#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 3:33 GMT TreeBASE (cc) 1994-2008 Study reference: Takamatsu S., Ito T., Yamamoto H., & Braun U. 2007. Sawadaea nankinensis comb. nov.: a powdery mildew fungus of Acer buergerianum. Mycoscience, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1939] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=54; TAXLABELS Podosphaera_tridactyla Podosphaera_xanthii Sawadaea_bicornis_ex_A._campestre_AB193362 Sawadaea_bicornis_ex_A._campestre_AB193378 Sawadaea_bicornis_ex_A._campestre_AB193379 Sawadaea_bicornis_ex_A._platanoides_AF298540 Sawadaea_bicornis_ex_A._pseudoplatanus_AB193380 Sawadaea_nankinensis_ex_A._buergerianum_MUMH1273 Sawadaea_nankinensis_ex_A._buergerianum_MUMH3691 Sawadaea_nankinensis_ex_A._buergerianum_MUMH3799 Sawadaea_nankinensis_ex_A._buergerianum_MUMH3801 Sawadaea_nankinensis_ex_A._buergerianum_MUMH4232 Sawadaea_nankinensis_ex_A._buergerianum_MUMH4233 Sawadaea_polyfida_ex_A._amoenum_AB193374 Sawadaea_polyfida_ex_A._amoenum_var._matsumurae_AB193358 Sawadaea_polyfida_ex_A._amoenum_var._matsumurae_AB193381 Sawadaea_polyfida_ex_A._japonicum_AB193369 Sawadaea_polyfida_ex_A._palmatum_AB000936 Sawadaea_polyfida_ex_A._palmatum_AB193382 Sawadaea_polyfida_ex_A._shirasawanum_AB193352 Sawadaea_polyfida_ex_A._sieboldianum_AB193360 Sawadaea_polyfida_ex_A._sieboldianum_AB193365 Sawadaea_sp._ex_A._argutum_AB193367 Sawadaea_sp._ex_A._argutum_AB193375 Sawadaea_sp._ex_A._australe_AB193384 Sawadaea_sp._ex_A._cissifolium_AB193373 Sawadaea_sp._ex_A._micranthum_AB193371 Sawadaea_sp._ex_A._negundo_AB193350 Sawadaea_sp._ex_A._negundo_AB193353 Sawadaea_sp._ex_A._negundo_AB193354 Sawadaea_sp._ex_A._negundo_AF011313 Sawadaea_sp._ex_A._negundo_AF073356 Sawadaea_sp._ex_A._nipponicum_AB193370 Sawadaea_sp._ex_A._platanoides_AB193387 Sawadaea_sp._ex_A._pseudoplatanus_AB193351 Sawadaea_sp._ex_A._rufinerve_AB193355 Sawadaea_sp._ex_A._tataricum_AB193383 Sawadaea_sp._ex_Acer_sp._AB193390 Sawadaea_sp._ex_Acer_sp._AB193391 Sawadaea_tulasnei_ex_A._crataegifolium_AB193359 Sawadaea_tulasnei_ex_A._crataegifolium_AB193364 Sawadaea_tulasnei_ex_A._crataegifolium_AB193368 Sawadaea_tulasnei_ex_A._ginnala_AB193372 Sawadaea_tulasnei_ex_A._mono_subsp._glaucum_AB193357 Sawadaea_tulasnei_ex_A._mono_var._ambiguum_AB193356 Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB022367 Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB193366 Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB193377 Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB193386 Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB193388 Sawadaea_tulasnei_ex_A._mono_var._mayrii_AB193376 Sawadaea_tulasnei_ex_A._platanoides_AB193361 Sawadaea_tulasnei_ex_A._platanoides_AB193363 Sawadaea_tulasnei_ex_A._platanoides_AB193385 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=46; TAXLABELS Arthrocladiella_mougeotii Blumeria_graminis_f._sp._bromi Blumeria_graminis_f._sp._hordei Blumeria_graminis_f._sp._tritic Brasiliomyces_trina Byssoascus_striatosporus Cystotheca_lanestris Cystotheca_wrightii Erysiphe_adunca Erysiphe_aquilegiae Erysiphe_australiana Erysiphe_friesii Erysiphe_glycines Erysiphe_gracilis Erysiphe_heraclei Erysiphe_mori Erysiphe_pulchra Erysiphe_simulans Golovinomyces_cichoracearum Golovinomyces_orontii Leveillula_taurica Neoerysiphe_galeopsidis Phyllactinia_kakicola Phyllactinia_moricola Pleochaeta_shiraiana Podosphaera_filipendulae Podosphaera_longiseta Podosphaera_pannosa Podosphaera_tridactyla Podosphaera_xanthii Sawadaea_bicornis_ex_A._campestre Sawadaea_nankinensis_MUMH1273 Sawadaea_nankinensis_MUMH3691 Sawadaea_nankinensis_MUMH3799 Sawadaea_nankinensis_MUMH3801 Sawadaea_nankinensis_MUMH4232 Sawadaea_nankinensis_MUMH4233 Sawadaea_polyfida_ex_A._japonicum_AB193393 Sawadaea_polyfida_ex_A._palmatum_AB193397 Sawadaea_sp._ex_A._argutum_AB193395 Sawadaea_sp._ex_A._cissifolium_AB193394 Sawadaea_sp._ex_A._negundo_AB193392 Sawadaea_tulasnei_ex_A._mono_AB193399 Sawadaea_tulasnei_ex_A._mono_AB193400 Sawadaea_tulasnei_ex_A._platanoides_AB193398 Typhulochaeta_japonica ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2964] TITLE 28S_rDNA; LINK TAXA = Taxa2; DIMENSIONS NCHAR=968; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arthrocladiella_mougeotii AAGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGCCG-CGGCCTAC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGACCCTAGGAACGTAGCTCCCTTC----GGGGCGTG--TTATAGCCTAGGGTGCAATGCAGCCTACCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTACGTGAGAACCCGTAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACCAGCAT--------------------------------------------------------------------------------------------------------------------------------------------------------------- Blumeria_graminis_f._sp._bromi TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGATCCATTA--GGAGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGCG-ACGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATG-CTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACCTGTGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATAA------GGGGGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC--------------------- Blumeria_graminis_f._sp._hordei TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACC-CAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGGTTA-C-GGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGTA-GTGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGAGTACTCAGTG-CCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Blumeria_graminis_f._sp._tritic TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGTTTA-C-GGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGTG-GCGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATG-CTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATAA------GGGGGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAC-TGGTTCCTGCC Brasiliomyces_trina TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTGACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGAATCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCG-AGGTTTGC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGG-CC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCTACCAGACTTGGGCGCTGCCGATCATCCCGAG-TTCTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCCTTC--GGGGCAGTG--TTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGTTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTTACATCAATGCGAGTGTTTGGGCGTGAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTGTAAAGGGGGTGCATCATCGACCGATCCTGATGT?TTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAG--------------------------------- Byssoascus_striatosporus ----------------------------------------------------------AAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGGGTCCGAGTTGTAATTTGGAGAAGATGCTTCGGGT-ACGGTCCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCG-GTGGCCGT-GCCCGTGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCCATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGTCGATCATCCTGGG-TTCGCCCGGGTGCACTCGGCCGCGCTCAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTCGGGAACGTGGCTCCCCTC----GGGGAGTG--TTATAGCCCGAGGTGCAATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cystotheca_lanestris TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGAGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGT-ATGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTT-GTCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCTGGGG-TTCTCCCCGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGAGGAATGTAGCTGTCTCTC--GGGGCAGTG--TTATAGCCTCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCGTTA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATATAGGAC-TG-TTCC---- Cystotheca_wrightii TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTT-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGTCGGGG-TTCTCCCCGGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGTGAGGGGAATGTAGCTGTCTCTC--GGGGCAGTG--TTATAGCCCCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTTA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT------------------- Erysiphe_adunca TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGCAGCTTTGGGTTGTGGGACCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCTGC-ACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACACCACTGATCCGCGAGGG-TTCTCTCTCGGGCACTCGGTGGGGTACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCCGAAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTTCGGTGCAATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTAAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTC-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC--------------------- Erysiphe_aquilegiae TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCA-TGGCCCGC-GCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCTCTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC----GGGGAGTG--TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC--------------------- Erysiphe_australiana TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTGGTAACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCG-TGGCTTGC-GCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGACTTGGGCATCGCTGATCATCCGGGGGTA-TCTCCGGTGCACTCGACGATGCACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCTGTGGGAACGTGGCTCCTTTC----GAGGAGTG--TTATAGCCCACGGTGCAATGCAGCCCATCCGGACCGAGGACCGCGCCCTTCGGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATATA-TGA-CTGTTCCTGCC Erysiphe_friesii TTGACCTCGAATCAGGTAGGAATACCCGCTGAAC------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCTAC-GCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGTTCTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCG------------------------------------- Erysiphe_glycines TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCG-AGGTTTGC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTTGATCATCTAGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT----GGGGAGTG--TTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAA-CCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCCTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACC-------------------------------------------------------------------------------------------------------------------------------------------------- Erysiphe_gracilis TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCTGC-GCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAGGTTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTC--GGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTG------GGGTGCATCATC-ACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACC-------------------------------------------------------------------------------------------------------------------------------------------------- Erysiphe_heraclei TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---TGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCCGC-GCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTTT---GGGGGCGCATCATCGACCGATCCTGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Erysiphe_mori TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCTGC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGACCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCTGATCATCCAGAG-TTCTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTCTC--GGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGCAGGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Erysiphe_pulchra TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCCGC-GCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCCAGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCG------------------------------------- Erysiphe_simulans TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGCTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCTG-AGGCCCGC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCTGCCGATCATTCCGAG-TTCTCTCTGATGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGCAGAAAGACCGGAGGAACGTAGCTCCCCCCTCGGGAGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAC-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTCG------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC--------------------- Golovinomyces_cichoracearum TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCG-TGGCCTAC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTCGATCATCCGGGG-TTCTCCTCGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCCCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGAGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCC-TTT--GGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTCA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCAT---CTAG------------ Golovinomyces_orontii TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTGAGCTCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGCCCG-TGGCCTAT-GCCCGTGTAAGGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGGGCGTAATGCAGCCTATCTGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATACCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCGT---C--------------- Leveillula_taurica TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CC------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT--GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-A-GCGCCT-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATA--------AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTTGATCATCCAAAG-TTTTCTTTGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGGACGTAGCTCCTTTC----GGGGAGTG--TTATAGCC-GTGGCGCAATACCACCTACTCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCTAAA-CCCACACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTTCGA-----GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC--------------------- Neoerysiphe_galeopsidis TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCGGCCG-TGACCTGT-GCCCGTGTAAGGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAAAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCTTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAA-TCTTCGGATGGATTTGAGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phyllactinia_kakicola TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT--GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-GTTTCGAC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCATCGCTGATCATCCAAAG-TTCTCTTTGGTGCACTCGACGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC----GGAGAGTG--TTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCGTTAA-----GGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGG----------------------------------------------------------------------------------------------------------------------------------------------------- Phyllactinia_moricola TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT--GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCA-GTGTCGGC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG---CTCTTTGGTGCACTTGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC----GGAGAGTG--TTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTCGA-----GGGGGCATCATCGACCGATCCTG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pleochaeta_shiraiana TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTCAC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTAGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCG-GTGCCTGT-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTTGGTGATCATCCGGAG-TTTTCTCTGGTGCACTCGGCAATGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTAGGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCCTGGGCGCAATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTA------GGGTGCATCATCGACCGATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Podosphaera_filipendulae ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGG-TTCTCCCTGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATATATGAC-TG-TTCCTGCC Podosphaera_longiseta ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGT-GCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGG-TTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTGA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC--------------------- Podosphaera_pannosa ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGC-GCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGG-TTCTCCCTGGGGTACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTAT-------------------------------------------- Podosphaera_tridactyla ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGT-GCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGGAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGG-TTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTGA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGG--------------------------------------- Podosphaera_xanthii ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT----CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGT-GCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGG-TTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTCTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC--------------------- Sawadaea_bicornis_ex_A._campestre TTGACCTCGGATCAGGTAGGGA------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCCGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGTAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCTTC----GGGCAGTG--TTATAGCCACCGGTGTCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCC Sawadaea_nankinensis_MUMH1273 TTGACCTCGGATCAGGTAGG???????????????????????????????????????????????????????????????GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAGATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGTAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGCGTCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTAA------GGGTGCATCATCGACCGATCCGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sawadaea_nankinensis_MUMH3691 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG-------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTA{AG}ATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGTAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGCGTCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTAA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAA------------------------------------------------------ Sawadaea_nankinensis_MUMH3799 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGTAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGCGTCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTAA------GGGTGCATCATCGACCGATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Sawadaea_nankinensis_MUMH3801 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGTAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGCGTCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTAA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGAC--------------------------------------------------------------------------------------------------------------------------------------------------- Sawadaea_nankinensis_MUMH4232 TTGACCTCGGATCAGGTAGGGATACCCGCTGA--------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGTAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGCGTCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTAA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAG------------------------------------------------------------------------------------------ Sawadaea_nankinensis_MUMH4233 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG-------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGTAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGCGTCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTAA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATT--------------------------------------------------- Sawadaea_polyfida_ex_A._japonicum_AB193393 TTGACCTCGGATCAGGTAGGGAT-----------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGCGGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCC Sawadaea_polyfida_ex_A._palmatum_AB193397 TTGACCTCGGATCAGGTA-----------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCC Sawadaea_sp._ex_A._argutum_AB193395 TTGACCTCGGATCAGGTAG----------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCA?CGGTTCTGACGTGCAAATCGATCGTCA?????GGGTATAGGGGCGAAAGACTAATCGAACC?TCTAGTA?CTGGTTCCTGCC Sawadaea_sp._ex_A._cissifolium_AB193394 TTGACCTCGGATCAGGTA-----------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCCGGCGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCGCCGGTGGCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCC Sawadaea_sp._ex_A._negundo_AB193392 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCCGATCCGCGGGGG-TTCTCCCTCGGGCACTCGGTAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGTCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCC Sawadaea_tulasnei_ex_A._mono_AB193399 TTGACCTCGGATCAGGTA-----------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGCCA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGG?TG?A?CC??AG??AACTCTGGTG--------------------------------------------------------------------------------------------- Sawadaea_tulasnei_ex_A._mono_AB193400 TTGACCTCGGATCAGGTA----------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGA?ACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCC Sawadaea_tulasnei_ex_A._platanoides_AB193398 TTGACCTCGGATCAGGTAGGGAT-----------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGTCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGT-------------- Typhulochaeta_japonica TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA--------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCTTGC-GCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCCAGAG-TTCTCTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCAGAGGAACGTAGCTACCTTTC--GGGGGAGTGTTTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTG------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATATACTAG-CTGTTCCTGC- ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 28S_rDNA) = N: 1-968; CODONPOSSET CodonPositions (CHARACTERS = 28S_rDNA) = N: 1-968; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2963] TITLE ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=480; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Podosphaera_tridactyla CCGAGCGCGAGCCACGCAGGGCGCCTGTCCTGTGTTGGCTGACCCTCCACCCGTGTGAATTATATCTATTGTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTCAGTGTTGTCTGAGTGAATGTGGAATTAATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATGTATCTCGCGACAGAGCGGCGACGGGACCTGCCAGAACCCCCCAATTTTCTTG Podosphaera_xanthii CTGAGCGCGAGCCCCGCAGCGCGCACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATCT--GTTGCTTTGGCGGGCCGGGCTCGACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTGAGTGTTGTCTGAGGAAATGTGGAATTAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTATCTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC--AGTCTTT-GG Sawadaea_bicornis_ex_A._campestre_AB193362 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTACTTTGGCGGGCCAGGCTCGACCTACCGGCTCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTACAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCTTGGGGCCTGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGTGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGACCTGCCGAAGCT---CCATCTCTTGG Sawadaea_bicornis_ex_A._campestre_AB193378 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTACTTTGGCGGGCCAGGCTCGACCTACCGGCTCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTACAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCTTGGGGCCTGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGTGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGACCTGCCGAAGCT---CCATCTCTTGG Sawadaea_bicornis_ex_A._campestre_AB193379 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTACTTTGGCGGGCCAGGCTCGACCTACCGGCTCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTACAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCTGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGTGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGACCTGCCGAAGCT---CCATCTCTTGG Sawadaea_bicornis_ex_A._platanoides_AF298540 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTACTTTGGCGGGCCAGGCTCGACCTACCGGCTCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTACAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCTGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGTGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGACCTGCCGAAGCT---CCATCTCTTGG Sawadaea_bicornis_ex_A._pseudoplatanus_AB193380 CCGAGCGCGAGCCACGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATTTCA-GGCTACTTTGGCGGGCCGGGCTCGACCTACCGGCTCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTACAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCTGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGTGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGACCTGCCGAAGCT---CCATCTCTCGG Sawadaea_nankinensis_ex_A._buergerianum_MUMH1273 CTGAGCGTGAGCCACGCAGGGCGCAAGCCCCGCG-CGGCCGACCCTCCACCCGTGCCGACTCATATCC-GGTTGCCCTGGCGG-----------CCTGCCGGCCCCGGCTGGCA-GTGCCCGCGAGAGGCGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTCGCAGTTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCCGCCGGCCTGGCGGCCCTTAAACACAGTGGCGGCGCCGCCGCGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCAGGCGGGGCCAGCCGAAGCACCCCCTTCTCTCGG Sawadaea_nankinensis_ex_A._buergerianum_MUMH3691 CTGAGCGTGAGCCACGCAGGGCGCAAGCCCCGCG-CGGCCGACCCTCCACCCGTGCCGACTCATATCC-GGTTGCCCTGGCGG-----------CCTGCCGGCCCCGGCTGGCA-GTGCCCGCGAGAGGCGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTCGCAGTTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCCGCCGGCCTGGCGGCCCTTAAACACAGTGGCGGCGCCGCCGCGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCAGGCGGGGCCAGCCGAAGCACCCCCTTCTCTCGG Sawadaea_nankinensis_ex_A._buergerianum_MUMH3799 CTGAGCGTGAGCCACGCAGGGCGCAAGCCCCGCG-CGGCCGACCCTCCACCCGTGCCGACTCATATCC-GGTTGCCCTGGCGG-----------CCTGCCGGCCCCGGCTGGCA-GTGCCCGCGAGAGGCGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTCGCAGTTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCCGCCGGCCTGGCGGCCCTTAAACACAGTGGCGGCGCCGCCGCGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCAGGCGGGGCCAGCCGAAGCACCCCCTTCTCTCGG Sawadaea_nankinensis_ex_A._buergerianum_MUMH3801 CTGAGCGTGAGCCACGCAGGGCGCAAGCCCCGCG-CGGCCGACCCTCCACCCGTGCCGACTCATATCC-GGTTGCCCTGGCGG-----------CCTGCCGGCCCCGGCTGGCA-GTGCCCGCGAGAGGCGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTCGCAGTTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCCGCCGGCCTGGCGGCCCTTAAACACAGTGGCGGCGCCGCCGCGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCAGGCGGGGCCAGCCGAAGCACCCCCTTCTCTCGG Sawadaea_nankinensis_ex_A._buergerianum_MUMH4232 CTGAGCGTGAGCCACGCAGGGCGCAAGCCCCGCG-CGGCCGACCCTCCACCCGTGCCGACTCATATCC-GGTTGCCCTGGCGG-----------CCTGCCGGCCCCGGCTGGCA-GTGCCCGCGAGAGGCGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTCGCAGTTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCCGCCGGCCTGGCGGCCCTTAAACACAGTGGCGGCGCCGCCGCGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCAGGCGGGGCCAGCCGAAGCACCCCCTTCTCTCGG Sawadaea_nankinensis_ex_A._buergerianum_MUMH4233 CTGAGCGTGAGCCACGCAGGGCGCAAGCCCCGCG-CGGCCGACCCTCCACCCGTGCCGACTCATATCC-GGTTGCCCTGGCGG-----------CCTGCCGGCCCCGGCTGGCA-GTGCCCGCGAGAGGCGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTCGCAGTTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCCGCCGGCCTGGCGGCCCTTAAACACAGTGGCGGCGCCGCCGCGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCAGGCGGGGCCAGCCGAAGCACCCCCTTCTCTCGG Sawadaea_polyfida_ex_A._amoenum_AB193374 ??GAGCG???GCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGTGGGCCAGGCTCGACCTGCCGGCTCCGGCCGGGA-GCGCCCGCCAGAGGGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCCTGGGGCCCGCCCGCCGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_polyfida_ex_A._amoenum_var._matsumurae_AB193358 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGTGGGCCAGGCTCGACCTGCCGGCTCCGGCCGGGA-GCGCCCGCCAGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCCTGGGGCCCGCCCGCCGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_polyfida_ex_A._amoenum_var._matsumurae_AB193381 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGTGGGCCAGGCTCGACCTGCCGGCTCCGGCCGGGA-GCGCCCGCCAGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCCTGGGGCCCGCCCGCCGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_polyfida_ex_A._japonicum_AB193369 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGTGGGCCAGGCTCGACCTGCCGGCCCCGGCCGGGA-GCGCCCGCCAGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCCTGGGGCCCGCCCGCCGGGCGGCCCTCAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_polyfida_ex_A._palmatum_AB000936 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGTGGGCCAGGCTCGACCTGCCGGCTCCGGCCGGGA-GCGCCCGCCAGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCCTGGGGCCCGCCCGCCGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_polyfida_ex_A._palmatum_AB193382 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGTGGGCCAGGCTCGACCTGCCGGCTCCGGCCGGGA-GCGCCCGCCAGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCA{AT}CGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCCTGGGGCCCGCCCGCCGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_polyfida_ex_A._shirasawanum_AB193352 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGTGGGCCAGGCTCGACCTGCCGGCCCCGGCCGGGA-GCGCCCGCCAGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCCTGGGGCCCGCCCGCCGGGCGGCCCTCAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_polyfida_ex_A._sieboldianum_AB193360 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGTGGGCCAGGCTCGACCTGCCGGCTCCGGCCGGGA-GCGCCCGCCAGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCCTGGGGCCCGCCCGCCGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_polyfida_ex_A._sieboldianum_AB193365 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGTGGGCCAGGCTCGACCTGCCGGCTCCGGCCGGGA-GCGCCCGCCAGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCCTGGGGCCCGCCCGCCGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_sp._ex_A._argutum_AB193367 CCGAGCGCGAGCCACGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTCCTCTGGGGGGCCA------ACCTGCCGGCTCCGGCCGGGA-GGGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAGTTAATTAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAACCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGGCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCC-CCCCTTCTCTCGG Sawadaea_sp._ex_A._argutum_AB193375 CCGAGCGCGAGCCACGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTCCTCTGGGGGGCCA------ACCTGCCGGCTCCGGCCGGGA-GGGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAGTTAATTAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAACCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGGCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCC-CCCCTTCTCTCGG Sawadaea_sp._ex_A._australe_AB193384 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGTGGGCCAGGCTCGACCTGCCGGCTCCGGCCGGGA-GCGCCCGCCAGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCCTGGGGCCCGCCCGCCGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_sp._ex_A._cissifolium_AB193373 CCGAGCG?GAGCCACGCGGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCCCTGGTGGGCCGGGCTCGACCTGCCGGCTCCGGCCGGGA-GCGCCCGCCAGGGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCGATGAATGAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCCTGGGGCCCGCCCGCGGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCACCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_sp._ex_A._micranthum_AB193371 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGTGGGCCAGGCTCGACCTGCCGGCTCCGGCCGGGA-GCGCCCGCCAGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCCTGGGGCCCGCCCGCCGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_sp._ex_A._negundo_AB193350 ??????????????????????????????????-???CCGACCCTCCACCCGTGCTGA--TATTTCA-GGCTACTTTGGCGGGCCGGGCTCGACCTACCGGCTCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTACAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCTGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGTGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGACCTGCCGAAGCT---CCATCTCTCGG Sawadaea_sp._ex_A._negundo_AB193353 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGTCCGCCCGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_sp._ex_A._negundo_AB193354 CCGAGCGCGAGCCACGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATTTCA-GGCTACTTTGGCGGGCCGGGCTCGACCTACCGGCTCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTACAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCTGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGTGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGACCTGCCGAAGCT---CCATCTCTCGG Sawadaea_sp._ex_A._negundo_AF011313 ????????????????CACGGCGCCAGCGACGCG-TGGCCGACCCTCCACCCGTGCTAA--TGTTTCA-GGCTACTTTGGCGGGCCGGGCTCGACCTACCGGCTCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTACAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCTGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGTGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGACCTGCCGAAGCT---CCATCTCTCGG Sawadaea_sp._ex_A._negundo_AF073356 CCGAGCGCGAGCCACGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATTTCA-GGCTACTTTGGCGGGCCGGGCTCGACCTACCGGCTCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTACAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCTGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGTGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGACCTGCCGAAGCT---CCATCTCTCGG Sawadaea_sp._ex_A._nipponicum_AB193370 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_sp._ex_A._platanoides_AB193387 ??????????????????????????????????-????CGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_sp._ex_A._pseudoplatanus_AB193351 CCGAGCGCGAGCCACGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATTTCA-GGCTACTTTGGCGGGCCGGGCTCGACCTACCGGCTCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTACAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCTGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGTGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGACCTGCCGAAGCT---CCATCTCTCGG Sawadaea_sp._ex_A._rufinerve_AB193355 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGTAGTCGGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_sp._ex_A._tataricum_AB193383 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCCGGCCCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCTCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCCCTACGCGTAGTAATTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_sp._ex_Acer_sp._AB193390 CCGAGCGCGAGCCACGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCCGGCCCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCTCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAATTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_sp._ex_Acer_sp._AB193391 CCGAGCGCGAGCCACGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCCGGCCCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCTCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAATTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._crataegifolium_AB193359 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGTTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._crataegifolium_AB193364 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGGG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGTAGTCGGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._crataegifolium_AB193368 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGTAGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._ginnala_AB193372 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGTTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._mono_subsp._glaucum_AB193357 CCGAGCGCGA?CCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTG?TGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._mono_var._ambiguum_AB193356 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCGTCTCTCGG Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB022367 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB193366 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB193377 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB193386 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB193388 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._mono_var._mayrii_AB193376 CCGAGCGCGAGCCGCGCAGGGCGCCAGCCCCGCG-CGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCTGGCTCCGGCCGGGA-GCGCCCGCCCGAGAGGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCCCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._platanoides_AB193361 CCGAGCGCGAGCCACGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCCGGCCCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCAAGCCTGGCTTGGTCCTGGGGCTCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAATTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._platanoides_AB193363 CCGAGCGCGAGCCACGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCCGGCCCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCTCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAATTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG Sawadaea_tulasnei_ex_A._platanoides_AB193385 CCGAGCGCGAGCCACGCAGGGCGCCAGCCCCGCG-TGGCCGACCCTCCACCCGTGCTGA--TATATCA-GGCTGCTCTGGCGGG----------CCTGCCGGCCCCGGCCGGGA-GCGCCCGCCAGAGACGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTTGCAATTAATAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTGGCTTGGTCCTGGGGCTCGCCCGCTGGGCGGCCCTTAAACACAGTGGCGGCGCCGTCGTGCTCTACGCGTAGTAATTCTTCTCGCGACAGGGCGCTGACGGGGCCTGCCGAAGCT---CCTTCTCTCGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS) = N: 1-480; CODONPOSSET CodonPositions (CHARACTERS = ITS) = N: 1-480; END; BEGIN TREES; TITLE Tb8754; LINK TAXA = Taxa1; TRANSLATE 1 Sawadaea_tulasnei_ex_A._platanoides_AB193385, 2 Sawadaea_tulasnei_ex_A._platanoides_AB193363, 3 Sawadaea_tulasnei_ex_A._platanoides_AB193361, 4 Sawadaea_tulasnei_ex_A._mono_var._mayrii_AB193376, 5 Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB193388, 6 Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB193386, 7 Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB193377, 8 Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB193366, 9 Sawadaea_tulasnei_ex_A._mono_var._marmoratum_AB022367, 10 Sawadaea_tulasnei_ex_A._mono_var._ambiguum_AB193356, 11 Sawadaea_tulasnei_ex_A._ginnala_AB193372, 12 Sawadaea_tulasnei_ex_A._crataegifolium_AB193368, 13 Sawadaea_tulasnei_ex_A._crataegifolium_AB193364, 14 Sawadaea_tulasnei_ex_A._crataegifolium_AB193359, 15 Sawadaea_sp._ex_Acer_sp._AB193391, 16 Sawadaea_sp._ex_Acer_sp._AB193390, 17 Sawadaea_sp._ex_A._tataricum_AB193383, 18 Sawadaea_sp._ex_A._rufinerve_AB193355, 19 Sawadaea_sp._ex_A._pseudoplatanus_AB193351, 20 Sawadaea_sp._ex_A._platanoides_AB193387, 21 Sawadaea_sp._ex_A._nipponicum_AB193370, 22 Sawadaea_sp._ex_A._negundo_AF073356, 23 Sawadaea_sp._ex_A._negundo_AF011313, 24 Sawadaea_sp._ex_A._negundo_AB193354, 25 Sawadaea_sp._ex_A._negundo_AB193353, 26 Sawadaea_sp._ex_A._negundo_AB193350, 27 Sawadaea_sp._ex_A._micranthum_AB193371, 28 Sawadaea_sp._ex_A._cissifolium_AB193373, 29 Sawadaea_sp._ex_A._australe_AB193384, 30 Sawadaea_sp._ex_A._argutum_AB193375, 31 Sawadaea_sp._ex_A._argutum_AB193367, 32 Sawadaea_polyfida_ex_A._sieboldianum_AB193365, 33 Sawadaea_polyfida_ex_A._sieboldianum_AB193360, 34 Sawadaea_polyfida_ex_A._shirasawanum_AB193352, 35 Sawadaea_polyfida_ex_A._palmatum_AB193382, 36 Sawadaea_polyfida_ex_A._palmatum_AB000936, 37 Sawadaea_polyfida_ex_A._japonicum_AB193369, 38 Sawadaea_polyfida_ex_A._amoenum_var._matsumurae_AB193381, 39 Sawadaea_polyfida_ex_A._amoenum_var._matsumurae_AB193358, 40 Sawadaea_polyfida_ex_A._amoenum_AB193374, 41 Sawadaea_nankinensis_ex_A._buergerianum_MUMH4233, 42 Sawadaea_nankinensis_ex_A._buergerianum_MUMH4232, 43 Sawadaea_nankinensis_ex_A._buergerianum_MUMH3801, 44 Sawadaea_nankinensis_ex_A._buergerianum_MUMH3799, 45 Sawadaea_nankinensis_ex_A._buergerianum_MUMH3691, 46 Sawadaea_nankinensis_ex_A._buergerianum_MUMH1273, 47 Sawadaea_bicornis_ex_A._pseudoplatanus_AB193380, 48 Sawadaea_bicornis_ex_A._platanoides_AF298540, 49 Sawadaea_bicornis_ex_A._campestre_AB193379, 50 Sawadaea_bicornis_ex_A._campestre_AB193378, 51 Sawadaea_bicornis_ex_A._campestre_AB193362, 52 Sawadaea_tulasnei_ex_A._mono_subsp._glaucum_AB193357, 53 Podosphaera_xanthii, 54 Podosphaera_tridactyla; TREE Fig._10 = [&R] ((54,53),(((((((36,(34,37),33,32,39,27,40,38,35,29),28),((9,25,(((18,13),12),14,11),10,8,52,21,4,7,6,5),20)),((2,3,1,15,16),17)),((24,19,26,47,22,23),((51,50),49,48))),(31,30)),(46,45,42,41,44,43))); END; BEGIN TREES; TITLE Tb8753; LINK TAXA = Taxa2; TRANSLATE 1 Typhulochaeta_japonica, 2 Sawadaea_tulasnei_ex_A._platanoides_AB193398, 3 Sawadaea_tulasnei_ex_A._mono_AB193400, 4 Sawadaea_tulasnei_ex_A._mono_AB193399, 5 Sawadaea_sp._ex_A._negundo_AB193392, 6 Sawadaea_sp._ex_A._cissifolium_AB193394, 7 Sawadaea_sp._ex_A._argutum_AB193395, 8 Sawadaea_polyfida_ex_A._palmatum_AB193397, 9 Sawadaea_polyfida_ex_A._japonicum_AB193393, 10 Sawadaea_nankinensis_MUMH4233, 11 Sawadaea_nankinensis_MUMH4232, 12 Sawadaea_nankinensis_MUMH3801, 13 Sawadaea_nankinensis_MUMH3799, 14 Sawadaea_nankinensis_MUMH3691, 15 Sawadaea_nankinensis_MUMH1273, 16 Sawadaea_bicornis_ex_A._campestre, 17 Podosphaera_xanthii, 18 Podosphaera_tridactyla, 19 Podosphaera_pannosa, 20 Podosphaera_longiseta, 21 Podosphaera_filipendulae, 22 Pleochaeta_shiraiana, 23 Phyllactinia_moricola, 24 Phyllactinia_kakicola, 25 Neoerysiphe_galeopsidis, 26 Leveillula_taurica, 27 Golovinomyces_orontii, 28 Golovinomyces_cichoracearum, 29 Erysiphe_simulans, 30 Erysiphe_pulchra, 31 Erysiphe_mori, 32 Erysiphe_heraclei, 33 Erysiphe_gracilis, 34 Erysiphe_glycines, 35 Erysiphe_friesii, 36 Erysiphe_australiana, 37 Erysiphe_aquilegiae, 38 Erysiphe_adunca, 39 Cystotheca_wrightii, 40 Cystotheca_lanestris, 41 Byssoascus_striatosporus, 42 Brasiliomyces_trina, 43 Blumeria_graminis_f._sp._tritic, 44 Blumeria_graminis_f._sp._hordei, 45 Blumeria_graminis_f._sp._bromi, 46 Arthrocladiella_mougeotii; TREE Fig._9 = [&R] ((((((((37,((32,35),30)),(34,(((33,(42,29)),1),31))),38),(((28,27),46),25)Golovinomyceteae),36),(((23,24),26),22)Phyllactinieae),((((((5,16),((9,6,7,8,4,3),2)),(15,14,11,10,13,12))Sawadaea,(39,40)Cystotheca),((17,(20,18)),(19,21))Podosphaera)Cystotheceae,((44,43),45)Blumerieae)),41); END;