#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 10:36 GMT TreeBASE (cc) 1994-2008 Study reference: Yokoyama R., Salleh B., & Honda D. 2007. Taxonomic rearrangement of the genus Ulkenia sensu lato based on morphology, chemotaxonomical characteristics, and 18S rRNA gene phylogeny (Thraustochytriaceae, Labyrinthulomycetes): emendation for Ulkenia and erection of Botryochytrium, Parietichytrium, and Sicyoidochytrium gen. nov. Mycoscience, 48(6): 329-341. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1908] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=53; TAXLABELS Aplanochytrium_kerguelense Aplanochytrium_minuta Aplanochytrium_sp._PR24_1 Aplanochytrium_stocchinoi Aurantiochytrium_limacinum Aurantiochytrium_mangrovei Aurantiochytrium_sp._KH105 Aurantiochytrium_sp._MBIC11093 Aurantiochytrium_sp._N1_27 Aurantiochytrium_sp._SEK209 Aurantiochytrium_sp._SEK217 Aurantiochytrium_sp._SEK218 Bacillaria_paxillifer Botryochytrium_radiatum_Raghukumar_16 Botryochytrium_radiatum_SEK353 Botryochytrium_sp._BUTRBC_143 Botryochytrium_sp._Raghukumar_29 Japonochytrium_sp._ATCC_28207 Labyrinthula_sp._AN1565 Labyrinthula_sp._L59 Labyrinthula_sp._L72 Labyrinthula_sp._N12 Labyrinthula_sp._N8 Oblongichytrium_minuta Oblongichytrium_multirudimentalis Oblongichytrium_sp._SEK347 Ochromonas_danica Parietichytrium_sp._F3_1 Parietichytrium_sp._H1_14 Parietichytrium_sp._MBIC11085 Parietichytrium_sp._SEK351 Parietichytrium_sp._SEK364 Schizochytrium_aggregatum Schizochytrium_sp._SEK210 Schizochytrium_sp._SEK345 Schizochytrium_sp._SEK346 Sicyoidochytrium_sp._MBIC11071 Sicyoidochytrium_sp._MBIC11077 Sicyoidochytrium_sp._SEK354 Thraustochytrium_aggregatum Thraustochytrium_aureum Thraustochytrium_kinnei Thraustochytrium_pachydermum Thraustochytrium_sp._BURABG_162 Thraustochytrium_sp._C9G Thraustochytrium_sp._KK17_3 Thraustochytrium_striatum Ulkenia_amoeboidea Ulkenia_profunda Ulkenia_profunda_BUTRBG_111 Ulkenia_visurgensis_ATCC_28208 Ulkenia_visurgensis_BURAAA_141 l_quahog_parasite_QPX_1 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3781] TITLE Labyrinthulomycetes_SSU; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1983; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aplanochytrium_kerguelense -------GGTGATCC-TGCCAGTAGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTGCAAGC-AC-TTGTACTGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGATGCCT------ACTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATGCA--ACAAAGCCCAACTTTT------CGGACGGGCTGTATTTATTAGATAG--AAACCAATGCGGGG-------TTCTCCCCGGTGTTGTGGTGAGTCATAATAACTAAGCGAATCGCAG----TGGCTTCGG--CCGGCGATGAATCATT-CAAGTTTCTGCCCTATCAGCTGTCGATGGTAGGGTATTGGCCTACCATGG-CGTTAACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATCCTG-ATACGGGGAGGTAGTGA-CAATAAATAACAATACGGGGCC-------CATCGGGTCTTGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CACCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGGATTTCTGGTAGGAGTGAC-G-TTCCGGACTTGA--TTGTCCG----TGTATTGTGT-TGTCTCCAGCCA-TCCTCGTGG-AGAACTTTTCCAGCATTAACTTGTTGGGATT---GGGACCCACGTCGTTTACTGTGAAAAAATT-AGAGTGTTTA--AAGCAGGCAAT---CGCT-TGAATACAT-TAGCATGGAATAATAAGATAGGACTTTGG--TACTATTTTGTTGGTTT-GCATACCAAATTAA-TGATCAACAGGAACAG-TTGAGGATATTCGTA-TGAACATG-TCAGAGGTGAAATTCTTGGATTTTGATCAGACGAACTACTGCGAAAGCATTTATCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCATAAA-CTATGCCGACTAGGGATTGGCGGA-CGTTGTTT------AATTGACTCCGCCA-GCACCTCA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGG--CTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGT-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAATA--GTGTGCG--TATTCGAAAGAA----TGCGTTCGACTTCTTAGAGGGAC-ATTTCGGTTTTACC--GGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACAATGATGAATTCAACGAGTTTATAA-------------------------------CCTTGGTTGAAAAGCCTGGG-TAATCTTTTGAACTTTCGTCGTGATGGGGCTAGACCCTTGCAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCTAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAATCTTCGGACCGTGACTTTGA-TTTGTTCACTCAAAACGC-TGTTATGGGAAGTTGATTAAACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGTGAACCTGCA------------- Aplanochytrium_minuta -AACCTGGTTGATCC-TGCCAGTAGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTGCAAGC-AC-TTGTACTGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGATTTCT------ACTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATGCA--ACAAAGCCCATTT--------------GGGCTGTATTTATTAGATAG--AAACCAATGCAGGG-------TTTTCCCTGGTGTTGTGGTGAGTCATAATAACTAAGCGAATCGCAG----TGGCTTCGG--CCGGCGATGAATCATT-CAAGTTTCTGCCCTATCAGCTGTCGATGGTAGTGTATTGGACTACCATGG-CGTTAACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATCCTG-ATACGGGGAGGTAGTGA-CAATAAATAACAATACGGGGCC-------CATCGGGTCTTGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGGATTTCTGGTAGGAGTGACCG-TTCCGAACTTGA--TTGTTCG----TGTATTGTGT-TTTCTCCAGCCA-TCCTTGTGG-AGAACTTTTCTTGCATTAATTTGTAGGGATT---GGGACCCGCATCGTTTACTGTGAAAAAATT-AGAGTGTTTA--AAGCAGGCAAT---CGCT-TGAATACAT-TAGCATGGAATAATAAGATAGGACTTTGG--TACTATTTTGTTGGTTT-GCATACCAAATTAA-TGATCAACAGGAACAGTTTGAGGATATTCGTA-TGAACATG-TCAGAGGTGAAATTCTTGGATTTTGATCAGACGAACTACTGCGAAAGCATTTATCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCATAAA-CTATGCCGACTAGGGATTGGCGGA-CGTTGTCT------ATATGACTCCGCCA-GCACCTCA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGT-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAATA--GTGTGCA--TATTCGAAAGAA---T-GTGTTCGACTTCTTAGAGGGAC-ATTTCGGTTTTACC--GGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACAATGATGAATTCAACGAGTTTATAA-------------------------------CCTTGGTTGAAAAGCCTGGG-TAATCTTTTGAACTTTCGTCGTGATGGGGCTAGACCCTTGCAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAATCTTCGGATTGAGACTTTGA-TTTCTTCACGGAAAACGC-TGTTTTAAAAAGTTGATTAAACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCAGAAGGATCAAGC Aplanochytrium_sp._PR24_1 -----------------------------------------------------------CT???TGC??G?AC-T---TGTACTGTGAAACTG?GAATGGCTCATTATATCAG?TATAGTT?ATTTGATAGAT?TCT------ACTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATGCA--ACAAAGCCCATTT--------------GGGCTGTATTTATTAGATAG--AAACCAATGCAGGG-------TTTTCCCTGGTGTTGTGGTGAGTCATAATAACTAAGCGAATCGCAG----TGGCTTCGG--CCGGCGATGAATCATT-CAAGTTTCTGCCCTATCAGCTGTCGATGGTAGTGTATTGGACTACCATGGGCGTTAACGGGTGACCGGAAGAATTAGGGGTTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATCCTG-ATACGGGGAGGTAGTGA-CAATAAATAACAATACGGGGCC-------CATCGGGTCTTGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGGATTTCTGGTAGGAGTGACCG-TTCCGAACTTGA--TTGTTCG----TGTATTGTGT-TTTCTCCAGCCA-TCCTTGTGG-AGAACTTTTCTTGCATTAATTTGTAGGGATT---GGGACCCGCATCGTTTACTGTGAAAAAATT-AGAGTGTTTA--AAGCAGGCAAT---CGCT-TGAATACAT-TAGCATGGAATAATAAGATAGGACTTTTGG-TACTATTTTGTTGGTTT-GCATACCAAATTAAATGATCAACAGGAACAGTTTGAGGATATTCGTA-TGAACATG-TCAGAGGTGAAATTCTTGGATTTTGATCAGACGAACTACTGCGAAAGCATTTATCAAGGAATGTTTTTCCATTAAACCAAGAACG?AAAGTTAGGGAATCGAAGAATGATTAGATACCATCGTAGTCTTAACCATAAAACTATGCCGACTAGGAATTGGCGGAACGTTGTCT------ATATGACTCCGCCAAGCACCTCA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGAAGTATGGTCGCAA-GGCTGAAAACTTAAAGGAATTGACTGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGTTAAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGGTGGTGGTGCATGGCC-GTTCTTAGTTTGGGGGAGTGGATTGGTCTGG-TTAATTCCGTTAACGAACGAAACCCCAACCTGCTTAAATAAGTGTGCAT-TATTCCAAAGAA---TTGTGTTCGACTTCTTAGAGGGAC-ATTTCGGTTTTACC--GGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACAATGATGAATTCAACGAGTTTATAA-------------------------------CCTTGGTTGAAAAGCCTGGG-TAATCTTTTGAACTTTCGTCGTGATGGGGCTAGACCCTTGCAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAATCTTCGGATTGAGACTTTGA-TTTCTTCACGGAAAACGC-TGTTTTAAAAAGTTGATTAAACCTTACCATTTAGAGGAAGG------------------------------------------------ Aplanochytrium_stocchinoi ----------------------GAGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTGCAAGC-AC-TTGTACTGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGATGCCT------ACTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATGCA--ACAAAGCCCAACTTTT------TGGACGGGCTGTATTTATTAGATAG--AAACCAATGCAGGG-------TTTTCCCTGGTGTTGTGGTGAGTCATAATAACTAAGCGAATCGCAG----TGGCTTCGG--CCGGCGATGAATCATT-CAAGTTTCTGCCCTATCAGCTGTCGATGGTAGGGTATTGGCCTACCATGG-CGTTAACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATCCTG-ATACGGGGAGGTAGTGA-CAATAAATAACAATACGGGGCC-------CATCGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGGATTTCTGGTAGGAGCGACCG-TTCCGGACTTGA--TTGTTCG----TGTATTGTGT-TGTCTCCAGCCA-TCCTTGTGG-AGAACTTTTCTTGCATTAATTTGTAGGGATT---GAGACCCGCATCGTTTACTGTGAAAAAATT-AGAGTGTTTA--AAGCAGGCAAT---AGCT-TGAATACAT-TAGCATGGAATAATAAGATAGGACTTTGG--TACTATTTTGTTGGTTT-GCATACCAAATTAA-TGATCAACAGGAACAGTTTGAGGATATTCGTA-TGAACATG-TCAGAGGTGAAATTCTTGGATTTTGATCAGACGAACTACTGCGAAAGCATTTATCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCATAAA-CTATGCCGACTAGGGATTGGCGGA-CGTTGTCT------ATATGACTCCGCCA-GCACCTCA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGT-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAATA--GTGTGCA--TATTCGAAAGAA----TGTGTTCGACTTCTTAGAGGGAC-ATTTCGGTTTTACC--GGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACAATGATGAATTCAACGAGTTTATAA-------------------------------CCTTGGTTGAAAAGCCTGGG-TAATCTTTTGAACTTTCGTCGTGATGGGGCTAGACCCTTGCAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAATCTTCGGATCGAGACTTTGT-TTTGTTTACTCAAAACGC-TGTTTCGAGAAGTTGATTAAACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTA---------------------------- Aurantiochytrium_limacinum ---------------CCTCCAGTAGTCATATGCT-CGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAGC-GA-TTGTACTGTGAGACTGCGAACGGCTCATTATATCAGTAATAATTTCTTCGGTAGTTTCTT-------TTATATGGATACCTGCAGTAATTCTGGAAATAATACATGCT-GTAAGAGCCCTG-TAT-----------GGGGCTGCACTTATTAGATTG--AAGCCGATTT-----------------------TATTGGTGAATCATGATAATTGAGCAGATTGA--------CTTTTTTA---GTCGATGAATCGTTT-GAGTTTCTGCCCCATCAGTTGTCGACGGTAGTGTATTGGACTACGGTGA-CTATAACGGGTGAC--GGAGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCATATC-CAAGGA-TAGCAGCAGGCGCGTAAATTACC-CACTGTGG-ACTCCACGAGGTAGTGA-CGAGAAATATCGATGCGAAGTG-------GTATGCGTTTTGCTATCGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCA-CAGCCGCGGTAATT-CCAG-CTCCAG-AAGCATATGC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATTTCTGGCATGGGCGACCGGTGCTTTCCCTG---AATGG-GGATTG-ATTGTCT---GTGTTGCCTTGG---CCATCTTTCTCATTTTCTTTATAGGGGAGA-------------------AATCTTTCACTAAAATCAAAGC-AGAGTGTTCC--AAGCAGGTCGT--ATGACGGTTATGTT--TATTATGGGATGATAAGATAGGACTTGGG--TGCTATTTTGTTGGTTT-GCACGCCTGAGTAA-TGGTTAATAGGAACAG-TTGGGGGTATTCGTA-TTTAGGAGCT-AGAGGTGAAATTCTTGGATTTCCGAAAGACGAACTAGAGCGAAGGCATTTACCAAGCA---TGTTTTCATTAATC-AAGAACG-AAAGTCTGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTAGACCGTAAA-CGATGCCGACTTGCGATTGTTGGGTGCTTTTTATA--GGG?????????????-------CA-T??GAAA??A-AACT--TTTGGGTTCC-GGGGG????????????AAG?-???AAA--TTAAAGGATTTG---GAAGG???--CC?CC???GG---??GGGCCTGGCGTTAAATTTA?CCCAAC?-GGG??AAACTT???????-?????-???????-??????????????????-??????????-??????????????-????????????-??????????-?????????-??????CTGG-TTAATTCCGTTAACGAACGA?ACCTCGG??TACTAAATA--GTGCGTGG-TATGGCAACATA-GTACGTTT-T-ACTTCTTA-AGGGAC-A-GTCCGGTT-AC---GGCAGGA-GTTCA--GCAA-TAACAG-TCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCATCGGGTTTTAATTCA-----------TTTTATGGAATTGAGT-GCTTGGTCGGAAGGCCTGGC-TAATCCTTGGAACGCTCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACC-ATGGGATGTTTCTGTT---TGGATTAATTTTTG-GACAGAGGCAGAAC------------------------------------------------------------------------------ Aurantiochytrium_mangrovei --------GTTGATCCTGCCAGTAGCCATATGCTCGGTCTCAAAGATTAAGGCATGCATGTGTAAGTATAACGCGA-TTGTTCTGTGAGACTGCGAACGGCTCATTATATCAGTAATAATTTCTTCGGTAGTTTCTT-------TTATATGGATACCTGCAGTAATTCTGGAAATAATACATGCT-GTAAGAGCCCGACTTT-----------GGGGCTGCACTTATTAGATTG--AAGCCGATTT-----------------------TATTGGTGAATCATGATAATTGAGCAGATTGA--------CTTTTTT----GTCGATGAATCGTTT-GAGTTTCTGCCCCATCAGTTGTCGACGGTAGTGTATTGGACTACGGTGA-CTATAACGGGTGAC--GGAGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCATATC-CAAGGA-TAGCAGCAGGCGCGTAAATTACC-CACTGTGG-ACTCCACGAGGTAGTGA-CGAGAAATATCGATGCGAAGTG-------GTATGCGTTTTGCTATCGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCACAGGCCGCGGTAATC-CCAG-CTCCAG-AAGCATATGCGTAAACGTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATTTCTGGCATGGGCGACCGGTGCTTTCCCTGT--AATGG-GGATTG-ATTGTCT---GTGTTGCCTTAG---CCATCTTTCTCATGTCATTTTGGTTAGAGA-------------------AATCTTCCACTGTAATCAAAGC-ATAGTGTCCC--AAGCAGGTCGT--ATGACCGGTATGTT--AATTATGGGATGATAAGATAGGACTGGGT--CTCTATTTGGTGGGTTG-GCACGCCTGAGTAA-TGGTTAATAGGAACAG-TTGGGGGTATCCGTA-TTTAGGAGCT-AAAGGTGAAATTCTTGGATTCCCGAAAGACGAACTACAGCGAAGGCATTTACCAAGCA---TGTTTTCATTAATC-AAGAACG-AAAGTCTGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTAGACCGTAAA-CGATGCCGACTTGCGATTGTTGGGTGCTTTTTATA--GGGCCCCCGCCCCCCA-GCAGCACA-TGAAAAACCA-AAGTCTTTTGGGTTCCCGGGGGGAGTATGGCCCCAAGGGCAGAAA-CTTAAAGGATTCAACGGAAGGGCCACCCACCAGAGACGTTGGAGCCCGCGGCTTAATTTAACTCAACACGGGAAAAACTCACCAGGC-CCAGATCATAGGT-AGGATAGAAAGATTGAGACGCCCTCTCATAGATTCTATGGGTGG-GGGCGCATGCCC-GCTCTTAGTG-GGGGGAGAG-ATTTGTCTGGGTTAATTCCGTTAACGAACGAGACCTCGGCCTACTAAATATTGCCGGGCG-TATGGCAACATATGTACGTTTGTAACTTCTTAAAGGGAC-ATGTCCGGTTTACC-GAGAAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCCTTAAATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCATCGGGTCTTTAGTTGTAA--------TTTTTGGAAATTGCGTCGCTTGGTCGGAAGGCCTGGC-TAATCCTTTGAACGCCCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACCCATGGGATGTTT?TGTT---TGGATTCATTTTTG-G------------------------------------------------------------------------------------------- Aurantiochytrium_sp._KH105 CCAACCTGGTTGATCCTGCCAGTAGCCCTACGCTTCGTCTCAAAGACTAAGCCATGCATGTGTAAGTATAAGCGAA-TTATACTGTGAAACTGCGAACGGCTCATTATATCAGTTATAATCCCTTCGGTAGTTCCTT-------T-ACACGGATACCTGCAGTAATTCTGGAATTAATACGTGCT-GTACGGGCCCGACTTTCG------GGGAGGGCCGCACTTATTAGGTCT--AAGCCAACGT-----------------------TCTTGGTGAGTCATGATAATTGAGCAGATCG---------CTTTTCGG---AGCGATGAATCGTTT-GAGTTTCTGCCCCATCAGTTGTCGACGGTAGGGTATTGGCCTACGGTGA-CTATAACGGGTGAC--GGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATGTGG-ACTCCACGAGGTAGTGA-CGAGAAATATCAATGCGGGGCG-------CTTCGCGTCTTGCTATTGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAG-AAGCGTATGC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATTTCTGGTGTGGGAGCCCAGGCCTCGGTGCG---AATGT-GCCTTGTATTGCCTT--GCGGCTCCTTTG---CCATCCTCGTCTGAGCAATCA------GGC-------------------AGTCATTCACTGTAATCAAAGC-AGAGTGTTCC--AAGCAGGCCGT--AGGGCCGGTATGTT--TATTATGGGATGATCAGATAGGACTCGGG--TGCTATTTGGTTGGTTT-GCACATCTGAGTAA-TGATTAATAGGAACAG-TCGGGGGTATCCGTA-TTTAGGAGCT-AGAGGTGAAATTCTTGGATTTCCGAAAGACGAACTACAGCGAAGGCATTTACCAAGCA---TGTTTTCATTAATC-AAGAACG-AAAGTCTGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTAGACCGTAAA-CGATGCCGACTTGCGATTGC-GGGTGGCTTGTATT-------GGGCCTCCGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGGT-AGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCGGCCTACTAAATA--GCCGGGCG-TATGGCGACATA--TGTGTTTGTGGCTTCTTAGAGGGAC-ATGTTCGGTTTACG--AGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAGCGGGTCTTTGTTGTG------------TTTACTCACAGCGTTGCTTTGTCGGAAGGCATGGC-TAATCCTTTGAACGCCCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACC-ATGGGTCTACCTTTTG---AGCGTTTGTTCGCG-ATGGAGGTGGGAACTCGGGTGAATCTTATTGTTTAGAGGAAGGTGAAGTCGTAACAAGG--------------------------------- Aurantiochytrium_sp._MBIC11093 ----------------------TAGCCCTACGCT-CGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAGCGA--TTATACTGTGAAACTGCGAACGGCTCATTATATCAGGTATAATTTCTTCGGTAGTTT--------CTTTACATGGAAACCTGCAGTAATTCTGGAATTAATACATGCT-GTAAGGGCCCGACTGCTTGC----GGGAGGGCCGCACTTATTAGAATTG-AAGCCAAC-----------------------TTTATTGGTGAGTCATGATAATTTCGCAGATCGC-----------TCTTTT-GGGCGATGAATCGTT-TGAGTTTCTGCCCCATCAGTTGTCGACGGTAGTGTATTGGACTACGGTGA-CTATAACGGGTGAC--GGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATGTGGACTCCA-CGAGGTAGTGA-CGAGAAATATCAATGCG-GGGCGCTTC-----GCGTC-TTGCTATTGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAG-AAGCGTATGC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATTTCTGGCGTGGG-AGCCCTGGCCTTTGCGCG--AATG-CGCTCTGTT-----TGCTGTGTGGCTCCTCTG-CCATCCTCGCCAGCCTTTT-----------------------GGTTGGCGGTCATTCACTGTAATTAAAGC-AGAGTGTTCC--AAGCAGGTCGTA----CGATCTGGATGTTTATTATGGGATGATCAGATAGGACTCGGG--TGCTATTTTGTTGGTTT-GCACATCTGAGTAA-TGATTAATAGGAACAG-TTGGGGGTATTCGTA-TTTAGGAGCT-AGAGGTGAAATTCTTGGATTTCCGAAAGACGAACTACAGCGAAGGCATTTACCAAGCA---TGTTTTCATTAATC-AAGAACG-AAAGTCTGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTAGACCGTAAACGATGCCGACT-TGCGATTGCGGGGCGTTTG--------TATTGGACCCTCGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGGTGAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCGGCCTACTAAATA--GCGACGGG-TATGGCGACATACCTGGGTCT---GCTTCTTAGAGGGAC-ATGTTCGGTTTACG--AGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAACGGGTCTTTTCGCTG--------------CTTGCAGCGAGTTGCTTTGCCGGAAGGCATGGC-TAATCCTTTCAACGCTCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACCATGGGATGACCTTTTGAGCGTTTATTCGCGATGGAGG------TCAGAACTCGGGTGAATCTTATTGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCC--------------------------- Aurantiochytrium_sp._N1_27 ----------------------------TACGCTCG-TCTCAAAGACTAAGCCATGCATGTGTAAGTATAAGCGA----ATACTGTGAAACTGCGAACGGCTCATTATATCAGTTATAATTTCTTCGGTAGTTTCT-------TT-AC-TGGATACTTGCAGTAATTCTAGAACTAATACATGCT-GTAAGGGCCCGACTGCTTG----CGGGAGGGCCGCACTTATTATAATTG-AAGCCAAC-----TTTATTGGTGAGTCATGATACTTTGGTGAGTCATGATAATTCCGCCGCCCTGG-------TCGCCTTTTTGAGCGATGAATCGTT-TGAGTTTCTGCCCCATCAGTTGTCGACGGTAGTGTATTGGACTACGGTGA-CTATAACGGGTGAC--GGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATCTCAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATGTGGACTCCATCGAGGTAGTGAGCGAGAAATATCAATGACGGGGCACTT------CGTGTCTTGCTATTGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAAGCTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-CTAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATTTCTGGCGTGGG-AGCCCTGGCCTTTGCGCG--AATG--CGCTCTGT-TTGCTG---TGT-GGCTCCTCTGCCATCCTCGCCAGCCTTTGGTT-------------------------GGCGTCATTCACTGTAATTAAAGC-AGAGTGTTCCCAAAGCAGGTCGTA--TGATCTGGGAGTT--TATTATGGGATGATCAGATAGGACTCGGG--TGCTATTTTGTTGGTTT-GCACATCTGAGTAA-TGATTAATAGGAACAG-T--GGGGTATTCGTA-TTTAGGAGCT-AGAGGTGAAATTCTTGGAT-TCCGAAAGACGAACTACAGCGAAGGCATTTACCAAGCA---TGTTT-CATTAATC-AAGAACG-AAAGTCTGGG-ATCGAAGA-TGATTAGATACCATCGTAGTCTAGACCGTAAACGATGCCGACT-TGCGATTGCGGGC-GTTTGTAT-----TGGACCT---TCGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGG--CTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGG-TAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCGGCCTACTAAATA--GCGACGGG-TATGGCGACATA--CCTGGGTCTG-CTTCTTAGAGGGAC-ATGTTCGGTTTACG--AGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAACGGGTCTTTTC--------------GCTGCTCGCAGCGAGTTGCTTTGCCGGAAGGCATGGC-TAATCCTTTCAACGCTCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACCATGGGATGACCTTTTGAGCGTTTATTCGCGATG----GAGTCG------------------------------------------------------------------------------------ Aurantiochytrium_sp._SEK209 ------------------------------------------AAGATTA-GCCATGCATGTGTAAGTATAAGCGA--TTATACTGTGAAACTGCGAACGGCTCATTATATCAGTTATAATTTCTTCGGTAGTTT--------CTTTACATGGATACCTGCAGTAATTCTGGAATTAATACATGCT-GTAAGGGCCCGACTGCTTGC----GGGAGGGCCGCACTTATTAGAATTG-AAGCCAAC-----------------------TTTATTGGTGAGTCATGATAATTTCGCAGATCGC-----------TCTTTT-GAGCGATGAATCGTT-TGAGTTTCTGCCCCATCAGTTGTCGACGGTAGTGTATTGGACTACGGTGA-CTATAACGGGTGAC--GGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCAC?TC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATGTGGACTCCA-CGAGG?AGTGA-CGAGAAATATCAATGCG-GGGCCACTC-----G?GTC-TTGCTATTGGAATGAAAGCAATGTAAAACCCTCATCAAGGATCAA-CTG?AGGGCAAGTCTGG?GCCAGCAGCCGCGGAAATT-CCAG-CTCCAA-AAGCGTATGC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATTTCTGGCGTGGG-AGCCCTGGCCTTTGCGCG--AATG-CGCTCTGTT-----TGCTGTGGGGCTCCTCTG-CCATCCTCGCCAGCCTTTT-----------------------GGTTGGCG-TCATTCACTGTAATTAAAGC-AGAGTGTTCC--AAGCAGGTCGTA----TGATCTGGATGTTTATTATGGGATGATCAGATAGGACTCGGG--TGCTATTTTGTTGGTTT-GCACATCTGAGTAA-TGATTAATAGGAACAG-TTGGGGGTATTCGTA-TTTAGGAGCT-AGAGGTGAAATTCTTGGATTTCCGAAAGACGAACTACAGCGAAGGCATTTACCAAGCA---TGTTTTCATTAATC-AAGAACG-AAAGTCTGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTAGACCGTAAACGATGCCGACT-TGCGATTGCGGGGCGTTTG--------TATTGGACCCTCGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGG-TAGGAT-GACAGAT-GAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCGGCCTACTAAATA--GCGACGGG-TATGGCGACATACCTGGGTCT---GCTTCTTAGAGGGAC-ATGTTCGGTTTACG--AGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAACGGGTCTTTTCGCTG--------------CTCGCAGCGAGTTGCTTTGCCGGAAGGCATGGC-TAATCCTTTCAACGCTCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACCATGGGATGACCTTTTGAGCGTTTATTCGCGATGGAGG------TCAGAACTCGGGTGAATCTTATTGTT-AGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGAA-------------------- Aurantiochytrium_sp._SEK217 ------------------CCAGTAGCCCTACGCT-CGTCTCAAAGACTAAGCCATGCATGTGTAAGTATAAGCGAA-TTATACTGTGAAACTGCGAACGGCTCATTATATCAGTTATAATCCCTTCGGTAGTT--------CCTTTACACGGATACCTGCAGTAATTCTGGAATTAATACGTGCT-GTACGGGCCCGACTTTC------GGGGAGGGCCGCACTTATTAGGTCT--AAGCCAAC-----------------------GTTCTTGGTGAGTCATGATAATTGAGCAGATCGC------------TTTTCGGAGCGATGAATCGTT-TGAGTTTCTGCCCCATCAGTTGTCGACGGTAGGGTATTGGCCTACGGTGA-CTATAACGGGTGAC--GGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATGTGGACTCCA-CGAGGTAGTGA-CGAGAAATATCAATGCGGGGCGCTT------CGCGTC-TTGCTATTGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCA?CA?CCGCGGTAATT-CCAG-CTCCAG-AAGCGTATGC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATTTCTGGTGTGGG-AGCCCAGGCCTCGGTG?G--AATG-CGCCTTGTA----TTGCCTTGCGGCTCCCTTG-CCATCCTCGTTTTTCTTTT----------------------GAAG?AC--GTCATTCACTGTAATCAAAGC-AGAGTGTTCC--AAGCAGGCCGTA----GGGCCGGTATGTTTATTATGGGATGATCAGATAGGACTCGGG--TGCTATTTTGTTGGTTT-GCACATCTGAGTAA-TGATTAATAGGAACAG-TCGGGGGTATCCGTA-TTTAGGAGCT-AGAGGTGAAATTCTTGGATTTCCGAAAGACGAACTACAGCGAAGGCATTTACCAAGCA---TGTTTTCATTAATC-AAGAACG-AAAGTCTGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTAGACCGTAAACGATGCCGACT-TGCGATTGCGGG??GCTTG--------TATTGGGCTTCCGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGG-TAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCGGCCTACTAAATA--GCCGGGCG-TATGGCGACATATGTGTTTGTG--GCTTCTTAGAGGGAC-ATGTTCGGTTTACG--AGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCCTTA?ATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAGCGGGTCTTTGTTGTGTTT------------ACTCACAGCGTTGCTTTGTCGGAAGGCATGGC-TAATCCTTTGAACGCCCATCGTGCTGGGGCTAAATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACCATGGGACTACCTTTTGAGCGTTTGTTCCCAATGGAGG------GGGGAACTCGGGTGAATCTTATTGTTTAAAGGAAGG?GAAGTCGTAACAAGGTTTCCGTAGGTGA?CCT?GCGGAA?GG----- Aurantiochytrium_sp._SEK218 ---------------CTGCCAGTAGCCCTACGCT-CGTCTCAAAGACTAAGCCATGCATGTGTAAGTATAAGCGAA-TTATACTGTGAAACTGCGAACGGCTCATTATATCAGTTATAATCCCTTCGGTAGTT--------CCTTTACACGGATACCTGCAGTAATTCTGGAATTAATACGTGCT-GTACGGGCCCGACTTTC------GGGGAGGGCCGCACTTATTAGGTCT--AAGCCAAC-----------------------GTTCTTGGTGAGTCATGATAATTGAGCAGATCGC------------TTTTCGGAGCGATGAATCGTT-TGAGTTTCTGCCCCATCAGTTGTCGACGGTAGGGTATTGGCCTACGGTGA-CTATAACGGGTGAC--GGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATGTGGACTCCA-CGAGGTAGTGA-CGAGAAATATCAATGCGGGGCGCTT------CGCGTC-TTGCTATTGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAG-AAGCGTATGC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATTTCTGGTGTGGG-AGCCCAGGCCTCGGTGCG--AATG-CGCCTTGTA----TTGCCTTGCGGCTCCTTTG-CCATCCTCGTTTTTCTTTT----------------------GAAGAAC--GTCATTCACTGTAATCAAAGC-AGAGTGTTCC--AAGCAGGCCGTA----GGGCCGGTATGTTTATTATGGGATGATCAGATAGGACTCGGG--TGCTATTTTGTTGGTTT-GCACATCTGAGTAA-TGATTAATAGGAACAG-TCGGGGGTATCCGTA-TTTAGGAGCT-AGAGGTGAAATTCTTGGATTTCCGAAAGACGAACTACAGCGAAGGCATTTACCAAGCA---TGTTTTCATTAATC-AAGAACG-AAAGTCTGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTAGACCGTAAACGATGCCGACT-TGCGATTGCGGGTGGCTTG--------TATTGGGCTTCCGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGG-TAGGAT-GACAGAT-GAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCGGCCTACTAAATA--GCCGGGCG-TATGGCGACATATGTGTTTGTG--GCTTCTTAGAGGGAC-ATGTTCGGTTTACG--AGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCCTTAAATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAGCGGGTCTTTGTTG?GTTT------------ACTCACAGCGTTGCTTTGTCGGAAGGCATGGC-TAATCCTTTGAACGCCCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACCATGGGACTACCTTTTGAGCGTTTGTTCGCGATGGAGG------TGGGAACTCGGGTGAATCTTATTGT----------------------------------------------------------- Bacillaria_paxillifer -AACCTGGTTGAT-CCTGCCAGTAGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTATA---AATCTTTTACTTTGAAACTGCGAACGGCTCATTATATCAGTTATAGTTTATTTGATAGTCCCT------TACTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATGC--GTCAATACCCT-TCTG------------GGGTAGTATTTATTAGATTG--AAACCAACCT---------------TCGGGGTGATGTGGTGATTCATAATAAGCTTG-CGGATCGCA------TGGCGTATGCCGGCGATGGATCATT-CAAGTTTCTGCCCTATCAGCTTTGGATGGTAGGGTATTGGCCTACCATGG-CTTTAACGGGTAAC--GGGAAATTAGGG-TTTGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATCCTGACACAG-GGAGGTAGTGA-CAATAAATAACAATGCC-GGGCCT----TTGTAGGTC-TGGCAATTGGAATGAGAACAATTTAAATCCCTTATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGGATTTGTGGC-TGTCGCGTGCGGCGTGACACTTTTGTGTTATCGCT-----TGCT-T-GCGTC--GCCAT-CC--TTGGGTGGA-ACCTGTGTGGCATTAGGTTGTCGTGC--AGGGGATGCCCATCATTTACTGTGAAAAAATT-AGAGTGTTCA--AAGCAGGC-TTAT--GCCGTTGAATATATTAGCATGGAATAATAAGATAGGACCTTGG--TACTATTTTGTTGGTTT-GCGCACCGAGGTAA-TGATTAATAGGGACAG-TTGGGGGTATTCGTATTCCATTG-T-CAGAGGTGAAATTCTTGGATTTTTGGAAGACGAACTACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCATAAACTATGCCGACA-AGGGATTGGCGGA-GTCTC-------GTTT-TGTCTCCGTCA-GCACCTTA-TGAGAAATCACAAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGAAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGT-GAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCCCTGCCTGCTAA-ATAGCTTACCGAGTGAATGT-TCACTGGGT----GAAGCTTCTTAGAGGGACGTGCATTCTATTAGA--TGCAGGAAGATAGGGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCCGCACGCGCGCTACACTGATGCATTCAACGAGTTTAA---------------------------------CCTTGGCTGAGAAGCCTGGG-CAATCTTTTGAACGTGCATCGTGATAGGGATAGATTATTGCAATTATTAATCTTGAACGAGGAATTCCTAGTAAACGCAGATCATCAATCTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAGCCTCGGGATTGTGGCGAGTTCCCTTTATTGGGAGTTTG----TCGCGAGAACTTGTCTAAACCTTATCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCAGAAGGATCAAGC Botryochytrium_radiatum_Raghukumar_16 -------TGGTTGATCCTGCCAGTAATCATACGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAAGGA--TTTAATACTGAGACTGCGAACGGCTCAAGACAACAGTTATCGTTTCTTTGATAGTGTTTT------GTTAGATGGATACTTGTGGCAAATCTAGAAACAATACATGC--TTGAAGGCCTGACTTTTG------GGGAGGGCTGCATTTATTTGATTG--AAACCAATAC----------CTTTCGGGG-TTGTTTGGGTGAGTCAGAATAACTAAGCGAATCGCAT----------TT----GGGCGATGAATCATT-CAAGTTTCTGCCCCATCAGTTGTCGACGGTAGTGTATTGGACTACCGTGA-CAGTAACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACT-CAATGTCA-ATTCGACGAAGTAGTGA-CGAGAAATAACAATGAGGAGCG-------CATCGGTTTTCTCGATTGGAATGAGAGCAATTTAAAAACCTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAACTGTTGATGTGAGTGCGATACTTT-CGGGATG--AATGTC-CGAGAT---GGCGTGTTGTGCTTGTG-----TCAT-TTTC------ATTTGCGTTTTG-----------------------ATCATTTACTGTAAAAAAATT-AGAGTGT-CC--AAGCAGGATGTA-TGTCC-GGAATATAG-TAGTATGGAATAATAAGATAGGACTTTGG--TACTATTT-GTTGGTTT-GTATACCAAGGTAA-TGATTAATAGG-ACAG-TTGGGG-TAT-CGTA-TT-AGA-G-TCAGAGTG??????????????????AAAGACGAACAACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCGTAAA-CTATGCCGACTTGCGATTGTCTCTTTATCTT--------ATA-GAGGGAGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GCGTTGTG-AATGGTGACATTC----ATGATGAGCTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACGAGTTATTCTTGTTC---------TTTTAGGAATGAGAAGTCCTTGGCCGGAAGGTCTGGG-TAATCTTTTGAACGCCGATCGTGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATC-GCTTGCATTGATTACGTCCCTGCCCTTTGTA-ACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAGACCTTGGGATTCTATGTTGATTGATTTATTTTGATTGATGT----------------------------------------------------------------------------------------- Botryochytrium_radiatum_SEK353 ------------------------------------------------------------------------------------CTGAGACTGCGAACGGCTCAAGACAACAGTTATCGTTTCTTTGATAGTGTTTT------GTTAGATGGATACTTGTGGCAAATCTAGAAACAATACATGC--TTGAAGGCCTGACTTT{AT}{AG}------GGGAGGGCTGCATTTATTTGATTG--AAACCAATAC----------CTTTCGGGG-TTGTTTGGGTGAGTCAGAATAACTAAGCGAATCGCAT----------TT----GGGCGATGAATCATT-CAAGTTTCTGCCCCATCAGTTGTCGACGGTAGTGTATTGGACTACCGTGA-CAGTAACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACT-CAATGTCA-ATTCGACGAAGTAGTGA-CGAGAAATAACAATGAGGAGCG-------CATCGCGTTTCTCGATTGGAATGAGAGCAATTTAAAAACCTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAACTGTTGATGTGAGTGCGATAGCTTTCGGGATG--AATGTCTCGAGAT---GGCGTGTTTTGCTTGTG-----TCATACTTTGCTTTCATTTTTGTGTGAAGGCA------------------ATCGTTTACTGTAAAAAAATT-AGAGTGTTCC--AAGCAGGATGTA-TGTCC-GGAATATAG-TAGTATGGAATAATAAGATAGGACTTTGG--TACTATTTTGTTGGTTT-GTATACCAAGGTAA-TGATTAATAGGGACAG-TTGGGGGTATTCGTA-TTTAGATG-TCAGAGGTGAAATTCTTGGATTTTCGAAAGACGAACAACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCGTAAA-CTATGCCGACTTGCGATTGTCTCTTTATCTT-------CTAAAGAGGGAGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GCGTTGTG-AATGGTGACATTC----ATGATGAGCTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACGAGTTTTTCTTGTTC---------TTTTAGGAATGAGAAGTCCTTGGCCGGAAGGTCTGGG-TAATCTTTTGAACGCCGATCGTGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAGACCTTGGGATTCTATGTTGATTGATTTATTTTGATTGATGT----GGAAGAACTTGAGCAAACCTTATCGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCC--------------------------- Botryochytrium_sp._BUTRBC_143 -------TGGTTGATCCTGCCAGTAATCATACGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAAGGA--TTTAATACTGAGACTGCGAACGGCTCAAGACAACAGTTATCGTTTCTTTGATAGTGTTTT------GTTAGATGGATACTTGTGGCAAATCTAGAAACAATACATGC--TTGAAGGCCTGACTTTTG------GGGAGGGCTGCATTTATTTGATTG--AAACCAATAC----------CTTTCGGGG-TTGTTTGGGTGAGTCAGAATAACTAAGCGAATCGCAT----------TT----GGGCGATGAATCATT-CAAGTTTCTGCCCCATCAGTTGTCGACGGTAGTGTATTGGACTACCGTGA-CAGTAACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACT-CAATGTCA-ATTCGACGAAGTAGTGA-CGAGAAATAACAATGAGGAGCG-------CATCGGTTTTCTCGATTGGAATGAGAGCAATTTAAAAACCTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAACTGTTGATGTGAGTGCGATACTTT-CGGGATG--AATGTC-CGAGAT---GGCGTGTTGTGCTTGTG-----TCAT-TTTC------ATTTGCGTTTTG-----------------------ATCATTTACTGTAAAAAAATT-AGAGTGT-CC--AAGCAGGATGTA-TGTCC-GGAATATAG-TAGTATGGAATAATAAGATAGGACTTTGG--TACTATTT-GTTGGTTT-GTATACCAAGGTAA-TGATTAATAGG-ACAG-TTGGGG-TAT-CGTA-TT-AGA-G-TCAGAGTGGAAATTCTTGGATTTACAAAAGACGAACAACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCGTAAA-CTATGCCGACTTGCGATTGTCTCTTTATCTT--------ATA-GAGGGAGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GCGTTGTG-AATGGTGACATTC----ATGATGAGCTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACGAGTTATTCTTGTTC---------TTTTAGGAATGAGAAGTCCTTGGCCGGAAGGTCTGGG-TAATCTTTTGAACGCCGATCGTGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATC-GCTTGCATTGATTACGTCCCTGCCCTTTGTA-ACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAGACCTTGGGATTCTATGTTGATTGATTTATTTTGATTGATGT----------------------------------------------------------------------------------------- Botryochytrium_sp._Raghukumar_29 ------CTGGTTGATCCTGCCAGTAATCATACGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAAGGA--TTTAATACTGAGACTGCGAACGGCTCAAGACAACAGTTATCGTTTCTTTGATAGTGTTTT------GTTAGATGGATACTTGTGGCAAATCTAGAAACAATACATGC--TTGAAGGCCTGACTTTTA------GGGAGGGCTGCATTTATTTGATTG--AAACCAATAC----------CTTTCGGGG-TTGTTTGGGTGAGTCAGAATAACTAAGCGAATCGCAT----------TT----GGGCGATGAATCATT-CAAGTTTCTGCCCCATCAGTTGTCGACGGTAGTGTATTGGACTACCGTGA-CAGTAACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACT-CAATGTCA-ATTCGACGAAGTAGTGA-CGAGAAATAACAATGAGGAGCG-------CATCGCGTTTCTCGATTGGAATGAGAGCAATTTAAAAACCTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAACTGTTGATGTGAGTGCGATACTTT-CGGGATG--AATGTCTCGAGAT---GGCGTGTTGTGCTTGTG-----TCATACTTC------ATTTGGTTTTTTGCAT---------------GAT-ATCGTTTACTGTAAAAAAATT-AGAGTGT-CC--AAGCAGGATGTA-TGTCC-GGAATATAG-TAGTATGGAATAATAAGATAGGACTTTGG--TACTATTTTGGTTGGTT-GTATACCAAGGTAA-TGATTAATAGGGACAG-TTGGGGGTATTCGTA-TTTAGATG-TCAGAGGTGAAATTCTTGGATTT-CGAAAGACGAACAACTGCGAAAGCATTTACCAAGGA---TGTTT-CATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCGTAAA-CTATGCCGACTGGCGATTGTCTCTTTATCTT--------ATAAGAGGGAGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GCGTTGTG-AATGGTGACATTC----ATGATGAGCTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACGAGTTTTTCTTGTTC---------TTTTAGGAATGAGAAGTCCTTGGCCGGAAGGTCTGGG-TAATCTTTTGAACGCCGATCGTGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAGACCTTGGGATTCTATGTTGATTGATTTATTTTGATTGATG------------------------------------------------------------------------------------------ Japonochytrium_sp._ATCC_28207 ------------------------------------------AAGACTAAGCCATGCATGTCTAAGTATAAGCGAT-TTATACGGTGAAACTGCGAACGGCTCATTAAAACAGTTATAGTTTCTTTGAAAATGTTTG------ATTAGATGGATACTTGTGGCAAATCTAGAAATAATACATGC--TTTAGGGCCCGACTTTTG------GGAAGGGCTGCATTTATTAGATAT--AAACCAATACC----------TCTCGGGG-TTGTTTTGGTGATTCATAGTAACTAGGCGAATCGCAGAG----GTGTTTGTGCCGGCGATGT-TCATT-CAAGTTTCTGCCCCATCAATTGTCGATGGTAGGGTATTGGCCTACCATGA-TTGTTACGGGTGAC--GGAGAATCAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACT-CAATGTCA-ATTCGACGAAGTAGTGA-CGAGAAATAACAGTGGGGTGGG------CTAAGCCTACTCTTT-CTGTAATGAGAGCAATCTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAACT-CCAG-CTCCGGT-AGCGTGTAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAGTATTGGTAGGACGGACCAGGC-TTTTCGGCG--AATGCTGAGGTATGCTTTTGT----GTTTGATC--TGGCCATGGTTGCTCGTTTGCGCCTTTGGGCGTGGGT------------GGGCATCATTTACTGTAAAAAAATT-AGAGTGTTTC--AAGCAAATCGTAT--GGTTGGAATAGAG-TAGTATGGAATAATAAGATAGGACTTTGT--TGCTATTTTGTTGGTTT-GCACATCAAAGTAA-TGATTAACAGGGACAG-TTGGGGGTATTCGTA-TTTGGTTG-TCAGAGGTGAAATTCTTGGATTTACAAAAGACGAACAACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCT-TACCGTAAA-CGATGCC-ACTTGCGATTGTCCGATGTTTTTTTTT----AATAGACTTGGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAA--CTTAAAGGAATT-ACGGAAGGGCA--CCACCAGGAG---TGG-GCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGTCCAGA--CATAGGA-AGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCT--GTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GTACGTGC-TATGGTGACATA---GTG-GCGAGACTTCTTAGAGGGAC-ATTTCGGTTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGATTCAACGAGTATGTGTTGTTTG------TTTAACGATGAATGACGGTCCTAGACAGGAATGTCCGGG-CAATCTTTTAAATGTCCATCGTGATGGGGCTAGATTTTTGCAATTCTTAATCTCCAACGAGGAATTCCTAGTAG--------CATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAAATCTTCGGATCCTGTTGTTTTGCGTTTGTT-CGTGTGATG-ACGGG--AAAAGTTGAGTAAACCTTATCGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGTGACCTGCA-------------- Labyrinthula_sp._AN1565 ------CTGGTGATCCTGCCAGTAGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTACAAGC-AC-TTGTATTGTGAAACTGCGAATGGCTCATTAAAACAGTTATAGTTTATTTGATAAATTT---------CTACATGGATAACCGTAGTAATTCTAGAGCTAATACATGA-------GTCCGC--------------AAGGAGC---ATTTATTAGACATT---ACCAACACGGG-----------CAACCGTATTCAAGGTGAGTCATAATAACTAAGCATATCGTG----------------CAAACGAAGAATCATT-CAAGTTTCTGACCTATCAGCTGTAGATGGTAGAGTATTGGCCTACCATGG-CGTTCACGGGTAAC--GGAGAATTAGGG-TTCGGTTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACC-CAATCCTG-ACACGGGGAGGTAGTGA-CAAGAAATAACAATACGAAACC--------ACTTGGTTTTGTAATTGGAATGAGTACAATGTAAAACCTTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAATTCTAGACAACGGCCGCAATTGTT----------------------TCAATCGCAGGCTTGAGTCTA-TTCTCACGA-AGAAGCTATCGCTCATTAACTTGGGTGGTAGC---GGAGACGTGTCGTTTACTGTGAACAAATT-AGGGTGTTTA--AAGCAGACCTC---TGTT-TGCATACAT-TAGCATGGAATAATTAGATATGACTTTGG--TTGTATTTTGTTGGTGA---CTGCCAGAGTAA-TGATTGATAGGAACTG-TCGTGGGTATTCGTA-TGAGCATG-TCAGAGGTGAAATTCTTGGATTTTGATCAGACGAACTACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCATAAA-CTATGCCGACTAGGGATTGGTGAACGT----------AGAATAAACGTCATCA-GTACCTCG-CGAGAAATCA-AAGTC-TTTGGGTTCT-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCGGA-CATGAG-AAGGATTGACAGATTGAGA-GCTCTTTCAT-GATTTTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTGATTCCGTTAACGAACGAGACCTCAGCCTGCTAAATAGGCAGCGCA--TTCTTGAATG--------T-GATGGCTTCTTAGAGGGAC-TTTCCGGGTCTACC--GGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACAATGACAGAGTCAGCGAGCTCT----------------------------------CCTGTATCGAAAGGTATGGG-GAATCTTTTCAGTCTCTGTCGTGATGGGGCTAGACCCTTGTAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCAGGTCATTAACCTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAGTC-T----------------------------------------------------------------------------------------------------------------------------- Labyrinthula_sp._L59 -----------ATCC-TGCCAGTAGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTACAAGC-AC-TTGTATTGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAAAACC--------ACTACATGGATAACCGTAGTAATTCTAGAGCTAATACATGCA----AA--CCCT-------------TCGGGGGC---ATTTATTGGATAC---AACCAACAC-----------------TCGAAAGC-TGGTGAGTCACGATAAATTAGCATATCGCG----------------TA-GCGATGAATCATT-CAAGTTTCTGCCCTATCAGCTGTAGATGGTAGAGTATTGGCCTACCATGG-CGTTAACGGGTAAC--GGGGAATTAGGG-TTCGGTTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACC-CAATCCTG-ACACGGGGAGGTAGTGA-CAAGAAATAACAATACGGAGCC--------TTATGGTTTTGTAATTGGAATGAGTACAATCTAAAACCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAATTTTAGCGCGGTGAGCCCTCTACAATGTA-----------------GCAGCG-GCTCTCCGGGCTAA-TACTCGCAA-AGAAGCCTGTGCTCATTAACTTGGGCGCAGGT---TGAGTTGCGTCGTTTACTGTGAACAAATT-AGGGTGTTTA--AAGCAGGCCTA---CGTT-TGAATACAT-TAGCATGGAATAATGAGATATGACTTTGG--TCGTATTT-GTTGGTGA---CTGCCGGAGTAA-TGATTGACAGGAACTG-TTGTGGGTATTCGTA-TGAGCATG-TCAGAGGTGAAATTCTTGGATTTTGATCAGACGAACTACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCATAAA-CTATGCCGACTAGGGATTGGTGGATGT----------GAAAACGACATCATCA-GTACCTCG-TGAGAAATCA-AAGTC-TTTGGGTTCT-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCGGA-CATAAGTAGG-ATTGACAGATTGAGA-GCTCTTTCAT-GATTTTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCAGCCTACTAAATAGTCCGCGCAT-TTTCGCAATG--------T-GATGACTTCTTAGAGGGAC-ATTTCGGTTCTACC--GAAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACAATGACAGAATCAACGAGTTCAT---------------------------------CCTTTGCTGACAAGCACAGG-TAATCTTTTCAGTTTCTGTCGTGATGGGGATAGACCCTTGTAATTGTTGGTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATTAACTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAGTCTTCGGACCGCTGCGCGTCCTCTGGAA-G---------GCGCAACGGGAAGTTGAGTAAACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTTGC------------ Labyrinthula_sp._L72 TTACCTGGTTGATTCCTGCCAGTAGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTACAAGC-AC-TTGTATTGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAAAACC--------GCTACATGGATAACCGTAGTAATTCTAGAGCTAATACATGCA----ATT--CCTGGCA--------ACAGGAGGC---ATTTATTGGATAT---AACCAACACGGC----------CTAGCCGAAAACCTGGTGAGTCACGATAAGTTAGCATATCACG----------------TATGTGATGAATCATT-CAAGTTTCTGCCCTATCAGCTGTAGATGGTAGAGTATTGGCCTACCATGG-CGTTAACGGGTAAC--GGGGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACC-CAATCCTG-AAACGGGGAGGTAGTGA-CAAGAACTAACAATACGGAGCC--------TTTTGGTTTTGTAATTGGAATGAGAACAATCTAAAACCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAATTTTAGGTCGG-GAACCGGCTGCTTTCGC-----------------ACGCTG-CGTTCCTGAACTGA-TACTCGCAA-AGAAGCTTTCACCCATTAGTTTGGGTGTCTGC---CGAGTTGCGTCGTTTACTGTGAACAAATT-AGGGTGTTTA--AAGCAGGCCTA---CGTT-TGAATACAT-TAGCATGGAATAATGAGATATGACTTTGA--TTGTATTTTGTTGGTGA---CCGTCAAAGTAA-TGATTGATAGGAACTG-TTGTGGGTATTCGTA-TGAGCATG-TCAGAGGTGAAATTCTTGGATTTTGATCAGACGAACTACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTTACCCTAAA-CTATGCCGACTAGGGATTGGTGAATGTATT---------CAATGACATCATCA-GTACCTCG-TGAGAAATCA-AAGTC-TTTGGGTTCT-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAA---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCGGA-CATAAGTAGGCATTGACAGATTGAGA-GCTCTTTCAT-GATTTTATGGGTGG-TGGTT???-GCC-GATC?GAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCAGCCTACTAAATAGACCTGGCAT-TTTCATAATG--------TCGAGGACTTCTTAGAGGGAC-TTTTCGGTTCTACC--GAAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACAATGACAGAATCAGCGAGTTCAT---------------------------------CCTTTGCCGACAGGCACAGG-TAATCTTTTCAGTTTCTGTCGTGATGGGGCTAGACCCTTGCAATTGTTGGTCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATTAACTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAGTCTTCGGACCGAAGTGCATCCTTCGGGACA---------GCACAGCGGGAAGTTGAATAAACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGAT------------------------------ Labyrinthula_sp._N12 ----------------------TAGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGC-A-TTTATACTGTGAAACTGCGAATGGCTCATTAAAACAGTTATAGTTTATTTGATAAATTT---------CTACATGGATAACCGTAGTAATTCTAGAGCTAATACATGA-------GTCCCTC--------------GGGAGC---ATTTATTAGACTGT---ACCAGCACGG-----------TTTACCGTTCTAAAGGTGAGTCACAATAACTAAGCATATCGCGT----------------AAGCGAAGAATCATT-CAAGTTTCTGACCTATCAGCTGTAGATGGTAGTGTATTGGACTACCATGG-CGTTAACGGGTAAC--GGAGAATTAGGG-TTCGGTTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACC-CAATCCTA-ATACGGGGAGGTAGTGA-CAAGAAATAACAATACGAGACC--------TTTTGGTTTTGTAATTGGAATGAGTACAACATAAAACCTTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAGATCTGG-GTGAAGGCCGTGTCATTGACAC-------------------------TAGGCCGGACCCC-TATTCACGA-GGAAGCCTTAGTGCATTAACTTGTGCTTTGGT---CGATTCGTGTCGTTTACTGTGAACAAATT-AGGGTGTTTA--AAGCAGACCT----CTGTTTGTATACAT-TAGCATGGAATAATTAGATATGACTTCAG--TTATATTTTGTTGGTGA---TAACTAAAGTAA-TGATTGATAGGAACAG-TCGTGGGTATTCGTA-TGAGCATG-TCAGAGGTGAAATTCTTGGATTTTGATCAGACGAACTACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCATAAA-CTATGCCGACTAGGGATTGGTAGACGTAG----------CTTAAACGCTATCA-GTACCTCG-CGAGAAATCA-AAGTC-TTTGGGTTCT-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCGGA-CATAAG-AAGGATTGACAGA?TGAGA-GCTCTTTCAT-GATTTTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTGATTCCGTTAACGAACGAGACCTCAGCCTGCTAAATAGTTATGCTA--TTCTTGAATA--------GCTTAG-CTTCTTAGAGGGAC-TTTCCGGGTCTACT--GGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACAATGGCAAAGTCAGCGAGTCT-----------------------------------CCTTTACCGAAAGGTATAGG-AAATCTTTTCAGTCTTTGCCGTGATGGGGCTAGACCCTTGTAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCAGGTCATTAACCTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAGTCTCCGGAACGAGTACTTTC-------------------AGTACTTGTGAAGTTGACTAAACCTTACTATTTAGAGGAAGGTGAAGTCGCAACAAGGTTTCC--------------------------- Labyrinthula_sp._N8 ----------------------TAGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGC-A-TTTATACTGTGAAACTGCGAATGGCTCATTAAAACAGTTATAGTTTATTTGATAAATTT---------CTACATGGATAACCGTAGTAATTCTAGAGCTAATACATGA-------GTCCCTC--------------GGGAGC---ATTTATTAGACTGT---ACCAGCACGG-----------TTTACCGTTCTAAAGGTGAGTCACAATAACTAAGCATATCGCGT----------------AAGCGAAGAATCATT-CAAGTTTCTGACCTATCAGCTGTAGATGGTAGTGTATTGGACTACCATGG-CGTTAACGGGTAAC--GGAGAATTAGGG-TTCGGTTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACC-CAATCCTA-ATACGGGGAGGTAGTGA-CAAGAAATAACAATACGAGACC--------TTTTGGTTTTGTAATTGGAATGAGTACAACATAAAACCTTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAGATCTGG-GTGAAGGCCGTGTCATTGACAC-------------------------TAGGCCGGACCCC-TATTCACGA-GGAAGCCTTAGTGCATTAACTTGTGCTTTGGT---CGATTCGTGTCGTTTACTGTGAACAAATT-AGGGTGTTTA--AAGCAGACCT----CTGTTTGTATACAT-TAGCATGGAATAATTAGATATGACTTCAG--TTATATTTTGTTGGTGA---TAACTAAAGTAA-TGATTGATAGGAACAG-TCGTGGGTATTCGTA-TGAGCATG-TCAGAGGTGAAATTCTTGGATTTTGATCAGACGAACTACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCATAAA-CTATGCCGACTAGGGATTGGTAGACGTAG----------CTTAAACGCTATCA-GTACCTCG-CGAGAAATCA-AAGTC-TTTGGGTTCT-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCGGA-CATAAG-AAGGATTGACAGATTGAGA-GCTCTTTCAT-GATTTTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTGATTCCGTTAACGAACGAGACCTCAGCCTGCTAAATAGTTATGCTA--TTCTTGAATA--------GCTTAG-CTTCTTAGAGGGAC-TTTCCGGGTCTACT--GGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACAATGGCAAAGTCAGCGAGTCT-----------------------------------CCTTTACCGAAAGGTATAGG-AAATCTTTTCAGTCTTTGCCGTGATGGGGCTAGACCCTTGTAATTATTGGTCTCCAACGAGGAATTCCTAGTAAACGCAGGTCATTAACCTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAGTCTCCGGAACGAGTACTTTC-------------------AGTACTTGTGAAGTTGACTAAACCTTACTATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCC--------------------------- Oblongichytrium_minuta -----TGGTTGATCC-TGCCAGTAGTCATACGCTCG-TCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCGAC-TTATACTGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGTAACT------TTCTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATGC--ACTAAGGCCTGACTTTTG-----TGGAAGGGCTGTATTTATTAGATAC--AAACCAATGCGGTG-------CTTGCACCGGTATTGTGGTGAGTCATAGTAACTAAGCGAATCGTAT-----GGCCTTTGCGCTGACGATGAATCATT-CAAGTTTCTGCCCTATCAGCTGTCGATGGTAGGGTATTGGCCTACCATGG-CGTTAACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATCCTA-ATACGGGGAGGTAGTGA-CAAGAAATAACAATACGGGGCC---------TATGGTCTTGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAT-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGGATTTCTGACAGGAGCGACCGGT-CCG-ATCCTTT-GGGT-CGAG--TACTTTGTGT-TGTCTCTAGTCA-TCCTTATGG-AGAACGCTCGTGGTATTAAGTTATCGTGAGT---GGGAACCATATCGTTTACTGTG-AAAAATT--AAGTGTTTA--AAGCAGGCAAT---CGCTGTGAATACGT-TAGCATGGAATAATAAGATAGGACTTTGG--TACTATTTTGTTGGTTT-ACATACCAAGGTAA-TGATTAAGAGGGACAG-TTGGGGGTATTCGTA-TTTAATTG-TCAGAGGTGAAATTCTTGGATTTATGAAAGACGAACTACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCTTAAA-CCATGCCGACTAGGGATTGGTGGACGTTAATT-------GAACGACTTCATCA-GCACCTTA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCGGA-CATAGT-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAATA--GTATGCG--CTTTCTTTGGAAA----GCGTAAGACTTCTTAGAGGGAC-ATTTCGGTTTTACC--GAAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGAATTCAACGAGTTTATAA-------------------------------CCTTGGCTGAGAAGCCTGGGGTAATCTTTTAAACGTTCATCGTGATGGGGCTAGATTATTGCAATTATTAATCTTCAACGAGGAATTCCTAGTACACGCAAGTCATCAGCTTGCATGGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACTTACCGATTGAATGGTCCGGTGAAAACTTTGGACCGTGACTTTGCCTTTCTTTCGGGAAAGCGT-TGTCGTGGGAAGTTGTTTAAACCTTATCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGTGAACCTGC-------------- Oblongichytrium_multirudimentalis -----CCTGGTTGATCCTGCCAGTAGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTCTAAGTTTAAGCAA-TTTAAACTGTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGTACTT------TACTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATGC--GTCAACGCCCGACTGCTT----GCGGAAGGGCCGTATTTATTAGATTT--AAACCAATGCGG---------TTTCGCCCGGTATTGTGGTGAGTCATAATAACTAAGCGAATCGTAT-----GGCC-TTGTGCCGACGATGAATCATT-CAAGTTTCTGCCCTATCAGCTGTCGATGGTAGGGTATTGGCCTACCATGG-CGTTAACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATCCTA-ACACGGGGAGGTAGTGA-CAATAAATAACAATACGGGGCC-------ATTTTGGTCTTGTAATTGGAATGAGTACAATATAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGGATTTCTGACAGGAGCGACCGGTCTCGAATCCTTCGTGGTTCGTGTTTACTTTGTGTCCGTCTCTAGTCA-TCCTTACGG-AGAACGTGTGTGTCATTAAGTTGGCGTGCAT---GGGAACCGTATCGTTTACTGTGAAAAAATT-AGAGTGTTTA--AAGCAGGCAAT---CGCTGTGAATACAT-TAGCATGGAATAATAAGATAGGGCTTTGG--TACTATTTTGTTGGTTT-GTATACCAAGGTAA-TGATTAAGAGGGACAG-TTGGGGGTATTCGTA-TTTAATTG-TCAGAGGTGAAATTCTTGGATTTATGAAAGACGAACTACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCATAAA-CTATGCCGACTAGGGATTGGTGGACGTTATTT-------GAACGACTTCATCA-GCACCTTA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCG-CTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCAGA-CATAGT-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAATA--GTATGCC--TTTTCTCACGAAA---GGGTACTGACTTCTTAGAGGGAC-ATTTCGGTTTTACC--GGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGAATTCAACGAGTTTATAA-------------------------------CCTTGGCTGAGAAGCCTGGG-TAATCTTTTAAATGTTCATCGTGATGGGGATAGATTATTGCAATTATTAATCTTCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAATCTTTGGACCGTGACTTTGTCTTGCTTTCGGGCGAGACGCTGTTGTGGGAAGTTGATTAAACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAG----------------------- Oblongichytrium_sp._SEK347 ------------------CCAGTAGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAAC-TTATACTGCGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATAGTACTT------TTCTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATGC--GTCAAAGCCCGACTGCTT----GCGGAAGGGCTGTATTTATTAGATAT--AAACCAATGCGGG---------TTTACCCGGTATTGTGGTGAGTCATAATAACTAAGCGAATCGTAT-----GGCC-TTGCGCCGACGATGAATCATT-CAAGTTTCTGCCCTATCAGCTGTCGATGGTAGGGTATTGGCCTACCATGG-CGTTAACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATCCTA-ACACGGGGAGGTAGTGA-CAAGAAATAACAATACGGGGCC---------TTTGGTCTTGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAT-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGGATTTCTGACAGGAGCGACCGGT-CCG-AGCCTTC-GGGTTCGTG--TACTTTGTGT-TGTCTCTAGTCA-TCCTTATGG-AGAGCGTGTCTTTCATTAATTTGTTGGGCATA--GGGATCCATATCGTTTACTGTGAAAAAATT-AGAGTGTTCA--AAGCAGGCAAT---CGCTGTGAATATAT-TAGCATGGAATAATAGGATAGGACTTTGG--TACTATTTTGTTGGTTT-GCATACCAAGGTAA-TGATTAAGAGGGACAG-TTGGGGGTATTCGTA-TTTAATTG-TCAGAGGTGAAATTCTTGGATTTATGAAAGACGAACTACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCATAAA-CTATGCCGACTAGGGATTGGCGATCGTTATTT-------ATACGACCTCGTCA-GCACCTTA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCGGA-CATAGT-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAATA--GTATGCG--TTTTCTCACGAAA----GCGTAAGACTTCTTAGAGGGAC-ATTTCGGTTTTACC--GGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGAATTCAACGAGCTT-TAA-------------------------------CCTTGGCTGAGAAGCCTGGG-TAATCTTTTGAACGTTCATCGTGATGGGGATAGATTATTGCAATTATTAATCTTCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAATCTTTGGACCGTGGTATCGTCTTGCTTTCGGGCAAGACTTTGCCGTGGGAAGTTGATTAAACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAG----------------------- Ochromonas_danica -AACCTGGTTGAT-TCTGCCAGTAG-CATACGCT-TGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATCTTATAC-GTGAAACTGCGAATGGCTCATTATATCAGTTATAGTTTCTTTGATG-GTCCT------TGCTACTTGGATAACCGTAGTAATTCTAGAGCTAATACATGC---AGCAATCCCTGACT-------TAGGAAAGGGTGTACTTATTAGATAG--AAACCAATGGGGG-----------CAACCCTTTGTTTGGTGATTCATAGTAATTT--TCGGATCGATCTTC-----------GGATCGATGCATCATT-CAAGTTTCTGCCCTATCAGCTTTGGATGGTAGGGTATTGGCCTACCATGG-CATTAACGGGTAAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAAATGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATCCTGACACAG-GGAGGTAGTGT-CAATAAATAACAATGTT-GGGCCTTC------GGGTC-TGACAATTGGAATGAGAACAATTTAAATCCCTTATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAATTCTGATTTCGGATGTCGGTC--GGCCCCAAGGGGTTAGTACCGTC----TGTTCGGAATCATCCTCGAGA-GGAA-CACGTCTGTCATTCAGTTGATGGGCGTGGGATTCTC--------GTCTTTTACTGTGAGTAAACT-AGAGTGTTCA--AAGCAGACATCATGT-CAT-TGAATACGTTAGCATGGAATAATAAGATAGGACCTTGG---TCTATTTTGTTGGTTT-GACT-CCAAGGTAA-TGATTAATAGGGACAG-TTGGGGGTATTCGTA-TTCAATTG-TCAGAGGTGAAATTCTTGGATTTATGGAAGACGAACTACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCATAAACTATGCCGACT-AGGGATTGGTGGACGTTG---------TAATTGACTCCATCA-GCACCTTA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGAAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCAGA-CATAGT-GAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCCCTGCCTGCTAACTAGTCGTCTGAATGCCTAGGCATTGA--GATCCGA---CTTCTTAGAGGGACTTTTGGTGACTAACC---AAAGGAAGTTAGGGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCCGCACGCGCGCTACACTGACACATGCAGCGAGTTCTT---------------------------------CCTTGTCCGAAAGGTCTGGG-TAATCTTGTCAATGTGTGTCGTGATAGGGATAGATTATTGCAATTATTAATCTTGAACGAGGAATTCCTAGTAAATGCGGGTCATCAGCTCGCGTTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGATTCGGTGAAACTTTCGGACCGTGGTTCTTGCCACTTCGGTGGTGAGAA----TCGTGGAAAGTTATTTAAACCTCATCATTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATT- Parietichytrium_sp._F3_1 ----------------------GCCAGTAACATACGCTTTCAAAGATTAAGCCATGCATGTCTAAGT-TAAGGA---TTATATC-TGAAACTGCGAACGGCTCATTAAACCAGTACTAACCTAATTGATGATGAAAGTT-------AGATGGATACTTGTGGCAAATCTAGAACCAATACATGCT--TGGAGGCCCGACTTTGT------GGGAGGGCTGCATTTATTTGAACC--AAACCAATAGCTCGTTTCGGCGG----GTTTCGTGTGGGTGAGTCAGAATAAGTAAGCGAACCCT----------TTCTTAGGAGAGGGTGAATCATT-CGAGTTTCTGCCCCATCAGTTGTCGACGACACGGTATTGACCTGTCGTGA-CTGTCACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACT-CAATGTTAAATGGA-CGAAGTAGTGA-CGAGAAATAACAATGTG-GAGCGCTT------CGCGTTTTACAATTGTAATGAGAGCAGATTAAAGGGGTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAGAAGGGTTGTCT-TTAG-------TTTG--------TT--TT---CGTATGAGAC---TAAATGTGGCAACATTCGTCTGTTCTTGAAAGAGGGC-------------------------AGACCGTTTACTGTAAAAAAATT-AGAGTGTTCA--AAGCGTGATGTATGTTGTTTGAATATAG-TAGTATGGAATAATGAGATAGGACTTTGT--TGTTATTT-GTTGGTT--GCATGGCAAGGTAA-TGATTAATAGGGACAG-TTGGGGGTATTCGTA-TTACGATG-TCAGAGGTGAA-TTCTTGGAT--TTCGAAGACGAACCACTGCGAAAGCATTAATCAAGAA---TGTTTTCATTAATC-AAGAACG-AAAGT-AGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTGACCGTAAACAATGCCGACT-TGCGATTGTGTTCTTCTTTTT--------GGAGAGGGATGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCCCGGGGGGAGTATGGTCGCAA-GGCTGAAA-CT-AAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTCCTG-A--TCTATGGGTGG-TGGTGCATGCCC-GGTCATAGTT-G-TGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--ATGGTGGA-TTTTTGTTAGGA---AAGACATGTCGTTCT-AGAGGGAC--TTTCGGGTTTACC--GGAAGGAAGTTTGTGGCAA-TAAC-GGTCTGTGATGCCCTTAGATGTTCTGGGCCG-A-GCGCGCTACACTGA-CGGTTCAAGATATTCA-------------------GTTTCTTTTGATGTTCCTTGGTAGGAATGCCTGGG-TAATCTTTTGAACGCCGATCGTGATGGGGCTAGATTTTTGCAATTGTTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGCTCATCGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAGAC-TTGGGATTGCTCGATTTTCTTTTCACGAGGAGAG----TCAGTAGAAGAAGGGAGCAA--------------------------------------------------------------------- Parietichytrium_sp._H1_14 --------------------------CCCACTGACGCTGTCTCAAGCCTAGTCATGCATGTCTAAGTATAAAGGA-CTTATACT-CTGAACTGCGAACGGCTCATTATATCAGTTATAGTTCCTTTGATAGTGAA-GTT-------AGATGGATACTTGTGGCAAATCCG---CCCATACATGCT--TGA--GCCCGACTTTT------GGGGAGGGCCGCATTTATTTGA-TT--AAACCAATAGCC---------TCTCGGGG-TTGTTTGGGTGAGTCAGAATAAGTCAGCGAACCTT----------TGGTAACGA--AGGTGAATCATT-CGAGTTTCTGCCCCATCAGTTGTCGACGACACGGTATTGACCTGTCGTGA-CTGTCACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACT-CAATGTTAAATGGA-CGAAGTAGTGA-CGAGAAATAACAATGTG-GATCGCTTA-----TGCGTTTTACAATTGTAATGAGAGCAGATTAAAGGGGTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT--GC---TAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TGGAGTATATCATATCT--TGAGGTTTTGGCC---------TT--TTAAACACGTGGCCC---CGAAAAAAGAGAAACTCTTCTCTCTCTGAGAGAA----------------------------AAAACATACTGGGAAAAAAAATT-AGAGTGCACA--ACGCGGGGTGTGTG--GGGTGAATATAG---GTATGGAATAATGAGATAGGACTTTGT--TGTTATTTTGTTGGTTT-GCATGGCAAGGTAA-TGATTAATAGGGACAG-TTGGGGGTATTCGTA-TTACGATG-TCAGAGGTGAAATTCTTGGC---TG-AAAGACGAACAACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCGTAAACAATGCCGACT-TGCGATTGTGTCGCTCTTGTTTT----GAATAGGGCGGTGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCG-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--ATGTCGTT-TTTTTTGATTAA---AAGGCGTATGTTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACAAGTTTTTTT---------------ATCATTTCATAATTTTCCTTGGTAGGAATGCCTGGG-TAATCTTTTGAACGCCGATCGTGATGGGGCTAGATTTTTGCAATTGTTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCACCTTGCATTGATTACCGCCCTGCCCTTTGTACACACCGGCCGTCGGACCTACCGATTGAACGATCCGGTGAGACCTTGGGATTGCTTGTATTTTTTTTAACGAAAGGAT----GTAGGCGAGAACTTGAGCAAACCTTATCGTTTAGAGGAAGGTGAA-TCGT-ACAAGGTTCCGTGTGAACCGC----------------- Parietichytrium_sp._MBIC11085 ----------------------TAATCATACGCT-TGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAAGGA--TTATACTCTGAAACTGCGAACGGCTCATTAAACCAGTACTAACCTAATTGATGATGAA-------AGTTAGATGGATACTTGTGGCAAATCTAGAACCAATACATGC--TTGGAGGCCCGACTTTAT------GGGAGGGCTGCATTTATTTGAACC--AAACCAATAGCTCG----TTTCGGCGGGTTTCGTGTGGGTGAGTCAGAATAAGTAAGCGAA-CCC---------TTTTTTCGGAGAGGGTGAATCATT-CGAGTTTCTGCCCCATCAGTTGTCGACGACACGGTATTGACCTGTCGTGA-CTGTCACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACT-CAATGTTAAATGGA-CGAAGTAGTGA-CGAGAAATAACAATGTGGAGCGCTTT------GCGTT-TTACAATTGTAATGAGAGCAGATTAAAGGGGTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAGAAG-GGTTGTCTTTAGTTTAGTTTTCTTATGAGAA-----------------------------------CTAAATGTGGCAACATTCGTCTGTTTTCTTT-----------AGAGGGCAGACCGTTTACTGTAAAAAAATT-AGAGTGTTCA--AAGCGTGATGTA-TGTTGTTTGAATATAGTAGTATGGAATAATGAGATAGGACTTTGT--TGTTATTTTGTTGGTTT-GCATGGCAAGGTAA-TGATTAATAGGGACAG-TTGGGGGTATTCGTA-TTACGATG-TCAGAGGTGAAATTCTTGGATTTTCGAAAGACGAACAACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTCAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTGACCGTAAACAATGCCGACT-TGCGATTGTGTTCTTCTTG------TTTTAGAGAGGGATGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATAATGGTGTTTTTTTGTTTTAGGAAAGACATGTC---GTTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACGAGTGTTTGCAGTTTC--------TTTGTTGAGATTGTGGTCCTTGGTAGGAATGCCTGGG-TAATCTTTTGAACGCCGATCGTGATGGGGCTAGATTTTTGCAATTGTTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAGACCTTGGGATTGCTCGATTTTCTTTTCACGAGGAGAGTCA--GTAGCAAGAACTTGAGCAAACCTTATCGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCC--------------------------- Parietichytrium_sp._SEK351 ----------------------TAATCATACGCT-TGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAAGGA--TTATACTCTGAAACTGCGAACGGCTCATTAAACCAGTACTAACCTAATTGATGATGAAAG-------TTAGATGGATACTTGTGGCAAATCTAGAACCAATACATGC--TTGGAGGCCCGACTTTAT------GGGAGGGCTGCATTTATTTGAACC--AAACCAATAGC----TCGTTTCGGCGGGTTTCGTGTGGGTGAGTCAGAATAAGTAAGCGAACCCTTT----------CTTGGGAGAGGGTGAATCATT-CGAGTTTCTGCCCCATCAGTTGTCGACGACACGGTATTGACCTGTCGTGA-CTGTCACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACT-CAATGTTAAATGGA-CGAAGTAGTGA-CGAGAAATAACAATGTGGAGCGCTT------TGCGTT-TTACAATTGTAATGAGAGCAGATTAAAGGGGTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAGAAGGGTTGTCTTTGGTTTGG-TTTTCGTAAGAGAA-----------------------------------CCAAATGTGGCAACATTCGTCTGTTCTTTTT-----------AGAGGGCAGACCGTTTACTGTAAAAAAATT-AGAGTGTTCA--AAGCGTGATGTA-TGTTGTTTGAATATAGTAGTATGGAATAATGAGATAGGACTTTGT--TGTTATTTTGTTGGTTT-GCATGGCAAGGTAA-TGATTAATAGGGACAG-TTGGGGGTATTCGTA-TTACGATG-TCAGAGGTGAAATTCTTGGATTTTCGAAAGACGAACAACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTCAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTGACCGTAAACAATGCCGACT-TGCGATTGTGTTCTTCT--------TTTTGGAGAGGGATGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTACTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATAATGGTGTTTTTTTGTTTTAGGAAAGACATGTC---GTTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACGAGTGTTTTCAGTTTC----------TTTTGAGACTGTGTTCCTTGGTAGGAATGCCTGGG-TAATCTTTTGAACGCCGATCGTGATGGGGCTAGATTTTTGCAATTGTTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAGACCTTGGGATTGCTCGATTTTCTTTTCACGAGGAGAGTCA-GTATCAAGGAACTTGAGCAAACCTTATCGTTTAGAGGAAGG?GAAGCCGTAACAAAGTTTCC--------------------------- Parietichytrium_sp._SEK364 ---------------CTGCCAGTAATCATACGCT-TGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAAGGA--TTATACTCTGAAACTGCGAACGGCTCATTAAACCAGTACTAACCTAATTGATGATGA-------AAGTTAGATGGATACTTGTGGCAAATCTAGAACCAATACATGC--TTGGAGGCCCGACTTTAT------GGGAGGGCTGCATTTATTTGAACC--AAACCAATAGCTCG----TTTCGGCGGGTTTCGTGTGGGTGAGTCAGAATAAGTAAGCGAA-CCC---------TTTTTTCGGAGAGGGTGAATCATT-CGAGTTTCTGCCCCATCAGTTGTCGACGACACGGTATTGACCTGTCGTGA-CTGTCACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACT-CAATGTTAAATGGA-CGAAGTAGTGA-CGAGAAATAACAATGTGGAGCGCTTTG------CGTT-TTACAATTGTAATGAGAGCAGATTAAAGGGGTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAT-TAAA-GTTGTTGCAGTTA-?AAGCTCG-TAG---TTGAAGAAGGGTTGTCTTTAGTTTAGT-TTTCTTGTGAGAACTAAATGTG-----------------------------------GCAACATTCGTCTGTTTTCTTT-----------AGAGGGCAGACCGTTTACTGTAAAAAAATT-AGAGTGTTCA--AAGCGTGATGTA-TGTTGTTTGAATATAGTAGTATGGAATAATGAGATAGGACTTTGT--TGTTATTTTGTTGGTTT-GCATGGCAAGGTAA-TGATTAATAGGGACAG-TTGGGGGTATTCGTA-TTACGATG-TCAGAGGTGAAATTCTTGGATTTTCGAAAGACGAACAACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTCAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTGACCGTAAACAATGCCGACT-TGCGATTGTGTTCTTCTTG------TTTTAGAGAGGGATGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGA?GGGCA--CCACC?GTAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGAT-GACAGAT-GAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTGATTCTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATAATGGTGTTTTTTTGTTTTAGGAAAGACATGTC---GTTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACGAGTGTTTGCAGTTTC--------ATTGTTGAGATTGTGGTCCTTGGTAGGAATGCCTGGG-TAATCTTTTGAACGCCGATCGTGATGGGGCTAGATTTTTGCAATTGTTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAGACCTTGGGATTGCTCGATTTTCTTTTCACGAGGAGAGTCA--GTAGCAAGAACTTGAGCAAACCTTATCGTT-AGAGGAAGG------------------------------------------------ Schizochytrium_aggregatum -----------------------------------------AAAGATTAAGCCATGCATGCGATAGTATAGTTGGT---AATCAGCGAAACTGCGAACGGCTCATTATATCTGTTATAATTCCCATGATTGTGCGTTG-----TGTAGACGGATACATGTGGCAAATCTAGAATCAATACGTGTCTTGGAGGTCCCGAACTTTTGT---GGGAAGGGACTCATTATTTTACCCT--AAACCAGTAGGCT---------CTCGGGCCTTGTTTCGGTGAGTCATAGTAATTGAGCGAATCGCATAG----CCCTCGGG--CGGCGATGAATCATT-CAAGTTTCAGCCCCATCAGTTGTCGACGGGAGGGTATTGGCCTCCCGTGA-CCGTTACGGGTGAC--GGGGAATTAGGG-TTCGAGTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACTGCAAGTTCT-ACAGAACGAAGTAGTGA-CGAAAAATAACAGTGAG-TGCG------CTGTGCGTAATCTCGACTGAAATGAGAGCAATTTAAAACCCCCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCCCGGTAATT-CCAG-CTCCAAT-AGCGTATAC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TCGAACGTGTGGCGTGCGCG--CGGGTCCGTCGGGGG--GCC---GA---ATGCCTCCGA--GCAGCGACTCGC--GCGGTGCCAGTCTGGCACTTTTTGAGGTG---------------------CCTCTTTCACGGTAAAAAAATT-AGGGTGTTTC--AAGCAAAGGTT--GATATTGGAATATGA-TAGTATGGGATGATGAGATAGGCCGTTGG--CGGTATTTTGTTGGTTT-GCGCGTTGGCGGAA-TGATGAAGAGGGACAG-TTGGGGGTATTCGAA-TTCTAGTG-TCAGAGGTGAAATTCTTGGATTACTAGAAGGCGAACGACTGCGAAA-CATTTACCAAGGA---TGTTTTCATTGATC-AAGAACG-AAAGTATGGGGATCGAAGA-TGATTAGATACCATCGTAGTCCATACCGTAAA-CGATGCCGACTCGCGATGGTCCCCTGGCTCT---------AGTGGCGGGGGGC-GGCACGCA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCCACACGGGGAAA-CTTACCAGGT-CCAGA-CATAGGA-AGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCCCGTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTGATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GTGCGCGT-TGTGGCGACACA---GTGAGAGGCACTTCTTAGAGGGAC-ACTTTGGGTTTACC--AGAGGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTTGC----------------TTTGTCGTACGACAACGTCCTGGGCCGGAAGGTTTGGG-TAATCGTGTGAATACCAGTCGTGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACAC--CGCCCGTCGCACCTACCGATTGAACGTTCCGGTGAGACTTCGGAGGGCACGATGTTCCTGGCGACAGGACGTG--------------------------------------------------------------------------------------------- Schizochytrium_sp._SEK210 ----------------------CGGTCATACGCT-TGTCTTAAAGATTAAGCCATGCATGCGATAGTATTAGTTGG-TAATACAGCGAAACTGCGAACGGCTCATTATATCTGTTATAATTCCCATGATTGTGCGTT-----GTGTAGACGGATACATGTGGCAAATCTAGAATCAATACGTGC--TTGGAGGCCCGACTTTT------GGGGAGGGCCGCACTTATTAGACCT--AAACCAGTAGGC---------TCTCGGGCCTTGTGATGGTGAGTCATAGTAATTGAGCGAATCGCATAG------CCCTCGGGCGGCGATGAATCATT-CAAGTTTCAGCCCCATCAGTTGTCGACGGGAGGGTATTGGCCTCCCGTGA-CCGTTACGGGTGAC--GGGGAATTAGGG-TTCGAGTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACTGCAAGTTT-ACAGAA-CGAACTAGTGA-CGAGAAATAGCAGTGAG-GTGCGCTGT-----GCGTA-TCTCGACTGAAATGAGAGCGATTTAAAACCCCCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TCGAACGTGTGGTGTGTGTGCGGGTCCGTCGA?GGGTG-AATGCCTGTCGAGCAG?GACTCGTGCACTG--------CCAGTCTGGTATGTCTGCAAGG--------ACATGC--------------CTCTTTCACTGTAAAAAAATT-AGGGTGTTTC--AAGCAAAGGTTGATA---TTGGAATATGATAGTATGGGATGATGAGATAGGCCGTTGG--CGGTATTTTGTTGGTTT-GCGCGTTGGCGGAA-TGATGAAGAGGGACAG-TTGGGGGTATTCGAA-TTCTAGTG-TCAGAGGTGAAATTCTTGGATTACTAGAAGGCGAACGACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTGATC-AAGAACG-AAAGTATGGGGATCGAAGA-TGATTAGATACCATCGTAGTCCATACCGTAAACGATGCCGACT-CGCGATGGTCTCTCGGCT--------CTTGAAGCGGGAGGCG-GCAGCGCA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCAGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTGATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GAGTGCGT-TGTGGCGACACAGT--GACAT---TCTTCTTAGAGGGAC-ACTTTGGGTTTACC--AGAGGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTT?AGGTGGCTTC---------------CAGCCGTCGTCCTGGGCCGGAAGGTTTGGG-TAATCGTGTGAATACCAGTCGTGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGTTCCGGTGAGACCTTCGGAGGGCACGTTGTTCCTGGCGACAGGACGTCG-----TGGCCAAAGTTGAGCAAACCTTAACGTT-A?AGGAAGGTGAA?TCGTAACAAGGTTTCCGTAGGTGAA------------------ Schizochytrium_sp._SEK345 -------------------------TCATACGCT-TGTCTTAAAGATTAAGCCATGCATGCGATAGTATTAGTTGG-TAATACAGCGAAACTGCGAACGGCTCATTATATCTGTTATAATTCCCATGATTGTGCGTT-----GTGTAGACGGATACATGTGGCAAATCTAGAATCAATACGTGC--TTGGAGGCCCGACTTTT------GGGGAGGGCCGCACTTATTAGACCT--AAACCAGTAGGC---------TCTCGGGCCTTGTGATGGTGAGTCATAGTAATTGAGCGAATCGCATAG------CCCTCGGGCGGCGATGAATCATT-CAAGTTTCAGCCCCATCAGTTGTCGACGGGAGGGTATTGGCCTCCCGTGA-CCGTTACGGGTGAC--GGGGAATTAGGG-TTCGAGTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACTGCAAGTTT-ACAGAA-CGAAGTAGTGA-CGAGAAATAGCAGTGAG-GTGCGCTGT-----GCGTA-TCTCGACTGAAATGAGAGCGATTTAAAACCCCCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TCGAACGTGTGGTGTGTGTGCGGGTCCGTCG??GGGTG-AATGCCTGTCGAGCAGCGACCCGTGCACTG--------CCAGTCTGGTATGTTTGCAAGG--------ACATGC--------------CTCTTTCACTGTAAAAAAATT-AGGGTGTTTC--AAGCAAAGGTTGATA---TTGGAATATGATAGTATGGGATGATGAGATAGGCCGTTGG--CGGTATTTTGTTGGTTT-GCGCGTTGGCGGAA-TGATGAAGAGGGACAG-TTGGGGGTATTCGAA-TTCTAGTG-TCAGAGGTGAAATTCTTGGATTACTAGAAGGCGAACGACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTGATC-AAGAACG-AAAGTATGGGGATCGAAGA-TGATTAGATACCATCGTAGTCCATACCGTAAACGATGCCGACT-CGCGATCGTCTCTCGGCT--------CTTGAAGCGGGAGGCG-GCAGCGCA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCAGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTGATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GAGTGCGT-TGTGGCGACACAGT--GACAT---TCTTCTTA{GT}AGGGAC-ACTTTGGGTTTACC--AGAGGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTCTTGGTGGCTCT---------------GAGCCGTCGTCCTGGGCCGGAAGGTTTGGG-TAATCGTGTGAATACCAGTCGTGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGTTCCGGTGAGACCTTCGGAGGGCACGTTGTTCCTGGCGACAGGACGTCG-----TGGCCAAAGTTGAGCAAACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCC--------------------------- Schizochytrium_sp._SEK346 ----------------------CGGTCATACGCT-TGTCTTAAAGATTAAGCCATGCATGCGATAGTATTAGTTGG-TAATACAGCGAAACTGCGAACGGCTCATTATATCTGTTATAATTCCCATGATTGTGCGTT-----GTGTAGACGGATACATGTGGCAAATCTAGAATCAATACGTGC--TTGGAGGCCCGACTTTT------GGGGAGGGCCGCACTTATTAGACCT--AAACCAGTAGGC---------TCTCGGGCCTTGTGATGGTGAGTCATAGTAATTGAGCGAATCGCATAGC------CCTCGGGCGGCGATGAATCATT-CAAGTTTCAGCCCCATCAGTTGTCGACGGGAGGGTATTGGCCTCCCGTGA-CCGTTACGGGTGAC--GGGGAATTAGGG-TTCGAGTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACTGCAAGTTT-ACAGAA-CGAAGTAGTGA-CGAGAAATAGCAGTGAGGTGCGCTG------TGCGTA-TCTCGACTGAAATGAGAGCGATTTAAAACCCCCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCA?CAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TA?---TC?AACGTGTGGTGTGTGTG-CGAGT------CCGTCG-A?GGGTG-----AATGCCTGTCGAGCAGCGACTCGTG-CACTG------CCAGTCTGGTATGTCTGCAAAGACATGC-----------CTCTTTCACTGTAAAAAAATT-AGGGTGTTTC--AAGCAAAGGTTGA---TATTGGAATATGATAGTATGGGATGATGAGATAGGCCGTTGG--CGGTATTTTGTTGGTTT-GCGCGTTGGCGGAA-TGATGAAGAGGGACAG-TTGGGGGTATTCGAA-TTCTAGTG-TCAGAGGTGAAATTCTTGGATTACTAGAAGGCGAACGACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTGATC-AAGAACG-AAAGTATGGGGATCGAAGA-TGATTAGATACCATCGTAGTCCATACCGTAAACGATGCCGACT-CGCGATGGTCTCTCGGCT--------?TTGAAGCGGGAGGCG-GCAGCGCA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCAGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGT?TGG-TTGATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GAGTGCGT-TGTGGCGACACAGT--GACAT---TCTTCTTAGAGGGAC-ACTTTGGGTTTACC--AGAGGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTTTTGGTGGCTTCG---------------AGCCGTCGTCCTGGGCCGGAAGGTTTGGG-TAATCGTGTGAATACCAGTCGTGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGTTCCGGTGAGACCTTCGGAGGGCACGTTGTTCCTGGCGACAGGACGTCG-----TGGCCAAAGTTGAGCAAACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGGAA------------------- Sicyoidochytrium_sp._MBIC11071 -----------------------AGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCTTTTG--TACTGTGAAACTGCGAACGGCTCATTATACCAGTTATCGTCTATTGGATAGTGTT-------TTTTAGATGGATATCTGCAGTAATTCTGGAGCTAATACATGC--TTAGAGGGGCGACTTTTT------GGAAGCCCTGCATTTGTTAGATTAC--AACCAACA----------------------TTTCTTGGTGATTCATAACAACTTAGCGGACCGCAGTG-------CCTTGAGCGGCGGTAAATCCTT-CGAGTTTCTGCCCCATCAGCTGTTGACGGTAGCGTAACGGGCTACCGTGG-CTTTCACGGGTAAC--GGAGAATCAGGG-TTTGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATTCTGATACGG-AGAGGTAGTGA-CGAGAAATAGCAAGGCG-CGGCCCTTT-----GGGTT-GTGCTATTGCAATGAGTGCGATGTAAAGTTCCCAACGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAC-TAAC-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATGTGTGGTGGGTGTTGACCGTGTCTGTCCCTTGTGTACTGTTTCACAG----TGTCAATGCCTGCTA------------TTCTGGGAGATTCGTCTCCC------------------------TCGTTTACTGTAAACAAATT-AGAGTGTTTC--AAGCAGGCTGTAA----GCCGGAATATACTAGTATGGAATAATAAGATAGGACTTTTG--GTCTA-CTTGTTGGTTC-TAACC-AAGAGTAA-TGATGAATAGGGACAG-TTGGGGGTATTCGTA-TTTACATG-TCAGAGGTGAAATTCTTGGATTTTGGAAAGACGAACAACTGCGAAAGCATTTACCATGGA---TGTTTTCATTAATC-AAGAACG-AAAACTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCCTGGTAGTAAACTATGCCGACT-TGCGATTGCAAGGTGTCTG-------TTTTTTGACTCTTGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGGTCT-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCTTGCGGCTTAATTCGACTCAACACGGGAAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCGGCCTACTAAATA--AGACGCAT-TATGGCGACATAGT--GTGAG---CTTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTGCGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACATGTTGAACAAGTTTTTTTTCTTT---------TTTTACGAGGAAAAAGTCCTTATCCGGAAGGATTGGG-TAATCTTTTGAATCCATGTCGTGATGGGGCTAGATTCTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAACTCGTTGGATATGTTGTATTGGATGAAAGTTTGATGTAG------CGTAGAAATCGAGTAAACCTTATCGTTTAAAGGAAGGTGAAGTCG-AACAAGGTTTCC--------------------------- Sicyoidochytrium_sp._MBIC11077 ----------------------TAGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCTTTTG--TACTGTGAAACTGCGAACGGCTCATTATACCAGTTATCGTCTATTGGATAGTGTT-------TTTTAGATGGATATCTGCAGTAATTCTGGAGCTAATACATGC--TTAGAGGGGCGACTTTTT------GGAAGCCCTGCATTTGTTAGATTAC--AACCAACA----------------------TTTCTTGGTGATTCATAACAACTTAGCGGACCGCAGTG-------CCTTGAGCGGCGGTAAATCCTT-CGAGTTTCTGCCCCATCAGCTGTTGACGGTAGCGTAACGGGCTACCGTGG-CTTTCACGGGTAAC--GGAGAATCAGGG-TTTGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATTCTGATACGG-AGAGGTAGTGA-CGAGAAATAGCAAGGCG-CGGCCCTTT-----GGGTT-GTGCTATTGCAATGAGTGCGATGTAAAGTTCCCAACGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAC-TAAC-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATGTGTGGTGGGTGTTGACCGTGTCTGTACCTTGTGTACTGTTTCACAG----TGTCAACGCCTGCTA------------TTCTGGGAGATTCGTCTCCC------------------------TCGTTTACTGTAAACAAATT-AGAGTGTTTC--AAGCAGGCTGTAA----GCCGGAATATACTAGTATGGAATAATAAGATAGGACTTTTG--GTCTA-CTTGTTGGTTC-TAACC-AAGAGTAA-TGATGAATAGGGACAG-TTGGGGGTATTCGTA-TTTACATG-TCAGAGGTGAAATTCTTGGATTTTGGAAAGACGAACAACTGCGAAAGCATTTACCATGGA---TGTTTTCATTAATC-AAGAACG-AAAACTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCCTGGTAGTAAACTATGCCGACT-TGCGATTGCAAGGTGTCTG-------TTTTTTGACTCTTGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGGTCT-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCTTGCGGCTTAATTCGACTCAACACGGGAAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCGGCCTACTAAATA--AGACGCAT-TATGGCGACATAGT--GTGAG---CTTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTGCGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACATGTTGAACAAGTTTTTTTTCTTT---------TTTTACGAGGAAAAAGTCCTTATCCGGAAGGATTGGG-TAATCTTTTGAATCCATGTCGTGATGGGGCTAGATTCTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGT-AACTCG-TGGATATGTTGTATTGGATGAAAGTTTGATGTAG------CGTAGAAATCGAGT-AACCTTATCGTTTAGAGGAAGG------------------------------------------------ Sicyoidochytrium_sp._SEK354 ----------------------TAGTCATACGCT-CGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCTTTTG--TACTGTGAAACTGCGAACGGCTCATTATACCAGTTATCGTCTATTGGATAGTGTT-------TTTTAGATGGATATCTGCAGTAATTCTGGAGCTAATACATGC--TTAGAGGGGCGACTTTTT------GGAAGCCCTGCATTTGTTAGATTAC--AACCAACA----------------------TTTCTTGGTGATTCATAACAACTTAGCGGACCGCAGTG-------CCTTGAGCGGCGGTAAATCCTT-CGAGTTTCTGCCCCATCAGCTGTTGACGGTAGCGTAACGGGCTACCGTGG-CTTTCACGGGTAAC--GGAGAATCAGGG-TTTGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATTCTGATACGG-AGAGGTAGTGA-CGAGAAATAGCAAGGCG-CGGCCCTT-----TGGGTT-GTGCTATTGCAATGAGTGCGATGTAAAGTTCCCAACGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAC-TAAC-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATGTGTGGTGGGTGTTGACCGTGTCTGTACCTTGTGTACTGTTTCACAG----TGTCAACGCCTGCTA------------TTCTGGGAGATTCGTCTCCC------------------------TCGTTTACTGTAAACAAATT-AGAGTGTTTC--AAGCAGGCTGTAA----GCCGGAATATACTAGTATGGAATAATAAGATAGGACTTTTG--GTCTAC-TTGTTGGTTC-TAACC-AAGAGTAA-TGATGAATAGGGACAG-TTGGGGGTATTCGTA-TTTACATG-TCAGAGGTGAAATTCTTGGATTTTGGAAAGACGAACAACTGCGAAAGCATTTACCATGGA---TGTTTTCATTAATC-AAGAACG-AAAACTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCCTGGTAGTAAACTATGCCGACT-TGCGATTGCAAGGTGTCTG-------TTTTTTGACTCTTGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGGTCT-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCTTGCGGCTTAATTCGACTCAACACGGGAAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCGGCCTACTAAATA--AGACGCAT-TATGGCGACATAGT--GTGAG---CTTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTGCGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACATGTTGAACAAGTTTTTTTTCTTT---------TTTTACGAGGAAAAAGTCCTTATCCGGAAGGATTGGG-TAATCTTTTGAATCCATGTCGTGATGGGGCTAGATTCTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAACTCGTTGGATATGTTGTATTGGATGAAAGTTTGATGTAG------CGTAAAAATCGAGTAAACCTTATCGTTTA?AGGAAGGTGAAGTCCGTAACAAGG?A----------------------------- Thraustochytrium_aggregatum --------GTTGATCCTGCCAGCTGTCATTTGCT-CGTCTAAAAGATTAAGCCATGCATGTCTAAGTATAAACTAA-TTATACGGTGAAACTGCGAACGGCTCATTATATCAGTTATAGTTTCTTTGATAGTGTATTTCTATATCTATTTGGATAACTGTGGCAATTCTAGAGCTAACACATGCT-TTCGAGT-GGGACTTTTT------GGTACCACTGCATTTATTAGATTTTGAAGCCAACGT---------------------AAAATTGGTGATTCATGATAACTTTGCGAATCGCAGTA--GCGTCTTGTACGCGGCGATGAATCATT-CAAGTTTCTGCCCCATCAGCTGTCGATGGTACGGTATTGGCCTACCATGG-CTTTCACGGGTGAC--GGAGAATTAGGG-TTTGATTCCGGAGAGGA-CGC-TTGAGAGACGGCGACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATGGGG-ACTCCCCGAGGTAGTGA-CAAGAAATAAAAATGAGGAGCG-------CTTTGCGTTTTTCAATTTGAATGAGAGAATCGTACAATCCTCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAACT-CCAG-CTCCAAT-AGCAAATAT-TAGA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATTTCCGATAGTCTTTGGCCGTGTCTTTGGTCTCGTA-----CCGTAGATT------------AATTGTG---CCAAGATGATCGTCCTCTATGGTTAGTGATAGTCAT-------------AGTCGTTTACTGTAAAAAAAAC-TGGAGTGTTT--AACGCATTTCTTTGGGAAAGGTACATAT-TAGTATAGGATAATTAGATAGGACCTGTG--ATTCTTATGGTTGGTTT-GTGAGTCATGGTAA-TGATTAATAGGGACAA-TCGGGGGTATTCGAA-TTTAATTG-TCAGAGGTGAAATTCTTGGATTTAAGAAAGTCGAACTACTGCGAAGGCATTTACCAAGGA---TGTTTTCATTAATA-AAGAACG-AAAGTTAGGGG????????-????????????????????????????????-???????????????????????????????------------???CTGGGCA-GCAGCACA-TGAGAAATCA-AAGT--TTTTGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGC-TGCGGCTTAATTCGACTCAACACGGGAAAA-CTTACCAGGT-CCAAGACATAGT-AAGGATTGACCAGATTGGAGAGCTCTTTCT-GGATCTATGGGTGG-TGG-GCATGGC--GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCAGCCTACTAAATA--GTGGTGCA-TATTGTGAGATATGTGATTTGATCGCTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCCTAGATGTTCTGGGCCGCACGCGCGCTACAATGACAGATTCAACAAGTCCGGTAGTGGGC----------TCTGTGCCTATTATTACTTTTCCGAGAGGAATGGT-TAATCTTCTAAATGTCTGTCGTGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACAC--C-GCCGTCGCAC-TACCGATTGAACGGTCT-ATGAAATTTCGGAT------------------------------------------------------------------------------------------------------------------------- Thraustochytrium_aureum -----CCTGGTTGATCCTGCCAGTAGTCATACGCTTATCTCAAAGATTAAGCCATGCATGTCTAAGTATAAAGGC--TTATACTCTGAAACTGCGAACGGCTCATTATATCAGTTATAGTTTCTTTGATA--GTGTTT---TTTCTACATGGATACTTGTGGCAAATCTAGAAACAATACATGC--GTACAGGCCTGACTTTGG------GGGAGGGCTGCATTTATTTGACTT--AAGCCAATAC----------CCCTCGGGGTTGTTTT-GGTGATTCAGAATAACTGAGCGAATCGCAT-----AGCTTTC-GGGCGGCGATGAATCATTTCAAGTTTCTGCCCCATCAGCTGTCGATGGTAGGGTATAGGCCTACCATGG-CTGTCACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACT-CAATGTTG-ACTCGACGAAGTAGTGA-CGAGAATTAACAATGCGGAGCG-------CTCAGCGTTTTGCAATTGGAATGAGAGCAATGTAAAAGCCTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAACCTCTGGTAGGGCCGACCTTGGCG---CGCGGTGAATGCCGCGTCGTTTAGAAGCGTCGTGCCCG-G-----CCATCCTCC------CCCGGTCTTTTGGGCT---------------GGGGGTCGTTTACTGTAAAAAAAAT-AGAGTGTTCC--AAGCAGGGGGTAATATCCCGGTATATAG-TAGTATGGAATAATGAGATAGGACTTTGG--TACTATTTTGTTGGTTT-GCATGCCAAGGTAA-TGATTAAGAGGGACAG-TTGGGGGTATTCGTA-TTTAGATG-TCAGAGGTGAAATTCTTGGATTTTCGAAAGACGAACTACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCGTAAA-CTATGCCGACTTGCGATTGTCCGGCGTCGCTTTT-----AGATGACCTGGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCGGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GTGGCCGT-TATGGCGACATA-----GCGGTGAACTTCTTAGAGGGAC-ATTTCGGGTATACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATCGGTTCAACGAGTATTTGTTTTTTTCTC--ATTTTGGGAGGGGGCAGAGTCCTTGGCCGGAAGGTCTGGG-TAATCTTTTGAATGCCGATCGTGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAGACGCAAGTCATCAGCTTGCATCGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAGACCTTGGGATTCTGTTGTGG--CTGATTCATTTTGGC-TG-CGATGGGAGAACTTGAGCAAACCTTATCGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGTGAACCTGC-------------- Thraustochytrium_kinnei ---AACCTGGTTGATCCTGCCAGTAGTCGTACGCTTGTTTCAAAGGTTAAGCCATGCATGTCTCAGTGTAAACTCA-TTGCACAGTGAAACTGCGAACGGCTCATTAAATCGGTTCTAGTCTCCAGAGTGGTGTTTTC---AATCTAAATGGATACTTGTGGCAAATCTAGAAACAATACATGC--TTGGAGGCCTGACGGTGTTTTCACTGAAGGGCTGCATTTATTTGATGT--TAGGACCAATAC--------CTTTCGGGGGTGATTCGGGTGATTCAGAGTAACTATGCGAACCGCAGT----GGCTTTT-AGTCGGCGGTGACTTTAT--GAGGTTCTGCCCTATCAGGCTTTGC--AACGGGTATTGTCCTTTGCAAC-CGGTCACGGGTGAC--GGAGAATCAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACT-CTATGCCA-ACGCGGCGAAGTAGTGA-CGAAAAATAGGACTG-GGTAGCG------CTTTGCGTTATCTTTGTCCAATGAGAGCAATGTAAAAGCCTCATCGAGGATCCA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTACAC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TCTAATGTATGGGAGTTGTGGGGTG-------GGTGTTTGGTTGGTTTTGCCGACTAGACAATACTCGCTCC-----GCTTCCCGCTT--GTTTTGCTCTCTTTTCTA-----------GAAGGCAAATGTTTCACTGTAAGTAAA---ACAACTCGCT--CAACAGCAAGGT-TATCTTGATATGAAT-TAGTATGGGATGATGAGATAGGCT-CGGT--CCGTATTTTGTTGGTTT-TAGTGGTCTGAGAA-TGATGAAGAGGGACAA-TTGGGGGTATTCGTA-TTTACATG-TCAGAGGTGGAATTCTTGGATTTTGGAAAGACGAACTAATGCGAAAGCATCTACCAAAGA---TGTTTTCATTGATC-AAGAACG-AAAGTTTGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTAAACCATAAA-CTATGCCGACTTGCGATTGTTTTGTGTCATTT-------AATGAGCA-GAGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGCG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GTGGTGTC-TATGGCGACATAG-----GTGATTGCTTCTTAGAGGGAC-ATTTCGGTTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGATTTCAACGAGTTGTTTATGTTGCTG--------TTTTTGGCAATATTTCCTTGTCCGTTAGGTCTGGG-TAATCTTTTGAATGGTCATCGTGATGGGGCTAGATTTTTGCAATTTTTAATCTCCAACGAGGAATTCCTAGTAAACGCGAGTCATCAGCTCGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGTTCCGGTGAGACCTTTGGATCTGCTGATGT--GGGGCGCAAGCCTTGTTG-TTGGCGGAGAAATTGAGCAAACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCAGAAGGATC---- Thraustochytrium_pachydermum ------------GATCCTGCCAGTAGTCATACGCTCAGGTCAAAGATTAAGCCATGCATGTGTAAGTATAAACTAA-TTATACGGTAAAACTGCGGACGGCTCATTATATCAGTTAGATTTTCTATGGTAATGTAATT----AATTAGGTGGATAACCGAGGTAATTCTTTGGCTAATACATGG--GTAAAAGTTCAACTGCTTTACGGCAGACGAACTGCACTTATTAGATTT--AAACCAATCATGG-----------TAACATGTTGAATGATGATTCATAATAATTAAGCGAATCGCAGT----GTCTTTA-TGACGGCGATAAACC-TT-GAACTTTCTGCCCTATCAGTTGTCGATTGTAGGGTAGTGGCCTACAATGA-CTTTAACGGGTGAC--GGAGAATTGGGG-TTCGATTCCGGAGAGGA-GGC-CTTAGAGACGGCCACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACC-CAATGGTG-GAATGCCGAGGTAGTGA-CAATTAATATTATCGCAGAGCCA------ATTTTGGTTTTGTTAT-GAAATGAGTGCAATTTAAAACTCTCAACGAGGATCAA-TTGAAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTTCAAT-AGCGTATAT-TAAT-GTTGTTGCAGTTACAAAGC-CG-TAG---TTTAATTTCTGTTAGGATTGGCCTGGCCT---TTGACGTAATGCATTGTTTT-GCTGGGGGCTATTATCTGG-----ACATCCT------GAATTTTTTTTTCGAAAA-----------AAATTC---TCATTAACTGTGAAAAAATT-AGAGTGTTTA--AAGCATACCGTA-ATGGTAGGAATATTT-CAGTATGGAATTACAAGATAGGATTTTGA--TTTTATTTTGTTGGTTT-GTGAATCAAAATAA-TGATTAATAGGGACAG-TTGGGGGTATTCGTA-TTTAATTGCT-AGAGGTGAAATTCTTGGATTTATGAAAGACGAACTACTGCGAAGGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACTATAAA-CTATGCCGACTTGCGATTGTTTAATGGTGTTT-------TTTGGCCATAAACA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCG-CTTAATTTGACTCAACACGGGAAAA-CTTACC--GT-CCAGA-CATGAG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTTTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCAGCCTACTAAATA--GTAATATT-TTAAGCAATTAAG----GTATA-GACTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGATTCAACAAGTTTTATTTAAAATTTA-------TTTTATAAATTTTTTCCTTGATCGGAAGGTCTGGG-TAATCTTTTAAATGTCTATCGTGATGGGGCTAGAT--TTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAATCTTCGGATTTTGCACATA--TTGATTTATTTCATTTTG-AGCAG-AAAAAGTTGAGTAAACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTCTCCGTAGTGAACCTGCA------------- Thraustochytrium_sp._BURABG_162 -----------------------------TCGCTCG-TCTCAAAGACTAAGCCATGCATGTGTAAGTATAAGCGAA-TTATACTGTGAAACTGCGAACGGCTCATTATATCAGTTATAATCCCTTCGGTAGTTCCTTT--------AGACGGATACCTGCAGTAATTCTGGAATTAATACGTGCT-GTACGGGCCCGACTTTC------GGGGAGGGCCGCACTTATTAGGTCT--AAGCCAAC-GTT----------------------CTTGGTGAGTCATGATAATTGAGCAGA----------TCGCTT--TTCGGAGCGATGAATCGTTT-GAGTTTCTGCCCCATCAGTTGTCGACGGTAGGGTATTGGCCTACGGTGA-CTATAACGGGTGAC--GGGGAGTTAGGG-CTCGACTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACC-CAATGTGGACTCCA-CGAGGTAGTGA-CGAGAAATATCAATGCG-GGGCGCTT------CGCGTCTTGCTATTGGAATGAGAGCAATGTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAG-AAGCGTATGC-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATTTCTGGTGTGGGAGCCCAGGCC-TCGGTGCG--AATGCGCCTTGTCTTGCCT-TGC-GGCTCCTTTGCCATCCTCGTTTTTCTTTTGAAG----------------------------GACGTCATTCACTGTAATCAAAGC-AGAGTGTTCC--AAGCAGGCCGTA--GGGCCGGTATGTTT--ATTATGGGATGATCAGATAGGACTCGGG--TGCTATTTTGTTGGTTT-GCACATCTGAGTAA-TGATTAATAGGAACAG-TCGGGGGTATCCGTA-TTTAGGAGCT-AGAGGTGAAATTCTTGGATTTCCGAAAGACGAACTACAGCGAAGGCATTTACCAAGCA---TGTTTTCATTAATC-AAGAACG-AAAGTCTGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTAGACCGTAAACGATGCCGACT-TGCGATTGCGGGTGGCTTGTAT-----TGGGC-C--TCCGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGG-TAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCGGCCTACTAAATA--GCCGGGCG-TATGGCGACATA--TGTGTTTGTGGCTTCTTAGAGGGAC-ATGTTCGGTTTACG--AGCAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAGCGGGTGATTTATGGG------------TTTTTCACTGAAGTTGCTTTGTCGGAAGGCATGGC-TAATCCTTTGAACGCCCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACCATGGGACTACC-TTTTGAGCGTTT-GTTCGC--GAT--GGAGGTGGGAACTCGGGTGAATCTTATTGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCC--------------------------- Thraustochytrium_sp._C9G ---------------------------ATACGCTTG-AGTCAAAGATTAAGCCATGCATGTGTAAGTTTAAATCAATTTAAACGATGAAACTGCGGACAGCTCATTACACAAGAGAGAATCTATTTGGTAGTGTTTTAT-----ACGATAGGATATCTGTTGTAATTCAAGAGTTAATACTTACA-TTAAAGACCCAACTTTCT------GGACGGGTTGTATATATTAGATTT--AAACCAACCAGG----------GTGACCTGTTAATATGGTGATTCATAATATCTAAGCGGATCGCAG----TGACTTTTAGT-CGGCGATGAGCCAA--CGACTTTCTTCCCCATCAAGTTTAGACTGTAGGGTAGTGGCCTACAGTGC-TTGTTACGGGTGAC--GGAGAATTAGGG-TTTGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACC-CCATGGTGACATGC-CGAGGTAGTGA-CAACTAATATTATTGCG-GA-CCATTT-----TTGGTTTTGCTATGA-AATGAGTGCAATTTAAAATACTCAACGAGGATCAA-TTGAAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTTCAAT-AGCGTATGT-ACAC-GTTGTTGCAGTTAAAACGCTCG-TAG---TTGAATTTCTGGTAGAAGTGACCAAGCC-TTTGACGT--AATGT-CAATGTTTTGCTT-TGTGTCA-CTTTGGCCATCCTAGATTAAAATTTACTTTT------------------------TAATCTTCATTTACTGTAAAAAAATT-AGAGTGTTTA--AAGCATTTCGTATGAAAAGAATATATCT--G-TATGGAATAATAAGATAGGACTTTGG--TGCTATTTTGTTGGTTT-GCACACCAAGGTAA-TGATTAATAGGGACAG-TTGGGGGTATTTGTA-TTTAATTG-TCAGAGGTGAAATTCTTGGATTTAATAAAGACAAACAACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-ATGAACG-AAAGTTTGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTAAACAGTAAACTATGCCGACT-TGCGATTGTTTGATGGTGTTTTT--AATTTGCCA--CAAGCA-GCAGCATATGAGAAATCAT-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GATTGAAA-CTTAAAAGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCGGA-CATAAG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTTTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGTTTG-AATTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCGGCCTACTAAATA--GTAATGCT-TTGAGCAATCAA--GGTAGTTT-GACTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTCGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGTATCAACAAGTTTTTATATAT------------TTTATTATATAATTTCCTTGATCGGAAGGTCTGGG-TAATCTTTTAAATCACCATCGTGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAATCTTCGGAGTTTGATTTTTTGGATTTATTTT-TAAAA---GATTGAGCAAAGTTGAGTAAACCTTATCATTTAGAGGAAGGTGAAGTCGTAACAAGGTCTCC--------------------------- Thraustochytrium_sp._KK17_3 ----------TTGATCCTGCCAGTAGTCATACGCTTGTCTTAAAGATTAAGCCATGCATGCGATAGTATTAGTTGG-TAATACAGCGAAACTGCGAACGGCTCATTATATCTGTTATAATTCCCATGATTGTGCGTT-----GTGTAGACGGATACATGTGGCAAATCTAGAATCAATACGTGC--TTGGAGGCCCGACTTTTG------GGGAGGGCCGCACTTATTAGACCT--AAACCAGTAGG---------CTCTCGGGCCTTGTGATGGTGAGTCATAGTAATTGAGCGAATCGCAT-----AGCCCTC-GGGCGGCGATGAATCATT-CAAGTTTCAGCCCCATCAGTTGTCGACGGGAGGGTATTGGCCTCCCGTGA-CCGTTACGGGTGAC--GGGGA-TTAGGG-TTCGATTCCGGAGAGGGCAGCTCTGAGAGACGGCTACCACATC-CAAGGAGAGGCAGCAGGCGCGTAAATTACT-GCAAGTCTTACAGAACGAAGTAGTGA-CGAGAAATAGCAGTGAGGTCGCG------CTGTGCGTATCTCGACTGAAATGAGAGCGATTTAAAACCCCCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCGTATAC-TAAA-GTTGTTGCAGTTAAAAAGCTCGGTAAGGTCCGAATGTATGGTTGGTGTGGCGTGTCGGTGGGGGGGTTGAATGGCCTGGCGGACCGGTGGCCA--GGTGGCGCGGCCGAGTC--GGGCAGCCCTGCGGGGGG----------------GCGTGGCCCCTTCCCCGTGTAAAAAAATAGAGGGTTTTCA--CAACCAAGAGGT-TGTATTGGAATATGA-TAGTATGGGATGATGAGATAGGCCGTTGG--CGGTATTTTGTTGGTTT-GCGCGTTGGCGGAA-TGATGAAGAGGGACAG-TTGGGGGTATTCGAA-TTCTAGTGGTCAGAGGTGAAATTCTTGGATTACTAGAAGGCGAACGACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTGATC-AAGAACG-AAAGTATGGGGATCGAAGA-TGATTAGATACCATCGTAGTCCATACCGTAAA-CGATGCCGACTCGCGATCGTTTCCCGGCTCTT-------GAAGCGGG-AGGCG-GCAGCGCA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCAGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTGATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GTGCGCGT-TGTGGCGACACAACG--TAGGAGTACTTCTTAGAGGGAC-ACTTTGGGTTTACC--AGAGGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTGTTTCTTGTTC-------------TTTGGGATGAGTTCCTGGGCCGGAAGGTTTGGG-TAATCGTGTGAATACCAGTCGTGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGTTCCGGTGAGACCTTCGGAGGGCACGTTGTTCCTGGCGACAGGAGTTCGTGGCCA-----AAGTTGAGCAAACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGG-------------------------------- Thraustochytrium_striatum -----------TGATCCTGCCAGTAATCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCGA-TTTATACTGTGAAACTGCGAACGGCTCATTATATCAGTTATAGTTTCTTTGATAGTGTTTTT-------TAGATGGATACTTGTGGCAAATCTAGAAACAATACATGC--TTATAGGCCCGACTTTTA------GGGAGGGCTGCATTTATTTGATAT--AAACCAATAC----------CTTTCGGGG-TTGTTTTGGTGATTCAGAATAACTAAGCGAACCGCAGT----GGCCTTTGTGCCGGCGGTGAATCATT-CAAGTTTCTGCCCCATCAGCTGTCGACGGTAGTGTATTGGACTACCGTGG-CCATCACGGGTGAC--GGAGAATTAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGTAAATTACT-CAATGTTG-ACTCGACGAAGTAGTGA-CGAGAAATACACATGCGGTGCA-------CTCAGTGTATTGCAATGTGAATGAGAGCAATGTAAAAGCCTCATCGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCAAT-AGCATATAT-TAAC-GTTGTTGCAGTTGAAAAGCTCG-TAG---TTGAACTTTTGGTATGGGCGACCTGGCCT----TGGGCGCATGCCTTGGTTTTGCCGTGTGTC-GGACCTGG-----CCATCCTTCAC-ATTTCTATTTTTTGGGGTGT-----------------GATCATTTACTGTGAGTAAACT-GGAGTGCTCA--AAACAAGACGTT--TGTTTGGTACATCA-AAGCATGGAATAATAAGATAGGACCTGGT--TACTATTT-GTTGGTTT-GCATAGCTAGGTAA-TGATTAACAGGGACAG-TTGGGGGTATTCGTA-TTTAATTG-TCAGAGGTGAAATTCTTGGATTTATG-AAGACGAACGACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCGTAAA-CTATGCCGACTTGCGATTGTCCGATGTTCGTA--------ATGGACTTGGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GTTTAGTG-TATCGCAAGATACT---GTTTCTGGCTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCC-CACGCGCGCTACACTGATGAATTCAACGAGTTTTTTTGTTTCTTT----------GGAAATAAAATGTCCTTGATCGGAAGGTCTGGG-TAATCTTTTGAATGTTTATCGTGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGGTGAAATCTTGGGATTTGTCGTATGTGGCTTTATTGTCTTGTATG-ACGAAG---AACTTGAGTAAACCTTACCGTTTAGA------------------------------------------------------ Ulkenia_amoeboidea --------------CCTGCCAGTAATCGCACGCT-TGTCTCAAAGA?TAAGCCATGCATGTCTAAGTATAAGCGAT-TTATACGGTGAAACTGCGAACGGCTCATTAAAACAGTTATAGTTTCTTTGAAAATGTTTG------ATTAGATGGATACTTGTGGCAAATCTAGAAATAATACATGC--TTTAGGGCCCGACTTTTG------GGAAGGGCTGCATTTATTAGATAT--AAACCAATACC----------TCTCGGGG-TTGTTTTGGTGATTCATAGTAACTAGGCGAATCGCAGAG----GTGTTTGTGCCGGCGATGT-TCATT-CAAGTTTCTGCCCCATCAATTGTCGATGGTAGGGTATTGGCCTACCATGA-TTGTTACGGGTGAC--GGAGAATCAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACT-CAATGTCAATTCGA-CGAAGTAGTGA-CGAGAAATAACAGTGGGGTGGG------CTAAGCCTA-CTCTTTCTGTAATGAGAGCAATCTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAACT-CCAG-CTCCGGT-AGCGTGTAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAGTATTGGTAGGACGGACCAGGC-TTTTCGGCG--AATGCTGA?GTATGCTTTTGT----GTTTGATC--TGGCCATGGTTGCTCGTTTGCGCCTTTGGGCGTGGGT------------GGGCATCATTTACTGTAAAAAAATT-AGAGTGTTTC--AAGCAAATCGTAT--GGTTGGAATAGAG-TAGTATGGAATAATAAGATAGGACTTTGT--TGCTATTTTGTTGGTTT-GCACATCAAAGTAA-TGATTAACAGGGACAG-TTGGGGGTATTCGTA-TTTGGTTG-TCAGAGGTGAAATT?TTGGATTTACAAAAGACGAACAACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCGTAAACGATGCCGACT-TGCGATTGTCCGATGTTTTTTTTT---?AATAGACTTGGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGG-AAGGATTGACAGAGTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GTACGTGC-TATGGTGACATAGT-GGCGAG---ACTTCTTAGAGGGAC-ATTTCGGTTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGATTCAACGAGTATGTGTTGTTTG------TTTAACGATGAATGACGGTCCTAAACAGGAATGTCC?GG-CAATC?TTTAAATGTCCATCGTGATGGGGCTAGATTTTTGCAATTCTTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAAATCTTCGGATCCTGTTGTTTTGCGTTTGTT-CGTGTGATG-ACGGG--AAAAGTTGAGTAAACCTTATCGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAACCCTGCGGAAGGA----- Ulkenia_profunda ---AACCTGGTTGATCCTGCCAGTAATCGCACGCTGGTCTCAAAGACTAAGCCATGCATGTCTAAGTTTAAGCAA--TTAAACGGTGAAACTGCGAACGGCTCATTAAATCAGTTATAGTTCCTTTGAAAATGTTTTC----ATTTAGGTGGATACTTGTGGCAAATCTAGAACTAATACATGC--ATAACGGCCCGACTTTTG------GGAAGGGCTGCATTTATTAGCATT--AAACCAATAC---------CTCTTCGGGGGTTGTTTTGGTGATTCATAATAACTAAGCGAATCGCAGA------TGCTTCGGCAGGCGATGT-TCATT-CAAGTTTCTGCCCCATCAATTGTCGATGGTAGGGTATTGGCCTACCATGA-TTGTTACGGGTGAC--GGAGAATCAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACT-CAATGTCA-ATTCGACGAAGTAGTGA-CGAGAAATAACAGTGGGGTGGG-------CTTCGCCTACTCTTTCTGTAATGAGAGCAATCTAAAAACCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAACT-CCAG-CTCCGGT-AGCGTGTAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAGTATTGGTAGGGCTGACCTGATCT-GGCGGTG--AATGCCGCTA-GTTTTTCAGTGTC-GTGCCTGG-----CCATCCTTTC---CGTTTTCTTTTTAAGGAAT----------GGG-----ATCATTTACTGTAAAAAAATT-AGAGTGTTTC--AAGCAAGTTGTA-TTAACTGGAATATAG-TAGTATGGAATAATAAGATAGGACTTTGA--TACTATTTTGTTGGTTT-GTATATCAAGGTAA-TGATTAACAGGGACAG-TTGGGGGTATTCGTA-TTTGGTTG-TCAGAGGTGAAATTCTTGGATTTACAAAAGACGAACAACTGCGAA-GCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCGTAAA-CGATGCCGACTTGCGATTGTCCGATGTTTGTT-------ATAAGACTTGGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCG-CTCAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GTACGCGT-TATGGTAACATAG----CAGTGAGACTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGATTCAACGAGTATTGTTCTATGC------TTTTCGGAGTGTGGGATGTCCTGGGCAGGAATGTCTGGG-TAATCTTTTAAATGTCCATCGTGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAAATCTTCGGATTCTGTCATGTTGCCTTTTATTAGTGGTATG-ACGGG--AAAAGTTGAGTAAACCTTATCGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCAGAAGGATC---- Ulkenia_profunda_BUTRBG_111 ---AACCTGGTTGATCCTGCCAGTAATCGCACGCTGGTCTCAAAGACTAAGCCATGCATGTCTAAGTTTAAGCAA--TTAAACGGTGAAACTGCGAACGGCTCATTAAATCAGTTATAGTTCCTTTGAAAATGTTTTC----ATTTAGGTGGATACTTGTGGCAAATCTAGAACTAATACATGC--ATAACGGCCCGACTTTTG------GGAAGGGCTGCATTTATTAGCATT--AAACCAATAC---------CTCTTCGGGGGTTGTTTTGGTGATTCATAATAACTAAGCGAATCGCAGA------TGCTTCGGCAGGCGATGT-TCATT-CAAGTTTCTGCCCCATCAATTGTCGATGGTAGGGTATTGGCCTACCATGA-TTGTTACGGGTGAC--GGAGAATCAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACT-CAATGTCA-ATTCGACGAAGTAGTGA-CGAGAAATAACAGTGGGGTGGG-------CTTCGCCTACTCTTTCTGTAATGAGAGCAATCTAAAAACCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAACT-CCAG-CTCCGGT-AGCGTGTAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAGTATTGGTAGGGCTGACCTGATCT-GGCGGTG--AATGCCGCTA-GTTTTTCAGTGTC-GTGCCTGG-----CCATCCTTTC---CGTTTTCTTTTTAAGGAAT----------GGG-----ATCATTTACTGTAAAAAAATT-AGAGTGTTTC--AAGCAAGTTGTA-TTAACTGGAATATAG-TAGTATGGAATAATAAGATAGGACTTTGA--TACTATTTTGTTGGTTT-GTATATCAAGGTAA-TGATTAACAGGGACAG-TTGGGGGTATTCGTA-TTTGGTTG-TCAGAGGTGAAATTCTTGGATTTACAAAAGACGAACAACTGCGAA-GCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCGTAAA-CGATGCCGACTTGCGATTGTCCGATGTTTGTT-------ATAAGACTTGGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCG-CTCAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GTACGCGT-TATGGTAACATAG----CAGTGAGACTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGATTCAACGAGTATTGTTCTATGC------TTTTCGGAGTGTGGGATGTCCTGGGCAGGAATGTCTGGG-TAATCTTTTAAATGTCCATCGTGATGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAAATCTTCGGATTCTGTCATGTTGCCTTTTATTAGTGGTATG-ACGGG--AAAAGTTGAGTAAACCTTATCGTTT--------------------------------------------------------- Ulkenia_visurgensis_ATCC_28208 -----CCTGGTTGATCCTGCCAGTAATCGCACGCTTGTCTCAAAGACTAAGCCATGCATGTCTAAGTATAAGCGA-TTTATACGGTGAAACTGCGAACGGCTCATTAAAACAGTTATAGTTTCTTTGAAAATGTTT------GATTAGATGGATACTTGTGGCAAATCTAGAAATAATACATGC--TTTAGGGCCCGACTTTTG------GGAAGGGCTGCATTTATTAGATAT--AAACCAATAC----------CTCTCGGGG-TTGTTTTGGTGAT-CATAGTAACTAGGCGAATCGCAGA----GGTGTTT-GTGCCGGCGATGTTCATT-CAAGTTTCTGCCCCATCAATTGTCGATGGTAGGGTATTGGCCTACCATGA-TTGTTACGGGTGAC--GGAGAATCAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACT-CAATGTCA-ATTCGACGAAGTAGTGA-CGAGAAATAACAGTGGGGTGGG-------CTAAGCCTACTCTTTCTGTAATGAGAGCAATCTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAACT-CCAG-CTCCGGT-AGCGTGTAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAGTATTGGTAGGACGGACCAGGCTT-TTCGGCG--AATGCTGAGGTATGCTTTTGTGTT-TGATCTGG-----CCATGGTTGCT--CGTTTGCGCCTTTGGGCGT----------GGGTGGGCATCATTTACTGTAAAAAAATT-AGAGTGTTTC--AAGCAAATCGTA-T-GGTTGGAATAGAG-TAGTATGGAATAATAAGATAGGACTTTGT--TGCTATTTTGTTGGTTT-GCACATCAAAGTAA-TGATTAACAGGGACAG-TTGGGGGTATTCGTA-TTTGGTTG-TCAGAGGTGAAATTCTTGGATTTACAAAAGACGAACAACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCGTAAA-CGATGCCGAT-TGCGATTGTCCGATGTTTTTTTA--TTGAATAGACTTGGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GTACGTGC-TATGGTGACATAG----TGGCGAGACTTCTTAGAGGGAC-ATTTCGGTTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCC-CACGCGCGCTACACTGATGGATTCAACGAGTATGTGTTGTTTG------TTTAACGATGAATGACGGTCCTAGACAGGAATGCC-GGG-CAATCTTTTAAATGTCCATCGTGATGGGGCTAGATTTTTGCAATTCTTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAAATCTTCGGATCCTGTTGTTTTGCGTTT-GTTCGTGTGATG-ACGGGA--AAAGTTGAGTAAACCTTATCGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAG-TGAACCTGCAG----------- Ulkenia_visurgensis_BURAAA_141 -----CCTGGTTGATCCTGCCAGTAATCGCACGCTTGTCTCAAAGACTAAGCCATGCATGTCTAAGTATAAGCGA-TTTATACGGTGAAACTGCGAACGGCTCATTAAAACAGTTATAGTTTCTTTGAAAATGTTT------GATTAGATGGATACTTGTGGCAAATCTAGAAATAATACATGC--TTTAGGGCCCGACTTTTG------GGAAGGGCTGCATTTATTAGATAT--AAACCAATAC----------CTCTCGGGG-TTGTTTTGGTGAT-CATAGTAACTAGGCGAATCGCAGA----GGTGTTT-GTGCCGGCGATGTTCATT-CAAGTTTCTGCCCCATCAATTGTCGATGGTAGGGTATTGGCCTACCATGA-TTGTTACGGGTGAC--GGAGAATCAGGG-TTCGATTCCGGAGAGGG-AGC-CTGAGAGACGGCTACCACATC-CAAGGA-AGGCAGCAGGCGCGCAAATTACT-CAATGTCA-ATTCGACGAAGTAGTGA-CGAGAAATAACAGTGGGGTGGG-------CTAAGCCTACTCTTTCTGTAATGAGAGCAATCTAAAACCCTCATCGAGGATCAA-CTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAACT-CCAG-CTCCGGT-AGCGTGTAT-TAAA-GTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAAGTATTGGTAGGACGGACCAGGCTT-TTCGGCG--AATGCTGAGGTATGCTTTTGTGTT-TGATCTGG-----CCATGGTTGCT--CGTTTGCGCCTTTGGGCGT----------GGGTGGGCATCATTTACTGTAAAAAAATT-AGAGTGTTTC--AAGCAAATCGTA-T-GGTTGGAATAGAG-TAGTATGGAATAATAAGATAGGACTTTGT--TGCTATTTTGTTGGTTT-GCACATCAAAGTAA-TGATTAACAGGGACAG-TTGGGGGTATTCGTA-TTTGGTTG-TCAGAGGTGAAATTCTTGGATTTACAAAAGACGAACAACTGCGAAAGCATTTACCAAGGA---TGTTTTCATTAATC-AAGAACG-AAAGTTAGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTTAACCGTAAA-CGATGCCGAT-TGCGATTGTCCGATGTTTTTTTA--TTGAATAGACTTGGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GGCTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAA-CTTACCAGGT-CCAGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCACAGCCTACTAAATA--GTACGTGC-TATGGTGACATAG----TGGCGAGACTTCTTAGAGGGAC-ATTTCGGTTTTACC--GGAAGGAAGTTTGTGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCC-CACGCGCGCTACACTGATGGATTCAACGAGTATGTGTTGTTTG------TTTAACGATGAATGACGGTCCTAGACAGGAATGCC-GGG-CAATCTTTTAAATGTCCATCGTGATGGGGCTAGATTTTTGCAATTCTTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGATCCGGTGAAATCTTCGGATCCTGTTGTTTTGCGTTT-GTTCGTGTGATG-ACGGGA--AAAGTTGAGTAAACCTTATCGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTTCCGTAG-TGAACCTGCAG----------- l_quahog_parasite_QPX_1 -----------------------AGTCATACGCTCA-AGTCAAAGATTAACCCATGCATGTGCAAGTATAAACA--TTTATACTGTGAAACTGCGAACGGCTCATTATATCAGCTATAGTCTATTTGGTAATGTCT-------ACTACTTGGATACTCGTAGTAATTCTAGGGTCAATACATGC--ATAAATGCCCAACTTTTC------GGACGGGCAGTATTTATTTGATAT--AAACCAATCGCT------------TCTGGCGTTTTGTGGTGATTCAAAGTAACTAAGCGGACCGCAGTGC------CTTTTGGCGGCGGTGGACCATT-CGAGTTTCTGCCCTATCAGTTGTCGTAGGTAGTGTATTGGACTACCTAGA-CCTTTACGGGTGAC--GGAGAATTGGGG-TTCGATTCCGGAGAAGA-AGC-CTGAGAGACGGCTACTACATC-CAAGGA-AGGCAGCAGGGGCGCAAATTACC-CAATGGTGACACGC-CGAGGTAGTGA-CAACCAATATCGTTGCG-GA-CCCTTA-----TGGGTTTTGCTA-TGAAATGAGTGCAATCTAAAATACTCAACGAGGATCAA-TTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT-CCAG-CTCCGTT-AGCGTATAT-TAAA-TTTGTTGCAGTTAAAAAGCTCG-TAG---TTGAATTTCTGGTAGGAG-TGACCTGGCCTTTGACG---AATGT---CAATGTTT-GCTG---TGTGTCATCTCTGGCCATCCTCGGCCTGCTTTTAGTA-----------------------GGCCGTCATTTACTGTAAAAAAATT-AGAGTGTTTC--AAGCATTTTGTA--TGAAAAGAATATA-TTAGTATGGAATAATAAGATAGGACTTTGG--TGCTATTTTGTTGGTTT-GCACACCAAAGTAA-TGATGAATAGGGACAG-TTGGGGGTATTCGTA-TTTAATTG-TCAGAGGTGAAATTCTTGGATTTATGAAAGACGAACTACTGCGAAGGCATTTACCAAGGA---TGTTTTCATTGATC-AAGAACG-AAAGTATGGGGATCGAAGA-TGATTAGATACCATCGTAGTCTATACTTCAAACTATGCCGACT-TGCGATTGTCTGGTGGTG-------TTTTTTGGCCCCAGGCA-GCAGCACA-TGAGAAATCA-AAGTC-TTTGGGTTCC-GGGGGGAGTATGGTCGCAA-GATTGAAA-CTTAAAGGAATTGACGGAAGGGCA--CCACCAGGAG---TGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAA-CTTACCAGGT-CCAGA-CATAGG-AAGGATTGACAGATTGAGA-GCTCTTTCTT-GATTCTATGGGTGG-TGGTGCATGGCC-GTTCTTAGTT-GGTGGAGTG-ATTTGTCTGG-TTAATTCCGTTAACGAACGAGACCTCAGCCTACTAAATA--GTACTGCT-TTTCGCAAGA-----AAGGTAGAGACTTCTTAGAGGGAC-ATTTCGGGTTTACC--GGAAGGAAGTTTGAGGCAA-TAACAGGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGATTCAACAAGTTTAC-------------------TATTTTATAGTTGTCCTTGGTCGGAAGGCCTGGG-TAATCTTTTAAATGTCTATCGTGATGGGGCTAGATTTTTGCAATTATTAATCTCTAACGAGGAATTCCTAGTAAGCGCAAGTCATCAACTTGCACTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAATGGTCCGGTGAAATCTTCGGATTCTGCATTTTGTTCTTTATTGGGCAGTTTG----CGGAAAAAGTTGAGTGAACCTTACCATTTAGAGGAAGGTGAAGTCGTAACAAGGTCTCC--------------------------- ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Labyrinthulomycetes_SSU) = N: 1-1983; CODONPOSSET CodonPositions (CHARACTERS = Labyrinthulomycetes_SSU) = N: 1-1983; END; BEGIN TREES; TITLE Tb8668; LINK TAXA = Taxa1; TRANSLATE 1 Ulkenia_visurgensis_BURAAA_141, 2 Ulkenia_visurgensis_ATCC_28208, 3 Ulkenia_profunda_BUTRBG_111, 4 Ulkenia_profunda, 5 Ulkenia_amoeboidea, 6 Thraustochytrium_striatum, 7 Thraustochytrium_sp._KK17_3, 8 Thraustochytrium_sp._C9G, 9 Thraustochytrium_sp._BURABG_162, 10 Thraustochytrium_pachydermum, 11 Thraustochytrium_kinnei, 12 Thraustochytrium_aureum, 13 Thraustochytrium_aggregatum, 14 Sicyoidochytrium_sp._SEK354, 15 Sicyoidochytrium_sp._MBIC11077, 16 Sicyoidochytrium_sp._MBIC11071, 17 Schizochytrium_sp._SEK346, 18 Schizochytrium_sp._SEK345, 19 Schizochytrium_sp._SEK210, 20 Schizochytrium_aggregatum, 21 Parietichytrium_sp._SEK364, 22 Parietichytrium_sp._SEK351, 23 Parietichytrium_sp._MBIC11085, 24 Parietichytrium_sp._H1_14, 25 Parietichytrium_sp._F3_1, 26 Ochromonas_danica, 27 Oblongichytrium_sp._SEK347, 28 Oblongichytrium_multirudimentalis, 29 Oblongichytrium_minuta, 30 Labyrinthula_sp._N8, 31 Labyrinthula_sp._N12, 32 Labyrinthula_sp._L72, 33 Labyrinthula_sp._L59, 34 Labyrinthula_sp._AN1565, 35 l_quahog_parasite_QPX_1, 36 Japonochytrium_sp._ATCC_28207, 37 Botryochytrium_sp._Raghukumar_29, 38 Botryochytrium_sp._BUTRBC_143, 39 Botryochytrium_radiatum_SEK353, 40 Botryochytrium_radiatum_Raghukumar_16, 41 Bacillaria_paxillifer, 42 Aurantiochytrium_sp._SEK218, 43 Aurantiochytrium_sp._SEK217, 44 Aurantiochytrium_sp._SEK209, 45 Aurantiochytrium_sp._N1_27, 46 Aurantiochytrium_sp._MBIC11093, 47 Aurantiochytrium_sp._KH105, 48 Aurantiochytrium_mangrovei, 49 Aurantiochytrium_limacinum, 50 Aplanochytrium_stocchinoi, 51 Aplanochytrium_sp._PR24_1, 52 Aplanochytrium_minuta, 53 Aplanochytrium_kerguelense; TREE Fig._5 = [&R] ((((((34,(30,31)),(33,32)),(53,50,(51,52))),((28,29),27)),(((((((((20,(17,(19,18))),7),11),(((38,40),39,37),((25,((22,21),23)),24))),12),6),(((36,5),(1,2)),(4,3))),13),(((((((((49,48),47),9),(43,42)),46),44),45),(14,15,16)),((10,8),35)))),26,41); END;