#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 20:58 GMT TreeBASE (cc) 1994-2008 Study reference: Yagame T., Funabiki E., Yukawa T., & Nagasawa E. 2016. Identification of mycobionts in an achlorophyllous orchid, Cremastra aphylla (Orchidaceae), based on molecular analysis and basidioma morphology. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S19061] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=36; TAXLABELS Coprinellus_bisporus_GU227705 Coprinellus_callinus_FN396105 Coprinellus_disseminatus_AY461838 Coprinellus_domesticus_AB597769 Coprinellus_domesticus_FB Coprinellus_domesticus_HQ847052 Coprinellus_domesticus_LC026051 Coprinellus_eurysporus_HQ846992 Coprinellus_flocculosus_FN396139 Coprinellus_heterosetulosus_GU227708 Coprinellus_heterothrix_HQ847000 Coprinellus_impatiens_JN943132 Coprinellus_micaceus_AF345808 Coprinellus_micaceus_JX160060 Coprinellus_radians_HM595561 Coprinellus_sclerocystidiosus_KC992942 'Coprinellus sp. MA-1 LC026052' 'Coprinellus sp. SA-1 LC026050' Coprinellus_truncorum_FM878007 Coprinellus_xanthothrix_AF361228 Coprinus_rufopruinatus_FN396104 Coprinus_silvaticus_HQ846986 Parasola_leiocephala_FM163194 Psathyrella_badhyzensis_KC992883 Psathyrella_candolleana_AF345810 Psathyrella_hymenocephala_FJ168608 Psathyrella_leucotephra_FM163226 Psathyrella_typhae_DQ389721 mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176568 mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176569 mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176570 mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176571 mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176572 uncultured_mycorrhizal_fungus_AB306309 vouchered_mycorrhizae_Basidiomycota_AB597773 vouchered_mycorrhizae_Basidiomycota_AB597781 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M37350] TITLE Aphyllamycobionts_36x608; LINK TAXA = Taxa1; DIMENSIONS NCHAR=608; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Coprinellus_bisporus_GU227705 GGTTGTAGCTGGCTCTTAGGAGCA--TGTGCACACCC--GTCATCTTTATC----TTTCCACCTGTGC----ACACTATGT-AGATCTGGATAAC-TCTCGC-----TCTTC-----TGAGCGGAAACAAGGATTGCTGCGTCGC--AAGGCCAGCTCTCTTTGAATTTCCAGGT-CTATGTCATTT-ACAAACCCCAATTGAATGATGCAGAATG-TCGT--CAATGGGCTCT---AAGCCTATAAAACAAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTGTTATGA-GACTGTGTAAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTTTTG-GC-GGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCA----CTAAGCT-CCGTCTATTGGCGTGATAAT-TATCT-ACGCC-GTGGAATGGGTTTAGACTTGCTTCTAACCGTCCGA Coprinellus_callinus_FN396105 GGTTGTAGCTGGCTCTTAGGAGCA--TGTGCACACCC--GTCATCTTTATC----TTTCCACCTGTGC----ACTCAATGT-AGATCTGGATAAC-TCTCGC-----TCTTC-----GGAGCGGAAACAAGGATTGCTGCGTCGC--AAGACCGGCTCTCTTTGAATTTCCAGGT-CTATGT-CATT-ACAAACCCCAATTGAATGATGAAGAATG-TAGT--CAATGGGCTCT---AAGCCTATAAAACAAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTGTTATGA-GACTGTGTAAGGCTTGGATGTGGGGGTTTTTGCAGGCTGCC-TCTGTGC-GGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCA----CTAAGCT-CCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGAATGGGTTTAGACTTGCTTCTAACCGTCTGA Coprinellus_disseminatus_AY461838 GGTTGTCGCTGGCTCCTCGGAGCA-TTGTGCACGCCC--GCCATTTTTATC----TATCCACCTGTGC----ACCGAATGT-AGGTCTGGATGAC-TCTCGCCTTC------------GGGCGGATGCGAGGTTTGCGTGCGAGC---------GCTCTCCTCGAATTTCCAGGCTCTACGTCTCTTTACACACCCCAAACGTATGATGCAGAATG-TAGT--CAATGGGCCTTTACAAGCCTATAAAACACTATACAACTTTCA-CAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCGGTTTTCTGA--ACCGTTCTCCGAGGCTTGGATGTGGGGGTCTGTGCAGGTCGCCTCAGC--GCGGTCTGCTCCCCTGAAATGCATTAGCGAGATTCAT--TCTGGACCTCCGTCTATCGGTGTGATAAT-TATCTTACGTC-GTTGACTTGGT-CGGACTCGCTTCTAACCGTCCG- Coprinellus_domesticus_AB597769 GGTTGTAGCTGGCTCCTCGGAGCA-ATGTGCACGCCC--GCCATTTTTATC----TTTCCACCTGTGC----ACCGACTGT-AGGTCTGGATACC-TCTCGCCCTT-CAC-------GGGGCGGATGCGAGGGTTGCCCGTCACA-------CGGCTCCCCTCGAATTTCCAGGCTCTACGTCTTTTTACACACCCCAATAGTATGATGCAGAATG-TAGT--CAATGGGCTTCT--CAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGGAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGGTTTCTGA--ACTGTTCTTCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTC-AC-GGCGGTCCGCTCCCCTGAAATGCATTAGCGAG-TTCATA--CTGAACTTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACGAGGT-CAGACTCGCTTCTAACCGTCCGA Coprinellus_domesticus_FB GGTTGTAGCGGGCTCCTGGGAGCA-ATGTGCACGCCCCGCCCATTTTTATC----TTTCCACT-GTGC----ACCGACTGT-AGGTCTGGATACC-TCTCGCCCTTTCAC-------GGGGCGGATGCGAGGGTTGCCCGTCACA-------CGGCTCCCCTCGAATTTCCAGGCTCTACGTCTTTTTACACACCCCAATAGTATGATGCAGAATG-TAGT--CAATGGGCTTCT--CAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTCTGA--ACTGTTCTTCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTC-AC-GGCGGTCCGCTCCCCTGAAATGCATTAGCGAG-TTCATA--CTGAACTTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACGAGGT-CAGACTCGCTTCTAACCGTCCGA Coprinellus_domesticus_HQ847052 GGTTGTAGCTGGCTCCTCGGAGCA-ATGTGCACGCCC--GCCATTTTTATC----TTTCCACCTGTGC----ACCGACTGT-AGGTCTGGATACC-TCTCGCCCTT-CAC-------GGGGCGGATGCGAGGGTTGCCCGTAACA-------CGGCTCTCCTCGAATTTCCAGGCTCTACGTCTTTTTACACACCCCAATAGTATGATGCAGAATG-TAGT--CAATGGGCTT-CT-CAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTCTGA--ACTGTTCTTCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTC-AC-GGCGGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCCTA--CTGAACTTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACGAGGT-CAGACTCGCTTCTAACCGTCCG- Coprinellus_domesticus_LC026051 GGTTGTAGCGGGCTCCTGGGAGCA-ATGTGCACGCCCCGCCCATTTTTATC----TTTCCACT-GTGC----ACCGACTGT-AGGTCTGGATACC-TCTCGCCCTTTCAC-------GGGGCGGATGCGAGGGTTGCCCGTCACA-------CGGCTCCCCTCGAATTTCCAGGCTCTACGTCTTTTTACACACCCCAATAGTATGATGCAGAATG-TAGT--CAATGGGCTTCT--CAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTCTGA--ACTGTTCTTCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTC-AC-GGCGGTCCGCTCCCCTGAAATGCATTAGCGAG-TTCATA--CTGAACTTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACGAGGT-CAGACTCGCTTCTAACCGTCCGA Coprinellus_eurysporus_HQ846992 GGTTGTCGCTGGCGCTTCGGCGCA--TGTGCACACCC--GCTATTCATATC----TTTCCACCTGTGC----ACTTCATGT-AGAACTGAGAAAC-TCTCGC-T---CTCG--------AGCGGATGCAAGGATTGCTGTGTCGC--AAGGCCGGCTCTCTTTGAACTCTCAGTT-CTATGTACTCATACACCCCATTACAAACAGTCAAAGAATG-AAAC--AA-TGGGCTTT---GTGCCTATAAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTCTTGTTATGA-GACTGTGTAAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCC-TCAGTGC-GGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCAAA--CTGAGCT-CCGTCTATTGGTGGGATAAT-TATCT-ACGCC-GTGGATGGTTCTTAGACTTGCTTCTAACCGTCCG- Coprinellus_flocculosus_FN396139 GGTTGTAGCTGGCTCCTCGGAGCA-ATGTGCACGCCC--GCCATTTTTATC----TTTCCACCTGTGC----ACCGACTGT-AGGTCTGGATACC-TCTCGCCTCCCTTCTCTTAGGGAGGCGGATGCGGGGATTGCTCGC------AAGG-GC--TCTCCTCGAACTTCCAGGCTCTACGTCTTTTTACACACCCCAATAGTATGATCCAGAATGATAGT--CAATGGGCTTTCA-TAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTCTGA--ACTGTTCTCCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTCAGC--GCGGTCTGCTCCCCTGAAATGCATTAGCGAGTTCGATA--CTGAGC-TCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGATCGGGCTTAGACTCGCTTCTAACCGTCCGA Coprinellus_heterosetulosus_GU227708 GGTTGTAGCTGGCTCTTAGGAGCA--TGTGCACACCC--GTCATCTTTATC----TATCCACCTGTGC----ACACATTGT-AGATCTGGATAAC-TCTCGC-----TCTTC-----GGAGCGGAAACAAGGATTGCTGCGTCGA--AAGGCCAGCTCTCTTTGAATTTCCAGGT-CTATGTTCTTT-ACAAACCCCAATTGAATGTCGAAGAATG-TAGT--CAATGGGCTCT---AAGCCTATAAAACAAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTGTTATGA-GACTGTGTAAGGCTTGGATGTGGGGGTTTTTGCAGGCTGCCATCTGTGC-GGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCA----CTAAGCT-CCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGAATGGGTTTAGACTTGCTTCTAACCGTCTGA Coprinellus_heterothrix_HQ847000 GGTTGTAGCTGGCTCTTAGGAGCA--TGTGCACGCCC--GTCATCTT-ATC----TTTCCACCTGTGC----ACATAATGT-AGATCTGGATAAC-TCTCGC-----TCTTC-----GGGGCGGAAACAAGGATTGCTGCGTCGC--AAGACCAGCTCTCTTTGAATTTCCAGGT-CTATGT-CATT-ACAAACCCCAATTGAATGATGTAGAATG-TAGT--CAATGGGCTCT---AAGCCTATAAAACAAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCTTACCAGTTTTGTAATGA-GACTGTGTAAGGCTTGGATGTGGGGGTTTTTGCAGGCTGCC-TCTGTGC-GGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCA----CTAAGCT-CCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGAATGGGTTTAGACTTGCTTCTAACCGTCTG- Coprinellus_impatiens_JN943132 GGTTGTAGCTGGCTCTTAGGAGCA--TGTGCACACCC--GTCATCTTTATC----TTTCCACCTGTGC----ACTTAATGT-AGATCTGGATAAC-TCTCGC-----TCTTC-----GGAGCGGAAACAGAGATTGCTGCGTCGC--AAGGCCAGCTCTCTTTGAATTTCCTGGT-CTATGTCCTTT-ACAAACCCCAATTGAATGATGAAGAATG-TAGT--CAATGGGCTCT---AAGCCTATAAAACAAAATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCTCACCAGTTTTGTTATGA-GACTGTGTAAGGCTTGGATGTGGGGGTTTTTGCAGGCTGCC-TCTGTGC-GGTCTGCTCCCCTGAAATACATTAGCGAG-TTCA----CTAAGCT-CCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGAATGGGTTTAGACTTGCTTCTAACCGTCTGA Coprinellus_micaceus_AF345808 GGTTGTAGCTGGCTCCTCGGAGCA-TTGTGCACGCCC--GCCATTTTTATC----TATCCACCTGTGC----ACCGACTGT-AGGTCTGGATGAC-TCTCGTGCTCTCTG-------AGTGCGGATGCGAGGATTGCCCTTCAACTCGGAGGTGTCTCTCCTCGAATTTCCAGGCTCTACGTCTTTTTACACACCCCAAAAGCATGATATAGAATG-TAGT--CAATGGGCT-T-GATTGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCCGTTTTCTGA--ACGGTTCTCCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTCAGC-GC-GGTCCGCTCCCCTGAAATGCATTAGCGAG-TTCGTA--CTGAGC-TCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACAGGGT-TAGACTCGCTTCTAACCGTCCGA Coprinellus_micaceus_JX160060 GGTTGTAGCTGGCTCCTCGGAGCA-ATGTGCACGCCC--GCCATTTTTATC----TTTCCACCTGTGC----ACCGACTGT-AGGTCTGGATGAC-TCTCGCACTCC----------GGTGCGGATGCGAGGATTGCTCTCG-----------GGCTCTCCTCGAATTTCCAGGCTCTACGTCTTTTTACACACCCCAAACGTATGATACAGAATG-TAGT--CAATGGGCT-T-GATCGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCCGTTTTCTGA--ACGGTAC-CCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTCAGC-GCTGGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCATA--CTGAACCTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACTGGGT-TAGACTCGCTTCTAACCGTCCGA Coprinellus_radians_HM595561 GGTTGTAGCTGGCTCCTCGGAGCA-ATGTGCACGCCC--GCCATTTTTATC----TTTCCACCTGTGC----ACCGACTGT-AGGTCTGGATACC-TCTCGCC-----TC-------CGGGCGGATGCGAGGGTTGCTCGT------AA-GGGC--TTCCCTTGAACTTCCAGGCTCTACGTCTTTTTACACACCCCAATAGTATGATGCAGAATG-TAGT--CAATGGGCTT-CT-CAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTCTGA--ACTGAC--T-GAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCT-CACCGGCGGTCTGCTCCCCTGAAATGCATTAGCGAGGTTCATG--CTGGACCTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACGAGGTACAGACTCGCTTCTAACCGTCCGA Coprinellus_sclerocystidiosus_KC992942 GGTTGTCGCTGGCGCCTCGGCGCA--TGTGCACACCC--GCTATTCATATC----TTTCCACCTGTGC----ACTTTATGT-AGAATTGAGAAAC-TCTCGC-T---CTCG--------AGCGGATGCAAGGATTGCTGTGTCGC--AAGGCCAGCTCTCTTTGAACTCTCAGTT-CTATGTACTCATACACCCCATTATAAACAGTCAAAGAATG-AAAC--AA-TGGGCTTC---GTGCCTATAAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGTTTTGTTATGA-GACTGTGTAAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCC-TCAGCGC-GGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCAAA--CTGAGCT-CCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGATGGTTCTTAGACTTGCTTCTAACCGTCCGA 'Coprinellus sp. MA-1 LC026052' GGCTGTCGCTGGCTCCTCGGAGCA-TCGTGCACGCCC--GCCATTTTTATC----TATCCACCTGTGC----ACCGAATGT-AGGTCTGGATGAC-TCTCGTCTCC------------GGGCGGATGCGAGGTTTGCATGTGCGTAGCGTACGGGCTCACCTCGAATTTCCAGACTCTACGTCTTTTTACACACCCCAAACGTATGATGCAGAATG-TAGT--CAATGGGCCTTTAAAAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCCGTTTTCTGA--ACGGTTCTCCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTCAGT--GCGGTCTGCTCCCCTGAAATGTATTAGCGAGATTCATAATCTGAACCTCCGTCTATCGGTGTGATAAT-TATCT-ACGTC-GTTGACTTGAT-CGGACTCGCTTCTAACCGTCCG- 'Coprinellus sp. SA-1 LC026050' GGTTGTAGCTGGCTCCTCGGAGCA-ATGTGCACGCCC--GCCACTTTTATC----TTTCCACCTGTGC----ACCGACTGT-AGGTCTGGATGAC-TCTCGTACTCC----------GGTGCGGATGCGAGGATTGCTCTCG-----------GGCTCTCCTCGAATTTCCAGGCTCTACGTCTTTTTACACACCCCAAACGTATGATACAGGATG-TAGT--CAATGGGCT-T-GATCGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCCGTTTTCTGA--ACGGTAC-CCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTCAGC-GCTGGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCATA--CTGAACCTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACTGGGT-TAGACTCGCTTCTAACCGTCCGA Coprinellus_truncorum_FM878007 GGTTGTAGCTGGCTCCTCGGAGCA-TTGTGCACGCCC--GCCATTTTTATC----TATCCACCTGTGC----ACCGATTGT-AGGTCTGGATGAC-TCTCGCGCTCTCTG-------AGTGCGGATGCGAGGATTGCCCTCTTAA-CGGAGGTGTCTCTCCTCGAATTTCCAGGTTCTACGTCTTTTTACACACCCCAAACGCAT----TAGAATG-CAGT--CAATGGGCT-T-G----CCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCCGTTTTCTGA--ACGGTTCTCCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTCAGC-GC-GGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCGTA--CTGAGC-TCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACAGGGT-TAGACTCGCTTCCAACCGTCCG- Coprinellus_xanthothrix_AF361228 GGTTGTAGCTGGCTCCTCGGAGCA-ATGTGCACGCCC--GCCATTTTTATC----TTTCCACCTGTGC----ACCGACTGT-AGGTCTGGATACC-TCTCGCC-----GC-------AAGGCGGATGCGAGGGTTGCTCGT------AAAGGGC--TCCCCTCGAACTTCCAGGCTCTACGTCTTTTTACACACCCCAATAGTATGATGCAGAATG-TAGT--CAATGGGCTT-CA-CAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCCGTTTTCTGA--ACGGGG--TCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTTCACTGGCGGTCTGCTCCCCTGAAATGCATTAGCGAGGTTCATG--CTGAACTTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACGAGGT-CAGACTCGCTTCTAACCGTCCGA Coprinus_rufopruinatus_FN396104 GGTTGTAGCTGGCTCCTCGGAGCA-ATGTGCACGCCC--GCCATTTTTATC----TTTCCACCTGTGC----ACCGACTGT-AGGTCTGGATGAC-TCTCGTACTCC----------GGTGCGGATGCGAGGATTGCTCTTG-----------GGCTCTCCTCGAATTTCCAGGCTCTACGTCTTTTTACACACCCCAAACGTATGATACAGAATG-TAGT--CAATGGGCT-T-GATCGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCCGTTTTCTGA--ACGGTAC-C-GAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTCAGC-GCTGGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCATA--CTGAACCTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACTGGGT-TAGACTCGCTTCTAACCGTCCGA Coprinus_silvaticus_HQ846986 GGTTGTAGCTGGCTCCTCGGAGCAATTGTGCACGCCC--GCCATTTTTATC----TTTCCACCTGTGC----ACCGACTGT-AGGTCTGGATAAC-TCTCGTCTCCCTAG-------GAGGCGGATGCGACGGTTGCTCGT------AAAGGGCTCTC--GTCGAATTTCCAGGCTCTACGTCTTTTTACACACCCCAACCGTATGACATAGAATG-TAGT--CAATGGGCTTTCAATAGCCTATAAAACAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTCTGA--ACTGTGT--CGAGGCTTGGATGTGGGGGTTTGTGCAGGCCGCCTCAGC-GC-GGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCATA--CTGAGC-TCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACAGGGT-TAGACTCGCTTCTAACCGTCCG- Parasola_leiocephala_FM163194 GGTTGTTGCTGGCTCTTAGGAGCA--TGTGCACACCT--GTCACCTTTATC----TTTCCACCTGTGC----ACCCTTTGTAGTCCCAGGATAACCTCTCGCGCACTCTTGT-----GTTGCGGATGCGAAGGTTGTCGTGCCTAA-CCGGCCGGCTTCCATCGAATTTCCTGGGTCTATGTC-TTT-ACACACCCCTGTATGTTAA-AAAGAATGTTGATTTCAAATGGCT-T---AGGCCTATAGAAAA---TACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAAC-CACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCTG----GCGA-----ACTG---ATGGCTTGGAC-TGGGAGT----GCAGGCTACAGT-----TTGCTCTGCTCTCCTTAAATGTATTAGCAGGTCTTTTA------CCTCTATCCCAACGGTGTGATAATCTATCT-ACGCTGCTGGTTTGGATACGGACTGGCTTCTAACCGTCTG- Psathyrella_badhyzensis_KC992883 GGTTGTAGCTGGCTCCTAGGAGCAC-TGTGCACGCCC--GTCATTCATATCATC-TTTCCACCTGTGA----ACCATGTGT-AGGCCTGGATACC-CCTCGC-TTTGGCAAC-----AAAGCGGATGCAAGGATTGCTGCGTCGAC-AAGGCCGGCTCTCTTTGAATTTCCAGGTTCTATGTCTTTTTACACACCCCAATTGAATGATTTAGAATG-TAGT--CAATGGGCTTTC--ATGCCTATAAAAAACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTGTAACGA-GACAGGTGAAGGCTTGGATGTGGGGGTTTT-GCAGGCTGCC-TCAGTGCTGGTCTGCTCCCCTGAAATGCATTAGCGAG-CTCATA--TTGAGCTTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGATTGGACTCATGCTTGCTTCTAACCGTCCGA Psathyrella_candolleana_AF345810 GGTTGTAGCTGGCTCCTAGGAGTA--TGTGCACACCC--GTCATCTTTATC----TTTCCACCTGTGC----ACACAATGT-AGATCTGGATAAC-TCTCGC-----TCTTC-----GGAGCGGAAACAAGGATTGCTGCGTCGC--AAGACCGGCTCTCTTTGAATTTCCAGGT-CTATGTCTTTT-ACAAACCCCAATTGAAAAATGCAGAATG-TCAT--CAATGGGCTCT---AAGCCTATAAAACTAA-TACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGTTTTGTTATGA-GACTGTGTAAGGCTTGGATGTGGGGGTTTTTGCAGGCTACC--TAGTGT-GGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCA----CTAAGCT-CCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGAAGGAACTTAGACTTGCTTCTAACCGTCTGA Psathyrella_hymenocephala_FJ168608 GGTTGTAGCTGGCTCCTAGGAGCA-TTGTGCACGCCC--GTCATTCATATCATC-TTTCCACCTGTGA----ACCATGTGT-AGGCCTGGATACC-CCTCGC-TTTGGCAAC-----AAAGCGGATGCAAGGATTGCTGCGTCGAC-AAGGCCAGCTCTCTTTGAATTTCCAGGTTCTATGTCTTTT-ACACACCCCATTTGAATGATTTAGAATG-TAGT--CAATGGGCTTTC--ATGCCTATAAAAAACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTGTAACGA-GACAGGTGAAGGCTTGGATGTGGGGGTTTT-GCAGGCTGCC-TCAGTGCAGGTCTGCTCCCCTGAAATGCATTAGCGAG-CTCATA--TTGAGCTTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGATTGGACTCATGCTTGCTTCTAACCGTCCG- Psathyrella_leucotephra_FM163226 GGTTGTTGCTGGCTTCTAGGAGCA-TTGGACACGACCCG?TCATTCATATCATCATTTCCACCTGTGATGCAACCATGTGTTAGGCCTGGATACC-CCTCGCCTTTGGCAAC-----AAAGCGGATGCAAGGATTGCTGCGTCG------GCCGGCTCTCTTTGAATTTCCAGGTTCTATGTCCTT--ACACACCCCATTTGAATGATTTAGAATG-TAGT--CAATGGGCTTTC--ATGCCTATAAAAAA---TACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAAC-CACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAG---------GA-GACA---GAAGGCTTGGAT-TGGGGG---T-GCAGGCTGCC-TCA-----GGTCTGCTCCCCTGAAATGCATTAGCGAG-CT----------GCTTCCGTCTATTGGTGTGATAAT-TATCT-ACGCCCGTGGA?TTGG--AT?GCTTGCTTCTAACCGTCCG- Psathyrella_typhae_DQ389721 GGTTGTAGCTGGCTTCTAGGAGCA-TTGTGCACGCCC--GTCATTCATATCACC-TTTCCACCTGTGA----ACTATTTGT-AGATCTGGATCCC-TCTCGC-TTTGCTCGC-----ATGGCGGATGCAAGGATTGCTGTGCCTCT-AAAGCCAGCTCTCTTTGAATTTCCAGGT-CTATGTCTTTTTACACACCCCAGTGCATAA-CGCAGAATG-TATC--AAATGGGCCGT--AAGGCCTATAAA-CACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTATCATTAAATTCTCAACCTCACCCGCTTTGTAATGAAGACGGTGTAAGGCTTGGATATGGGGGTCT-TGCATGCTGCC-TTGGTGCTGGCTTGCTCTCCTGAAATACATTAGCGGG-CTTATA--CTGAGCT-CCGTATCCCGGCGTGATAAT-TATCT-ATGCT-GTGGATTGGACTCGTGCTTGCTTCTAACCGTCCGA mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176568 GGTTGTCGCTGGCTCCTCGGAGCA-TCGTGCACGCCC--GCCATTTTTATC----TATCCACCTGTGC----ACCGAATGT-AGGTCTGGATGAC-TCTCGCCCTC------------GGGCGGATGCGAGGTTTGCGTTCGCGT---GCGAGCGCTCTCCTCGAATTTCCAGGCTCTACGTCTCTTTACACACCCCAAACGTATGATGCAGAATG-TAGT--CAATGGGCCTTTACAAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCGGTTTTCTGA--ACCGTTCTTCGAGGCTTGGATGTGGGGGTTTGTGCAGGTCGCCTCAGC--GCGGTCTGCTCCCCTGAAATGCATTAGCGAGATTCAT--TCTGGACCTCCGTCTATCGGTGTGATAAT-TATCT-ACGTC-GTTGACTTGGT-CGGACTCGCTTCTAACCGTCCGA mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176569 GGTTGTAGCTGGCTCCTCGGAGCA-ATGTGCACGCCC--GCCATTTTTATC----TTTCCACCTGTGC----ACCGACTGT-AGGTCTGGATACC-TCTCGCCCTT-CAC-------GGGGCGGATGCGAGGGTTGCCCGTCACA-------CGGCTCCCCTCGAATTTCCAGGCTCTACGTCTTTTTACACACCCCAATAGTATGATGCAGAATG-TAGT--CAATGGGCTT-CT-CAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGTGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTCTGA--ACTGTTCTTCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTC-AC-GGCGGTCCGCTCCCCTGAAATGCATTAGCGAG-TTCATA--CTGAACTTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACGAGGT-CAGACTCGCTTCTAACCGTCCGA mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176570 GGTTGTAGCTGGCTCCTCGGAGCA-ATGTGCACGCCC--GCCATTTTTATC----TTTCCACCTGTGC----ACCGACTGT-AGGTCTGGATACC-TCTCGCCCTT-CAC-------GGGGCGGATGCGAGGGTTGCCCGTCACA-------CGGCTCCCCTCGAATTTCCAGGCTCTACGTCTTTTTACACACCCCAATAGTATGATGCAGAATG-TAGT--CAATGGGCTTTT--CAGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAGATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAGCGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTCTGA--ACTGTTCTTCGAGGCTTGGATGTGGGGGTTTGTGCAGGCTGCCTCCAC-GGCGGTCCGCTCCCCTGAAATGCATTAGCGAG-TTCATA--CTGAACTTCCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGACGAGGT-CAGACTCGCTTCTAACCGTCCGA mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176571 GGTTGTAGCTGGCTCCTAGGAGCACTTGTGCACGCCC--GTCATTCATATCATC-TTTCCACCTGTGA----ACTATGTGT-AGGCCTGGATACC-CCTCGC-TTTGGTGAC-----AAAGTGGATGCAAGGATTGCTGCGTCGAC-AAGGCCGGCTCTCTTTGAATTTCCAGGTCCTATGTCTTTTTACACACCCCATTCGAATGATGTAGAATG-TAGT--CAATGGGCTCTT--ATGCCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTGTAATGA-GACGGGCGAAGGCTTGGATGTGGGGGTTTTAGCAGGCTGCC-TCAGTGCTGGTCTGCTCCCCTGAAATGCATTAGCGAG-CTTATA--CTGAGCTTCCGTCTATTGGTGTGATAAT-TATCT-ATGCC-GTGGATTGGACTCGTGCTTGCTTCTAACCGTCCGA mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176572 GGTTGTAGCTGGCTCCTAG-AGCA-TTGTGCACGCCC--GTCATTCATATCATC-TTTCCACCTGTGA----ACCATGTGT-AGGCCTGGATACC-CCTCGC-TTTGGCAAC-----AAAGCGGATGCGAGGATTGCTGCGTCGAC-AAGGCCGGCTCTCTTTGAATTTCCAGGTTCTATGTCTTTT-ACACACCCCATTCGAATGATTTAGAATG-TAGT--CAATGGGCTTTC--ATGCCTATAAAAAACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCCGTTTTGTAACGA-GACAGGTGAAGGCTTGGATGTGGGGGTTTT-GCAGGCTGCC-TCAGTGCTGGTCTGCTCCCCTGAAATGCATTAGCGAG-CTCATA--TTGAGCTTCCGTCTATTGGTATGGTAAT-TATCT-ACGCC-GTGGATTGGACTCATGCTTGCTTCTAACCGTCCGA uncultured_mycorrhizal_fungus_AB306309 GGTTGTAGCTGGCTCCTAGGAGCA-TTGTGCACGCCC--GTCATTCATATCATC-TTTCCACCTGTGA----ACCATGTGT-AGGCCTGGATACC-CCTCGC-TTTGGCAAC-----AAAGCGGATACAAGGATTGCTGTGTCGAC-AAGGCCGGCTCTCTTTGAATTTCCAGGTTCTATGTCTTTTTACACACCCCATTTGAATGATTTCGAATG-TAGT--CAATGGGCTTTC--ATGCCTATAAAAAACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTGTAATGA-GACAGGTGAAGGCTTGGATGTGGGGGTTTT-GCAGGCTGCC-TCAGTGCTGGTCTGCTCCTCTGAAATGCATTAGCGAG-CTCATA--TTGAGCTTCCATCTATTGGTGTGATAAC-TATCT-ATGCC-GTGGATTGGACTCATGCTTGCTTCTAGCCGTCCGA vouchered_mycorrhizae_Basidiomycota_AB597773 GGT?GTAGCTGG?T?CT?GGAGCA-ATGTGCACGCCC--GCCA?TTTT?TC----TTTCC?C?TGTGC----AC?GAC?GT-AG?TCTGGATA?C-TCTCGCCCTT-CAC-------GGGGCGGATGCGAGGGTTGC??GTCAC?-------CG?CTCCCCTCGAATTT?CAG?CT?TACGTCTTTTTAAACACCCCAATAGTATGATGCAGAA?G-TAGT--CAATGGGCTTAT--CA?CCTATAAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCT?GCATCGATGAAGA?CGCAGCGAAAT?CGATAAGTAATGTGAATTGCAGAATTCAG?GAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTCCTGA--ACTGTTCTTCGAGGCT?GGATGTGGGGGTTTGTGCGGGCTGCCTC-AC-GGCGGTCCGCTCCCCTGAAATGCATTAGCGA?-TTCATA--CTGAACTTCCGTCTATTGGTGTGATAAT-TAT?T-AC?CC-GTGGACGAGGT-CAGACTCGCTT?TA?CCGTCCG- vouchered_mycorrhizae_Basidiomycota_AB597781 GGTTGTAGCTGGCTCTTAGGAGCA--TGTGCACACCC--GTCATCTTTATC----TTTCCACCTGTGC----ACTCAATGT-AGATCTGGATAAC-TCTCGC-----TCTTC-----GGAGCGGAAACAAGGATTGCTGCGTCGC--AAGACCGGCTCTCTTTGAATTTCCAGGT-CTATGT-CATT-ACAAACCCCAATTGAATGATGAAGAATG-TAGT--CAATGGGCTCT---AAGCCTATAAAACAAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTGTTATGA-GACTGTGTAAGGCTTGGATGTGGGGGTTTTTGCAGGCTGCC-TCTGTGC-GGTCTGCTCCCCTGAAATGCATTAGCGAG-TTCA----CTAAGCT-CCGTCTATTGGTGTGATAAT-TATCT-ACGCC-GTGGAATGGGTTTAGACTTGCTTCTAACCGTCTG- ; END; BEGIN TREES; TITLE Aphyllamycobionts_36x608; LINK TAXA = Taxa1; TRANSLATE 1 Parasola_leiocephala_FM163194, 2 Coprinellus_bisporus_GU227705, 3 Coprinellus_heterosetulosus_GU227708, 4 Coprinellus_impatiens_JN943132, 5 Coprinellus_heterothrix_HQ847000, 6 Coprinellus_callinus_FN396105, 7 vouchered_mycorrhizae_Basidiomycota_AB597781, 8 Coprinellus_eurysporus_HQ846992, 9 Coprinellus_sclerocystidiosus_KC992942, 10 Psathyrella_typhae_DQ389721, 11 mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176571, 12 mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176572, 13 Psathyrella_leucotephra_FM163226, 14 Psathyrella_hymenocephala_FJ168608, 15 Psathyrella_badhyzensis_KC992883, 16 uncultured_mycorrhizal_fungus_AB306309, 17 Psathyrella_candolleana_AF345810, 18 Coprinellus_truncorum_FM878007, 19 Coprinellus_micaceus_AF345808, 20 Coprinus_rufopruinatus_FN396104, 21 'Coprinellus sp. SA-1 LC026050', 22 Coprinellus_micaceus_JX160060, 23 Coprinus_silvaticus_HQ846986, 24 'Coprinellus sp. MA-1 LC026052', 25 Coprinellus_disseminatus_AY461838, 26 mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176568, 27 Coprinellus_flocculosus_FN396139, 28 Coprinellus_radians_HM595561, 29 Coprinellus_xanthothrix_AF361228, 30 Coprinellus_domesticus_HQ847052, 31 mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176569, 32 vouchered_mycorrhizae_Basidiomycota_AB597773, 33 Coprinellus_domesticus_AB597769, 34 mycorrhizal_basidiomycete_of_Epipogium_roseum_AB176570, 35 Coprinellus_domesticus_LC026051, 36 Coprinellus_domesticus_FB; TREE Imported_tree_1 = [&R] (1:0.07155653000000001,(((2:0.00670593,17:0.02266366)0.3670:0.00450773,(3:0.00447187,((4:0.01354224,5:0.00901088)0.3810:0.00445989,(6:0.0,7:0.0)0.9580:2.5E-7)0.2690:0.00223401)0.4030:0.0)0.7800:0.01044193,(((8:0.00903819,9:0.00441641)1.0000:0.07515549,((10:0.07080016,11:0.00208166)0.1900:0.00660841,(12:0.00907635,((13:0.01813072,15:0.00223468)0.0210:0.0,(14:0.0,16:0.01575061)0.1630:0.0)0.2430:0.00214544)0.3430:0.0027006)0.5200:0.02965476)0.2310:0.00730223,(((24:0.01178044,(25:0.00405002,26:0.00267944)0.8840:0.00900087)0.9980:0.02809487,((18:0.00901391,19:0.00902464)0.7700:0.00990914,(22:0.0,(20:0.00223834,21:0.00224028)0.4910:0.00223731)0.7720:0.0036518)0.5040:0.00454606)0.5610:0.01027652,(27:0.0092635,(23:0.01964201,((28:0.00703889,29:0.0057882)0.8470:0.0051639,(30:0.0,((31:0.00223769,32:0.00448662)0.1320:0.0,(34:0.00448311,(33:0.0022383,(35:0.0,36:0.0)0.6830:0.00224152)0.1000:0.0)0.0570:0.0)0.6920:0.00223769)0.7080:0.0)0.8210:0.00840645)0.2410:0.00596121)0.2270:0.0)0.9970:0.04151599)0.1350:0.00819296)0.0000:0.07155653000000001); END;