#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 11:26 GMT TreeBASE (cc) 1994-2008 Study reference: Arzanlou A., Groenewald J.Z., Gams W., Braun U., & Crous P.W. 2007. Phylogenetic and morphotaxonomic revision of Ramichloridium and allied genera. Studies in Mycology, 58: 57-93. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1901] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=137; TAXLABELS Annulatascus_triseptatus_AY346257 Annulatascus_triseptatus_AY780049 Ascotaiwania_hughesii_AY094189 Ascotaiwania_hughesii_AY316357 Athelia_epiphylla_AY586633 Batcheloromyces_proteae Capronia_coronata Capronia_mansonii Capronia_pulcherrima Carpoligna_pleurothecii_AF064645 Carpoligna_pleurothecii_AF064646 Carpoligna_pleurothecii_AY544685 Catenulostroma_abietis Catenulostroma_macowanii Cercosporella_centaureicola Cibiessia_dimorphospora Cladosporium_bruhnei Cladosporium_cladosporioides Cladosporium_sphaerospermum Cladosporium_uredinicola Conioscypha_lignicola Conioscyphascus_varius Cryptadelphia_groenendalensis Cryptadelphia_polyseptata Devriesia_staurophora Dissoconium_aciculare Exophiala_dermatitidis Exophiala_jeanselmei Fonsecaea_pedrosoi Magnaporthe_grisea Metacoleroa_dickiei Mycosphaerella_communis Mycosphaerella_endophytica_DQ246252 Mycosphaerella_endophytica_DQ246255 Mycosphaerella_graminicola Mycosphaerella_gregaria Mycosphaerella_intermedia Mycosphaerella_lateralis Mycosphaerella_madeirae Mycosphaerella_marksii_DQ246249 Mycosphaerella_marksii_DQ246250 Mycosphaerella_parkii Mycosphaerella_punctiformis Mycosphaerella_walkeri Myrmecridium_flexuosum Myrmecridium_schulzeri_CBS_100.54 Myrmecridium_schulzeri_CBS_114996 Myrmecridium_schulzeri_CBS_134.68 Myrmecridium_schulzeri_CBS_156.63 Myrmecridium_schulzeri_CBS_188.96 Myrmecridium_schulzeri_CBS_304.73 Myrmecridium_schulzeri_CBS_305.73 Myrmecridium_schulzeri_CBS_325.74 Myrmecridium_schulzeri_CBS_381.87 Myrmecridium_schulzeri_CBS_642.76 Ophiostoma_stenoceras Paullicorticium_ansatum_AY586693 Periconiella_arcuata Periconiella_levispora Periconiella_velutina_CBS_101948 Periconiella_velutina_CBS_101949 Periconiella_velutina_CBS_101950 Pleurothecium_obovoideum Pseudocercospora_epispermogonia_DQ204757 Pseudocercospora_epispermogonia_DQ204758 Pseudovirgaria_hyperparasitica_CPC_10702 Pseudovirgaria_hyperparasitica_CPC_10704 Pseudovirgaria_hyperparasitica_CPC_10753 Radulidium_epichloes_AF050287 Radulidium_epichloes_CBS_361.63 Radulidium_sp._CBS_115704 Radulidium_subulatum_CBS_101010 Radulidium_subulatum_CBS_287.84 Radulidium_subulatum_CBS_405.76 Radulidium_subulatum_CBS_912.96 Ramichloridium_apiculatum_CBS_156.59 Ramichloridium_apiculatum_CBS_390.67 Ramichloridium_apiculatum_CBS_391.67 Ramichloridium_apiculatum_CBS_400.76 Ramichloridium_australiense Ramichloridium_biverticillatum Ramichloridium_brasilianum Ramichloridium_cerophilum_AF050286 Ramichloridium_cerophilum_CBS_103.59 Ramichloridium_indicum Ramichloridium_musae_CBS_190.63 Ramichloridium_musae_CBS_365.36 Ramichloridium_pini Ramichloridium_strelitziae Ramularia_miae Ramularia_pratensis_var._pratensis Ramularia_sp. Rasutoria_pseudotsugae Rasutoria_tsugae Readeriella_considenianae Repetophragma_goidanichii Rhinocladiella_anceps_AF050284 Rhinocladiella_anceps_AF050285 Rhinocladiella_anceps_CBS_157.54 Rhinocladiella_anceps_CBS_181.65 Rhinocladiella_atrovirens Rhinocladiella_basitona Rhinocladiella_fasciculata Rhinocladiella_mackenziei_AF050288 Rhinocladiella_mackenziei_CBS_367.92 Rhinocladiella_mackenziei_CBS_368.92 Rhinocladiella_mackenziei_CBS102590 Rhinocladiella_phaeophora Rhinocladiella_sp. Rhodoveronaea_varioseptata Septoria_tritici Sporidesmium_pachyanthicola Staninwardia_suttonii Teratosphaeria_alistairii Teratosphaeria_fibrillosa Teratosphaeria_molleriana Teratosphaeria_parva_DQ246240 Teratosphaeria_parva_DQ246243 Teratosphaeria_readeriellophora Teratosphaeria_suberosa Teratosphaeria_toledana Thyridium_vestitum Thysanorea_papuana Venturia_asperata Venturia_carpophila Venturia_chlorospora Venturia_hanliniana Venturia_inaequalis Venturia_pyrina Veronaea_botryosa_CBS_121.92 Veronaea_botryosa_CBS_254.57 Veronaea_botryosa_CBS_350.65 Veronaea_compacta Veronaea_japonica Veronaeopsis_simplex_CBS_588.66 Xenomeris_juniperi Zasmidium_cellare ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3435] TITLE 28S_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=995; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Annulatascus_triseptatus_AY346257 --------------------------------------------------------------------------------------------------------AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--------GGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCG--GCGCCTTCCGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGAT----GCCAAGCCT-CTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACGTGTGCCTCGT-GAATCATCCGGCGT----TCTCGCCGGTGCACTT-CGCCTGG-CACAGGCCAGCATCGGTTTTCCCAGGGGGATAAAAGCCGCGGGAACGTAGCTCTT---CCG-GG---AGTATTATAGCC-CGTGGC-ACAATG-CCCTTGGGGGGACCGAGGCCCGC------------------------------GCT-CC-GCA-AGGATGCTGGCATAATGGTCATCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTCAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTATT--CGGATGG-ATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGATGGTGAACTATGCCTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGGGCATGGGGGCGAAAGTGAGTTTTATAACC Annulatascus_triseptatus_AY780049 ---------------------------------------------------TCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTC---------GGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCG--GCGCCTTCCGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGAT----GCCAAGCCT-CTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACGTGTGCCTCGT-GAATCATCCGGCGT----TCTCGCCGGTGCACTT-CGCCTGG-CACAGGCCAGCATCGGTTTTCCCAGGGGGATAAAAGCCGCGGGAACGTAGCTCTT---CCG-GG---AGTGTTATAGCC-CGTGGC-ACAATG-CCCTTGGGGGGACCGAGGCCCGC------------------------------GCT-CC-GCA-AGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTCAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTATT--CGGATGG-ATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGATGGTGAACTATGCCTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGGGCATGGGGGCGAAAGACTAATCGAACCAT Ascotaiwania_hughesii_AY094189 -------------------------------------------------------------ATCAT?GGCCTGTTC?-T?AAGGCGGTTTGCCCAAGACGGCGAGTGAACTGCAACCCCAGATTTGAAATCCGGCCC---------CGGCCCGAGTTGTAATCTGCAGATGAGTCTTCGGGCAAG--GCGTCGTCCAAGTTCCCTGGAATGGGACGCCGGAGAGGGTGAGAGCCCCGTACCGACGGCC----GCCGCGCCT-GTGCGAAGCTCATTCGAAGAGTCGAGTAGTTTGGAAATGCTGCTCTAATTGCGGGGTAAATCTCCCGTAAGGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGAGCCTTGAATAAGGGCGTCAAAAAGTATGTGAAATTGTTGTGGGGGAAGCGCTTGGCGCCAGACGTGGCGGCGGT-TGGTTACCCGGCGTT---ACTCGCCGGCGCACTC-TGCCGCC-GCCAGGCCAGCATCGGTTCGGCCTGGGACCTACTGACGCGAGGAACGTGGCCCT----TCG-GG----GTGTTACAGCC-TCGCGG--AGA-CGTCCCGCGCCGGACCGAGGATCGC------------------------------GCTTCG-GCT-CGGATGCTGGCGTAATGGCCCTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTTGACCTA-CCCGCGAGTGTTTGGGTGTCAAGCCC-TCACGCGCAGTGAAAGCGAACGCAGGTGGGAGCC-----TC--GCGCACCATCGA-CGATCCTGAAGTTCA--C-GACGG-ATTTTAGT-AGAGCGTGCTGGGTCTGACCCGAAAGAA-GTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TCTTACG-GCAA-TCGATCGTCAATTTTG--CATGGGGGCGAAAAACCA-TCGAACCTC Ascotaiwania_hughesii_AY316357 ---------------------------------------------------------------------------------------------------------------GCAACCCCAGATTTGAAATCCGGCCC---------CGGCCCGAGTTGTAATCTGCAGATGAGTCTTCGGGCAAG--GCGTCGTCCAAGTTCCCTGGAATGGGACGCCGGAGAGGGTGAGAGCCCCGTACCGACGGCC----GCCGCGCCT-GTGCGAAGCTCATTCGAAGAGTCGAGTAGTTTGGAAATGCTGCTCTAATTGCGGGGTAAATCTCCCGTAAGGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGAGCCTTGAATA-GGGCGTCAAAAAGTATGTGAAATTGTTGT-GGGGAAGCGCTTGGCGCCAGACGTGGCGGCGGT-TGGTTACCCGGCGT----TCTCGCCGGCGCACTC-TGCCGCC-GCCAGGCCAGCATCGGTTCGGCCTGGGACCTACTGACGCGAGGAACGTGGCCCT----TCG-GG----GTGTTACAGCC-TCGCGG--AGA-CGTCCCGCGCCGGACCGAGGATCGC------------------------------GCTTCG-GCT-CGGATGCTGGCGTAATGGCCCTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTTGACCTA-CCCGCGAGTGTTTGGGTGTCAAGCCC-TCACGCGCAGTGAAAGCGAACGCAGGTGGGAGCC-----TC--GCGCACCATCGA-CGATCCTGAAGTTCA--C-GACGG-ATTTTAGT-AGAGCGTGCTGGGTCTGACCCGAAAGAA-GTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGG-TCTTACG-GCAA-TCGATCGTCAATTTTG--CATGGGGGCGAAAAACCA-TCGAACCTC Athelia_epiphylla_AY586633 --------TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGACACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGTCCTC--CGGGCGTCCGAGTTGTAATCTGGAGA-AGCGTTTTCCGCGTCG-ACCGTGTACAAGTCTTCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTCTGACACGGACTACCGATGCTTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAG----TCGCGTTGGCCGAGACTC-AGCCTGG--CTTGCCTGGTGTACTT-CTCGGTT-GACGGGTCAGCATCAGTTTTGACCGCCGGATAAAGGTTGGAGGAATGTGGCATCCC--TCG-GG--ATGTGTTATAGCCTTCGATTCGCATACGGCGATT--GGGACTGAGGAACTCAGCACGCCTTTATGGTCGGGGTTCGCCCACGTAACGTGCTTAGGATGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGTTAAACCC-GAGCGCGTAATGAAAGTGAAAATTGAG-ATCCCTG-TCGCGGGGAGCATCGATGCCCGGACCAGACCTTTT--GTGACGG-ATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Batcheloromyces_proteae ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCAGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---TTGGCACCCG-TCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCCACCAGACTTGTCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GACAGGCCAGCATCATCTGGGGGCGCCGGATAAAGGCGCGGGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-CCGCGC-ACAATACGGTGACCCTCGGGTGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTTGTTTGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGGAATGAAAGTGAACGGAGGTGGGAACC--TTTACCGGTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Capronia_coronata ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTCTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGATCGG--CGGTAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGTTATTC-CGCCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCTCTGGGAATGTATCTACCCT-TCG-GGCGTAGACTTATAGCC-CAGGGT-GTCATGCGGCCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGAAATGAAAGTGAACGGAGGTAGGAAGC---TTCG-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTAGGTATAGGGGCGAAAGACTAATCGAACCAT Capronia_mansonii ------------------------------------------TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGCACC-CTCCGGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAACCCCGTCTTGGACCGG--CAGTAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGCGGTTCCCCC-TTCCT----TCTGGTTGGGTTATTC-CGCCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCCGGGGAATGTATCTACCCT-TCG-GGCGTAGACTTATAGCC-CCGGGT-GTCATGCGACCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGC---TTCG-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Capronia_pulcherrima ------------------ATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTT-----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACC-CTCCGGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGG--TGGTAGGGCCT-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGCGCGCGGCGGTT-CCCC-TTCCT----TTTGGTTGGGTTACTC-CGCCGTG-TCCAGGCCAATATCGGTTTTGGGGGTCGGTCAAAGGCGCTGGGAATGTACCTACCCT-TCG-GGCGTAGACTTATAGCC-CAGCGT-GTCATGCGACCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATATTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGTAATGAAAGTGAACGGAGGTAGGAAGCC--TTTGGGCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAAATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Carpoligna_pleurothecii_AF064645 ----------------------------------------------------------------------------------------------------------GCGGCAACAGCCCAGATTTGAAATCCGGCTTT-------CGGGCCCGACTTGTAATCTGCAGATGAGTCTTTTGGCGGA--GCGCCGTCCAAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACCGACGTGC----GCCGAGTCT-TTGCAAAGCTCATTCGAAGAGTCGAGTAGTTTGGAAATGCTGCTCAAATTGTGGGGTAAATCTCCCATAAGGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGAGCCTTGAACAAGGGCGTCAAAAAGCATGTGAAATTGTTGTGAGGGAAGCGCTCGATGCCAGACGTGGAGGCGGT-TGGTTACCCGGCGT----TCTCGCCGGCGCACTC-TGCCGTC-TCCAGGCCAGCATCAGTTCGGCTTGGGACTCAATGCAGCTGGGAACGTGGCTCT----TCG-GA----GTGTTATAGCC-TAGCTG--CGA-CGTCCTGGGCCGGACTGAGGAACGC------------------------------GCATCT-GCC-CGGATGCTGGCGTAATGGCTTCTAGCGA-CCGTCTTGAAACACGGAC-CAAGGAGTTGACCTAACATGCGAGTGTTTGGGTGTAAAGCCC-TCACGCGCAGTGAAAGCGAACGCAGGTGGGAGT-----TTC-GGCGCACCATCGACCGATCCTGAAGTTTA--CGGATGG-ATTTGAGTAAGAGCATGTTGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGAACCTT Carpoligna_pleurothecii_AF064646 ---------------------------------------------------------------------------------------------------------------------CCAGATTTGAAATCCGGCTTT-------CGGGCCCGACTTGTAATCTGCAGATGAGTCTTTTGGCGGA--GCGCCGTCCAAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACCGACGTGC----GCCGAGTCT-TTGCAAAGCTCATTCGAAGAGTCGAGTAGTTTGGAAATGCTGCTCAAATTGTGGGGTAAATCTCCCATAAGGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGAGCCTTGAACAAGGGCGTCAAAAAGCATGTGAAATTGTTGTGAGGGAAGCGCTCGATGCCAGACGTGGAGGCGGT-TGGTTACCCGGCGT----TCTCGCCGGCGCACTC-TGCCGTC-TCCAGGCCAGCATCAGTTCGGCTTGGGGCTCAATGCAGTTGGGAACGTGGCTCT----TCG-GA----GTGTTATAGCC-CAGCTG--CGA-CGTCCTGGGCCGGACTGAGGAACGC------------------------------GCATCT-GCC-CGGATGCTGGCGTAATGGCTTCTAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTTGACCTAACATGCGAGTGTTTGGGTGTAAAGCCC-TCACGCGCAGTGAAAGCGAACGCAGGTGGGAGC-----TTC-GGCGCACCATCGACCGATCCTGAAGTTTA--CGGATGG-ATTTGAGTAAGAGCATGTTGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGAACCTT Carpoligna_pleurothecii_AY544685 -----------------------------------------------------------------------------------------------------------------CAGCCCAGATTTGAAATCCGGCTTT-------CGGGCCCGACTTGTAATCTGCAGATGAGTCTTTTGGCGGA--GCGCCGTCCAAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACCGACGTGC----GCCGAGTCT-TTGCAAAGCTCATTCGAAGAGTCGAGTAGTTTGGAAATGCTGCTCAAATTGTGGGGTAAATCTCCCATAAGGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGAGCCTTGAACAAGGGCGTCAAAAAGCATGTGAAATTGTTGTGAGGGAAGCGCTCGATGCCAGACGTGGAGGCGGT-TGGTTACCCGGCGT----TCTCGCCGGCGCACTC-TGCCGTC-TCCAGGCCAGCATCAGTTCGGCTTGGGGCTCAATGCAGTTGGGAACGTGGCTCT----TCG-GA----GTGTTATAGCC-TAGCTG--CGA-CGTCCTGGGCCGGACTGAGGAACGC------------------------------GCATCT-GCC-CGGATGCTGGCGTAATGGCTTCTAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTTGACCTAACATGCGAGTGTTTGGGTGTAAAGCCC-TCACGCGCAGTGAAAGCGAACGCAGGTGGGAGC-----TTC-GGCGCACCATCGACCGATCCTGAAGTTTA--CGGATGG-ATTTGAGTAAGAGCATGTTGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGAACCTT Catenulostroma_abietis -------------------------------------------------------------------------------GGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGG---TTGGCACCCG-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCCGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCG-GGCAGGCCAGCATCATCTGGGAGCGCCGGATAAAGGTAGCGGGAATGTGGCCCC----TCG-GG----GTGTTATAGCT-CGCTAC-ACAATACGGCGCCTCCCGGGTGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTTGTATGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTACCATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGCAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Catenulostroma_macowanii ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCAGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---TTGGCACCCG-TCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GGCAGGCCAGCATCATCTGGGTGCGCCGGATAAAGGCGTGGGGAATGTAGCTCC----TC--GG---AGTGTTATAGCC-CCGCGC-ACAATACGGCGCCGCCCGGGTGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTTGTATGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGGAATGAAAGTGAACGGAGGTGGGAAGC---GCAA-GCTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Cercosporella_centaureicola ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTAGGTAGC-GACCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CCCGCACCTT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAACCAGACTTCTGGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGTC-CCGAGGCCAACATCATCTGGGACCGCCGGATAA-GACCTCAGGAATGTAGCTTCCC--TCG-GG--AAGTGTTATAGCC-TGTGGT-G--ATGCGGCGCGTCCCGGGTGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAGC---GCAA-GCTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Cibiessia_dimorphospora ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---TTGGCACCCG-TCACGTAGCTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCAAGCAATCAGACTTGTCGGCGGT-GTTCCCCC-GGTCT----TCTGACCGGGTCACTC--GCCGCC-GGCAGGCCAACATCATTTGGGTGCGCCGGATAAAGACGTGAGGAATGTGGCCCCC---TCG-GG---GGTGTTATAGCC-TCGCGT-GCAATACGGTGTCGCCCGAGTGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGTTGGCGTAATGGTTGTTTGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAC----GAAA--GTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Cladosporium_bruhnei ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCTCTAGTAACGGCGAGTGAAGCAGCAATAGCTCAAATTTGAAATCTGGCGTCTTC----GACGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGAGTGGC-CACCGACCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTCGG--AAAGGCGCTCT-ATACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGATTGCAACCAGACTTGCTCGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCGTTGCAGGCCAGCATCGTCTGGTGCCGCTGGATAA-GACTTGAGGAATGTAGCTCCC---TCG-GG---AGTGTTATAGCC-TCTTGT-G--ATGCAGCGAGCGCCGGGCGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTCGTAATCCGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGAGAACC---GCAA-GGTGCATCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Cladosporium_cladosporioides ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCTCTAGTAACGGCGAGTGAAGCAGCAATAGCTCAAATTTGAAATCTGGCGTCTTC----GACGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGAGTAAC-CACCGACCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTCGG--AAAGGTGCTCT-ATACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGATTGCAACCAGACTTGCTCGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCGTTGCAGGCCAGCATCGTCTGGTGCCGCTGGATAA-GACTTGAGGAATGTAGCTCCC---TCG-GG---AGTGTTATAGCC-TCTTGT-G--ATGCAGCGAGCGCCGGGCGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTCGTAATCCGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGAGAACC---GCAA-GGTGCATCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Cladosporium_sphaerospermum ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCTCTAGTAACGGCGAGTGAAGCAGCAATAGCTCAAATTTGAAATCTGGCGTCTTC----GACGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGAGTGGC-CACCGACCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTCGG--AAAGGCGCTCT-ATACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGATTGCAACCAGACTTGCTCGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCGTTGCAGGCCAGCATCGTCTGGTGCCGCTGGATAA-GACTTGAGGAATGTAGCTCCC---TCG-GG---AGTGTTATAGCC-TCTTGT-G--ATGCAGCGAGCGCCGGGCGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTCGTAATCCGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGAGAACCC--GCAA-GGTGCATCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Cladosporium_uredinicola ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCTCTAGTAACGGCGAGTGAAGCAGCAATAGCTCAAATTTGAAATCTGGCGTCTTC----GACGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGAGTAAC-CACCGACCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTCGG--AAAGGTGCTCT-ATACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGATTGCAACCAGACTTGCTCGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCGTTGCAGGCCAGCATCGTCTGGTGCCGCTGGATAA-GACTTGAGGAATGTAGCTCCC---TCG-GG---AGTGTTATAGCC-TCTTGT-G--ATGCAGCGAGCGCCGGGCGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTCGTAATCCGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGAGAACC---GCAA-GGTGCATCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Conioscypha_lignicola --------------------------------------------------------------------------------------------------------------------------------------CTCTCTT---GGGGGCCCGAGTTGTAATCTGCAGATGGGTCTTTTGGTGAA--GCGCCGTCCAAGTTCCCTGGAATGGGACGCCTCAGAGGGTGAGAGCCCCGTACAGGCGGTC----GCCGAGCCT-CTGTAAAGCCCATTCGACGAGTCGAGTAGTTTGGAAATGCTGCTCTAATCGCGGGGTAAACCTCCCGTAAGGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGGGCCTTGAACAAGGGCGTCAAAAAGTATGTGAAATTGTTATGGGGGAAGCGCTCGATGCCAGACTCGGGGGCGGT-TGGTTACCCGGCGGT---CCTCGCCGGCGCACTC-TGCCGTC-CCCGGGCCAGCATCAGTTCGGCGCGGGGCTTACTGCCTCGGGGAACGTGGCTCCC---TCG-GG---AGTGTTATAGCC-TCGTGG--CGA-CGCCCCGTGCCGGACTGAGGACCGC------------------------------GCCTTCGGGCCTGGATGCT--CGTAATGGCCCCTAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTTGACCTAGCATGCGAGTGTACGGGTGTAAAGCCC-TGGCGCGCAATGAAAGTGATCATGGGTGGGAGCCC----TCGGGCGCACCATCGACCGATCCTGACGTCTCTACAGATGG-ATTTGAGTAAGAGCATGCTGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGAACCTT Conioscyphascus_varius ------------------------------------------------------------------------------------------------------------------------------------GGCTCTCTA---GGGAGCCCGAGTTGTAGTCTGCAGATGGGTCTTTCTGGCGGA-GCGCCGTCCAAGTTCCCTGGAATGGGACGCCGTAGAGGGTGAGAGCCCCGTACGGATGGTC----GCCGAGTCTCTTGTAAAGCCCATTCGACGAGTCGAGTAGTTTGGAAATGCTGCTCAAATCGCGGGGTAAACCTCCCGTAAGGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGAGCCTTGAACAAGGGCGTCAAAAAGTATGTGAAATTGTTGTGGGGGAAGCGCCCGAGACCAGACTCGGTGGCGGT-TGGTTACCCGGCGAGACCCCTCGCCGGCGCACTC-TGCCGTC-CCCGGGCCAGCATCGGTTGGACCTGGGGCCCAATGCCGCGAGGAACGTGGCTCCCC--TCG-GG--GAGTGTTATAGCC-ACGCGG--CGA-CGCCCCAGGACCGACCGAGGACCGC------------------------------GCTCTCGAGCCTGGATGCT--CGTAATGGTCTCTAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTTGACCTGGCATGCGAGTGTATGGGTTCCAAGCCC-TAGCGCGCAATGAAAGTGATC-TGGGTGGGATCCCCTCTCGGGGCGCACCATCGACCGATCCTGAAGTTTA--CGGATGG-ATTTGAGTAAGAGCATGCCGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGAACCTT Cryptadelphia_groenendalensis ------------------------------------------------------------------------------------------------------------------------AATTTGAAATCTGGCCTTT--------GGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCG--GTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACAGTCGGAC----ACCTAGCCT-CTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCTCGGT-GGATCATCTAGCGT----TCTCGCTGGTGCACTC-CGCCGTG-CTCAGGCCAGCATCGGTTTCCCCGGGGGGATAAAAGCTTCGGGAACGTGGCTCCT---TCG-GG---AGTGTTATAGCC-CGCTGC-ACAATG-CCTTCGGGGGGACCGAGGTTCGC------------------------------GCT-CC-GCA-AGGATGCTGGCGTAATGGTTACCGGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTAAAACCC-GCACGCGTAATGAAAGTGAACGTAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTCT--CGGATGG-ATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGATGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCAT Cryptadelphia_polyseptata ------------------------------------------------------------------------------AGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTCT-------GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCG--GCGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACAGTCGGAC----GCCTAACCT-TTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCTCGGT-GGATCATCTAGCGT----TCTCGCTGGTGCACTC-CACCGTG-CTCAGGCCAGCATCGGTTTCCCCGGGGGGATAAAAGCTTCGGGAACGTGGCTCCT---TCG-GG---AGTGTTATAGCC-CGTTGC-ATAATG-CCTTCGGGGGGACCGAGGTTCGC------------------------------GCT-CC--CA-AGGATGCTGGCGTAATGGTTACCGGCGAGCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTAAAACCC-GCACGCGTAATGAAAGTGAACGTAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTCT--CGGATGG-ATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGATGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCAT Devriesia_staurophora -----------------------------------------------------------------------AACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTAGGTTGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGACCGG---CTTGCACCTT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GACAGGCCAGCATCGTCTGGGGGCGCCGGAGAAAGGTGCCAGGAATGTAGCTCC----TC---G--GAGTGTTATAGCC-TGGCAC-ACAATACGGTGACTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTTGCCTGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCGACCATCTGTGCGAGTGTTCGGGTGTTAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAC----GCAA--GTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGGTCGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGG--------------------- Dissoconium_aciculare ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGG---CGCGCGCCCT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGGGTGGT-GTTCCGCC-GGGCT----TCTGCCCGGTCTACTC--ACCGCC-CGCAGGCCATCATCGTCTGGGGCCGCCGGAGAA-ACCGTCAGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-TGTCGA-C--ATGCGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCA-AT-GCA-AGGATGATGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGA------GCTTCGGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Exophiala_dermatitidis --TCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGCACC-CTCCGGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAACCCCGTCTTGGACCGG--CAGTAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGTTATTC-CGCCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCTGGGGAATGTATCTACCCT-TCG-GGCGTAGACTTATAGCC-CCGGGT-GTCATGCGACCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGC---TTCG-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Exophiala_jeanselmei --------------------CAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTC----GGGGCCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCTTGGACCGG--CGGTAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGAGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGTTACTC-CGCCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTCAAAGGCCCGGGGAATGTATCTACTCCTTCG-GGGGTAGACTTATAGCC-CCGGGT-GTCATGCGACCACCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGCC--TTTGGGCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Fonsecaea_pedrosoi ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGG--CGGTAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGCGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGCTACTC-CGTCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGACCCTGGGAATGTATCTACCCT-TCG-GGCGTAGACTTATAGCC-CAGGGT-GTCATGCGGCCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGAAATGAAAGTGAACGGAGGTAGGAAGCC--TTGAGGCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Magnaporthe_grisea -------GTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCC-------GGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAG--GCACCTACCGAGTCCCCTGGAATGGGGCGCCATAGAGGGTGAGAGCCCCGTATGGTAGGAC----GCCGAACCT-CTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGC-GGATCATCCAGCGT----TCTCGCTGGTGCACTC-CGCCCGG-TTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAGGCTTCGGGAACGTGGCTCCTT--TCG-GG--GAGTGTTATAGCC-CGTTGC-GTAATA-CCCCGGCGGGGACCGACGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGAC-CGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCC-GCACGCGTAATGAAAGTGAACGTAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTTT--CGGAAGG-ATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCAT Metacoleroa_dickiei --------TTGGCCTCGGATCAGGTGGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC---------ACGCCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGAAG-CCACGGTCCAAGTCCCTTGGAACAGGACGTCATAGAGGGTGAGAACCC-GTACCTGGCCGTCGGTTGCCCCCCG-CTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCCCGCGGT-TGCTCAGCCCGCCT----TTTGGCGGGTGCACTC-TTCCGCG-GTCAGGCCAGCATCGGTTTGGGCGGTCGGATAAAGGCGCAGGGAACGTGGCCTCCCC-TCG-GG-GAGGTGTTATAGCC-CGGCGT-GCAATGCGGCCAGCCTGGACCGAGGTTCGC------------------------------GCTCTG--CT-AGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCC-GTGCGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCCGACGTCTT--CGGAAGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_communis ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGG---CCCGCGCCCT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGGGCTTGCAACCAGACTTGACGGCGGT-GTTCCCCC-GGGCT----TCTGCCCGGGTTATTC--ACCGTC-GGCAGGCCATCATCGTCTGGGGCCGCTGGAGAA-ACCGTCAGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-TGTCGA-C--ATGCAGCGTGCCCCGGGCGAGGTCCGC------------------------------GCTTAG-GCA-AGGATGATGGCGTAATGGTTGTCAGCCGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGA------GCTTCGGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_endophytica_DQ246252 -----------------------------------------------------------------------------------------------------------------------AAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CACGTACCCT-TTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTCGTGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GCGAGGCCAGCATCGTCTGGGGCCGCCGGATAA-GACCTTAGGAATGTAGCTTGCC--TC--GG-TAAGTGTTATAGCC-TAGGGT-G--ATGCGGCGTGCCTCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAGC---GCAA-GCTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_endophytica_DQ246255 -----------------------------------------------------------------------------------------------------------------------AAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CACGTACCCT-TTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTCGTGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GCGAGGCCAGCATCGTCTGGGGCCGCCGGATAA-GACCTTAGGAATGTAGCTTGCC--TC--GG-TAAGTGTTATAGCC-TAGGGT-G--ATGCGGCGTGCCTCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAGC---GCAA-GCTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_graminicola ------GGTTGACCTCGGATCGGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC-------CGGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GACCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---CCCGCGCCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTTGGGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--TCCGTC-CCGAGGCCAACATCATCTGGGACCGCCGGACAA-GACCTCAGGAATGTAGCTCCCCC-TCG-GG-GGAGTGTTATAGCC-TGTGGT-G--ATGCGGCGCGTCCCGGGTGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGGAATGAAAGTGAACGGAGGTGGGAAGG--GGCAACCCTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_gregaria -----------------------------------------------------------------------------------------------------------------------AAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CACGTACCCT-TTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTCGTGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GCGAGGCCAGCATCGTCTGGGGCCGCCGGATAA-GACCTTAGGAATGTAGCTTGCC--TC--GG-TAAGTGTTATAGCC-TAGGGT-G--ATGCGGCGTGCCTCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAGC---GCAA-GCTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_intermedia -------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGGCAGC-GGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTCGCGGCGGT-GTTCCGCC-GGTCT----TTTGACCGGTCTACTC--GCCGCC-GCGAGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCATGGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-CACGGT-G--ATGCGGCGTGTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGCCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAG-----CTTC-GGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_lateralis ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGG---CCCGCGCCCT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGACGGCGGT-GTTCCCCC-GGGCT----TCTGCCCGGGTTACTC--ACCGTC-TTCAGGCCATCATCGTCTGGGGCCGCCGGAGAA-ACCGTCAGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-TGTCGA-C--ATGCGGCGTGCCCCGGGCGAGGTCCGC------------------------------GCTTAG-GCA-AGGATGATGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGA------GCTTCGGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_madeirae -----------------------------------------------------------------------------------------------------------------------AAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCCGCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCCACTC--GCCGCC-GCGGGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCGCAGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-TGCGGT-G--ATGCGGCGCGCCTCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGCCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAG-----CTTC-GGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_marksii_DQ246249 -------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGGCAGC-GGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTCGCGGCGGT-GTTCCGCC-GGTCT----TTTGACCGGTCTACTC--GCCGCC-GCGAGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCGTGGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-CACGGT-G--ATGCGGCGTGTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGCCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAG-----CTTC-GGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_marksii_DQ246250 -------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGGCAGC-GGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTCGCGGCGGT-GTTCCGCC-GGTCT----TTTGACCGGTCTACTC--GCCGCC-GCGAGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCATGGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-CACGGT-G--ATGCGGCGTGTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGCCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAG-----CTTC-GGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_parkii -----------------------------------------------------------------------------------------------------------------------AAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCCGCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCCACTC--GCCGCC-GTGGGGCCATCATCGTCTGGGGCCGTCGGATAA-GACCGTAGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-TGCGGT-G--ATGCGACGCGCCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGATGGCGTAATGGTTGCCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAG-----CTTC-GGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_punctiformis ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTAGGTAGC-GACCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGG---CCCGCACCTT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAACCAGACTTCTAGGCAGT-GTTCCGCC-GGTCT----TTTGACCGGTCTACTC--TCTGTC-TCGAGGCCAACATCATCTGGGACCGCCGGATAA-GACCTTAGGAATGTAGCTCCCC--TCG-GG--GAGTGTTATAGCC-TCTGGT-G--ATGCGGCGCGTCTCGGGTGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAGC---GTAA-GCTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Mycosphaerella_walkeri -------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTGCAACCAGACTTCGCGGCAGT-GTTCCGCC-GGTCT----TCTGACCGGTTCACTC--TCTGCC-GCGAGGCCATCATCGTCTGGGGCCGCCGGATAA-GACTGGAGGAATGTAGCTCCCC--TCG-GG--GAGTGTTATAGCC-TCCGGT-G--ATGCGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGATGGCGTAATGGTTGTCGGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAC----TTTT-TGTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Myrmecridium_flexuosum ---------TGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGCG--GTGCCTTCTGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACAGTTGGAC----ACCAAGCCT-TTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCCGGC-GGATCATCCGGCCT----TCTGGCCGGTGCACTC-CGCCGGG-CTCAGGCCAGCATCGGTTCTTCCGGGGGGACAAAAGCGGTGGGAACGTAGCTCTT---CCG-GG---AGTGTTATAGCC-CGCCGC-AGCATA-CCCCCGGGGGGACCGAGGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTCAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTTT--CGGATGG-ATTTGAGTAAGAGCCTTGCCGCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGACTAATCGAACCAT Myrmecridium_schulzeri_CBS_100.54 ---------------------------------------------------TCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCG--GTGCCTTCTGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACAGTTGGAC----ACCAAGCCT-TTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCCGGC-GGATCATCCGGCCT----TCTGGCCGGTGCACTC-CGCCGGG-CTCAGGCCAGCATCGGTTTTCCTGGGGGGATAAAAGTGGCGGGAACGTAGCTCCT---CCG-GG---AGTGTTATAGCC-CGCCGC-AGCATA-CCCCCGGGGGGACCGAGGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTCAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTTT--CGGATGG-ATTTGAGTAAGAGCCTTGCCGCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGAC------------ Myrmecridium_schulzeri_CBS_114996 TCTCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGCG--GTGCCTTCTGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACAGTTGGAC----ACCAAGCCT-TTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTCGTGACCAGACTTGCGCCCGTC-GGATCATCCGGCCT----TCTGGCCGGTGCACTC-CGGCGGG-CTCAGGCCAGCATCGGTTCTTCCGGGGGGACAAAAGCGGCGGGAACGTAGCTCCT---CCG-GG---AGTGTTATAGCC-CGCCGC-AGAATA-CCCCCGGGGGGACCGAGGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCACCAGCCACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTCAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTTT--CGGATGG-ATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGACTAATCGAACCAT Myrmecridium_schulzeri_CBS_134.68 ---------------------------------------------------TCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCG--GTGCCTCCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACAGTTGGAC----ACCAAGCCT-TTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCCGGC-GGATCATCCGGCCT----TCTGGCCGGTGCACTC-CGCCGGG-CTCAGGCCAGCATCGGTTCTTCTGGGGGGACAAAGGCGGTGGGAACGTAGCTCCT---CCG-GG---AGTGTTATAGCC-CGCCGC-AGCATA-CCCCCGGGGGGACCGAGGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTTAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTTT--CGGATGG-ATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGAC------------ Myrmecridium_schulzeri_CBS_156.63 ---------------------------------------------------TCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCG--GTGCCTCCTGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACAGTTGGAC----ACCAAGCCT-TTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCCGGC-GGATCATCCGGCCT----TCTGGCCGGTGCACTC-CGCCGGG-CTCAGGCCAGCATCGGTTCTTCTGGGGGGACAAAGGCGGCGGGAACGTAGCTCCT---CCG-GG---AGTGTTATAGCC-CGCCGC-AGCATA-CCCCCGGGGGGACCGAGGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTTAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTTT--CGGATGG-ATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGACTAATCGAGC--- Myrmecridium_schulzeri_CBS_188.96 ---------TGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGCG--GTGCCTTCTGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACAGTTGGAC----ACCAAGCCT-TTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCCGGC-GGATCATCCGGCCT----TCTGGCCGGTGCACTC-CGCCGGG-CTCAGGCCAGCATCGGTTCTTCCGGGGGGACAAAAGCGGTGGGAACGTAGCTCCT---CCG-GG---AGTGTTATAGCC-CGCCGC-AGAATA-CCCCCGGGGGGACCGAGGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTCAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTTT--CGGATGG-ATTTGAGTAAGAGCCTTGCCGCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Myrmecridium_schulzeri_CBS_304.73 ---------------------------------------------------TCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCG--GTGCTTTCTGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACAGTTGGAC----ACCAAGCCT-TTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCCGGC-GGATCATCCGGCCT----TCTGGCCGGTGCACTC-CGCCGGG-CTCAGGCCAGCATCGGTTCTTCCGGGGGGACAAAAGCGGCGGGAACGTAGCTCTT---CCG-GG---AGTGTTATAGCC-CGCCGC-AGAATA-CCCTCGGGGGGACCGAGGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTCAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTTT--CGGATGG-ATTTGAGTAAGAGCCTTGCCGCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGAC------------ Myrmecridium_schulzeri_CBS_305.73 ---------------------------------------------------TCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGCG--GTGCCTTCTGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACAGTTGGAC----ACCAAGCCT-TTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCCGGC-GGATCATCCGGCCT----TCTGGCCGGTGCACTC-CGCCGGG-CTCAGGCCAGCATCGGTTCTTCCGGGGGGACAAAAGCGGTGGGAACGTAGCTCCT---CCG-GG---AGTGTTATAGCC-CGCCGC-AGAATA-CCCCCGGGGGGACCGAGGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTCAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTTT--CGGATGG-ATTTGAGTAAGAGCCTTGCCGCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGACAA---------- Myrmecridium_schulzeri_CBS_325.74 ------------------------------------------------------------------AAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCG--GTGCCTCCTGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACAGTTGGAC----ACCAAGCCT-TTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCCGGC-GGATCATCCGGCCT----TCTGGCCGGTGCACTC-CGCCGGG-CTCAGGCCAGCATCGGTTCTTCTGGGGGGACAAAGGCGGCGGGAACGTAGCTCCT---CCG-GG---AGTGTTATAGCC-CGCCGC-AGCATA-CCCCCGGGGGGACCGAGGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTTAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTTT--CGGATGG-ATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGAC------------ Myrmecridium_schulzeri_CBS_381.87 ---------------------------------------------------TCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGCG--GTGCCTTCTGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACAGTTGGAC----ACCAAGCCT-TTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCCGGC-GGATCATCCGGCCT----TCTGGCCGGTGCACTC-CGCCGGG-CTCAGGCCAGCATCGGTTCTTCCGGGGGGACAAAAGCGGTGGGAACGTAGCTCCT---CCG-GG---AGTGTTATAGCC-CGCCGC-AGAATA-CCCCCGGGGGGACCGAGGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTCAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTTT--CGGATGG-ATTTGAGTAAGAGCCTTGCCGCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGACTAATCGAACCAT Myrmecridium_schulzeri_CBS_642.76 ---------------------------------------------------TCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCG--GTGCCTTCTGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACAGTTGGAC----ACCAAGCCT-TTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCCGGC-GGATCATCCGGCCT----TCTGGCCGGTGCACTC-CGCCGGG-CTCAGGCCAGCATCGGTTTTCCTGGGGGGATAAAAGTGGCGGGAACGTAGCTCCT---CCG-GG---AGTGTTATAGCC-CGCCGC-AGCATA-CCCCCGGGGGGACCGAGGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTCAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTTTT--CGGATGG-ATTTGAGTAAGAGCCTTGCCGCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGAC------------ Ophiostoma_stenoceras -------------------------------------TGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCC-------GGCCCGAGTTGTAATTTGGAGAGGATGCTTTTGGCGCG--GCGCCGTCCGAGTTCCTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTACGGACGGAC----GCCTAACCT-TTACAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGCGCCCCGT-GGACCATCCGGCGT----TCTCGCCGGTGCACTC-TGCGGGG-CGCAGGCCAGCATCGGTTCTCCTAGGGGGATAAAGGCCGCGGGAACGTAGCTCCT---TCG-GG---AGTGTTATAGCC-CGTGGT-GGCATG-CCCCTGGGGGGACCGAGGACCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTGGGGCGAGTGTATGGGTGCCAAACCC-GCACGCGAAATGAAAGTAAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATGGGGGCGAAAGACTAATCGAACCAT Paullicorticium_ansatum_AY586693 --------TCAGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCTGGCGGTTTC----ACCGTCCGAGTTGTATGCTTACGA-AGTGTTTTCGGTGTTG-ACCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTACTTGACATGGACTCCCAGTGCC-TTGTGATACACTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGA-AAGAGAGTGAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTCAG----TCGCGTCTCTAGGAATTC-AGCCTTG--AA----CGGTGTATTTTCCTAGTT-GACGGGCCAACATCGATTTTGGTCGGCGGAAATGGGCTTGAGGAATGTGGCACCT---TTG-GG--T-GTGTTATAGAC-TCTTGTCGCAAACGTCGGTT--GGGATCGAGGACCGCA-----------------------------GCTTCG-GCTTAGGATGTTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATGTGTGCGAGTGTTTGGGTGTTAAACCC-TTGCGCGTAATGAAAGTGAACGCAGGTGGGAGGCC-GTTAAGGCTGCACCATCGACCGATCCGGATCTTTA--GTGATGG-ATTTGAGTGAGAGCATATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Periconiella_arcuata --------------------------------------------------------------------ATGTGCCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACCTGGCGC---------AAGCCCGGATTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---CACGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCCGCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GTGGGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCGGAGGAATGTAGCTC---------AT-TGAGTGTTATAGCC-TCCGGT-G--ATGCGGCGCGTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Periconiella_levispora -------------------------------------------------------------------GGAGAGACTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTCGTGGCGGT-GTTCCGCC-GGCCT----CTTGGCCGGTCCACTC--GCCGCC-GCGAGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCGTAGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-TTCGGT-G--ATGCGGCGAGTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGCCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAG-----CTTC-GGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Periconiella_velutina_CBS_101948 --------------------------------------------------------------AGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACCTGGCGC---------AAGCCCGGATTGTAATTTGCAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---CACGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAACCAGACTCCGCGGCGGT-GTTCCGCC-GGTCT----TTTGACCGGTCTACTC--GCCGCC-GCGGGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCGGAGGAATGTAGCTC---------AT-TGAGTGTTATAGCC-TCCGGT-G--ATGCGGCGCGTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGG---------------------- Periconiella_velutina_CBS_101949 --------------------------------------------------------------CTAAGAAGAA-ACAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACCTGGCGC---------AAGCCCGGATTGTAATTTGCAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---CACGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAACCAGACTCCGCGGCGGT-GTTCCGCC-GGTCT----TTTGACCGGTCTACTC--GCCGCC-GCGGGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCGGAGGAATGTAGCTC---------AT-TGAGTGTTATAGCC-TCCGGT-G--ATGCGGCGCGTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTA-------------------------- Periconiella_velutina_CBS_101950 ---------------------------------------------------------------------------CACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACCTGGCGC---------AAGCCCGGATTGTAATTTGCAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---CACGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAACCAGACTCCGCGGCGGT-GTTCCGCC-GGTCT----TTTGACCGGTCTACTC--GCCGCC-GCGGGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCGGAGGAATGTAGCTC---------AT-TGAGTGTTATAGCC-TCCGGT-G--ATGCGGCGCGTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGG---------------------- Pleurothecium_obovoideum ------------------------------------------TTAAGCATATCAATAAGCGGAGCAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCCCAGATTTGAAATCTGGCCTT-------CGGGCCCGAGTTGTAATCTGCAGATGAGGCTTTAGGTAAC--GCGCCGTCTAAGTTCCCTGGAATGAGACGCCATAGAGGGTGAGAGCCCCGTACCGACGTGC----GCCGCGCCT-GTTTATAGCCCATTCGAAGAGTCGAGTAGTTTGGAAATGCTGCTCTAATTGTGGGGTAAATCTCCCATAAGGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGAGCCTTGGATAAGGGCGTCAAAAAGTATGTGAAATTGTTATGGGGGAAGCGCTTAGGGCCAGACGTGGCTTCGGC-TGGTTACCCGGCGTT---CTTCGCCGGCGCACTC-TGCCGTC-GCCAGGCCAGCATCGGTTCGGCTCGGGGCTTACTGCCGTCAGGAACGTGGCCCT----TCG-GG----GTGTTATAGCC-TTTCGG--TGA-CGTCCCGCGCCGGACCGAGGATCGC------------------------------GCATCT-GCT-CGGATGCTGGCGTAATGGCCCTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTTGACCTAACATGCGAGTGTTTGGGTGTCAAGCCC-TCACGCGTAGTGAAAGCGAATGCAGGTGGGAGCC-----TC-GGCGCACCATCGACCGATCCTGAAGTTTA--CGGATGG-ATTTGAGTAGGAGCATGTTGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGACTACT Pseudocercospora_epispermogonia_DQ204757 -----------------------------------------------------------------------------------------------------------------------AAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTCGCGGCGGT-GTTCCGCC-GGTCT----TTTGACCGGTCTACTC--GCCGCC-GCGAGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCATGGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-CACGGT-G--ATGCGGCGTGTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGCCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAG-----CTTC-GGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Pseudocercospora_epispermogonia_DQ204758 -----------------------------------------------------------------------------------------------------------------------AAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTCGCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GCGAGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCATGGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-CACGGT-G--ATGCGGCGTGTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGCCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAG-----CTTC-GGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Pseudovirgaria_hyperparasitica_CPC_10702 --------------------------------CCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCACCTCT---GGGTGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGTACCGG-TGCTGCTCCAGGTTCTTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTCTCTGGGCGG--TGCTAGGTACC-ATGTAAAGCGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCCAAAGCTAAATACAGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGA-AAGAGAGTCAAACAGCGCGTGAAATTGTTGAAAGGGAAGCGCTTGCAGTCAGACTTGGCTGCCCA-GTTCGGCAGTGCCT----CGTGTACTGTCTATGC-TGTGGTG-GTCAGGCCAGCATTGGTTTAGACGGCCGGATAAAGGCTGCGGGAATGTAGCTCCTC--TCG-GG--GAGTGTTATAGCC-CGCGGT-ATAATACGGCCTGTCTGGACCAAGGAACGC------------------------------GCTTCG-GCT-CGGATGCTGGCATAATGGCTGCAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTGTGCGAGTGTTTGGGTGTCAAGCCC-TTACGCGTAATGAAAGTGAACGGAGGTGGGAGCCC--TCGG--GCGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCACAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAACAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Pseudovirgaria_hyperparasitica_CPC_10704 -------------------------------------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCACCTCT---GGGTGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGTACCGG-TGCTGCTCCAGGTTCTTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTCTCTGGGCGG--TGCTAGGTACC-ATGTAAAGCGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCCAAAGCTAAATACAGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGA-AAGAGAGTCAAACAGCGCGTGAAATTGTTGAAAGGGAAGCGCTTGCAGTCAGACTTGGCTACCCA-GTTCGGCAGTGCCT----CGTGTACTGTCTATGC-TGTGGTG-GTCAGGCCAGCATTGGTTTAGACGGCCGGATAAAGGCTGCGGGAATGTAGCTCCTC--TCG-GG--GAGTGTTATAGCC-CGCGGT-ATAATACGGCCTGTCTAGACCAAGGAACGC------------------------------GCTTCG-GCT-CGGATGCTGGCATAATGGCTGCAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTGTGCGAGTGTTTGGGTGTCAAGCCC-TTACGCGTAATGAAAGTGAACGGAGGTGGGAGCCC--TCGG--GCGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCACAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAACAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Pseudovirgaria_hyperparasitica_CPC_10753 -------------------------------------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCACCTCT---GGGTGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGTACCGG-TGCTGCTCCAGGTTCTTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTCTCTGGGCGG--TGCTAGGTACC-ATGTAAAGCGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCCAAAGCTAAATACAGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGA-AAGAGAGTCAAACAGCGCGTGAAATTGTTGAAAGGGAAGCGCTTGCAGTCAGACTTGGCTGCCCA-GTTCGGCAGTGCCT----CGTGTACTGTCTATGC-TGTGGTG-GTCAGGCCAGCATTGGTTTAGACGGCCGGATAAAGGCTGCGGGAATGTAGCTCCTT--TCG-GG--GAGTGTTATAGCC-CGCGGT-ATAATACGGCCTGTCTGGACCAAGGAACGC------------------------------GCTTCG-GCT-CGGATGCTGGCATAATGGCTGCAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTGTGCGAGTGTTTGGGTGTCAAGCCC-TTACGCGTAATGAAAGTGAACGGAGGTGGGAGCCC--TCGG--GCGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCACAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAACAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Radulidium_epichloes_AF050287 --------TTGACCTCGGATCAGATAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCCTC----GACGTCCGAGTTGTAATTTGCAGAGGATACTTCGGCATCGG-TGCCGCTCCAGGTTCTTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTCTCTGGGCGG--TGCCAGATGCC-ATGTGAAGTGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCCAAAGCTAAATACAGGTTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGA-AAGAGAGTCAAACAGCGCGTGAAATTGTTAAAAGGGAAGCGCTTGCAGTCAGACTTGGCCGCCCG-GTTCGGCCGTCCCT----CGTGGACGGTCTCCGC-CGTGGCG-GGCAGGCCAGCATTACCTTGGGCGGGTGGATAAAGGCTGCGGGAATGTGGCACCTC--TCG-GG--GTGTGTTATAGCC-CGCGGC-ACAATACATCCTGCCCGGGGTAAGGAACGC------------------------------GCTTCG-GCT-CGGATGCTGGCGTAATGGCTGCAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTGTGCGAGTGTTTGGGTGTCAAGCCC-TTACGCGCAATGAAAGTGAACGGAGGTGGGAGCCC--TCGG--GCGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCACAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAGCAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC-- Radulidium_epichloes_CBS_361.63 --------------------CAGATAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCCTC----GACGTCCGAGTTGTAATTTGCAGAGGATACTTCGGCATCGG-TGCCGCTCCAGGTTCTTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTCTCTGGGCGG--TGCCAGATGCC-ATGTGAAGTGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCCAAAGCTAAATACAGGTTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGA-AAGAGAGTCAAACAGCGCGTGAAATTGTTAAAAGGGAAGCGCTTGCAGTCAGACTTGGCCGCCCG-GTTCGGCCGTCCCT----CGTGGACGGTCTCCGC-CGTGGCG-GGCAGGCCAGCATTACCTTGGGCGGGTGGATAAAGGCTGCGGGAATGTGGCACCTC--TCG-GG--GTGTGTTATAGCC-CGCGGC-ACAATACATCCTGCCCGGGGTAAGGAACGC------------------------------GCTTCG-GCT-CGGATGCTGGCGTAATGGCTGCAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTGTGCGAGTGTTTGGGTGTCAAGCCC-TTACGCGCAATGAAAGTGAACGGAGGTGGGAGCCC--TCGG--GCGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCACAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAGCAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC-- Radulidium_sp._CBS_115704 -CCTACGCTTGACCTCGAATTAGGTAAGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGCTT-------GCGTCCGAGTTGTAATTTGCAGAGGATACTTCGGTGTGGG-CGCTGCCCCGAGTTCTTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTATCTGGGCGG--CCGTCCACACC-ATGTGAAGTGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGA-AAGAGAGTCAAACAGCGCGTGAAATTGTTGAAAGGGAAGCGCTTGCAGTTAGACTTGACGGCCCG-GTTCGGCGACGCCT----CGCGTGTCGCCTACGC-CGTGGCC-GGCAGGCCAGCATTGGTTTGGGCGGTTGGATAAAGGCGGCAGGAATGTAGCACCTC--TCG-GG--GTGTGTTAGAGCC-TGCCGG-ACAATACAGCCTGCCCGGACCAAGGAACGC------------------------------GCTTCG-GCT-CGGATGCTGGCGTAATAGCTGCAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTGTGCGAGTGTTTGGGTGTCAAGCCC-TTGCGCGCAATGAAAGTGAACGGAGGTGGGAGC----TTCG--GCGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCACAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAGCAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC-- Radulidium_subulatum_CBS_101010 -----------------------------------------------------------------AAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCCTC----GACGTCCGAGTTGTAATTTGCAGAGGATACTTCGGCATCGG-TGCTGCTCCAGGTTCTTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTCTCTGGGCGG--TGCTAGATGCC-ATGTGAAGTGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCCAAAGCTAAATACAGGTTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGA-AAGAGAGTCAAACAGCGCGTGAAATTGTTAAAAGGGAAGCGCTTGCAGTCAGACTTGGCCGCCCG-GTTCGGCCGTCCCT----CGTGGACGGTCTCCGC-CGTGGCG-GGCAGGCCAGCATTACTTTGGGCGGGTGGATAAAGGCTGCGGGAATGTGGCACCCC--TCG-GG--GTGTGTTATAGCC-CGCGGC-ACAATACATCCTGTCCGGAGTAAGGAACGC------------------------------GCTTCG-GCT-CGGATGCTGGCGTAATGGCTGCAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTGTGCGAGTGTTTGGGTGTCAAGCCC-TTACGCGCAATGAAAGTGAACGGAGGTGGGAGCCC--TCGG--GCGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCACAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAGCAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTA---------- Radulidium_subulatum_CBS_287.84 ----------------GGATCAGATAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCCTC----GACGTCCGAGTTGTAATTTGCAGAGGATACTTCGGCATCGG-TGCTGCTCCAGGTTCTTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTCTCTGGGTGG--TGCTAGATGCC-ATGTGAAGTGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCCAAAGCTAAATACAGGTTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGA-AAGAGAGTCAAACAGCGCGTGAAATTGTTAAAAGGGAAGCGCTTGCAGTCAGACTTGGCCGCCCG-GTTCGGCCGTCCCT----CGTGGACGGTCTCCGC-CGTGGCG-GGCAGGCCAGCATTACTTTGGGCGGGCGGATAAAGGCCGCGGGAATGTGGCACCCC--TCG-GG--GTGTGTTATAGCC-CGTGGC-ACAATACGTCCTGCCTGGAGTAAGGAACGC------------------------------GCTTCG-GCT-CGGATGCTGGCGTAATGGCTGCAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTGTGCGAGTGTTTGGGTGTCAAGCCC-TTACGCGTAATGAAAGTGAACGGAGGTGGGAGCCC--TCGG--GCGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCACAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAGCAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC-- Radulidium_subulatum_CBS_405.76 -----------------------------------------------------------------AAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCCTC----GACGTCCGAGTTGTAATTTGCAGAGGATACTTCGGCATCGG-TGCTGCTCCAGGTTCTTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTCTCTGGGCGG--TGCTAGATGCC-ATGTGAAGTGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCCAAAGCTAAATACAGGTTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGA-AAGAGAGTCAAACAGCGCGTGAAATTGTTAAAAGGGAAGCGCTTGCAGTCAGACTTGGCCGCCCG-GTTCGGCCGTCCCT----CGTGGACGGTCTCCGC-CGTGGCG-GGCAGGCCAGCATTACTTTGGGCGGGTGGATAAAGGCTGCGGGAATGTGGCACCCC--TCG-GG--GTGTGTTATAGCC-CGCGGC-ACAATACATCCTGTCCGGAGTAAGGAACGC------------------------------GCTTCG-GCT-CGGATGCTGGCGTAATGGCTGCAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTGTGCGAGTGTTTGGGTGTCAAGCCC-TTACGCGCAATGAAAGTGAACGGAGGTGGGAGCCC--TCGG--GCGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCACAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAGCAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTA---------- Radulidium_subulatum_CBS_912.96 -----------------------------------------------------------------AAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCCTC----GACGTCCGAGTTGTAATTTGCAGAGGATACTTCGGCATCGG-TGCTGCTCCAGGTTCTTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTCTCTGGGTGG--TGCTAGATGCC-ATGTGAAGTGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCCAAAGCTAAATACAGGTTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGA-AAGAGAGTCAAACAGCGCGTGAAATTGTTAAAAGGGAAGCGCTTGCAGTCAGACTTGGCCGCCCG-GTTCGGCCGTCCCT----CGTGGACGGTCTCCGC-CGTGGCG-GGCAGGCCAGCATTACTTTGGGCGGGCGGATAAAGGCCGCGGGAATGTGGCACCCC--TCG-GG--GTGTGTTATAGCC-CGTGGC-ACAATACGTCCTGCCTGGAGTAAGGAACGC------------------------------GCTTCG-GCT-CGGATGCTGGCGTAATGGCTGCAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTGTGCGAGTGTTTGGGTGTCAAGCCC-TTACGCGTAATGAAAGTGAACGGAGGTGGGAGCCC--TCGG--GCGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCACAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAAGCAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC-- Ramichloridium_apiculatum_CBS_156.59 ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAATTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGG---CCCGCGCCCT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCG-GGCAGGCCATCATCGTCTGGGGCCGCCGGAGAA-ACCGTCAGGAATGTAGCTCCC---TCG-GG---AGTGTTATAGCC-TGGCGA-C--ATGCGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCA-CT-GCA-AGGATGATGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGA------GCTTCGGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Ramichloridium_apiculatum_CBS_390.67 ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAATTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGG---CCCGCGCCCT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCG-GGCAGGCCATCATCGTCTGGGGCCGCCGGAGAA-ACCGTCAGGAATGTAGCTCCC---TCG-GG---AGTGTTATAGCC-TGGCGA-C--ATGCGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCA-CT-GCA-AGGATGATGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGA------GCTTCGGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Ramichloridium_apiculatum_CBS_391.67 ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAATTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGG---CCCGCGCCCT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCG-GGCAGGCCATCATCGTCTGGGGCCGCCGGAGAA-ACCGTCAGGAATGTAGCTCCC---TCG-GG---AGTGTTATAGCC-TGGCGA-C--ATGCGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCA-CT-GCA-AGGATGATGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGA------GCTTCGGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Ramichloridium_apiculatum_CBS_400.76 ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAATTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGG---CCCGCGCCCT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCG-GGCAGGCCATCATCGTCTGGGGCCGCCGGAGAA-ACCGTCAGGAATGTAGCTCCC---TCG-GG---AGTGTTATAGCC-TGGCGA-C--ATGCGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCA-CT-GCA-AGGATGATGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGA------GCTTCGGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Ramichloridium_australiense --------------------------------------------------------------AGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACCTGGCGC---------AAGCCCGGATTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTCCCACCAGACTCCGCGGCGGT-GTTCCGCC-GGCCT----TCTGGCCGGTCCACTC--GCCGCC-GTGGGGCCAACATCGTCTGGTGCCGCCGGATAA-GACCGGAGGAATGTAGCTC---------AT-TGAGTGTTATAGCC-TCCGGG-G--ATGCGGCGCGCGCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTGGGCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGGAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG------ Ramichloridium_biverticillatum ---------------------------------------------------------------CGGAGAAGAAACAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACCTGGCGC---------AAGCCCGGATTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGTTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCCGCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCCACTC--GCCGCC-GTGGGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCCGAGGAATGTAGCTC---------AT-TGAGTGTTATAGCC-TCGGGG-G--ATGCGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCCTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Ramichloridium_brasilianum -------------------------------------------------------------------------------------------------------------------------------------------------------------GTAATTTGTAGAGGATGCTTCTAGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGACCGG---TTAGCACCTT-ACACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTTGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-CGCAGGCCAGCGTCGTCTGGGACCGCCGGATAAAGGTGGTGGGAATGTAGCTCC----TC---G--GAGTGTTATAGCC-CATCGC-ACAATACGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGACGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCGATCAATTGTGCGAGTGTTCGGGTGGAAAACCC-TTGCGCGTAATGAAAGTGAACGGAGGCGAGAACC---CTCG-GGTGCATCGTCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGATCGGACCCGAAAGATGGTGAACTATGCCTAAATAGAATGAAGCCAGAGGAAACTCTGGTGGAAGTTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAA---------------- Ramichloridium_cerophilum_AF050286 ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACCTGGCGCTT-------GCGTCCGGATTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCCGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTCCCACCAGACTCCGCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GTGGGGCCAGCATCGTCTGGGGCCGCCGGATAA-GACCGCAGGAATGTAGCTC---------AT-TGAGTGTTATAGCC-TGCGGG-G--ATGCGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTGGGCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAG-----CTTC-GGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCAT Ramichloridium_cerophilum_CBS_103.59 -----------------------------------------------------------------------------CAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACGTGGCGCTT-------GCGTCGGGATTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCCGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTCCCACCAGACTCCGCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GTGGGGCCAGCATCGTCTGGGGCCGCCGGATAA-GACCGCAGGAATGTAGCTC---------AT-TGAGTGTTATAGCC-TGCGGG-G--ATGCGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTGGGCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAG-----CTTC-GGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCAT Ramichloridium_indicum -------------------------------------------------------------------AAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGATCGG---CGCGCGCCCT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCGGCGGT-GTTCCCCC-GGTCT----TCTGACCGGGCTACTC--ACCGCC-AGCAGGCCATCATCGTCTGGGGCCGCCGGAGAA-ATCGTCAGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-TGGCGC-C--ATGCGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCA-CT-GCA-AGGATGATGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGA------GCTTCGGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Ramichloridium_musae_CBS_190.63 ---------------------------------------------------------------------AAGAGCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACCTGGCGC---------AAGCCCGGATTGTAATTTGCAGAGGATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTCCCACCAGACTCCGTGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GCGGGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCGGAGGAATGTAGCTC---------AT-TGAGTATTATAGCC-TCCGGG-G--ATGCGGCGCGCGCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTGGGCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGA----- Ramichloridium_musae_CBS_365.36 --------------------------------------------------------------------------------------------------------------------------------------CGC---------AAGCCCGGATTGTAATTTGCAGAGGATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTCCCACCAGACTCCGTGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GCGGGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCGGAGGAATGTAGCTC---------AT-TGAGTATTATAGCC-TCCGGG-G--ATGCGGCGCGCGCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTGGGCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAAC--- Ramichloridium_pini ---------------------------------------------------------------CGAGAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGGTAGC-GACCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CCCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAACCAGACTTCGCGGCGGT-GTTCAACC-GGTCT----TCTGACCGGTCTACTC--TCCGCC-GCGAGGCCAACATCGTCTGGGCCCGCCGGATAA-GACGGGGGGAATGTAGCTTGCCT-TCG-GG-GAAGTGTTATAGCC-CTCTTT-G--ATGCGGCGCGGCTCGGGCGAGGTCCGC------------------------------ACTTCG-GTA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGAGAACT---TTAC-AGTGCATCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Ramichloridium_strelitziae ----------------------------------------------------------------------------------ATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACCTGGCGC---------AAGCCCGGATTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTCCCACCAGACTCCGCGGCGGT-GTTCCGCC-GGCCT----TCTGGCCGGTCCACTC--GCCGCC-GTGGGGCCAACATCGTCTGGGGCCGTCGGATAA-GACCGGAGGAATGTAGCTC---------AT-TGAGTGTTATAGCC-TCCGGG-G--ATGCGACGCGCGCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTGGGCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAG-----CTTC-GGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Ramularia_miae -------GTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTAGGTAGC-GACCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CCCGCACCTT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAACCAGACTTCTGGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--ACCGTC-CCGAGGCCAACATCATCTGGGACCGCCGGATAA-GACCTCAGGAATGTAGCTCCCC--TCG-GG--GAGTGTTATAGCC-TGTGGT-G--ATGCGGCGCGTCTCGGGTGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAGG---GCAA-CCTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Ramularia_pratensis_var._pratensis ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTAGGTAGC-GACCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACCGG---CCCGCACCTT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTCTGGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--ACCGTC-CCGAGGCCAACATCATCTGGGACCGCCGGATAA-GACCTCAGGAATGTAGCTCCCC--TCG-GG--GAGTGTTATAGCC-TGTGGT-G--ATGCGGCGCGTCTCGGGTGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAGG---GTAA-CCTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Ramularia_sp. ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTAGGTAGC-GACCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGG---CCCGCACCTT-CTACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAACCAGACTTCTAGGCAGT-GTTCCGCC-GGTCT----TTTGACCGGTCTACTC--TCTGTC-TCGAGGCCAACATCATCTGGGACCGCTGGATAA-GACCTTAGGAATGTAGCTCCCC--TCG-GG--GAGTGTTATAGCC-TCTGGT-G--ATGCAGCGAGTCTCGGGTGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAGC---GTAA-GCTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rasutoria_pseudotsugae --------------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACCTGGCGC---------AAGCCCGGATTGTAATTTGCAGAGGATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGCGACCGG---CACGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAACCAGACTCCGCGGTGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GTGGGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCGGAGGAATGTGGCTC---------AT-TGAGTGTTATAGCC-TCCGGT-G--ATGCGGCGCGTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGCGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rasutoria_tsugae --------------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACCTGGCGC---------AAGCCCGGATTGTAATTTGCAGAGGATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGCGACCGG---CACGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACAACCAGACTCCGCGGTGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GTGGGGCCAACATCGTCTGGGGCCGCCGGATAA-GACCGGAGGAATGTGGCTC---------AT-TGAGTGTTATAGCC-TCCGGT-G--ATGCGGCGCGTCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGCGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Readeriella_considenianae ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCAGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---TTGGCACCCG-TCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GGCAGGCCAGCATCATCTGGGCGCGCCGGACAAAGGCGTGGGGAATGTGGCTCC----TC--GG---AGTGTTATAGCC-CCGCGC-ACAATACGGCGCCGCTCGGGTGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTTGTATGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAGC---GCAA-GCTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG------ Repetophragma_goidanichii ---------------------------------------------------------------GGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTTC---GGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTCGGTGGAAG-CCCCGGCCCAAGTCCCTTGGAACAGGACGTCAGAGAGGGTGAGAACCCCGTGTCCGGCCGGTGGC-GCTCCCCG-C-GTGAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTCAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCCCGCGGA-TGTTCAGCCCGTCT----TCTGGCGGGTGCACTC-TTCCGCG-GTCAGGCCAGCATCGGTTTGGGCGGCCGGACAAAGGCTCGGGGAACGTGGCCCCCT--TCG-GG--GGGTGTTATAGCC-CCGGGT-GCAATGCGGCCAGCCTGGACCGAGGACCGC------------------------------GCTCTG--CT-AGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCC-GTGCGCGTAATGAAAGTGAACGGAGGTGGGAACC---TTAG-GGTGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTAGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGGGTATAGGGGCGAAAG-------------- Rhinocladiella_anceps_AF050284 -----------------------GTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGG--TGGTAGGGCCC-GTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGCGCGGTGGTTCCCCT-ATCCT----TTTGGATGGGTTACTC-CGCCGCG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTCAAAGGCCTTGGGAATGTATCTACCCT-CCG-GGCGTAGACTTATAGCC-CTTGGT-GTCATGCGACCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGC---TTCG-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rhinocladiella_anceps_AF050285 ----------GACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAGAGAGGGTGAGAATCCCGTCTTGGACCGG--TGGTAGGGCCC-GTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGCGCGGTGGTTCCCCT-ATCCT----TTTGGATGGGTTACTC-CGCCGCG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTCAAAGGCCTTGGGAATGTATCTACCCT-TCG-GGCGTAGACTTATAGCC-CTTGGT-GTCATGCGACCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGC---TTCG-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCA- Rhinocladiella_anceps_CBS_157.54 -------------CTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAGAGAGGGTGAGAATCCCGTCTTGGACCGG--TGGTAGGGCCC-GTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGCGCGGTGGTTCCCCT-ATCCT----TTTGGATGGGTTACTC-CGCCGCG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTCAAAGGCCTTGGGAATGTATCTACCCT-TCG-GGCGTAGACTTATAGCC-CTTGGT-GTCATGCGACCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGC---TTCG-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rhinocladiella_anceps_CBS_181.65 -------------CTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGG--TGGTAGGGCCC-GTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGCGCGGTGGTTCCCCT-ATCCT----TTTGGATGGGTTACTC-CGCCGCG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTCAAAGGCCTTGGGAATGTATCTACCCT-CCG-GGCGTAGACTTATAGCC-CTTGGT-GTCATGCGACCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGC---TTCG-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rhinocladiella_atrovirens ------GGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTCTC---GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAGAGAGGGTGAGAATCCCGTCTTGGACCGG--CGGTAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGAGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGTTACTC-CGCCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCTGGGGAATGTATCTACTCCTTCG-GGGGTAGACTTATAGCC-CCGGGT-GTCATGCGACCACCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGAAATGAAAGTGAACGGAGGTAGGAAGCC--TTTAGGCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rhinocladiella_basitona --ACAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGCCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCATAGAGGGTGAGAATCCCGTCTTGGACCGG--TGGTAGGGCCT-ATGTGAAACTCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGAGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGTTACTC-CGTCGTG-TCCAGGCCAACATCGGTTCTAGGGGTCGGTTAAAGGCCTAGGGAATGTATCTACCCCTTCG-GGGGTAGACTTATAGCC-CTGGGT-GTCATGCGGCCACCTGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGCC--TTTAGGCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rhinocladiella_fasciculata -------------CTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGGAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAGAGAGGGTGAGAATCCCGTCTTGGACCGG--TGGTAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGCTATTC-TGCCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCTTGGGAATGTATCTACCCT-TCG-GGCGTAGACTTATAGCC-CTTGGT-GTCATGCGGCCTCCCGGGATCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGAAATGAAAGTGAACGGACGTAGGAAGC---TTCG--CTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rhinocladiella_mackenziei_AF050288 --TAATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGACTCCTTG----AGAGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTTCCCCTCCGGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACTGG-CGGTCGGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTCAAAAAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGCGCGCGATGGTTCCCCC-TTCCT----TCTGGTTGGGTTACTC-CGTCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCGTGGGAATGTATTTACCCTTTCGAGGCGTAGACTTATAGCC-CACGGT-GTCATGCGGCCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGAAATGAAAGTGAACGGAGGTAGGACGC---TTCG-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rhinocladiella_mackenziei_CBS_367.92 -----TGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGACTCCTTG----AGAGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTTCCCCTCCGGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACTGG-CGGTCGGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTCAAAAAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGCGCGCGATGGTTCCCCC-TTCCT----TCTGGTTGGGTTACTC-CGTCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCGTGGGAATGTATTTACCCTTTCGAGGCGTAGACTTATAGCC-CACGGT-GTCATGCGGCCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGAAATGAAAGTGAACGGAGGTAGGACGC---TTCG-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rhinocladiella_mackenziei_CBS_368.92 -----TGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGACTCCTTG----AGAGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTTCCCCTCCGGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACTGG-CGGTCGGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTCAAAAAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGCGCGCGATGGTTCCCCC-TTCCT----TCTGGTTGGGTTACTC-CGTCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCGTGGGAATGTATTTACCCTTTCGAGGCGTAGACTTATAGCC-CACGGT-GTCATGCGGCCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGAAATGAAAGTGAACGGAGGTAGGACGC---TTCG-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rhinocladiella_mackenziei_CBS102590 -----TGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGACTCCTTG----AGAGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTTCCCCTCCGGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACTGG-CGGTCGGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTCAAAAAGTATGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGCGCGCGATGGTTCCCCC-TTCCT----TCTGGTTGGGTTACTC-CGTCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCGTGGGAATGTATTTACCCTTTCGAGGCGTAGACTTATAGCC-CACGGT-GTCATGCGGCCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGAAATGAAAGTGAACGGAGGTAGGACGC---TTCG-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rhinocladiella_phaeophora -------------CTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGCCTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGG--CGGTAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTGCTCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGTTATTC-CGTCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCTTGGGAATGTACCTACCCT-TCG-GGCGTAGACTTATAGCC-CTTGGT-GTCATGCGGCCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGAAATGAAAGTGAACGGAGGTAGGAAGC---TTCG-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGATGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rhinocladiella_sp. -------GTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTTA---GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACC-CTCCGGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGG--CGGTAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGAGCGCGGCGGTTCCCCC-TTCCT----TCTGGTTGGGCTACTC-CGTCGCG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTCAAAGGCTCGGGGAATGTATCTACCCT-TCG-GGCGTAGACTTATAGCC-CCGAGT-GTCATGCGACCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGGAATGAAAGTGAACGGAGGTAGGAAGC---TTCT-GCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Rhodoveronaea_varioseptata --------------------------------------------------------------------------CAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT---------CGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGATGCG--GCGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTAGAGTCGGAC----GCCAAGTCT-CTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAAAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGCGCCTTGT-GGATAAGCCAGCGT----TCTCGCTGGTG-TTTC-TGCTCGG-TTCAGGCCAGCATCGGTTTTCTTAGGGGGATAAAAGCTTCGGGAACGTGGCTCCT---CCG-GG---AGTGTTATAGCC-CGCTGC-ACAATATCCCTAGGGGG-ACCGAGGCCCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTAAAACCC-GCACGCGAAATGAAAGTGAACGCTGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTACT--CGGATGG-ATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGTTGATGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAAT--- Septoria_tritici ------GGTTGACCTCGGATCGGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC-------CGGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTAGC-GACCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---CCCGCGCCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTTGGGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--TCCGTC-CCGAGGCCAACATCATCTGGGACCGCCGGACAA-GACCTCAGGAATGTAGCTCCCCC-TCG-GG-GGAGTGTTATAGCC-TGTGGT-G--ATGCGGCGCGTCCCGGGTGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGTTGGCGTAATGGTTGTCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGGAATGAAAGTGAACGGAGGTGGGAAGG--GGCAACCCTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Sporidesmium_pachyanthicola ------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTAGAGGATGCTTCGGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGCGACCGG---CTGGCACCCC-ACATGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGACGGCGGC-GTTCCTCC-GGTCT----TCTGACCGGTCCACTC--GTCGCC-GGCAGGCCAGCATCGTCTGGGGCCGCCGGAGAAAGGCGCGGGGAATGTGGCTCC----TCC-GG--GAGTGTTATAGCC-CCACGT-ACAATACGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTCGTAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTGGACCATCTGTGCGAGTGTTCGGGCGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGCGGGAACC----TAG-GGTGCACCGTCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATGGCTGGTCCGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAG-------------- Staninwardia_suttonii ------GGTTGACCTCGGATCGGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGTTGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---CCAGCGCCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCTACCAGACTTGTCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCCACTC--GCCGCC-GGCAGGCCAGCGTCGTCTGGGGCCGCCGGAGAAAGGCGGTGGGAATGTGGCTCC----TCC-GG--GAGTGTTATAGCC-CACCGC-ACAATACGACGCGCCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGACGCTGGCGTAATGGGCGCAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCGATCAATTATGCGAGTGTTCGGGTGGAAAACCC-CTACGCGCAATGAAAGTGAACGGAGGCGAGAACC---GC---GGTGCATCGTCGACCGATCCTGATGTTTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGATCGGACCCGAAAGTTGGTGAACTATGCCTAAATAGAATGAAACCAGGGGAAACCCTGGCGGAAGTTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAA Teratosphaeria_alistairii ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCAGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---TTGGCACCCG-TCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCCACCAGACTTGTCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GACAGGCCAGCATCATCTGGGGGCGCCGGATAAAGGCGCGGGGAATGTGGCTCCC---TCG-GG---AGTGTTATAGCC-CCGCGC-ACAATACGGTGACCCTCGGGTGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTTGTTTGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGGAATGAAAGTGAACGGAGGTGGGAACC--TTAACCGGTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Teratosphaeria_fibrillosa ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCAGGGCAGC-GGCCGGTCTAGGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGACCGG---TGGGCACCCG-TCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTCGTCGGCGGC-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GGCGGGCCAGCATCATCTGGGCGCGCCGGACAAAGGCGCGGGGAATGTAGCTCC----TC--GG---AGTGTTATAGGC-CCGCGC-ACAATACGGCGCCGCCCGGGTGAGGTCCGC------------------------------GCTCCG-GCT-AGGATGCTGGCGTAATGGTTGTACGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTGCGCGGAATGAAAGTGAACGGAGGTGGGAAGC---GCGA-GCTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTCGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTAAACTTGGCCAGAGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAGCTGGGTTTAGGGGCGAAAGACTAATCGAA---- Teratosphaeria_molleriana ------GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGGAGAGGATGCTTCAGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---TTGGCACCCG-TCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAATCAGACTTGTCGGCGGT-GTTCCGCC-GGTCT----TTTGACCGGTCTACTC--GCCGCC-GGCAGGCCAGCATCATCTGGGTGCGCCGGACAAAGGCGCGGGGAATGTAGCTCC----TC--GG---AGTGTTATAGCC-CCGCGC-ACAATACGGCGCCGCCCGGGTGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTTGTATGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGGAATGAAAGTGAACGGAGGTGGGAAGC---GCAA-GCTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Teratosphaeria_parva_DQ246240 -------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTCGAGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGATTGG---CTCGCACCTC-ACACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGCATGCAACCAGACTTGCCGGTGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCT-GGCAGGCCAACATCGTCTGGGTGCGCCGGATAAAGGTGTCGGGAATGTGGCCCC----TCG-GG----GTGTTATAGCT-CGACAC-ACAATACGGCGCCGCTCGGGCGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGTTGGCGTAATGGTTGTATGCCGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGGAATGAAAGTGAACGGAGGTGGGGAACC--GCAA-GGTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Teratosphaeria_parva_DQ246243 -------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGCTTCGAGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGATTGG---CTCGCACCTC-ACACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGCATGCAACCAGACTTGTCGGTGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCT-GGCAGGCCAACATCGTCTGGGTGCGCCGGATAAAGGTGTCGGGAATGTGGCCCC----TCG-GG----GTGTTATAGCT-CGACAC-ACAATACGGCGCCGCTCGGGCGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGTTGGCGTAATGGTTGTATGCCGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGGAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Teratosphaeria_readeriellophora -------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---TTGGCACCCG-TCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCAAGCAATCAGACTTGTCGGCGGT-GTTCCCCC-GGTCT----TCTGACCGGGCTACTC--GCCGCC-GGCAGGCCAACATCATTTGGGTGCGCCGGATAAAGACGTAAGGAATGTGGCCCCC---TCG-GG---GGTGTTATAGCC-TTACGT-GCAATACGGTGTCGCCCGAGTGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGTTGGCGTAATGGTTGTTTGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAAC----GAAA--GTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Teratosphaeria_suberosa -------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGCTTCAGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---TTGGCACCCG-TCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGCCGGCGGT-GTTCAACC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GGCAGGCCAACATCATTTGGGAGCGCCGGATAAAGGTGGGAGGAATGTGGCCCC----TCG-GG----GTGTTATAGCC-TCCTAC-GCAATACGGCGCCTCCCGAGTGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGTTGGCGTAATGGTTGTCTGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTTGGGAAC---TTTT-TGTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Teratosphaeria_toledana -------------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------ACGCCCGAGTTGTAATTTGGAGAGGATGCTTCAGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---TTGGCACCCG-TCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCCACCAGACTTGTCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GGCAGGCCAGCATCATCTGGGCGCGCCGGACAAAGGCACGGGGAATGTGGCTCC----TC--GG---AGTGTTATAGCC-CCGCGC-ACAATACGGCGCCGCCCGGGTGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTGGTCTGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGGAATGAAAGTGAACGGAGGTGGGAAGC---GTAA-GCTGCACCATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT Thyridium_vestitum -------------------------------------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTC-------GGGCCCGAGTTGAAATTTGTAGAGGATGCTTTTGGTGCG--GTGCCTTCTGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATAGTTGGAC----ACCAAGCCT-GTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGCGCCCGGC-GGATCATCCAGCCT----TCTGGCTGGTGCACTC-CGCCGGG-CTCAGGCCAGCATCGGTTTTCCGAGGGGGATAAAAGCCCCAGGAACGTAGCTCCC---TCG-GG---AGTGTTATAGCC-TGGAGC-AGAATA-CCCTTCGGGGGACCGAGGACCGC------------------------------GCGTAA-GCA-AGGATGCTGGCGTAATGGTCATCGGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCAAGCATTAGGGCGAGTGTTTGGGTGTTAAACCC-GCACGCGAAATGAAAGTGAACGCAGGTGAGAGC-----TTC-GGCGCATCATCGACCGATCCTGATGTATT--CGGATGGGATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGACTAATCGAACCAT Thysanorea_papuana --------TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTCGAAATCTGAGCCTCT--TTGGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAGAGAGGGTGAGAATCCCGTCTTGGACCGG--CGGGAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGAGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGTTACTC-CGTCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCTTTGGGAATGTATCTACCCT-TCG-GGCGTAGACTTATAGCC-CAGAGT-GTCATGCGGCCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGTAACGCGAAATGAAAGTGAACGGAGGTAGGAAGCC--GCAAGGCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTAGGTATAGGGGCGAAAGACTAATCG------ Venturia_asperata --------------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGTTTCGGGTGAGG-CCGCGGTCCAAGTCCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACCTGGCCGCCGGC-TCCCCCCG-CTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCCCGCGGT-TGCTCAGCCCGCCT----TTTGGCGGGTGCACTC-TTCCGCG-GTCAGGCCAGCATCGGTTTGGGCGGTCGGATAAAGGCGCCGGGAACGTGGCCCCCCC-TCG-GG-GGGGTGTTATAGCC-CGGCGC-GCAATGCGGCCAGCCCGGACCGAGGTTCGC------------------------------GCTCTG--CT-AGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCC-GTGCGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAAGACTAATCGAACCAT Venturia_carpophila --------------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGTGAT-------GAAAGCCCGAGTTGTAATTTGCAGAGGATGTTTCGGGCGAGG-CCGCGGTCCAAGTCCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACCTGGCCGCCGGC-TCCCCCCG-CTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCCCGCGGT-TGCTCAGCCCGCCT----TTTGGCGGGTGCACTC-TTCCGCG-GTCAGGCCAGCATCGGTTCGGGCGGTCGGATAAAGGCGACGGGAACGTGGCCTCCCC-TCG-GG-GAGGTGTTATAGCC-CGGCGC-GCAATGCGGCCAGCCCGGACCGAGGTTCGC------------------------------GCTCTG--CT-AGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCC-GTGCGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA---------------------------------- Venturia_chlorospora --------TTGGCCTCGGATCAGGTGGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGAAG-CCACGGTCCAAGTCCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACCTGGCCGTCGGC-TCCCCCCG-CTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCCCGCGGT-TGCTCAGCCCGCCT----TTTGGCGGGTGCACTC-TTCCGCG-GTCAGGCCAGCATCGGTTTGGGCGGTCGGATAAAGGCGTTGGGAACGTGGCCTCCCC-TCG-GG-GAGGTGTTATAGCC-CGGCGC-GCAATGCGACCAGCCCGGACCGAGGTTCGC------------------------------GCTTTG--CT-AGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCC-GTGCGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAAGACTAATCGAACCAT Venturia_hanliniana --------TTGGCCTCGGATCAGGTGGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC---------ACGCCCGAGTTGTAATTTGTAGAGGATGTTTCGGGTGAAG-CCGCGGTCCAAGTCCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACCTGGCCGCCGGT-GCCCCC-G-CTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAA-GTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCCTGCGGT-TGCTCATCCCGCCT----TTTGGCGGGTGCACTC-TTCCGCA-GTCAGGCCAGCATCGGTTTGGGCGGTCGGATAAAGGCGCTGGGAACGTGGCCTCCCC-TCG-GG-GAGGTGTTATAGCC-CGGCGC-GCAATGCGACCAGCCCGGACCGAGGTTCGC------------------------------GCTTTG--CT-AGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCC-GTGCGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAAGACTAATCGAACCAT Venturia_inaequalis --------------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGTTTCGGGTGAAG-CCACGGTCCAAGTCCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACCTGGCCGTCGGT-GCCCCCCG-CTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCCCGCGGT-TGCTCAGCCCGCCT----TTTGGCGGGTGCACTC-TTCCGCG-GTCAGGCCAGCATCGGTTTGGGCGGTCGGATAAAGGCGTCGGGAACGTGGCCTCCCC-TCG-GG-GAGGTGTTATAGCC-CGGCGC-GCAATGCGGCCAGCCCGGACCGAGGTTCGC------------------------------GCTTTG--CT-AGGATGCTGGCGTAATGGCCGTAAGCGGCC-GTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCC-GTGCGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-AT?TGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCA?ATTTGCGTATAGGGGCGAAAGACTAATCGAACC-- Venturia_pyrina --------------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGC---------AAGCCCGAGTTGTAATTTGCAGAGGATGTTTCGGGTGAAG-CCACGGTCCAAGTCCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACCTGGCCGTCGGT-GCCCCCCG-CTGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTTGCCCGCGGT-TGCTCAGCCCGCCT----TTTGGCGGGTGCACTC-TTCCGCG-GTCAGGCCAGCATCGGTTTGGGCGGCCGGATAAAGGCGCCGGGAACGTGGCCTCCCC-TCG-GG-GAGGTGTTATAGCC-CGGCGT-GCAATGCGGCCAGCCCGGACCGAGGTTCGC------------------------------GCTCTG--CT-AGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCC-GTGCGCGTAATGAAAGTGAACGGAGGTGGGAACC---GCAA-GGTGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGCGTATAGGGGCGAAAGACTAATCGAACC-- Veronaea_botryosa_CBS_121.92 --------TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGG--CGGTAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGAGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGTTACTC-CGTCGTG-TCCAGGCCAACATCGGTTTCGGGGGTCGGTTAAAGACCTTGGGAATGTATCTACCCT-TCG-GGCGTAGACTTATAGCC-CAGGGT-GTCATGCGGCCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGAAATGAAAGTGAACGGAGGTAGGAAGCC--TTGAGGCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGG-CGAAAGACTAATCGAACC-- Veronaea_botryosa_CBS_254.57 --------TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGG--CGGTAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGAGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGTTACTC-CGTCGTG-TCCAGGCCAACATCGGTTTCGGGGGTCGGTTAAAGACCTTGGGAATGTATCTACCCT-TCG-GGCGTAGACTTATAGCC-CAGGGT-GTCATGCGGCCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGAAATGAAAGTGAACGGAGGTAGGAAGCC--TTGAGGCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGA----- Veronaea_botryosa_CBS_350.65 --------TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCGGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGG--CGGTAGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGAGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGTTACTC-CGTCGTG-TCCAGGCCAACATCGGTTTCGGGGGTCGGTTAAAGACCTTGGGAATGTATCTACCCT-TCG-GGCGTAGACTTATAGCC-CAGGGT-GTCATGCGGCCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGGAACGCGAAATGAAAGTGAACGGAGGTAGGAAGCC--TTGAGGCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGG-CGAAAGACTAATCGAACCAC Veronaea_compacta --------TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTTGGGTACCCCCC-GGTCTAAATTTCTTGGAACAGAATGTCAAAGAGGGTGAGAATCCCGTCTTGGACCGG--CGGTAGGGCCC-GTGTAAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGAGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGTTACTC-CGTCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGGCCCGGGGAATGTATCTACCCT-TTT-GGCGTAGACTTATAGCC-CCGGGT-GTCATGCGACCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGTAACGCGGAATGAAAGTGAACGGAGGTAGGAAGCC--TTGAGGCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCG--------------------------------------- Veronaea_japonica --------TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCTTT----GGGGTCCGAGTTGTAATTTGTAGAGGATG-TTTCAGGTACCCCTC-GGTTTAAATTTCTTGGAACAGAATGTCAGAGAGGGTGAGAATCCCGTCTTGGACCGG--CAGTGGGGCCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAGCGCTTACAACCAGACTTGAGCGCGGCGGTTCCCCC-TTCCT----TTTGGTTGGGTTACTC-CGTCGTG-TCCAGGCCAACATCGGTTCTGGGGGTCGGTTAAAGACCTCGGGAATGTATCTACCCT-TTT-GGCGTAGACTTATAGCC-CGAGAT-GTCATGCGGCCTCCCGGGACCGAGGAACGC------------------------------GCTTCG-GCT-CGGATGTTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCGTAACGCGGAATGAAAGTGAACGGAGGTAGGAAGCC--TTGCGGCTGCACTATCGACCGATCCTGATGTCTT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAATTTGGGTGATAGGGG-------------------- Veronaeopsis_simplex_CBS_588.66 ------------------------------------------------------------------------ACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGTACCTTC----GGTGCCCGAGTTGTAATTTGTAGAGGGTGTCTCGGGGGGAG-TGCCGGTCCAAGTCCCTTGGAACAGGATGTCATAGAGGGTGAGAACCCCGTATCCGGCTGGTCAC-GGGGGTCC-ATGTGAGACCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTATGCGGCCAGACTTGCCCGCGGT-TGCTCAGCCTGTCT----TCTGGCAGGTGTACTC-TTCCGCG-GTCAGGCCAGCATCGGTTTGGGCGGTCGGACAAAGGCGCTGGGAATGTGGCCCC----TCG-GG----GTGTTATAGCC-CAGCGT-GCAATGCGACCCGCCCGGACCGAGGCCCGC------------------------------GTTCTG--CT-AGGATGCTGGCGTAATGGCCGTATACGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCC-GGGCGCGCAATGAAAGTGAACGGAGGTGGGA-GC----TTC-GGCGCACCATCGACCGATCCTGATGTCTT--CGGAAGG-ATTTGAGTAAGAGCATAGCTGATAGGACCCGAAAGATGGTGAACTATGCGTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATT-------------------------------- Xenomeris_juniperi ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---TTGGCACCCG-TCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAACCAGACTTGTCGGCGGT-GTTCCGCC-GGTCT----TCTGACCGGTCTACTC--GCCGCC-GGCAGGCCAGCATCGCCTGGGAGCGCCGGATAAAGGTGTCGGGAATGTGGCCCC----TCG-GG----GTGTTATAGCT-CGGCAC-ACAATACGGCGCCCCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCT-AGGATGCTGGCGTAATGGTTGTATGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTACCATCTGTGCGAGTGTTCGGGTGTCAAACCC-CTACGCGGAATGAAAGTGAACGGAGGTGGGAACC---TTAC-GGTGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACC-- Zasmidium_cellare ---------------------------------------------------------------------AGGACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAACCTGGCGCTC-------GCGTCCGGATTGTAATTTGCAGAGGATGCTTCTGGGCAGC-GGCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCGG---CGCGCACCCT-CCACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCCGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTCCCACCAGACTCCGCGGCGGT-GTTCCGCC-GGCCT----TTTGGCCGGTCCACTC--GCCGCC-GCGGGGCCAGCATCGTCTGGGGCCGCCGGATAA-GACCGTCAGAATGTAGCTC---------AT-TGAGTGTTATAGCT-GGCGGT-G--ATGCGGCGCGCCCCGGGCGAGGTCCGC------------------------------GCTTCG-GCA-AGGATGCTGGCGTAATGGTGGGCAGCGGCCCGTCTTGAAACACGGAC-CAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCC-CTACGCGTAATGAAAGTGAACGGAGGTGGGAG-----CTTC-GGCGCACCATCGACCGATCCTGATGTCCT--CGGATGG-ATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTT{CG}TGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCAT ; END; BEGIN SETS; CHARSET LSU (CHARACTERS = 28S_rDNA) = 175-627 656-950; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 28S_rDNA) = N: 1-995; CODONPOSSET CodonPositions (CHARACTERS = 28S_rDNA) = N: 1-995; END; BEGIN TREES; TITLE Tb8657; LINK TAXA = Taxa1; TRANSLATE 1 Zasmidium_cellare, 2 Xenomeris_juniperi, 3 Veronaeopsis_simplex_CBS_588.66, 4 Veronaea_japonica, 5 Veronaea_compacta, 6 Veronaea_botryosa_CBS_350.65, 7 Veronaea_botryosa_CBS_254.57, 8 Veronaea_botryosa_CBS_121.92, 9 Venturia_pyrina, 10 Venturia_inaequalis, 11 Venturia_hanliniana, 12 Venturia_chlorospora, 13 Venturia_carpophila, 14 Venturia_asperata, 15 Thysanorea_papuana, 16 Thyridium_vestitum, 17 Teratosphaeria_toledana, 18 Teratosphaeria_suberosa, 19 Teratosphaeria_readeriellophora, 20 Teratosphaeria_parva_DQ246243, 21 Teratosphaeria_parva_DQ246240, 22 Teratosphaeria_molleriana, 23 Teratosphaeria_fibrillosa, 24 Teratosphaeria_alistairii, 25 Staninwardia_suttonii, 26 Sporidesmium_pachyanthicola, 27 Septoria_tritici, 28 Rhodoveronaea_varioseptata, 29 Rhinocladiella_sp., 30 Rhinocladiella_phaeophora, 31 Rhinocladiella_mackenziei_CBS102590, 32 Rhinocladiella_mackenziei_CBS_368.92, 33 Rhinocladiella_mackenziei_CBS_367.92, 34 Rhinocladiella_mackenziei_AF050288, 35 Rhinocladiella_fasciculata, 36 Rhinocladiella_basitona, 37 Rhinocladiella_atrovirens, 38 Rhinocladiella_anceps_CBS_181.65, 39 Rhinocladiella_anceps_CBS_157.54, 40 Rhinocladiella_anceps_AF050285, 41 Rhinocladiella_anceps_AF050284, 42 Repetophragma_goidanichii, 43 Readeriella_considenianae, 44 Rasutoria_tsugae, 45 Rasutoria_pseudotsugae, 46 Ramularia_sp., 47 Ramularia_pratensis_var._pratensis, 48 Ramularia_miae, 49 Ramichloridium_strelitziae, 50 Ramichloridium_pini, 51 Ramichloridium_musae_CBS_365.36, 52 Ramichloridium_musae_CBS_190.63, 53 Ramichloridium_indicum, 54 Ramichloridium_cerophilum_CBS_103.59, 55 Ramichloridium_cerophilum_AF050286, 56 Ramichloridium_brasilianum, 57 Ramichloridium_biverticillatum, 58 Ramichloridium_australiense, 59 Ramichloridium_apiculatum_CBS_400.76, 60 Ramichloridium_apiculatum_CBS_391.67, 61 Ramichloridium_apiculatum_CBS_390.67, 62 Ramichloridium_apiculatum_CBS_156.59, 63 Radulidium_subulatum_CBS_912.96, 64 Radulidium_subulatum_CBS_405.76, 65 Radulidium_subulatum_CBS_287.84, 66 Radulidium_subulatum_CBS_101010, 67 Radulidium_sp._CBS_115704, 68 Radulidium_epichloes_CBS_361.63, 69 Radulidium_epichloes_AF050287, 70 Pseudovirgaria_hyperparasitica_CPC_10753, 71 Pseudovirgaria_hyperparasitica_CPC_10704, 72 Pseudovirgaria_hyperparasitica_CPC_10702, 73 Pseudocercospora_epispermogonia_DQ204758, 74 Pseudocercospora_epispermogonia_DQ204757, 75 Pleurothecium_obovoideum, 76 Periconiella_velutina_CBS_101950, 77 Periconiella_velutina_CBS_101949, 78 Periconiella_velutina_CBS_101948, 79 Periconiella_levispora, 80 Periconiella_arcuata, 81 Ophiostoma_stenoceras, 82 Myrmecridium_schulzeri_CBS_642.76, 83 Myrmecridium_schulzeri_CBS_381.87, 84 Myrmecridium_schulzeri_CBS_325.74, 85 Exophiala_dermatitidis, 86 Dissoconium_aciculare, 87 Devriesia_staurophora, 88 Cryptadelphia_polyseptata, 89 Cryptadelphia_groenendalensis, 90 Conioscyphascus_varius, 91 Conioscypha_lignicola, 92 Cladosporium_uredinicola, 93 Cladosporium_sphaerospermum, 94 Cladosporium_cladosporioides, 95 Cladosporium_bruhnei, 96 Cibiessia_dimorphospora, 97 Cercosporella_centaureicola, 98 Catenulostroma_macowanii, 99 Catenulostroma_abietis, 100 Carpoligna_pleurothecii_AY544685, 101 Carpoligna_pleurothecii_AF064646, 102 Carpoligna_pleurothecii_AF064645, 103 Capronia_pulcherrima, 104 Capronia_mansonii, 105 Capronia_coronata, 106 Batcheloromyces_proteae, 107 Ascotaiwania_hughesii_AY316357, 108 Ascotaiwania_hughesii_AY094189, 109 Annulatascus_triseptatus_AY780049, 110 Annulatascus_triseptatus_AY346257, 111 Paullicorticium_ansatum_AY586693, 112 Athelia_epiphylla_AY586633, 113 Myrmecridium_schulzeri_CBS_305.73, 114 Myrmecridium_schulzeri_CBS_304.73, 115 Myrmecridium_schulzeri_CBS_188.96, 116 Myrmecridium_schulzeri_CBS_156.63, 117 Myrmecridium_schulzeri_CBS_134.68, 118 Myrmecridium_schulzeri_CBS_114996, 119 Myrmecridium_schulzeri_CBS_100.54, 120 Myrmecridium_flexuosum, 121 Mycosphaerella_walkeri, 122 Mycosphaerella_punctiformis, 123 Mycosphaerella_parkii, 124 Mycosphaerella_marksii_DQ246250, 125 Mycosphaerella_marksii_DQ246249, 126 Mycosphaerella_madeirae, 127 Mycosphaerella_lateralis, 128 Mycosphaerella_intermedia, 129 Mycosphaerella_gregaria, 130 Mycosphaerella_graminicola, 131 Mycosphaerella_endophytica_DQ246255, 132 Mycosphaerella_endophytica_DQ246252, 133 Mycosphaerella_communis, 134 Metacoleroa_dickiei, 135 Magnaporthe_grisea, 136 Fonsecaea_pedrosoi, 137 Exophiala_jeanselmei; TREE Fig._2 = [&R] (112,111,(((85,104),103,(29,((37,36),137)),(((15,(4,5)),(6,7,8)Veronaea_botryosa),136),105,(30,35),((41,38),(40,39))Rhinocladiella_anceps,(32,31,33,34)Rhinocladiella_mackenziei),((((94,92),(95,93))Cladosporium,(((((86,(133,127)),53),(61,62,60,59)Ramichloridium_apiculatum),(((((((130,27),47),48),(122,46)),97),(132,129,131)),((50,(121,((123,126),(((73,124,128,74),125),79)))),((((((1,(54,55)Ramichloridium_cerophilum),49),58),(51,52)Ramichloridium_musae),57),(((45,44)Rasutoria,(76,77,78)Periconiella_velutina),80))))),(((25,56),26),((((87,99,2),(21,20)Teratosphaeria_parva),(18,(96,19))),((106,24),(((23,98),22),43,17)))))),((67,(((68,69)Radulidium_epichloes,(64,66)),(65,63)))Radulidium,(72,71,70)Pseudovirgaria_hyperparasitica)),(3,(42,((11,12,10,(14,13)),134,9))),((((101,100,102)Carpoligna_pleurothecii,((107,108)Ascotaiwania_hughesii,75)),(90,91)),((((28,(109,110)Annulatascus_triseptatus),(88,89)Cryptadelphia,(((115,((120,((117,84,116),(119,82))),114),113,83),118)Myrmecridium,16)),81),135)))); END; BEGIN TREES; TITLE Tb8656; LINK TAXA = Taxa1; TRANSLATE 1 Zasmidium_cellare, 2 Xenomeris_juniperi, 3 Veronaeopsis_simplex_CBS_588.66, 4 Veronaea_japonica, 5 Veronaea_compacta, 6 Veronaea_botryosa_CBS_350.65, 7 Veronaea_botryosa_CBS_254.57, 8 Veronaea_botryosa_CBS_121.92, 9 Venturia_pyrina, 10 Venturia_inaequalis, 11 Venturia_hanliniana, 12 Venturia_chlorospora, 13 Venturia_carpophila, 14 Venturia_asperata, 15 Thysanorea_papuana, 16 Thyridium_vestitum, 17 Teratosphaeria_toledana, 18 Teratosphaeria_suberosa, 19 Teratosphaeria_readeriellophora, 20 Teratosphaeria_parva_DQ246243, 21 Teratosphaeria_parva_DQ246240, 22 Teratosphaeria_molleriana, 23 Teratosphaeria_fibrillosa, 24 Teratosphaeria_alistairii, 25 Staninwardia_suttonii, 26 Sporidesmium_pachyanthicola, 27 Septoria_tritici, 28 Rhodoveronaea_varioseptata, 29 Rhinocladiella_sp., 30 Rhinocladiella_phaeophora, 31 Rhinocladiella_mackenziei_CBS102590, 32 Rhinocladiella_mackenziei_CBS_368.92, 33 Rhinocladiella_mackenziei_CBS_367.92, 34 Rhinocladiella_mackenziei_AF050288, 35 Rhinocladiella_fasciculata, 36 Rhinocladiella_basitona, 37 Rhinocladiella_atrovirens, 38 Rhinocladiella_anceps_CBS_181.65, 39 Rhinocladiella_anceps_CBS_157.54, 40 Rhinocladiella_anceps_AF050285, 41 Rhinocladiella_anceps_AF050284, 42 Repetophragma_goidanichii, 43 Readeriella_considenianae, 44 Rasutoria_tsugae, 45 Rasutoria_pseudotsugae, 46 Ramularia_sp., 47 Ramularia_pratensis_var._pratensis, 48 Ramularia_miae, 49 Ramichloridium_strelitziae, 50 Ramichloridium_pini, 51 Ramichloridium_musae_CBS_365.36, 52 Ramichloridium_musae_CBS_190.63, 53 Ramichloridium_indicum, 54 Ramichloridium_cerophilum_CBS_103.59, 55 Ramichloridium_cerophilum_AF050286, 56 Ramichloridium_brasilianum, 57 Ramichloridium_biverticillatum, 58 Ramichloridium_australiense, 59 Ramichloridium_apiculatum_CBS_400.76, 60 Ramichloridium_apiculatum_CBS_391.67, 61 Ramichloridium_apiculatum_CBS_390.67, 62 Ramichloridium_apiculatum_CBS_156.59, 63 Radulidium_subulatum_CBS_912.96, 64 Radulidium_subulatum_CBS_405.76, 65 Radulidium_subulatum_CBS_287.84, 66 Radulidium_subulatum_CBS_101010, 67 Radulidium_sp._CBS_115704, 68 Radulidium_epichloes_CBS_361.63, 69 Radulidium_epichloes_AF050287, 70 Pseudovirgaria_hyperparasitica_CPC_10753, 71 Pseudovirgaria_hyperparasitica_CPC_10704, 72 Pseudovirgaria_hyperparasitica_CPC_10702, 73 Pseudocercospora_epispermogonia_DQ204758, 74 Pseudocercospora_epispermogonia_DQ204757, 75 Pleurothecium_obovoideum, 76 Periconiella_velutina_CBS_101950, 77 Periconiella_velutina_CBS_101949, 78 Periconiella_velutina_CBS_101948, 79 Periconiella_levispora, 80 Periconiella_arcuata, 81 Ophiostoma_stenoceras, 82 Myrmecridium_schulzeri_CBS_642.76, 83 Myrmecridium_schulzeri_CBS_381.87, 84 Myrmecridium_schulzeri_CBS_325.74, 85 Exophiala_dermatitidis, 86 Dissoconium_aciculare, 87 Devriesia_staurophora, 88 Cryptadelphia_polyseptata, 89 Cryptadelphia_groenendalensis, 90 Conioscyphascus_varius, 91 Conioscypha_lignicola, 92 Cladosporium_uredinicola, 93 Cladosporium_sphaerospermum, 94 Cladosporium_cladosporioides, 95 Cladosporium_bruhnei, 96 Cibiessia_dimorphospora, 97 Cercosporella_centaureicola, 98 Catenulostroma_macowanii, 99 Catenulostroma_abietis, 100 Carpoligna_pleurothecii_AY544685, 101 Carpoligna_pleurothecii_AF064646, 102 Carpoligna_pleurothecii_AF064645, 103 Capronia_pulcherrima, 104 Capronia_mansonii, 105 Capronia_coronata, 106 Batcheloromyces_proteae, 107 Ascotaiwania_hughesii_AY316357, 108 Ascotaiwania_hughesii_AY094189, 109 Annulatascus_triseptatus_AY780049, 110 Annulatascus_triseptatus_AY346257, 111 Paullicorticium_ansatum_AY586693, 112 Athelia_epiphylla_AY586633, 113 Myrmecridium_schulzeri_CBS_305.73, 114 Myrmecridium_schulzeri_CBS_304.73, 115 Myrmecridium_schulzeri_CBS_188.96, 116 Myrmecridium_schulzeri_CBS_156.63, 117 Myrmecridium_schulzeri_CBS_134.68, 118 Myrmecridium_schulzeri_CBS_114996, 119 Myrmecridium_schulzeri_CBS_100.54, 120 Myrmecridium_flexuosum, 121 Mycosphaerella_walkeri, 122 Mycosphaerella_punctiformis, 123 Mycosphaerella_parkii, 124 Mycosphaerella_marksii_DQ246250, 125 Mycosphaerella_marksii_DQ246249, 126 Mycosphaerella_madeirae, 127 Mycosphaerella_lateralis, 128 Mycosphaerella_intermedia, 129 Mycosphaerella_gregaria, 130 Mycosphaerella_graminicola, 131 Mycosphaerella_endophytica_DQ246255, 132 Mycosphaerella_endophytica_DQ246252, 133 Mycosphaerella_communis, 134 Metacoleroa_dickiei, 135 Magnaporthe_grisea, 136 Fonsecaea_pedrosoi, 137 Exophiala_jeanselmei; TREE Fig._1 = [&R] (112,111,(((((85,104),(29,(((((15,((4,5),((37,137),36))),(6,7,8)Veronaea_botryosa),136),(105,((30,((41,38),(40,39))Rhinocladiella_anceps),35))),(32,31,33,34)Rhinocladiella_mackenziei))),103),((((((94,92),(95,93))Cladosporium,((((86,(133,127)),53),(61,62,60,59)Ramichloridium_apiculatum),((((130,27),(((122,46),(48,47)),97)),(50,(132,129,131))),((121,((123,126),(((73,124,128,74),125),79))),((((((1,(54,55)Ramichloridium_cerophilum),49),58),(51,52)Ramichloridium_musae),57),(((45,44)Rasutoria,(76,77,78)Periconiella_velutina),80)))))),(((25,56),26),(((((87,(21,20)Teratosphaeria_parva),99),2),(18,(96,19))),((106,24),((((23,98),22),43),17))))),(67,((((68,69)Radulidium_epichloes,(64,66)),(65,63)),(72,71,70)Pseudovirgaria_hyperparasitica))),(3,(42,((((11,(14,13)),(12,10)),134),9))))),(((((101,100),102)Carpoligna_pleurothecii,((107,108)Ascotaiwania_hughesii,75)),(90,91)),((((28,((109,110)Annulatascus_triseptatus,(((((115,113,83),120),(((117,84,116),(119,82)),114)),118)Myrmecridium,16))),(88,89)Cryptadelphia),135),81)))); END;