#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 18:41 GMT TreeBASE (cc) 1994-2008 Study reference: Siahaan S.A., Hidayat I., Kramadibrata K., Meeboon J., & Takamatsu S. 2016. Bauhinia purpurea, Durio zibethinus, and Nephelium lappaceum: additional hosts of the asexual morph of Erysiphe quercicola. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S18959] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=33; TAXLABELS 'Erysiphe quercicola Ex_Acacia_auriculiformis_MUMH3241_Thailand' 'Erysiphe quercicola Ex_Acacia_mangium_VPRI20907_Australia' 'Erysiphe quercicola Ex_Anacardium_occidentale_MUMH781_Tanzania' 'Erysiphe quercicola Ex_Bauhinia_purpurea_MUMH5137_Indonesia' 'Erysiphe quercicola Ex_Bauhinia_purpurea_MUMH5678_Indonesia' 'Erysiphe quercicola Ex_Bixa_orellana_MUMH3230_Thailand' 'Erysiphe quercicola Ex_Bixa_orellana_MUMH_3165_Argentina' 'Erysiphe quercicola Ex_Cinnamomum_camphora_KC857653_Taiwan' 'Erysiphe quercicola Ex_Citrus_limon_VPRI30172_East_Timor' 'Erysiphe quercicola Ex_Citrus_reticulata_VPRI130173_East_Timor' 'Erysiphe quercicola Ex_Citrus_sinensis_MUMH3210_Malaysia' 'Erysiphe quercicola Ex_Durio_zibethinus_MUMH5155_Indonesia' 'Erysiphe quercicola Ex_Durio_zibethinus_MUMH5675_Indonesia' 'Erysiphe quercicola Ex_Euonymus_japonicus_MUMH133_Japan' 'Erysiphe quercicola Ex_Hevea_brasiliensis_MUMH2418_Brazil' 'Erysiphe quercicola Ex_Hevea_brasiliensis_MUMH2419_Brazil' 'Erysiphe quercicola Ex_Hevea_brasiliensis_MUMH2545_Malaysia' 'Erysiphe quercicola Ex_Hevea_brasiliensis_MUMH2602_Thailand' 'Erysiphe quercicola Ex_Mangifera_indica_MUMH3188_Argentina' 'Erysiphe quercicola Ex_Mangifera_indica_MUMH3267_Thailand' 'Erysiphe quercicola Ex_Mangifera_indica_MUMH3268_Thailand' 'Erysiphe quercicola Ex_Mangifera_indica_MUMH3705_Thailand' 'Erysiphe quercicola Ex_Mangifera_indica_VPRI20332_Australia' 'Erysiphe quercicola Ex_Murraya_paniculata_KC85765_Taiwan' 'Erysiphe quercicola Ex_Nephelium_lappaceum_MUMH5779_Indonesia' 'Erysiphe quercicola Ex_Nephelium_lappaceum_MUMH6552_Indonesia' 'Erysiphe quercicola Ex_Nephelium_lappaceum_MUMH6557_Indonesia' 'Erysiphe quercicola Ex_Quercus_crispula_MUMH1956_Japan' 'Erysiphe quercicola Ex_Quercus_crispula_MUMH242_Japan' 'Erysiphe quercicola Ex_Quercus_phillyreoides_MUMH124_Japan' 'Erysiphe quercicola Ex_Quercus_phillyreoides_MUMH885_Japan' 'Erysiphe quercicola Ex_Quercus_robur_MUMH960_UK' 'Erysiphe quercicola Ex_Quercus_sp._MUMH3242_Iran' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M39765] TITLE 'Erysiphe quercicola ITS+28S'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1324; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Erysiphe quercicola Ex_Acacia_auriculiformis_MUMH3241_Thailand' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCGCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Acacia_mangium_VPRI20907_Australia' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCGTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCGCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Anacardium_occidentale_MUMH781_Tanzania' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Bauhinia_purpurea_MUMH5137_Indonesia' ----------GGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA----------------------------------------CGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Bauhinia_purpurea_MUMH5678_Indonesia' ----------GGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Bixa_orellana_MUMH3230_Thailand' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCCAAAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCACGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Bixa_orellana_MUMH_3165_Argentina' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Cinnamomum_camphora_KC857653_Taiwan' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe quercicola Ex_Citrus_limon_VPRI30172_East_Timor' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTGTTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Citrus_reticulata_VPRI130173_East_Timor' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTGTTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Citrus_sinensis_MUMH3210_Malaysia' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTGTTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Durio_zibethinus_MUMH5155_Indonesia' -------------------------------GCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAGGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTCGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACTCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAG---------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Durio_zibethinus_MUMH5675_Indonesia' ----------GGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAGGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTCGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACTCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Euonymus_japonicus_MUMH133_Japan' CAGAGTGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-CAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGA------ 'Erysiphe quercicola Ex_Hevea_brasiliensis_MUMH2418_Brazil' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGA------ 'Erysiphe quercicola Ex_Hevea_brasiliensis_MUMH2419_Brazil' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Hevea_brasiliensis_MUMH2545_Malaysia' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTCAACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Hevea_brasiliensis_MUMH2602_Thailand' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTCAACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Mangifera_indica_MUMH3188_Argentina' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Mangifera_indica_MUMH3267_Thailand' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGTGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATACAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Mangifera_indica_MUMH3268_Thailand' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCAATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Mangifera_indica_MUMH3705_Thailand' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCAATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Mangifera_indica_VPRI20332_Australia' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGT------------------------------------------- 'Erysiphe quercicola Ex_Murraya_paniculata_KC85765_Taiwan' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGCATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Erysiphe quercicola Ex_Nephelium_lappaceum_MUMH5779_Indonesia' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Nephelium_lappaceum_MUMH6552_Indonesia' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGG---------GTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGAT----- 'Erysiphe quercicola Ex_Nephelium_lappaceum_MUMH6557_Indonesia' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTG----------GTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGAT----- 'Erysiphe quercicola Ex_Quercus_crispula_MUMH1956_Japan' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Quercus_crispula_MUMH242_Japan' CAGAGTGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACG------------------------------------------------ 'Erysiphe quercicola Ex_Quercus_phillyreoides_MUMH124_Japan' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCC--------- 'Erysiphe quercicola Ex_Quercus_phillyreoides_MUMH885_Japan' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT 'Erysiphe quercicola Ex_Quercus_robur_MUMH960_UK' CAGAGTGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCA-------------------- 'Erysiphe quercicola Ex_Quercus_sp._MUMH3242_Iran' CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTTGGGGCGCATCATCGACCGATCCTGATGTCTT ; END; BEGIN TREES; TITLE 'Erysiphe quercicola ITS+28S'; LINK TAXA = Taxa1; TRANSLATE 1 'Erysiphe quercicola Ex_Acacia_mangium_VPRI20907_Australia', 2 'Erysiphe quercicola Ex_Acacia_auriculiformis_MUMH3241_Thailand', 3 'Erysiphe quercicola Ex_Hevea_brasiliensis_MUMH2545_Malaysia', 4 'Erysiphe quercicola Ex_Hevea_brasiliensis_MUMH2602_Thailand', 5 'Erysiphe quercicola Ex_Citrus_limon_VPRI30172_East_Timor', 6 'Erysiphe quercicola Ex_Citrus_sinensis_MUMH3210_Malaysia', 7 'Erysiphe quercicola Ex_Citrus_reticulata_VPRI130173_East_Timor', 8 'Erysiphe quercicola Ex_Durio_zibethinus_MUMH5675_Indonesia', 9 'Erysiphe quercicola Ex_Durio_zibethinus_MUMH5155_Indonesia', 10 'Erysiphe quercicola Ex_Bixa_orellana_MUMH3230_Thailand', 11 'Erysiphe quercicola Ex_Bauhinia_purpurea_MUMH5678_Indonesia', 12 'Erysiphe quercicola Ex_Bauhinia_purpurea_MUMH5137_Indonesia', 13 'Erysiphe quercicola Ex_Nephelium_lappaceum_MUMH5779_Indonesia', 14 'Erysiphe quercicola Ex_Nephelium_lappaceum_MUMH6552_Indonesia', 15 'Erysiphe quercicola Ex_Nephelium_lappaceum_MUMH6557_Indonesia', 16 'Erysiphe quercicola Ex_Quercus_phillyreoides_MUMH885_Japan', 17 'Erysiphe quercicola Ex_Quercus_phillyreoides_MUMH124_Japan', 18 'Erysiphe quercicola Ex_Hevea_brasiliensis_MUMH2419_Brazil', 19 'Erysiphe quercicola Ex_Quercus_sp._MUMH3242_Iran', 20 'Erysiphe quercicola Ex_Quercus_crispula_MUMH1956_Japan', 21 'Erysiphe quercicola Ex_Bixa_orellana_MUMH_3165_Argentina', 22 'Erysiphe quercicola Ex_Anacardium_occidentale_MUMH781_Tanzania', 23 'Erysiphe quercicola Ex_Hevea_brasiliensis_MUMH2418_Brazil', 24 'Erysiphe quercicola Ex_Mangifera_indica_MUMH3188_Argentina', 25 'Erysiphe quercicola Ex_Mangifera_indica_MUMH3705_Thailand', 26 'Erysiphe quercicola Ex_Mangifera_indica_MUMH3268_Thailand', 27 'Erysiphe quercicola Ex_Mangifera_indica_VPRI20332_Australia', 28 'Erysiphe quercicola Ex_Mangifera_indica_MUMH3267_Thailand', 29 'Erysiphe quercicola Ex_Cinnamomum_camphora_KC857653_Taiwan', 30 'Erysiphe quercicola Ex_Murraya_paniculata_KC85765_Taiwan', 31 'Erysiphe quercicola Ex_Quercus_robur_MUMH960_UK', 32 'Erysiphe quercicola Ex_Quercus_crispula_MUMH242_Japan', 33 'Erysiphe quercicola Ex_Euonymus_japonicus_MUMH133_Japan'; TREE Fig._1 = [&R] ((31:1.0E-8,32:1.0E-8,33:0.001541):0.0064475,((25:1.0E-8,26:1.0E-8):7.15E-4,(18:1.0E-8,19:1.0E-8,20:1.0E-8,21:1.0E-8,22:1.0E-8,23:1.0E-8,24:1.0E-8,27:1.0E-8,(10:7.57E-4,11:1.0E-8,12:1.0E-8,13:1.0E-8,14:1.0E-8,15:1.0E-8,16:1.0E-8,17:1.0E-8,28:0.001525,29:1.0E-8,30:0.001731,(1:7.6E-4,2:1.0E-8):7.6E-4,(3:1.0E-8,4:1.0E-8):7.6E-4,(8:1.0E-8,9:1.0E-8):0.002312,(5:1.0E-8,6:1.0E-8,7:1.0E-8):7.58E-4):7.6E-4):8.06E-4):0.0064475); END;