valeriana_urticifolia, 20 Valeriana_tuberosa, 21 Valeriana_tripteris, 22 Valeriana_triphylla, 23 Valeriana_trichosto, 24 Valeriana_tomentosa, 25 Valeriana_texana, 26 Valeriana_tanacaetifolia, 27 Valeriana_supina, 28 Valeriana_stenoptera, 29 Valeriana_stenophylla, 30 Valeriana_sorbifolii, 31 Valeriana_sitchensi, 32 Valeriana_selerorum, 33 Valeriana_secunda, 34 Valeriana_scouleri, 35 Valeriana_scandens, 36 Valerianella_vesicaria, 37 Valerianella_umbilicata, 38 Valeriana_rzedowski, 39 Valeriana_rumicoidea, 40 Valeriana_robertiana, 41 Valeriana_rigida, 42 Valeriana_pyrenaica, 43 Valeriana_pyramidalis, 44 Valeriana_procera, 45 Valeriana_prionophy, 46 Valeriana_polemonifolia, 47 Valeriana_plantagina, 48 Valeriana_pinnatifida, 49 Valeriana_pilosa, 50 Valeriana_pauciflora, 51 Valeriana_palmeri, 52 Valeriana_officaina, 53 Valeriana_occidentalis, 54 Valeriana_nivalis, 55 Valeriana_niphobia, 56 Valeriana_naidae, 57 Valeriana_montana, 58 Valeriana_minutiflora, 59 Valeriana_microphylla, 60 Valeriana_mexicana, 61 Valeriana_laurifolia, 62 Valeriana_kawakamii, 63 Valeriana_interupta, 64 Valeriana_hirtella, 65 Valeriana_henrici, 66 Valeriana_gallinae, 67 Valeriana_flaccidis, 68 Valeriana_fauriei, 69 Valeriana_edulis, 70 Valeriana_dioica, 71 Valeriana_densiflora, 72 Valeriana_connata, 73 Valeriana_coartata, 74 Valeriana_clematis, 75 Valeriana_chaerophylla, 76 Valeriana_ceratophyla, 77 Valeriana_celtica, 78 Valeriana_candolleana, 79 Valeriana_californica, 80 Valeriana_bulbosa, 81 Valeriana_bryophilla, 82 Valeriana_bracteata, 83 Valeriana_barbareifolia, 84 Valeriana_asarifolia, 85 Valeriana_arizonica, 86 Valeriana_aretoides, 87 Valeriana_arborea, 88 Valeriana_apiifolia, 89 Valeriana_albonervata, 90 Valeriana_adscenden, 91 Valeriana_acutiloba, 92 Triplostegia_glandulifera, 93 Plectritis_macrocera, 94 Plectritis_congesta, 95 Plectritis_brachystema, 96 Patrinia_villosa, 97 Patrinia_triloba, 98 Patrinia_scabiosa, 99 Patrinia_gibbosa, 100 Nardostachys_jatamansii, 101 Fedia_cornucopiea, 102 Centranthus_sieberii, 103 Centranthus_ruber, 104 Centranthus_macrosiph, 105 Centranthus_lecoqii, 106 Centranthus_calcitrapae_Crete, 107 Centranthus_calcitrapae; TREE Fig._2 = [&R] (92,(((((((((((((52,68),16),((((91,85),(31,34)),50),(79,53))),70,(20,84)),(58,(62,23))),(67,28)),((45,((69,44),25)),((((((19,18),17),(32,((66,((38,83),71)),60))),((89,76),((((35,78),88),(26,81)),((51,40),30)))),((61,56),74)),(((((((59,33),64),((49,47),90)),(((41,86),(82,29)),55)),((87,22),((75,43),73))),(46,(((48,(72,80)),((63,39),65)),24))),(54,((93,95),94)))))),((57,(21,27)),42)),((103,102),(104,((106,107),105)))),((((8,7),101),((((13,4),36),((12,10),14)),6)),((11,5),(((1,37),(3,15)),(2,9))))),77),100),((97,99),(96,98)))); END;