#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on January 27, 2020; 3:14 GMT TreeBASE (cc) 1994-2008 Study reference: Lakner C., Mark P., Huelsenbeck J., Larget B., & Ronquist F. 2008. Efficiency of Markov Chain Monte Carlo Tree Proposals in Bayesian Phylogenetics. Systematic Biology, 57(1): 86-103. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1915] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=50; TAXLABELS Acraea_andromacha Actinote_genitrix Actinote_stratonice Anthocharis_midea Antirrhea_sp. Asterocampa_clyton Batesia_hypochlora Biblis_hyperia Boloria_bellona Caligo_idomeneus Catonephele_acontius Ceratinia_nise Cercyonis_pegala Colobura_dirce Diaethria_clymena Dione_juno Doxocopa_sp._RB273 Dryadula_phaetusa Dryas_iulia Eresia_nauplius Eueides_vibilia Euphydryas_phaeton Euptoieta_claudia Haetera_piera Hamadryas_chloe Heliconius_erato Hypna_clytemnestra Hypolimnas_bolina Laparus_doris Libytheana_carinenta Limenitis_arthemis Marpesia_orsilochus Mechanitis_polymnia Megisto_cymela Memphis_sp._RB226 Morpho_helenor Neruda_metharme Oleria_aquata Opsiphanes_cassina Panacea_divalis Philaethria_dido Phyciodes_tharos Pieris_rapae Podotricha_telesiphe Prepona_sp._RB256 Siproeta_stelenes Taygetis_sp._RB294 Tisiphone_abeona Vanessa_atalanta Vila_semistalachtis ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2907] TITLE 'ABrower2000_wingless50'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=378; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acraea_andromacha CTGTACAGTAAAGACATGTTGGATGAGGCTGCCTAGTTTCCGTTCTGTGGGAGACGCTTTGAAAGATCGCTTCGATGGAGCATCTCGAGTAATGATGCCGAACACGGAAGTTGAAGTACCTGTACAAAGGAACGACGCGGCAGCC---CACCGAGTTCCTCGGAGGGATCGCTATAAATTCCAACTAAGGCCACATAATCCAGATCACAAAACACCTGGACTCAAAGATTTAGTGTATCTAGAACCATCACCAGGCTTCTGCGAGAAGAACCCGAGGCTTGGCATTCCCGGAACACACGGGCGTGCCTGCAACGATACTAGCATCGGAGTCGATGGTTGCGATCTCATGTGCTGTGGCCGTAGGTACCGGACTGAGAC Actinote_genitrix CTGCACAGTTAAGACCTGTTGGATGAGGTTGCCTAGTTTCCGCTCAGTGGGAGATATCTTGAAAGACCGCTTCGATGGAGCATCGCGAGTAAAGATGCCGAATACGGAGGTTGACGTACCTGTTCAAAGGAACGACGCAGCAGCC---CACCGAATCCCTCGAAAAGACCGTTACAAATTTCAACTAGGTCCATATAATCCAGAACATAAGACACCTGGATTCAAAGATTTAGTGTACCTGGATCCATCACCTGGCTTCTGCAACAAGAACACGAAGCTTGGCATTCCTGGTACTAAGGGGCGCGCCTGTAACGATACTAGCATCGGTGTTGATGGTTGTGATCTAATGTGTTGCGGTCGCGGATACCGAACTGAGAC Actinote_stratonice CTGCACAGTTAAGACCTGTTGGATGAGGTTGCCTAGTTTCCGCTCAGTGGGAGATATCTTGAAAGACCGCTTTGATGGAGCATCGCGAGTAAAGATGCCGAATACGGAGGTTGATGTACCTGTTCAAAGGAACGACGCAGCAGCC---CACCGAATTCCTCGAAAGGACCGTTACAAATTCCAACTAGGTCCATATAATCCAGAACATAAGACACCTGGATTCAAAGATTTAGTGTACCTGGATCCATCACCTGGCTTCTGCAACAAGAACACGAAGCTTGGCATTCCTGGCACTAAGGGGCGTGCCTGTAACGATACTAGCATCGGTGTTGATGGTTGCGATCTTATGTGTTGCGGTCGCGGATACCGAACTGAGAC Anthocharis_midea TGGAACAGTGAAGACTTGCTGGATGCGGCTGCCCAGTTTTCGTTCTGTTGGCGATGCGCTAAAAGACCGCTTTGACGGGGCATCCCGAGTGATGATGTCTAACACGGACCTCGAAACGCCAGTACAGAGGAACGACGCAGCGCCA---CACAGAGTACCGCGAAGGGATCGATACAGATTCCAATTGCGGCCGCACAACCCCGATCATAAGTCGCCGGGAACCAAAGACCTCGTGTACCTGGAATCATCACCGGGTTTCTGCGAAAAGAACCCGAGGCTGGGCATTTCCGGCACGCACGGGCGCACCTGCAACGATACGAGTATCGGAGTCGACGGCTGCGACCTCTTGTGTTGCGGACGCGGATATCGGACTGAAAC Antirrhea_sp. CTGCTCCGTGAAGACGTGCTGGATGAGGCTGCCGAGTTTTCGGTCTGTGGGCGACGCTTTGAAGGACGGCTTCGATGGGGCGTCGCGGGTCATGATGCCCAACACAGAGGTTGAAGTGCCAGTCCTGCGAAACGATGCGGCTCCT---CACAGAGTCCCGCGGCGAGACCGTTACAGATTCCAACTTCGGCCGCACAATCCTGACCACAAATCACCGGGGGTCAAGGACCTAGTATACTTAGAATCATCGCCGGGTTTCTGTGAAAAGAATCCAAGGCTGGGCATTCCCGGTACGCACGGGCGTGCCTGCAACGATACGAGTATCGGTGTCGACGGCTGCGAGCTCATGTGCTGCGGCCGCGGATACCGCACGGAGAC Asterocampa_clyton CTGTACTGTAAAGACCTGTTGGATGAGGCTCCCAAGTTTTCGCTCCGTGGGTGATGCATTAAAAGATCGCTTCGATGGGGCATCGCGAGTCATGATGCCTAATACAGAAGTCGAAGCACCCGTGCAGCGTAACGACGCAGTGTCT---CACAGAGTTCCAAGAAGAGATCGGTACAGATTCCAACTACGCCCGCACAATCCCGATCATAAAACACCCGGGGTCAAGGACCTAGTGTACCTAGAATCATCGCCGGGCTTCTGTGAAAAGAACCCGAGACTGGGCATTCCCGGCACGCACGGGCGTGCCTGCATCGATACGAGTATCGGTGTAGGCGGCTGCGATCTTATGTGTTGTGGCCTCGGTTACCGCACGGAGAC Batesia_hypochlora CTGCACCGTAAAGACCTGCTGGATGATGCTGCCCAATTTCCGCTCCGTGGGTGATGCGTTGAAAGATCGCTTTGATGGGGCGTCGCGTGTCATGATGCCCAATACTGAACTCGAGGCATCCGTGCAGCGGAACGACGCATCGCCT---CAGAGGGTTCCAAAAAAAGATCGGTACCGATTTCAACTTCGGCCATACAATCCCGATCACAAAACACCTGGGGTCAAGGACCTAGTGTACCTAGAATCATCGCCAGGCTTCTGTGAAAAGAACCCGAGACTGGGCATTCCCGGTACACACGGACGTGCCTGCAACGATACGAGTGTCGGCGTCGACGGCTGTGACCTCATGTGTTGCGGGCGCGGTTACCGGACCGAGAC Biblis_hyperia CTGCACAGTTAAGACTTGCTGGATGAGGTTGCCGAGTTTCCGCTCCGTGGGTGATGCGCTAAAAGATCGCTTCGACGGGGCGTCTCGAGTCATGATGCCCAATACGGAAATAGAAGCACCCGTGCAGAGAAACGACGCAGCGCCT---CACAGAGTTCCAAGAAGAGATCGGTACAGATTCCAGCTCCGGCCGCACAATCCTGACCACAAGACGCCCGGGGTCAAGGACCTAGTGTACCTAGAATCATCGCCAGGTTTCTGTGAAAAGAACCCGAGGCTGGGCATTCCCGGTACGCACGGTCGTGCCTGCAACGACACGAGTATCGGCGTCGACGGCTGTGACCTCATGTGCTGCGGGCGCGGCTACAGAACCGAGAC Boloria_bellona CTGTACAGTTAAGACATGCTGGATGAGGCTACCAAGTTTCCGATCTGTGGGAGATGCATTAAAGGACCGCTTTGATGGAGCTTCGCGGGTTATGATACCTAACACAGAAGTCGAAGCTCCTATACCACGTAACGATGCAGCAGCT---CACAGAGTTCCCCGAAGGGATCGGTACAAATTTCAACTTCGACCGCATAATCCTGACCATAAAACACCAGGGGTCAAGGATCTAGTATACCTCGAATCATCGCCGGGTTTCTGTGAAAAGAACCCGAGGCTGGGCATTCCCGGCACGCACGGGCGTGCCTGCAATGATACTAGCATTGGCGTCGACGGGTGCGATCTCATGTGTTGTGGCCGCGGCTACCGGACTGAGAC Caligo_idomeneus ?????CTGTTAAGACTTGTTGGATGAGACTGCCGAGTTTTCGATCCGTGGGCGATGCTTTGAAAGATAGTTTTGATGGAGCGTCGCGGGTAATGATGCCCAATACGGACGTAGAGGCTCCAGTACAAAGAAATGATGCAGCTCCT---CACAGGCTTCCACGAGGAGACCGTTACAGATTCCAACTTCGGCCGCACAACCCTGACCACAAAGCACCCGGGGTCAAAGACTTAGTATACTTAGAATCATCTCCGGGTTTCTGTGAAAAAAATCCGAGGCTAGGCATCCCCGGTACACACGGGCGTGCCTGCAACGACACTAGCATCGGTGTTGATGGCTGCGAGCTCATGTGCTGCGGCCGTGGTTACCGGACCGAGAC Catonephele_acontius TTGCACAGTAAAGACCTGCTGGATGAGGCTGCCCAGTTTCCGCTCCGTGGGTGATGCATTGAAAGATCGTTTCGACGGGGCATCGCGGGTCATGATGCCTAACACGGAAATCGAAGCACCCGTGCAGCGAAACGACGCAGCGCCT---CACAGGGTGCCAAAAAGAGATCGGTACAGGTTCCAGCTTAGACCGCACAATCCCGATCACAAAACACCCGGGGTTAAAGACCTAGTTTACCTAGAATCATCGCCGGGCTTCTGTGAAAAGAACCCGAGGCTGGGCATTCCCGGTACGCACGGGCGTGCCTGCAACGATACGAGTATCGGCGTCGACGGCTGCGACCTCATGTGTTGCGGGCGCGGCTACCGGACCGAGAC Ceratinia_nise CTGCACAGTGAAAACTTGCTGGATGAGGCTACCAAGTTTTCGCTCTGTGGGTGATGCCCCAAAAGACCTTATTGACGGCGCCTCACGGGTGATGATGCCCAACACAGAAGTAGAAGCGCCGGTACAGCGGAATGACGCAGCAAAC---CACAGAGTTCCACGAAGAGATCGATACAGATTTCAACTTCGGCCTCATAATTCCGACCACAAGACCCCTGGGGTAAAAGACCTGGTATACCTAGAATCGTCCCCAGGTTTCTGTGAAAAAAACCCTAGGTTGGGCATTCCCGGCACGCACGGACGTGCTTGCACCGACACGAGTATCGGCGTAGACGGCTGCGACCTCATGTGTTGCGTCCGCGGTTACCGGACGGAGAC Cercyonis_pegala CTGCACGGTGAAGACGTGCTGGATGAGGCTGCCGACGTTCCGGTCTGTAGGCGATGCCCTAAAGGATGGCTTCGACGGAGCGTCGCGGGTCATGATGCCCAATACAGAGGTGGAAGCGCCGGCTCAGCGGAACGATGCCGCTCCG---CACAGAGTGTCGCGACGAGACCGGTACAGATTTCAACTCCGGCCGCACAATCCTGACCACAAAACGCCTGGGGTCAAGGACCTAGTATACCTGGAATCCTCGCCGGGTTTCTGCGAAAAGAACCCTCGGCTGGGCATTCCCGGTACGCACGGGCGTGCCTGCAACGACACGAGTATCGGCGTCGACGGCTGCGACCTCATGTGCTGCGGCCGCGGCTACCGGACCGAGAC Colobura_dirce CTGTACTGTTAAGACTTGCTGGATGAGATTACCCAGTTTTCGTTCTGTGGGTGATGCGTTAAAAGATCGTTTTGATGGAGCGTCACGGGTCATGATGCCTAATACAGAAATTGAAGCACCCGTACAACGAAATGACGCAGCGCCT---CACAGAGTTCCACGAAGAGATCGGTACAGATTTCAACTTCGACCCCACAATCCTGATCATAAAACACCGGGGGCTAAAGACCTAGTGTACCTAGAATCATCACCGGGTTTTTGTGATAAGAACCCGAGGCTGGGCATCCCCGGTACACACGGGCGTGCCTGCAACGACACAAGCATCGGCGTCGACGGCTGTGACCTTATGTGTTGCGGCCGTGGTTACCGAACCGAAAC Diaethria_clymena CTGTACTGTAAAGACCTGCTGGATGAGGCTGCCTAGTTTCCGGTCAGTGGGTGATGCATTAAAAGATCGCTTTGATGGGGCGTCGCGGGTCATGATGCCCAACACAGAAGTTGAAGCACCAGTGCAGCGAAACGACGCAGCACCT---CACAGGGTTCCAAGAAGAGATCGGTATAGGTTTCAACTAAGACCGCACAATCCCGACCACAAGACTCCTGGAGTCAAAGACCTGGTGTACCTAGAACCATCACCAGGCTTTTGTGAAAAAAACCAGAGGCTGGGCATTCCCGGTACACACGGGCGTTCCTGCAACGATACGAGTATGGGCGTCGAAGGCTGTGACCTCATGTGTTGCGGGCGCGGCTTCCGGACCGAAAC Dione_juno CTGCACAGTCAAGACTTGCTGGATGAGGCTTCCCAATTTTAGATCAGTGGGAGACGCCCTGAAGGATCGCTTCGACGGAGCCTCGCGGGTCATGATGCCTAATACGGAAGTTGAAGTACCTGTTCAAAGGAATGACGCAGCTGCG---CACAGAGTTCCTAGAAGAGATCGATATAAGTTCCAACTCCGTCCACACAACCCTGATCATAAAACACCTAGTGTCAAAGATTTGGTATACCTAGAACCATCACCGGGTTTCTGCGAGAAGAACCCGAGGCTGGGCATTCCCGGCACGCACGGGCGTGCCTGCAACGATACTAGCATCGGCGTCGACGGCTGCGATCTCATGTGTTTCGGCCGCGGATACAGGACCGAGAC Doxocopa_sp._RB273 CTGTACTGTGAAGACCTGTTGGATGAGGCTCCCAAGTTTCCGCTCTGTGGGTGATTCATTAAAAGATCGTTTCGACGGGGCATCGCGGGTTATGATGCCTAATACAGAAGTCGAAGCACCCGTACAGCGAAATGACGCAGCGCCT---CACAGGGTTCCAAGAAGAGATCGATACAGGTTTCAACTTCGACCGCACAATCCCGATCATAAAACACCCGGGGCCAAAGACCTAGTGTACCTAGAATCATCGCCGGGTTTCTGTGAAAAGAACCCGAGACTGGGCATTCCCGGGACGCACGGGCGTGCCTGCAACGATACGAGCATCGGCGTCGACGGTTGCGATCTCATGTGTTGCGGCCGCGGTTACCGAACCGAGAC Dryadula_phaetusa CTGCACAGTCAAGACCTGCTGGATGAGGCTTCCCAGTTTTAGATCTGTGGGAGATGCTTTGAAGGACCGCTTTGATGGAGCATCGCGAGTCATGATGCCCAATACGGAAGTTGAGGTGCCTGTACAAAGGAATGACGCAGCTGCG---CACAGAGTTCCTCGAAGAGATCGGTACAAGTTCCAACTCCGACCGCACAATCCTGATCATAAAACACCTGGTGTGAAAGATCTAGTTTACCTAGAACCATCACCGGGTTTCTGCGAAAAGAACCCGAGGCTGGGCATTCCCGGCACGCACGGGCGTGCCTGCAACGATACTAGCATCGGCGTTGACGGCTGCCACCTCATGTGTTGCGGCCGCGGATACCGGACCGAAAC Dryas_iulia CTGCACAGTTAAGACCTGTTGGATGAGACTTCCCAGTTTTAGATCTGTGGGAGACGCTTTGAAAGATCGTTTCGATGGAGCCTCACGAGTCATGATGCCCAACACGGAAGTTGAAGTGCCTGTTCAGAGGAACGATGCGGCTGCG---CACAGAGTTCCTCGAAGAGATCGGTACAAGTTCCAACTCCGACCGCATAATCCTGATCACAAAACACCAGGTGTCAAAGATTTAGTATACCTAGAACCATCACCGGGCTTCTGTGAGAAGAACCCGAGGCTGGGCATTCCCGGCACGCACGGGCGTGCCTGCAACGATACTAGCATCGGCGTCGACGGCTGCGACCTCATGTGTTGCGGCCGCGGATACCGCACCGAGAC Eresia_nauplius CTGCACGTTCAAGACATGCTGGATGAGGCTGCCGAGTTTTCGCTCCGTGGGTGATGCACTTAAAGATCGTTTCGACGGGGCTTCACGGGTCATGATGCCAAGCACAGAGACTGACATGCCCTTACGACAGCGAAACGATGCAGCACCGCACAGAGTTCCACGACGAGATCGTTACAGATTACAACTCCGTCCTCTCAATCCTGATCATAAAGCACCGGGCACAAAAGACCTAGTCTATCTAGAACCATCGCCAGGTTTCTGTGAAAGGAACACAAGACTGGGGATTCCTGGCACGCACGGGCGTACTTGTAACGACACGAGTATCGGTGTCGATGGATGCGACCTCATGTGTTGCGGCCGTGGGTACCGGACCGATAC Eueides_vibilia CTGCACAGTCAAGACTTGTTGGATGAGGCTTCCCAGCTTTAGGTCCGTAGGGGACGCCTTGAAGGATCGCTTTGATGGAGCCTCAAGGGTTATGATGCCTAATACGGAAGTTGAAGTGCCTGTCCAGAGGAATGACGCTGCTGCG---CACAGAGTTCCTCGAAGAGATCGGTATAAATTCCAACTTCGACCACATAACCCTGATCATAAAACACCTAGTGCCAAGGATTTGGTTTACTTAGAACCATCACCGGGTTTCTGCGAGAAAAACCCGAGGCTGGGCATTCCCGGCACGCACGGGCGTGCCTGCAACGATACTAGCATCGGCGTTGACGGCTGCGATCTCATGTGTTGCGGCCGCGGATACCGGACCGAGAC Euphydryas_phaeton CTGTACTGTCAAGACTTGCTGGATGAGGCTACCAAGTTTTCGCTCCGTGGGCGATGCACTTAAAGATCGCTTCGATGGAGCATCGCGGGTCATGATGCCAAATTCAGAAAGTGACATGCCCTTGCGACAGCGAAACGATGCAGCGCCTCACAGGGTTCCACGTAGAGATCGTTATAGGTTCCAACTCCGTCCACACAATCCCGATCATAAAACACCAGGTACCAAGGACCTAGTATATCTAGAACCATCGCCGGGTTTCTGTGAAAAGAACACAAGGCTGGGCATTCCTGGCACGCATGGGCGTGCTTGCAACGACACGAGCATTGGTGTTGGAGGCTGCGATCTTATGTGTTGTGGCCGTGGGTACCGGACCGAGAC Euptoieta_claudia ????ACCGTAAAGACCTGCTGGATGAGGCTGCCAAGTTTCCGATCTGTGGGAGATGCATTGAAAGATCGCTTCGATGGAGCTTCTCGAGTAATGATGCCAAATACAG---TCGAAGTTCCTGTTCCACGTAATGATGCAGCGGCC---CATAGAGTACCTCGGAGGGATCGGTATAAATTTCAACTTAGACCACATAATCCTGATCACAAAACACCTGGAGTCAAGGATCTAGTGTACTTGGAATCATCACCGGGTTTCTGCGAAAAGAACCCAAGGCTGGGCATTCCCGGCACGCACGGGCGTGCCTGCAATGATACTAGCATTGGTGTCGACGGCTGCGATCTTATGTGTTGCGGCCGCGGCTTCCGGACCGAGAC Haetera_piera CTGCCTCGTGAAGACGTGCTGGATGAGGCTGCCGACTTTCCGATCTGTAGGCGACGCCTTAAAGGATGGCTTCGACGGTGCTTCGCGGGTCATGATGCCCATCACGGAGGTAGAAGCACCGGTGCAGAGGAACGATGCCGCTCCG---CACAGAGTCCCGCGACGAGACCGATACAGATTTCAACTTCGGCCCCACAATCCTGACCATAAAACGCCTGGTGTCAAGGACCTAGTGTACTTGGAATCATCACCGGGGTTCTGTGAAAAGAATCCCAGACTGGGCATTCACGGTACGCACGGGCGTGCCTGCAACGATACTAGTATCGGCGTCGACGGCTGCGACCTCATGTGCTGCGGCCGCGGGTACCGGACCGAGAC Hamadryas_chloe CTGCACCGTAAAGACCTGCTGGATGAGGCTGCCCAGTTTCCGCTCCGTGGGTGATGCATTAAAAGATCGCTTCGATGGGGCGTCGCGGGTCATGATGCCCAATACAGAAGTCGAAGTACCCGTGCAGCGAAACGACGCAGCGCCT---CACAGGGTTCCAAGAAGAGATCGGTACAGATTCCAACTTAGGCCGCACAATCCCGATCACAAAACACCTGGGGTCAAGGATCTAGTGTACCTAGAATCATCGCCGGGCTTCTGTGAAAAGAACCCGAGGCTAGGCATTCCCGGTACGCACGGGCGTGCCTGCAACGATACGAGTATCGGTGTCGACGGCTGCGATCTTATGTGTTGCGGGCGCGGATATCGAACCGAGAC Heliconius_erato ????????TCAAGACCTGTTGGATGAGGCTCCCCAGTTTTAGATCTGTCGGGGACGCCTTAAAGGATCGCTTTGATGGAGCCTCGCGAGTCATGATGCCTAATACGGAAGTTGAAGTGCCTGTTCAGAGGAACGACGCAGCTGCG---CACAGAGTTCCTCGAAGAGACCGGTACAAGTTCCAACTGCGACCCCACAATCCCGATCATAAAACACCTGGTGCCAAGGATTTGGTTTACCTAGAACCATCACCGGGCTTCTGCGAGAAGAACCCGAGGCTGGGCATTCCCGGCACGCACGGGCGTGCCTGCAACGATACTAGCATCGGCGTCGACGGCTGCGATCTCATGTGTTGCGGCCGCGGATACCGGACCGAAAC Hypna_clytemnestra CTGCACTGTCAAAACTTGCTGGATGAGACTACCAACTTTCCGGTCTGTAGGCGACGCTTTAAAAGATCGCTTCGACGGGGCGTCGAGAGTGATGATGCCCAATACGGAGGTAGAAGCACCAGCGCAACGCAATGACGCTGCTCCT---CATCGAATCCCAAGACGAAATCGATATAGATTTCAACTTCGGCCGCACAATCCCGATCACAAAACACCTGGGGTCAAGGACCTAGTATACTTAGAATCATCACCCGGCTTCTGTGAAAAGAATCCGAGGCTGGGCATTCCCGGCACGCACGGGCGTACCTGCAACGATACGAGCATCGGCGTCGATGGTTGCGACCTCATGTGCTGCGGGCGCGGGTACCGGACGGAAAC Hypolimnas_bolina CTGTACTGTTAAGACTTGCTGGATGAGGCTTCCAAGTTTCCGCTCCGTGGTCGATGCGTTAAAAGATCGATTCGATGGTGCGTCGCGGGTCATGATGCCCAACACGGAAATCGAAGCGACTGTACAGCGAAGCGACGGAGCGCCA---CACAGAGTTCCACGAAGAGATCGGTACAGGTTCCAGCTCAGACCGCACAATCCCGATCATAAAACACCGGGATCTAAAGACCTAGTGTACCTCGAATCATCGCCGGGTTTCTGTGAAAAGAACCCGAGGCTGGGCATTCCCGGCACGCACGGGCGTGTCTCCCTCGATGCGAGCATCGGTGTCGGCGGCTGCGATCTCATGTGCTGCGGCCGTGGCTACAGGACCGAGAC Laparus_doris ????????????????????GGATGAGGCTCCCCAGTTTCAGATCCGTGGGGGACGCCTTAAAGGATCGCTTCGATGGAGCATCGCGGGTCATGATGCCTAATACAGAAGTTGAAGTACCTGTTCAGAGGAACGACGCAGCTGCG---CATAGAGTTCCTCGAAGAGATCGGTATAAGTTCCAACTCCGACCGCACAATCCCGATCATAAAACACCTGGTGTCAAGGATTTAGTTTACCTAGAACCATCACCGGTTTTCTGCGAGAAGAACCCGAGGCTGGACATTCCCGGCACGTACGGGCGTGCCTGCAACGATACTAGCATTGGCGACGAAGGCTGCGATCTCATGTGTTCCGGCCGCG???????????????? Libytheana_carinenta CTGCACTGTGAAGACTTGCTGGATGAGGCTGCCGAGTTTCCGCTCTGTGGGTGACGCGTTGAAGGACCGCTTCGACGGTGCCTCACGAGTCATGATGCCCAACACCGATCTCGAGGCGCCCGTGCAGCGAAACGAAGCGGCGCCC---CACAGAGTGCCGTGGAGAGATCGATTCAGGTTCCAAATCCGGCCACACAATCCCGATCACAAGACACATGGAGTCAAGGATCTGGTGTACTTAGAGTCTTCGCCGGGCTTCTGCGAGAAGAATCCCCGGCTGGGCATCCCCGGTACGCACGGTCGCACCTGCAATGACACCAGCATTGGGGTCGAAGGCTGCGACCTCATGTGCTACGCCCGCGGGTACAGGACCGAGAC Limenitis_arthemis CTGCACCGTGAAGACCTGCTGGATGAGGTTACCCAGTTTCCGATCCGTGGGAGACTCGCTGAAGGATCGCTTCGACGGGGCATCGCGGGTCATGATGCCTAATACGGAAATTGAAGTTCCTGTTCAACGAAATGATGCAGCAGCT---CCCAGAGTTTCGCGAAGGGATCGATATAAATTCCAGCTTAGACCGCACAACCCCGATCACAAAACACCCGGGTTCAAGGATTTAGTGTACCTCGAATCTTCACCGGGTTTCTGCGAAAAGAACCCTCGGGTGGGGATTCCCGGCACGCACGGGCGTGCCTGCAACGATACAAGCATCGGTGTCGACGGCTGCGACCTCATGTGCTGCGGCCGCGGGTATCGGACCGAGAC Marpesia_orsilochus CTGCACGGTCAAGACTTGCTGGATGAGGCTGCCTAGTTTTCGCTCTGTCGGCGATGCTTTAAAAGATCGCTTCGATGGGGCATCGCGGGTCATGATGCCTAATACAGAAATCGAAGCGCCCGTACAGAGAAATGACGCGGCGCCT---CATAGGGTGCCACGAAGAGATCGGTACAGATTCCAACTACGACCGCACAATCCCGATCACAAAACACCCGGGGTCAAGGACCTAGTCTACCTAGAACCATCGCCGGGATTCTGCGAAAAGAACCCGAGACTGGGCATTCCCGGTACGCATGGGCGTACCTGCAACGATACGAGCATAGGCGTCGATGGCTGTGACCTCATGTGCTGCGGCCGCGGCTACCGGACTGAGAC Mechanitis_polymnia ??GCACAGTGAAAACTTGTTGGATGAGGCTACCCAGTTTTCGATCTGTAGGCGATGCCCTAAAAGATCGATTCGACGGCGCTTCACGGGTAATGATGCCCAACACAGAAGTAGAAGTGGCGGCACAACGGAACGACGCAGCGCCT---CACAGAGTTCCACGACGAGATAGATACAGATTTCAGCTTCGGCCTCATAATCCTGACCACAAGACATCTGGAGTAAAAGACCTGGTATTCCTGGAATCATCACCGGGTTTCTGCGAAAAGAACCCAAGGTTGGGCATTCCTGGTACTCACGGACGTAACTGCAACGACACCAGCATCGTCGTGGACGGCTGCGACCTCATGTGTTGCGCCCGCGGTTACCGGACGGATAC Megisto_cymela CTGTACGGTCAAGACGTGCTGGATGAGGCTGCCAACTTTCCGGTCTGTGGGAGACGCCTTAAAAGACGGCTTTGACGGAGCATCACGAGTCATGATGCCCAATACCGAGGTTGAAGTACCAGCTCAGAGGAATGATGCTGCTCCG---CACAGAGTCCCGCGACGAGACCGATACAGATTTAAACTCCGGCCGCACAATCCTGACCACAAAACACCTGGGGTCAAGGACCTAGTATACTTGGAACCATCGCCGGGTTTCTGCGAAAAGAACCCGCGGCTGGGTATTCCCGGTACGCACGGGCGTGCCTGCAACGATACCAGTATCGGCGTCGACGGTTGCGACCTCATGTGCTGCGGCCGAGGTTACCGGACCGAGAC Memphis_sp._RB226 CTGCACGGTCAAAACTTGCTGGATGAGGCTACCGACTTTCCGATCCGTTGGGGACCCCTTGAAAGATCGCTTTGACGGAGCGTCGAGGGTGATGATGCCCAATGTAGAAGTGGAAACACCAGCGATGCGTAACGACGCACTTCCT---CACAGAGTCCCGCGACGGGATCGGTATCGATTTCAACTTAGGCCACACAACCCTGATCACAAGACACCCGGGGTGAAGGACCTAGTCTACTTGGAATCGTCGCCGGGTTTCTGCGAAAAGAATCCCAGGCTGGGCATTCCCGGCACGCACGGGCGTACCTGCAACGATACGAGTATTGGTGTCGACGGTTGCGACCTCATGTGCTGCGGCCGCGGGTACCGCACCGAGAC Morpho_helenor CTGCTCCGCCAAGACGTGCTGGATGCGGTTACCGAGTTTTCGGTCTGTAGGAGACGCCTTGAAAGATGGCTTCGATGGGGCGTCACGGGTCATGCTGCCGAACACTGAGGTGGAAGTGCCAGTGCAGCGGAATGACGCCGCTCCC---CACAGAGTACCCCGACGAGACCGGTACAGATTCCAACTTCGGCCGCATAATCCTGATCACAAATCACCTGGGGTCAAAGACCTAGTATACTTAGAATCGTCGCCGGGTTTCTGTGAAAAGAATCCCAGACTGGGCATTCCTGGTACGCACGGGCGTGCCTGCAACGACACGAGTATCGGCGTCGACGGCTGCGAACTCATGTGCTGCGGCCGCGGATACCGGACCGAGAC Neruda_metharme TTGTACAGTCAAGACATGCTGGATGAGGCTCCCCAATTTTAGATCCGTGGGGGACGCCTTAAAGGACCGCTTTGATGGAGCATCGCGGGTCATGATGCCTAATGCGGAAGTTGAAGTGCCTGTTCAGCGGAACGATGCCGCTGCG---CACAGAACTCCTCGAAGAGATCGATACAACTTCCAACTTCGACCACACAATCCTGATCACAAAACACCCGGTGTCAAGGATTTAGTTTACCTAGAACCATCACCTGGTTTCTGCGAGAAGAACCCGAGGCTAGGTATTCCCGGCACGCACGGGCGTGCCTGCAACGACACCAGCATCGGCGTCGACGGCTGCGATCTCATGTGTTGCGGCCGCGGATACCGGACTGAAAT Oleria_aquata CTGCACAGTGAAGACTTGCTGGATGAGGCTACCGAGTTTCCGTTCTGTGGGCGATGCTCTAAAAGACCGCTTCGACGGTGTTTCACGGGTAATGATGCCCAACACAGAAGTAGAAGCGCCGGTACAGCGTAATGACGCGGCACCC---CACAGAGTTCCACGAAGAGATCGATACAGATTTCAACTTCGGCCTCATAATCCTGACCATAAGACACCTGGTGTAAAAGATCTGGTATATCTGGAATCATCACCGGGTTTCTCCGAAAAGAACCCAAGGCTGGGCATTCCCGGTACGCACGGACGTGCCTGCAACGATACTAGTATCGGCGTGGACGGCTGCGACCTCATGTGTTGCGGCCGAGGTTACCGTACAGAGAC Opsiphanes_cassina ???TTCTGCCAAGACTTGCTGGATGAGACTGCCGAGTGTTCGATCTGTAGGTGATGCCTTGATAGACGGTTTCGTTGGAGCTTCGCGGGTCATGAAGCCCATCACGGAGGTAGAGGCCCCAATACACCGGACTGACGCCCCTCTT---CACAGAGTTCCGCGCCGGGATCTCTTCAGGTTCCAACTTCGGCCACACAATCCCGAACACAAAGCACCCGGGGTCAAGGACCTAGTATACTTAGAATCATCGCCGGGTTCCTGTGAAAAGAAGCCCAGGCTGGGCATTCCCGGTACGCACGGGCGTATGTGCAACGACACTAGCATCGGTGTCGTCGGCTGCGATCTCATGTACTTCGACCGAGGATACCGGACCGAGAC Panacea_divalis CTGCACCGTAAAGACCTGCTGGATGAGGCTGCCCAGTTTCCGCTCCGTGGGTGATGCGTTGAAAGATCGCTTCGATGGGGCGTCGCGGGTCATGATGCCCAATACTGAAGTCGAGGCACCCGTGCAGCGGAACGACGCAGCGCCT---CACAGGGTTCCAAGAAGAGATCGGTACCGATTCCAACTTCGGCCACATAATCCCGATCACAAAACGCCTGGGGTCAAGGACCTAGTGTACCTAGAATCATCGCCGGGCTTCTGTGAAAAGAACCCGAGACTGGGCATTCCCGGTACGCACGGACGTGCTTGCAACGATACGAGTATCGGCGTCGACGGCTGTGACCTCATGTGTTGCGGGCGCGGTTACCGGACCGAGAC Philaethria_dido CTGCGCTGTCAAGACCTGTTGGATGAGGCTTCCCAGTTTTAGATCCGTGGGAGGAGCTTTGAAGGACCGCTTCGACGGAGCTTCGCGGGTCATGATGTCCAATACGGAAGTTGAAGTGCCTGTTCAGAGGAATGACGCAGCTGCG---CATAGAGTTCCTCGAAGAGATAGGTACAAGTTCCAACTCCGACCACATAATCCAGATCATAAAACACCTGGTGTCAAGGATTTAGTGTACTTAGAACCATCACCGGGTTTCTGCGAGAAAAACCCGAGGCTGGGCATTCCCGGCACGCACGGGCGTGCCTGCAACGATACTAGCATTGCCGTTGACGGCTGCGATCTCATGTGTTTCGGCCGCGGCTACCGGACTGAGAC Phyciodes_tharos CTGCACTGTCAAGACATGCTGGATGAGGCTGCCAAATTCTCGCTCCGTGGGTGATGCACTTAAAGATCGCTTTGATGGGGCTTCTCGGGTCATGATGCCTAGCACAGAGAGTGACATGCCCTTACGACAGCGTAACGATGCAGCACCGCACAGAGTTCCTCGACGAGATCGTTACAGATTACAGCTCCGTCCTCTCAATCCTGACCATAAAGCACCGGGAACTAAAGACCTAGTCTATCTGGAACCATCGCCAGGTTTCTGTGAAAAGAACACAAGGCTGGGGATTCCTGGCACCCACGGGCGTACTTGCAATGACACGAGTATCGGCGTCGACGGCTGCGACCTCATGTGTTGCGGCCGAGGTTACCGGACGAACAC Pieris_rapae CTGCACGGTTAAGACCTGTTGGATGCGACTACCAAGTTTCCGTTCGGTCGGCGACTCATTGAAAGACCGCTTCGACGGGGCATCGCGAGTGATGGTGTCTAACACGGACCTCGAAACGCCAGTACAACGAAACGACGCAGCCCCA---CACAGGGTGCCTCGCAGGGATCGATACAGATTCCAACTGCGTCCGCACAACCCCGATCATAAATCACCGGGAGTCAAAGACCTCGTCTACTTGGAATCGTCGCCTGGTTTCTGCGAAAAGAATCCACGTTTGGGTATACCCGGCACCCACGGGCGTACTTGCAACGATACTAGTATCGGAGTGGACGGCTGCGACCTCATGTGCTGCGGCCGCGGTTACCGGACTGAGAC Podotricha_telesiphe CTGCACAGTCAAGACCTGTTGGATGAGGCTTCCCAGTTTTAGATCAGTGGGAGACGCTTTGAAAGACCGTTTCGATGGAGCATCGCGGGTCATGATGCCCAACACGGAAGTTGAAGTGTCTGTTCAGAGGAATGACGCAGCTGCG---CACAGAGTTCCTCGAAGAGACCGGTACAAGTTTCAATTCCGACCACACAACCCAGACCATAAAACACCTAGTATACGGGATTTAGTTTACCTAGAACCATCGCCAGGTTTCTGCGAGAAGAATCCGAGAGTGGGCATTCCCGGCACGCACGGGCGTGCCTGCAACGATACCAGCATCGGCGTCGACGGCTGTGATCTCATGTGTTGCGGCCGCGGATACCGGACCGAGAC Prepona_sp._RB256 CTGCACTGTCAAGACTTGCTGGATGAGACTACCCACTTTCCGGTCGGTAGGAGACGCGTTGAAAGATCGATTCGACGGGGCGTCGAGAGTGATGATGCCCAATACGGTAGTGGAAGCGCCGGTGCAGCGAAACGATGCAGCCCCT---CACAGAGTCCCACGAAGAGATCGATATAGATTTCAACTCCTGCCGCACAATCCCGATCACAAAACACCCGGGGTCAAGGACCTAGTGTACCTAGAATCGTCATCCGGTTTCTGTGAAAAGAATCCGAGACTGGGCATTCCCGGCACGCACGGCCGTGCCTGCAACGATACGAGCATCGACGGTGTCGACTGCGACCTGATGTACTACGGTCGTGGGTACCGGACTGAGAC Siproeta_stelenes CTGCACCGTTAAGACCTGCTGGATGAGGCTGCCTAGTTTTCGCTCCGTGGGCGATGCTCTAAAGGATCGCTTCGATGGGGCATCGCGGGTAATGATGCCCAATACAGAAATCGAAGCTCCCGTGCAGCGAAACGAGGCAGCTCCT---CACAGAGTACCACGAAGAGATCGGTACAGATTCCAACTTAGGCCACACAATCCCGATCATAAAACACCGGGGACCACAGACCTAGTGTACCTAGAATCATCGCCGGACTTCTGTGAAAAGCACCCGAGACTGGGCATTCCCGGCACGCACGGGCGTGCCTGCAACGATACGAGCATCGGCGTCGACGGTTGCGACCTTATGTGCTGCGGCCGTGGTTACCGCACCGAGAC Taygetis_sp._RB294 CTGCACTGTCAAGACATGCTGGATGAGATTGTCGACGTTTAGATCTGTGGGAGATGCTTCGATAGATGGCTTCGATGGAGCATCACGCGTCATGATGCCCAACACAGAGGTAGAAGTGCCGGCTCAAAGAAATGACGCGGCTCCT---CATAGAGTACCACGAAGAGACCGATATAGGTTTCAACTCAGGCCGCACAATCCTGACCACAAAACACCCGGGGTCAAGGATTTGGTATACCTGGAACCATCGCCAGGTTTCTGCGAAAAGAACCCACGGCTGGCCATTTCCGGCACGCACGGACGTGCCTGCAACGACACAAGTATCGGCGTCGACGGCTGTGACCTCATGTTCTGCGGTCGTGGGTACAGGACCGAGAC Tisiphone_abeona CTGCACAGTGAAGACGTGCTGGATGAGGCTGCCGAGTTTTCGCTCTGTAGGCGATGCTTTAAAAGATGGCTTCGACGGAGCATCGCGGGTCATGATGCCCAACACGGAGGTGGAAGCGCCGCTTCAGCGGAACGACGCCGCCCCG---CACCGAGTCCCGCGACGAGACCGATACAGGTTTCAACTCCGGCCGCACAATCCCGATCACAAAACACCCGGGGTCAAGGACCTAGTATACCTGGAATCATCGCCGGGTTTCTGCGAAAAGAACCCGAGGCTGGGCATTCCCGGTACGCACGGGCGTGCCTGCAACGATACGAGTATCGGCGTCGACGGCTGCGACCTCATGTGCTGCGGCCGCGGGTACCGGACCGAGAC Vanessa_atalanta CTGTACTGTTAAGACTTGTTGGATGAGGCTGCCCAGTTTTCGCTCCGTGGGTGACGCGTTAAAAGATCGCTTCGATGGAGCATCGCGGGTCATGATGCCTAATACAGAAATCGAAGCGCCCGTACAGCGAAATGACGCAGCGCCT---CATAGAGTTCCAAGAAGAGATCGGTACAGATTCCAGCTTCGGCCGCACAATCCGGATCATAAAACACCGGGAGCAAAAGACCTAGTCTACCTTGAATCATCACCGGGTTTTTGTGAAAAGAACCCGAGGCTGGGCATTCCCGGCACGCACGGGCGTGCCTGCAACGATACGAGCATCGGCGTCGACGGCTGCGACCTCATGTGTTGCGGTCGTGGTTACCGGACCGAAAC Vila_semistalachtis CTGCATAGTTAAGACCTGCTGGATGAGGCTGCCCAGTTTCCGCTCCGTGGGTGACGCGCTAAAAGATCGCTTCGACGGGGCATCCCGAGTCATGATGCCCAATACGGAAGTAGAAGCACCCGTGCAGCGGAACGACGCAGCGCCT---CACAGGGTTCCAAGAAAAGATCGGTACAGATTCCAGCTCCGGCCGCACAATCCCGACCACAAGACGCCCGGCGTCAAGGACCTAGTGTACCTAGAATCATCGCCAGGCTTCTGTGAAAAGAACCCAAGGCTGGGCATTCCCGGTACACACGGGCGTGCCTGCAACGACACGAGTATCGGCGTCCACGGCTGTGACCTTATGTGTTGCGGGCGCGGCTATCGGACCGAAAC ; END; BEGIN TREES; TITLE Tb8683; LINK TAXA = Taxa1; TRANSLATE 1 Vila_semistalachtis, 2 Vanessa_atalanta, 3 Tisiphone_abeona, 4 Taygetis_sp._RB294, 5 Siproeta_stelenes, 6 Prepona_sp._RB256, 7 Podotricha_telesiphe, 8 Pieris_rapae, 9 Phyciodes_tharos, 10 Philaethria_dido, 11 Panacea_divalis, 12 Opsiphanes_cassina, 13 Oleria_aquata, 14 Neruda_metharme, 15 Morpho_helenor, 16 Memphis_sp._RB226, 17 Megisto_cymela, 18 Mechanitis_polymnia, 19 Marpesia_orsilochus, 20 Limenitis_arthemis, 21 Libytheana_carinenta, 22 Laparus_doris, 23 Hypolimnas_bolina, 24 Hypna_clytemnestra, 25 Heliconius_erato, 26 Hamadryas_chloe, 27 Haetera_piera, 28 Euptoieta_claudia, 29 Euphydryas_phaeton, 30 Eueides_vibilia, 31 Eresia_nauplius, 32 Dryas_iulia, 33 Dryadula_phaetusa, 34 Doxocopa_sp._RB273, 35 Dione_juno, 36 Diaethria_clymena, 37 Colobura_dirce, 38 Cercyonis_pegala, 39 Ceratinia_nise, 40 Catonephele_acontius, 41 Caligo_idomeneus, 42 Boloria_bellona, 43 Biblis_hyperia, 44 Batesia_hypochlora, 45 Asterocampa_clyton, 46 Antirrhea_sp., 47 Anthocharis_midea, 48 Actinote_stratonice, 49 Actinote_genitrix, 50 Acraea_andromacha; TREE con_50_majrule = [&R] (50,((49,48),(((((((47,8),21),((((((46,(41,12),15),((24,6),16)),27),(38,(17,4))),3),((39,18),13))),19),(((45,34),(((44,11),(43,1),36,26),40)),(((37,2),(((31,9),29),23)),5))),(42,28),20),(((((35,30),(25,22,14)),(10,7)),33),32)))); END;