#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 14:52 GMT TreeBASE (cc) 1994-2008 Study reference: Yuan Y., Jia C., & He S. 2016. Geliporus exilisporus gen. et. comb. nov., a xanthochroic polypore in Phanerochaetaceae from China. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S19413] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=85; TAXLABELS 'Amyloporia xantha AFTOL_ID_1504' 'Antrodia albida CBS_308_82' 'Antrodiella pallescens Miettinen_12611' 'Bjerkandera adusta HHB_12826_Sp' 'Bondarzewia submesenterica Cui_10724' 'Byssomerulius corium FP_102382' 'Ceraceomyces serpens HHB_15692_Sp' 'Ceriporia crassitunicata Dai_10833' 'Ceriporia lacerata Dai_10734' 'Ceriporia variegata Li_1780' 'Ceriporiopsis aneirina HHB_15629_Sp' 'Cerrena unicolor FD_299' 'Climacocystis borealis FD_31' 'Climacodon septentrionalis AFTOL_ID_767' 'Crustodontia chrysocreas HHB_6333_Sp' 'Diplomitoporus crustulinus FD_137' 'Efibula americana FP_102165' Flavodon_flavus_LE295997 'Fomitopsis pinicola AFTOL_ID_770' 'Gelatoporia subvermispora FD_354' Geliporus_exilisporus_Dai2172 Geliporus_exilisporus_Dai7528 'Geliporus exilisporus Dai_15244' 'Geliporus exilisporus Dai_15248' 'Heterobasidion annosum Korhonen_06129_6' 'Hydnophlebia omnivora KKN_112' 'Hyphoderma litschaueri FP_101740_Sp' 'Hyphoderma medioburiense FD_335' 'Hyphoderma mutatum HHB_15479_Sp' 'Hyphoderma setigerum FD_312' Hyphodermella_corrugata_MA 'Hyphodermella corrugata MA_Fungi_5527' 'Hyphodermella rosae FP_150552' 'Hyphodermella rosae MA_Fungi_22929' 'Hyphodermella rosae MA_Fungi_24292' Inonotopsis_subiculosa_Dai14799 'Irpex oreophilus Niemela_7691' 'Junghuhnia fimbriatella Miettinen_2091' 'Junghuhnia pseudozilingiana Matti_Kulju_1004' 'Megasporoporia hexagonoide Dai_12079' 'Megasporoporia major Cui_10253' 'Meruliopsis taxicola Kuljok_00_75' 'Mycoacia fuscoatra KH_13275' Mycoacia_nothofagi_KHL13750 'Obba rivulosa FP_135416_Sp' 'Oxyporus corticola Dai_12632' 'Oxyporus populinus Dai_12793' 'Panus lecomtei HHB_11042_Sp' 'Perenniporia medulla panis_Dai_10780' 'Perenniporia medulla panis_MUCL_49581' 'Phaeophlebiopsis caribbeana HHB_6990' 'Phaeophlebiopsis peniophoroides FP_150577' 'Phanerochaete affinis KHL_11839' 'Phanerochaete arizonica RLG_10248_Sp' 'Phanerochaete australis HHB_105_Sp' 'Phanerochaete burtii HHB_4618' 'Phanerochaete carnosa HHB_9195_Sp' 'Phanerochaete chrysosporium HHB_6251_Sp' 'Phanerochaete citrinosanguinea FP_105385' 'Phanerochaete ericina HHB_2288' 'Phanerochaete laevis HHB_15519_Sp' 'Phanerochaete magnoliae HHB_9829_Sp' 'Phanerochaete sordida KHL_12054' 'Phanerochaete subceracea FP_105974_R' 'Phellinus ferrugineovelutinus Cui_10042' 'Phlebia acerina FD_301' 'Phlebia radiata AFTOL_ID_484' 'Phlebia setulosa HHB_6891_Sp' 'Phlebia unica KHL_11786' 'Phlebiopsis flavidoalba FD_263' 'Phlebiopsis gigantea FP_70857_Sp' 'Pirex concentricus OSC_41587' 'Rhizochaete brunnea MR_229b' 'Rhizochaete fouquieriae KKN_121b' 'Scopuloides rimosa HHB_15484' 'Skeletocutis chrysella FD_305' 'Spongipellis delectans HHB_10489_Sp' 'Spongipellis pachyodon FD_314' 'Steccherinum ochraceum KHL_11902' 'Terana caerulea FP_104073' Trametes_hirsuta_RLG5133T 'Trametes ochracea HHB_13445' 'Trametopsis cervina AJ_185' 'Tyromyces chioneus FD_4' 'Xanthoporus higanensis AFTOL_ID_774' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M44848] TITLE Geliporus_exilisporus; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1477; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Amyloporia xantha AFTOL_ID_1504' A--TACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTGGTCTTTGGCCATCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCGGAACTCAGCCTTGCTT---TTGCTA-GGTGCACTTTCTGGTT-GACGGGCCAGCATCAATTTTGAT-TGTTGGATAAAGGTTGGGGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCCTCAGTCACATACAACAGTTGGGATTGAGGATCTCAGCACGCCTTTA-TGGCCGGGG---TTCGCCCACGT-TCGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCTCTGTCATGGAGAGCACCGACGCCCGGACCTGACCTTCTGTGACGGCTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTGGTGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Antrodia albida CBS_308_82' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAAT--TATCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGCTT---TAGCTT-GGTGCATTTTCTGGTT-GACGGGCCAGCATCGATTTCGGT-CGTCGGATAAAGGTTGAGGGAATGTGGCA-TCTTCG--GATGTGTT-ATAGCCCTCAGTCACATACGACGGCTGGAATCGAGGACCGCAGCACGCCTTTA-TG-CCGGGG---TTCGCCGACCGTTCG-GCT-AGGATGC-GGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Antrodiella pallescens Miettinen_12611' TAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGC-TTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCTGTGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTCCCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTTGGCCAGAACTCAGCCTGGCTTTT---GCCT-GGTGCATTTTCTGGTT-GACGGGCCAGCATCAATTTTGAT-CGCTGGATAAAGGCCTTGGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCCTTGGTTGTATACAGTGGTTGGGATTGAGGATCACAGCATGCCTTTA-CGGCCGGGGT--TC-GCCCACGTT-CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGGGA-TCCCTGTCGCGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Bjerkandera adusta HHB_12826_Sp' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTCTCATGGAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTC---GGCCGTCCGAGTTGTAATCTGGAGAAGCGTTTTCCGCGCCGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACC{AG}GTGCTATGTGATGCGCTCTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTGTGCTAGAACTCAGCCTTGCTTTT---GCTT-GGTGCATTTTCTAGTG-TACGGGCCAGCATCAGTTTTGGC-CGCCGGAAAAAGGCCTTGGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCCTTGGTTGTATACGGTGGCTGGGACTGAGGAACATAGCATGCCTTTA-CGGCGGGGC--TTC-GGCCACCT-TCATGCTTTGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCG{CT}AATGAAAGTGAAAGTTGGGA-CTTCTGTCGTGGAAGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Bondarzewia submesenterica Cui_10724' ATACAACTTTCAACAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCCCTTTGGC-ATTCCGAAGGGCACACCTGTTTGAGTGTCGTGAAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGTCGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTCTGACACGGACAGCCGATGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATCGAAGTCAGTCGCGTCCGCCGGGACTCAGCCTCGCAATC-TTGCTT-GGTGTATTTTCTGGTG-GACGGGCCAGCATCAATTTTGGT-CGCCGGACAAAGGCTGGAGAAATGTGGCACCT-TC--GGGTGTGTT-ATAGTCTCTGGTCACACGCGGCGGTCGGGATTGAGGAACTCAGCACGCCTTTA-TGGTCGGGGC--TTTGCCCACGTTTCGTGCTTAGGATGCTGGCGTAATGGCTTTGAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGGA-AAACCCGTGCGCGTAATGAAAGTGATAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGAACTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCCGTCGCTTTATTGGACCGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG-- 'Byssomerulius corium FP_102382' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGCCATTCCGAGGAGCATGCCTGTTTGAGTATCATGAAAT--TCTCAA-A---ACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGG-CTTTTGTCGTCCGAGTTGTATTCTAGAGAAGCGTTTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTAGCTACAACTCAGCCAGGC--TT---GCTT-GGTGCAATTTGTAGTT-GACGGGCCAGCATCAGTTTTGAC-CGCAGGAAAAAGGCCAGGGAAATGTGGCA-CCTTCG--GGTGTGTT-ATAGTCCTTGGTTGTATACTGTGATTGGGACTGAGGCTCTCAGCACGCTTTTG-TTGT------------------------GCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGT-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCTCTGTCGCGGAGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Ceraceomyces serpens HHB_15692_Sp' TAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGG-----GGTCGTCCGAGTTGTAGTCTAGAGAAGTGTCTTCCGCGCCGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCTAGAACTCAGCCTTGCA-TT---GCTC-GGTGCATTTTCTAGTC-GACGGGCCAGCATCAGTTTTGAC-CGCGGGACAAAGGTCGGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTCTGGCTGCATGCCGTGATTGGGACTGAGGAACTCAGCACGCATCTG-CTGT------------------------GCTAAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACATGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCGGGCCAGACCTTCTGTGACGGCCCCGCGGTAGAGCAGGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAGCTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Ceriporia crassitunicata Dai_10833' ATTTACAACTTTCAGCAACGGATCTCTTGGCTCT-TGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTATCATGGAAA--CCTCAATAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTAACAGTCTTTGGCTGTTCGAGTTGTATTCTAGAGAAGTGTTTTCTGTGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTAGTTAGAACTCAGCCTTGCTTTG---GCTT-GGTGCACTTTCTAATG-AACGGGCCAGCATCAGTTTTGGC-TGCGAGATAAAGGTCGGAGGAATGTGGCA-CCTTTG--GGTGTGTT-ATAGCCTTTGATTGTATATCGCAGCTGGGACTGAGGATCTCAGCACGCCTTTA-CGGCCGGGG---TTCGCCCACGT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGT-AAACCCGAGCGCATAATGAAAGTGAAAGTTGGGA-TCTCTGTCATGGAGAGCACCGACGCCCAGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCATGTATGCTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTGGTGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCAAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTTG 'Ceriporia lacerata Dai_10734' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCACTCCTTGGT-ATTCCGAGGAGTATGCCTGTTTGAGTCTCATGGAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGG-CTTTGGTCGTCCGAGTTGTATCCTAGAGAAGTGTTTTCCGCGTTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTTAGCTAGAACTCAACCAGGC--TT---GCTT-GGCGTATTTTCTAGTT-AACGGGCCAGCATCAGTTTTGAC-CGCAGGAAAAAGGCCAGGGAAATGTGGCA-CCTTCG--GGTGTGTT-ATAGTCTTTGGTCATATACTGCGATTGGGACTGAGGTTCGCAGCACGCGCAAG-CTGT------------------------GCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTATTTGGGTGGT-AAACCCGAGTGCGTAATGAAAGTAAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTAATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCA 'Ceriporia variegata Li_1780' TTATACAACTTTCAGCAACGGATCTCTTGGCTCT-TGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTATCATGAAAA--TCTCAATAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGACAGTCTTTGGCTGTTCGAGTTGTATTCTAGAGAAGTGTTTTCTGTGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTAATTAGAACTCAGCCTCGCTTTT---GCTT-GGTGCATTTTCTAATG-AACGGGCCAGCATCAGTTTTGAC-TGCGAGATAAAGGTCGGAGGAATGTGGCA-CCCTTG--GGTGTGTT-ATAGCCTTTGATTGTATATCGCAGCTGGGACTGAGGATCTCAGCACGCCTTTA-TGGCCGGGG---TTCGCCCACGT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGT-AAACCCGAGCGCATAATGAAAGTGAAAGTTGGGA-TCTCTGTCATGGAGAGCACCGACGCCCAGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCATGTATGCTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCAAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTTG 'Ceriporiopsis aneirina HHB_15629_Sp' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAG-------TTGTCCGAGTTGTAGTCTAGAGAAGCGTTTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTATGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTAGTTAGAACTCAGCCAGGC--TT---GCCT-GGTGCATTTTCTAATTTAACGGGCCAGCATCAATTTTGGC-TGCGGGATAAAGGTCAGAGAAATGTGGCA-GCTTCG--GCTGTGTT-ATAGTCTCTGGCTGCATACCGTGACCGGGATTGAGGATCTCAGCACGCATTTG-TTGTT-----------------------GCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTATTTGGGTGATTAAACCCGAGTGCGCAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCGGACCAGACCTTTTGCGACGGCTCTGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCA 'Cerrena unicolor FD_299' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCCCCTTGGT-ATTCCGAGGGGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGCCTTCGGTTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGCTGGACCGTGTATAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTATGCAGAACTCAGCCTGGCTTTT---GCTT-GGTGTATTTTCTGTAT-GACGGGTCAGCATCAATTTTGAT-CGCTGGAAAAAGGCCTCAGAAATGTGGCA-CCTTCG--GGTGTGTT-ATAGTCTGGGGTCATATACAGCGGTTGGGATTGAGGTCTGCAGCACGCCTTTA-TGGCTGGGGT--TC-GCCCACATT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGA-TCCCTGTCGTGGGGAGCATCGACGCCCGGACCAGACCTTTTGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCCGTCTCTTAATTGGACCGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Climacocystis borealis FD_31' TAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACCGCCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGAACTCAGCCTGGCTTTT---GCTT-GGTGCATTTTCTGGAT-AACGGGCCAGCATCAATTTTGAT-CGTTGGATAAAGGTCTTGGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCCTTGATTGCATACAACGATTGGGATTGAGGATCTCAGCATGCCTTTA-TGGTCGGGGT--TC-GCCCACGTT-CATGCTTAGGATGCTGGCGTAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGT-AAACCCGAGTGCGCAATGAAAGTGAAAGTTGGGA-TCTCTGTCGCGGAGAGCACCGACGCCCGGACCAGACCTTTTGTGACGGTTCCGCGGTGGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACACTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGTGTGCTACCCATACCTCG 'Climacodon septentrionalis AFTOL_ID_767' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTAC--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGACTGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGTGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCACGTTGTTCAGAACTCAACCTGGCTTTTTT-GCTT-GGTGCATTTTCTGATT-AACGGGTCAGCATCAGTTTTGAC-TGTTGGAAAAATTCCATTGGAATGTGGCA-CCTTCAAAGGTGTGTT-ATAGCCTTTGGTTGTATGCGACAGTTGGGACTGAGGATTGCAGCACGCCTTTA-TGGCCGGGGT--TC-GCCCACGT-ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGC-AAACCCGAGTGCGCAATGAAAGTGAAAGTTGGGA-TCCCTGTCATGGGGAGCACCGACGCCCATACCAGACCTTCTGTGACGGATATGCGGTGGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTTGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGTGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCA 'Crustodontia chrysocreas HHB_6333_Sp' ATATACAACTTTTAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAAT--TATCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTAG-----GGCTGCCCGAGTTGTAGTCTGGAGAAGTGTCTTCCGCGCCGAACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAACCGCTTGAAGTCAGTCGCGTCGTCTAGAACTCAACCTTGCTT-----GCTC-GGTGCATTTTCTAGTT-GACGGGCCAACATCAGTTTTGAC-TGTCGGAAAAAAGCCTTTGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTTGGGTTGTATACGATGGTTGGGACTGAGGACCGCAGCACGCCTTTA-TGGCCGGGGT--TC-GCCCACGT-ACGTGCTTAGGATGTTGGCGAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGT-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCATACCAGACCTTCTGTGACGGATATGCGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGGGACGTCACTTAATTGGACCTCCTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCA 'Diplomitoporus crustulinus FD_137' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGT----GATTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGTGTTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAATGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTTCAGAACTCAGCCTGGCTTTT---GCTT-GGTGCATTTTCTGAAT-GACGGGCCAGCATCAATTTTGAC-CGGTGGATAAAAGCCTTTGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTTTGGTTGCATACATCGGTTGGGATTGAGGATCTCAGCACGCCTTTA-TGGTCGGGGT--TC-GCCCACGCT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCTCTGTCATGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACACTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGTGTGTTACCCATACCTCA 'Efibula americana FP_102165' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAAAT--TCTCAA-A---ACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGG-CTTTGGTCGTCCGAGTTGTAATCTAGAGAAGTGTCTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCTAGAACTCAGCCAGGC--TT---GCTT-GGTGCATTTTCTAGTC-AACGGGCCAGCATCAGTTTTGAC-TGCGGGAAAAAGGCCGGAGAAATGTGGCA-CCTTCG--GGTGTGTT-ATAGTCTCTGGTTGCATACCGTGGTTGGGACTGAGGCTCTCAGCACGCGCAAG-CTGT------------------------GCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGT-AAACTCGAGCGCGAAATGAAAGTGAAAGTTGGGA-TCCCTGTCGCGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG Flavodon_flavus_LE295997 ACATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCACTCCTTGGT-ATTCCGAGGAGTATGCCTGTTTGAGTCTCATGGTAT--TCTCAA---TAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAGATCTGGCGG-CTTTGGTCGTCCGAGTTGTATTCTAGAGAAGTGTTTTCCGCGTTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACC?ATGCTTTGTGATACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTATCTAGAACTCAACCAGGC--TT---GCTT-GGCGTATTTTCTAGTT-AACGGGCCAGCATCAGTTTTGAC-CGCAGGAAAAAGGCCAGGGAAATGTGGCA-CCCTCG--GGTGTGTT-ATAGTCTCTGGTCATATACTGTGATTGGGACTGAGGACCGCAGCACGCGCAAG-CTGT------------------------GCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTATTTGGGTGGC-AAACCCGAGTGCGCAATGAAAGTGAAAGTTGGGA-TCTCTGTCGTGGAGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTAATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCA 'Fomitopsis pinicola AFTOL_ID_770' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGTGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGCTTAT-TTGCTT-GGTGCATTTTCTGGTT-GACGGGCCAGCATCGATTTTGAC-CGCTGGAAAAAGATTAGGGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCCTTAGTCACATACAGTGGTTGGGATCGAGGACCGCAGCACGCCTTTA-TGGCCGGGG---TTCGCCCACGT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGA-TCCCTGTCGTGGGGAGCATCGACGCCCGGACCTGAACTTCGGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Gelatoporia subvermispora FD_354' TTATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCCCCTTGGT-ATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCCGGAACTCAGCCTTGCTTTC---GCTT-GGTGTACTTTCCGGTC-GACGGGCCAGCATCGATTTCGAT-CGTCGGAAAAAGGCAGAGGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCCTCTGTTGCATACGACGGTTGGGATCGAGGTTCGCAGCACGCCTTTA-TGGTCGGGG---TTCGCCCACGT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAGGTCGGGA-CCTCTGTCATGGAGGGCACCGACGCCCGGACCTGAAGTTCTCTGACGGCTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCTCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG Geliporus_exilisporus_Dai2172 ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCACGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCCGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCTAGAACTCAGCCTAGCCTCG---GCTT-GGTGCATTTTCTAGTA-GACGGGCCAGCATCACTTTTGGT-TGCGGGATAAAGGTCGCAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTGTGATTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCT-----------------------CACG--CTGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG Geliporus_exilisporus_Dai7528 ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCACGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCCGTTTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCTAGAACTCAGCCTAGCCTCG---GCTT-GGTGCATTTTCTAGTA-GACGGGCCAGCATCACTTTTGGT-TGCGGGATAAAGGTCGCAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTGTGATTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCT-----------------------CACG--CTGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCT-- 'Geliporus exilisporus Dai_15244' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCACGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCTAGAACTCAGCCTAGCCTCG---GCTT-GGTGCATTTTCTAGTA-GACGGGCCAGCATCACTTTTGGT-TGCGGGATAAAGGTCGCAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTGTGATTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCT-----------------------CACCG-CTGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Geliporus exilisporus Dai_15248' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCACGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCTAGAACTCAGCCTAGCCTCG---GCTT-GGTGCATTTTCTAGTA-GACGGGCCAGCATCACTTTTGGT-TGCGGGATAAAGGTCGCAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTGTGATTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCT-----------------------CACCG-CTGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Heterobasidion annosum Korhonen_06129_6' TTATACAACTTTCAACAATGGATCTCTCGGTTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCCCTTTGGT-ATTCCGAAGGGCACGCCTGTTTGAGTGTCGTGAAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGCCTCCGGTCGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGTCGGACCGTGTATAAGTTTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCGATGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGCGTCCGCCGGGACTCAGCCTTGCGTTC-TCGCTC-GGTGTACTTTCTGGTG-GACGGGCCAGCATCAATTTTGAT-CGTCGGAAAAGGATCGGGGAAATGTGGCACCTTTCG-GGGTGTGTT-ATAGTCTCCGGTCGCATACGACGGTTGGGATTGAGGAACTCAGCATGCCTTTA-CGGTCGGGG---TTCGCCCACG-TTCATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGGA-AAACCCGTGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGCGGAGGGCACCGACGCCCGGACCAGAACTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCCGTCGCTTGATTGGACCGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Hydnophlebia omnivora KKN_112' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCTAGAACTCAACCTGGCTTCG---GCTT-GGTGCACTTTCTAGTT-AACGGGCCAACATCAGTTTTGGC-CGCTGGAAAAAGGCTGTGGGAATGTGGCA-CCTCCG--GGTGTGTT-ATAGCCCATGGTTGTATACAGCGGCTGGGACTGAGGACCGCAGCACGCCTTTA-TGGCCGGGGT--TC-GCCCACGTTACGTGCTTAGGATGTTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGGGA-TCCCTGTTGTGGGGAGCACCGACGCCCATACCAGACCTTCTGTGACGGATATGCGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTAATTGGACCGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCA 'Hyphoderma litschaueri FP_101740_Sp' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGTAAT--CCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGACAGTCTTTGGCTGTCCGAGTTGTAATCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTTCAGAACTCAGCCTTACTTTT---GTTT-GGTGTATTTTCTGTTC-GACGGGCCAGCATCAATTTTGAC-CATTGGAAAAGGGCCAGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGTCTTTGGTCGCATACAATGGTTGGGATTGAGGATCTCAGCATGCCTTT--TGGCCGGGGT--TC-GCCCACGTT-CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGCTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTAATTGGACCGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGCTACCCATACCTCG 'Hyphoderma medioburiense FD_335' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATTTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGTTAT--TCTCAGTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGATAGTCTTTGGCTGTCCGAGTTGTAAACTGGAGAAGCATTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTTTGTGATGTGCTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTTCAGAATTCAGCCTGGTTTTG---GCCT-GGTGTATTTTCTGTTC-GACGGGCCAGCATCAATTTTGAT-CATTGGAAAAAGGTCTTGGGAATGTGGCA-TCCTCG--GATGTGTT-ATAGCCCTTGGCTGCATACAATGGTTGGGATTGAGGAACTCAGCACGCCTTTA-TGGTCGGGGT--TC-GCCCACGTTTCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGA-AAACCCGAGTGCGCAATGAAAGTGAAAGTTGGGA-TCTCTGTCATGGGGAGCACCGACGCCCGGACCAGACCTTTTGTGACGGCTCCGCGGTAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Hyphoderma mutatum HHB_15479_Sp' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCTTTGGT-ATTCCGAAGAGCATGCCTGTTTGAGTGTCATGTTTA-CCCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCT------GTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGTTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTTCAGAACTCAACCTGGCTTTT---GCTT-GGTGTAATTTCTGCGC-GACGGGCCAGCATCAATTTTGAT-CATTGGAAAAAGTCCAGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTTTGGTCGTATACAATGGTTGGGATTGAGGATCTCAGCACGCCTTTA-TGGTCGGGGT--TC-GCCCACGTT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCTCTGTCATGGAGAGCACCGACGCCCGGACCAGACCTTTTGTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCA 'Hyphoderma setigerum FD_312' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGTATT--CCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGT{CT}TTTGGCTGTCCGAGTTGTAATCTAGAGAAGCGTTTTCCGCGTTGGACCGTGTATAAGTCTTTTGGAATAAAGCATCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTATGCAGAACTCAGCCTGGCTTCC---GCCT-GGTGTATTTTCTGTTT-AACGGGCCAGCATCAATTTTAAT-CATTGGAAAAAGGCTGGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTCTGGTTGCATACAATGGTTGGGATTGAGGATATCAGCATGCCTTT--TGGCCGGGGT--TC-GCCCACGTT-CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCGGACTTGAACTTTTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGCTACCCATACCTCG Hyphodermella_corrugata_MA --T?G---GTT----------------------------------------------------T?G---GTT----------------------------------------------------T?G---GTT----------------------------------------------------T?G---GTT--------------------------------------AGTGAAGCGGGA--T?G---GTTAAAGCTCAAATTTAAAATCTGGCAGCCTTTGGTTGTCCGAGTTGTAGTCT--T?G---GTTGGAGAAGCGTTTTCCGCGTTGGACCGTGTACAAGTCTCCTGGAACGGAGC--T?G---GTTGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGT--T?G---GTTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGT--T?G---GTTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAA--T?G---GTTGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTA--T?G---GTTCGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCTAGAA--T?G---GTTCTCAGCCTGGCCTCG---GCTT-GGTGCATTTTCTAGTG-GACGGGCCAG--T?G---GTTCATCACTTTCGGT-TGCGGGATAAAGGTCGCAGAAATGTGGCA-CCCTCG--T?G---GTT--GGTGTGTT-ATAGTCTGCGGCTGTATACCGTGACTGGGAGTGAGGAAC--T?G---GTTTCAGCACGC---------------------G--CA--AGCTGTGCTTAGG--T?G---GTTATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGA--T?G---GTTGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGA--T?G---GTTAAGTGAAAGTTGGGA-TCTCTGTCGTGGAGAGCACCGACGCCCGGACCAG--T?G---GTTACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGA--T?G---GTTTGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGG--T?G---GTTCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGG--T?G---GTTCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCT--T?G---GTTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTA--T?G---GTTGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATG--T?G---GTTTA 'Hyphodermella corrugata MA_Fungi_5527' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCACGCCCGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGCCTTTGGTTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGTTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCTAGAACTCAGCCTGGCCTCG---GCTT-GGTGCATTTTCTAGTG-GACGGGCCAGCATCACTTTCGGT-TGCGGGATAAAGGTCGCAGAAATGTGGCA-CCCTCG--GGTGTGTT-ATAGTCTGCGGCTGTATACCGTGACTGGGAGTGAGGAACTCAGCACGCG-----------------------CA--AGCTGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCTCTGTCGTGGAGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGC-T?G---GTTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCAC 'Hyphodermella rosae FP_150552' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCACGCCCGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGCCTTCGGTTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGAACTCAGCCTGGCTTCG---GCTT-GGTGCATTTTCTAGTG-AACGGGCCAGCATCACTTTTGGC-TGCGGGATAAAGGTCGCAGAAATGTGGCA-CCCTCG--GGTGTGTT-ATAGTCTGTGGCTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCG-----------------------CA--AGCTGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCTCTGTCGTGGAGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Hyphodermella rosae MA_Fungi_22929' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCACGCCCGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGCCTTCGGTTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGAACTCAGCCTGGCTTCG---GCTT-GGTGCATTTTCTAGTG-AACGGGCCAGCATCACTTTTGGT-TGCGGGATAAAGGTCGCAGAAATGTGGCA-CCCTCG--GGTGTGTT-ATAGTCTGCGGCTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCG-----------------------CA--AGCTGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCTCTGTCGTGGAGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Hyphodermella rosae MA_Fungi_24292' ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGCCTTCGGTTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGAACTCAGCCTGGCTTCG---GCTT-GGTGCATTTTCTAGTG-AACGGGCCAGCATCACTTTTGGT-TGCGGGATAAAGGTCGCAGAAATGTGGCA-CCCTCG--GGTGTGTT-ATAGTCTGTGGCTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCG-----------------------CA--AGCTGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCTCTGTCGTGGAGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTA-T?G---GTTGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCAC Inonotopsis_subiculosa_Dai14799 A-ATACAACTTTCAACAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGTTAA--TATCAATAGTAACTGCGAGTGAAGCGGGATAAGCTCAAATTTAAAATCTGGCGGCTTT--GCTGTCCGAGTTGTAATCTGGAGAAGCGTTTTCCGCGTCGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCGTTGCTTTGTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTCCAGGACTCAGCCTTCGCCTTAGGGCTT-GGTGTACTTCCTGTTA-GACGGGTCAACATCGATTTTGGTTCGGCGGACAAAGGGGAGGGGAATGTGGCA-TCTTCG--GATGTGTT-ATAGCCCTACTTCGTATACGTCGACTGGGATCGAGGACCGCAGTGCGCCCTTG-TGGCCGGAGAT-TCGTCTCACGTATCGCACTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTGTTAGGGTGGA-AAACCCTTACGCGTAATGAAAGTGAAAGTTGGGATCCTCCGCAAGGGGGTGCACCGACGCCCGGCCCTGAAGTTCTCTGACGGTGCTGCGGTAGAGCACGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCTCTTTGTTGGACCGTTCGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGCTACCCATACCTCG 'Irpex oreophilus Niemela_7691' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGACAGC-TTTGGCTGTCCGAGTTGTAATCTGGAGAAGCGTTTTCTGTGCCGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTGGCTTTT---GCCG-GGTGTACTTTCTGGTT-GACGGGCCAGCATCAATTTTGAC-CGTCGGATAAAGGCCTCAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTGGGGTTGCATACGACGGTTGGGATTGAGGATCTCAGCACGCCTTTA-TGGTCGGGGT--TC-GCCCACGTA-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGGGA-TCCCTGTCGCGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Junghuhnia fimbriatella Miettinen_2091' TAATACAACTTTCAACAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCTTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGC-TTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGCTTTCTGTGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTATGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGCGTTGATCAGAACTCAGCCTGGCTTTT---GCTT-GGTGCATTTTCTGATT-GACGGGCCAGCATCAGTTTTGAC-CGCTGGATAAAGGTCTTAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTAGGGTTGTATACAGTGGTTGGGACTGAGGATCACAGCATGCCTTTA-CGGCCGGGGT--TC-GCCCACGTT-CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTAGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGATTTGGGGTTGAAACAACCTCAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Junghuhnia pseudozilingiana Matti_Kulju_1004' TAATACAACTTTCAACAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCTTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGC-TTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGCTTTCTGTGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTATGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGCGTTGATCAGAACTCAGCCTGGCTTTT---GCTT-GGTGCATTTTCTGATT-GACGGGCCAGCATCAGTTTTGAC-CGCTGGATAAAGGCCTTAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTAGGGTTGTATACAGTGGTTGGGACTGAGGATCACAGCATGCCTTTA-TGGCCGGGGT--TC-GCCCACGTT-CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGACTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Megasporoporia hexagonoide Dai_12079' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTTAC--ACCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCATCCGGAACTCAGCCTTGCTTTT---GCTT-GGTGCACTTTCCGGAA-GACGGGTCAGCATCGATTTTGAC-CGTCGGAAAAGGGCCAGAGTAATGTGGCA-CCTCCG--GGTGTGTT-ATAGACTTTGGTCT--TACGACGGTTGGGATCGAGGAACGCAGCGCGCCGCAA--GGCAGGGG---TTCGCCCACTT-TCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGA-CCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGCTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Megasporoporia major Cui_10253' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTTTT--GCCGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACAGGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCTTTT---GCTT-GGTGCACTTTCTGGAA-GACGGGTCAGCATCGATTTTGAC-CGTCGGAAAAGGGCCAGAGTAATGTGGCA-CCTCCG--GGTGTGTT-ATAGACTTTGGTCT--TACGACGGTTGGGATCGAGGAACGCAGCGCGCCGCAA--GGCAGGGG---TTCGCCCACTT-TCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGA-CCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGCTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGTGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Meruliopsis taxicola Kuljok_00_75' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTATCATGGAAT--TCTCAATAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTATTCTAGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTAGCTAGAACTCAGCCTTGCTTTT---GCCT-GGTGCATTTTCTAGTT-GACGGGCCAGCATCAGTTTTGAT-CGCAGGATAAAGGTCAGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTTTGATTGTATACTGTGGTTGGGACTGAGGATCACAGCACGCCTTTA-TGGCCGGGG--TTC-GCCCACGT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTATTTGGGTGGT-AAACCCGAGTGCGTAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGCTCCGCGGTAGAGCATGTATGCTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCCGTCACTTGATTGGACCGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGC-ATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCCGAATGAACTAGCCCTGAAAATTGGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Mycoacia fuscoatra KH_13275' AAATACAACTTTCAACAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTAGTCTTTGGCTGCCCGAGTTGTAGTCTAGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCAGAACTCAACCTGGCTTTT---GCTT-GGTGCACTTTCTGGTT-GACGGGCCAACATCAGTTTTGAC-TGTCGGAAAAAGTCCTTAGGAATGTGGCA-CCTCCG--GGTGTGTT-ATAGCCTTTGGTCGTATACGATGGTTGGGACTGAGGACCGCAGCACGCCTTA--TGGCCGGGGT--TC-GCCCACGT-ACGTGCTTAGGATGTTGGCGTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCATACCAGACCTTCTGTGACGGATATGCGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTAGTTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCA Mycoacia_nothofagi_KHL13750 AAATACAACTTTCAACAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAAT--TCTCAA-------TGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTAGT----GGCTGCCCGAGTTGTAGTCTAGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCAGAACTCAACCTGGCTTTC---GCTT-GGTGCACTTTCTGGTT-GACGGGCCAACATCAGTTTTGAC-TGTCGGAAAAAGTCCTTGGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCCTTGGTCGTATACGATGGTTGGGACTGAGGACCGCAGCACGCCTTT--TGGCCGGGGT--TC-GCCCACGT-ACGTGCTTAGGATGTTGGCGTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCATACCAGACCTTCTGTGACGGATATGCGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTAGTTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAATGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Obba rivulosa FP_135416_Sp' TTATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCCCCTTGGT-ATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCCGGAACTCAGCCTTGCTTCC---GCTT-GGTGTACTTTCCGGTC-GACGGGCCAGCATCGATTTCGAC-CGTCGGAAAAATGCGGGGGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCCTTCGTTGCATACGACGGTTGGGATCGAGGATCGCAGCACGCCTTTA-TGGTCGGGG---TTCGCCCACGT-ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCCGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAACCGAGA-CCCCTGTCATGGGGGGCACCGGTGCCCGGACCTGAAGTTCTCTGACGGCTCCGCGGTAGAGCGTGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Oxyporus corticola Dai_12632' ATATACAACTTTCAACAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGTAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGGTTC--CCCGTCCGAGTTGTAATCTGGAGAAGCGTTTTCCGTGTCGGACCGTGTACAAGTCCCTTGGAATGGGGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCGATGCTTTGTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGTCGAGACTCAGCCTTGCCTTT-GGGCCT-GGTGTATTTCTCGGTG-GACGGGTCAACATCGATTTTGAA-TGGCAGATAAAGGTCTGGGGAATGTGGCA-CCTCCG--GGTGTGTT-ATAGCCCCTCTCCGTATATGCTGTTTGGGATCGAGGACCGCAGCACGCCCTTG-TGGCCGGGGT--TTTACCCACGTACCGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTAGGGTGCA-AAACCCTTGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGAGGAGGGCACCGACGCCCGGCCCTGAACTCTTGTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGGGCCGTCTCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGCTACCCATACCTCG 'Oxyporus populinus Dai_12793' A-ATACAACTTTCAACAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGTAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTTGC--ACCGTCCGAGTTGTAATCTGGAGAAGCGTTTTCCGTGTTGGACCGTGTACAAGTCCCTTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCAATGCTTTGTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGGAGTCAGTCGCGTCTGTCGAGACTCAGCCTTGCCTTC-GGGCTT-GGTGTACTTCTCGGCCTGACGGGCCAACATCGATTTCAAA-CGGCGGATAAAGGTCTGGGGAAGGTGGCA-CCTTCG--GGTGTGTT-ATAGCCCCTCTCCGTATACGTCGTCTGGGATCGAGGACCGCAGCACGCCCTTG-TGGCTGGGGCCCTTTGCCCACATAACGTGCTTAGGATGTTGGCGTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTAGGGTGTA-AAACCCTTGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGAGGAGGGCACCGACGCCCGGCCCTGAACTCTTGTGACGGTGCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGGGCCGTCTCTTGATTGGACCGTCCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGCTACCCATACCTCG 'Panus lecomtei HHB_11042_Sp' TTATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAATTGTATTCTGGAGAAGCGTTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCATTCAGAACTCAGCCTGGCTTTT---GCTT-GGTGTATTTTCTGGTT-GACGGGCCAGCATCAATTTTGAC-CGCTGGAAAAAGGCTATGGGAATGTGGCA-CCTTTT--GGTGTGTT-ATAGCCCATGGTCATATACAGCGGTTGGGATTGAGGACCGCAGCACGCCTTTA-TGGTTGGGGT--TC-GCCCACATT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCGGACCAGACCTTTTGCGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCTCTTAATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGCTACCCATACCTCG 'Perenniporia medulla panis_Dai_10780' ATGTACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAAT--ATTCAATAGTAACTGCGAGTGAAGCGGGATAAGCTCAAATTTAAAATCTGGTGGTCTTTGGCCATCCGAATTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGATCAGAACTCAGCCTTGCTTTT---GCTT-GGTGCACTTTCTGACT-AACGGGCCAGCATCGATTTTGAC-CGTCGGAAAAGGGCCAGAGTAATGTGGCA-CCTCCG--GGTGTGTT-ATAGACTTTGGTCACATACGGCGGTTGGGATCGAGGAACGCAGCGCGCCGTAA--GGCAGGGG---TTTACCCACTT-TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGA-CCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Perenniporia medulla panis_MUCL_49581' ATGTACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAAAT-CTTCAATAGTAACTGCGAGTGAAGCGGGATAAGCTCAAATTTAAAATCTGGTGGTCTTTGGCCGCCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTTCAGAACTCAGCCTTGCTTCT---GCTT-GGTGCATTTTCTGACT-AACGGGCCAGCATCGATTCTGAC-CGCCGGAAAAGGGCCAGAGTAATGTGGCA-CCTCCG--GGTGTGTTTATAGACTTTGGTCACATACGGCGGTCGGGATCGAGGAATGCAGCGCGCCGCAA--GGCAGGGG---TTCGCCCACTT-TCGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGA-CCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Phaeophlebiopsis caribbeana HHB_6990' -TATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTATCATGGAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTAGTCTTTGGCTGCCCGAGTTGTAATCTGGAGAAGTGTTTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTC{AG}TAGAGGGTGAGAATCCCGTCTTTGACA{CT}GGACTACCAATGCTTTGTGATACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCTAGTACTCAACCTGTCTTTT---GACT-GGTGCATTTACTAGTT-AACGGGCCAGCATCAGTTTTGGC-TGCGGGATAAAGGCTAGAGAAATGTGGCA-TCTTCG--GATGTGTT-ATAGTCTCTGGTCATATACCGTGGCTGGGACTGAGGATCTCAGCACGCCTTCA-TGGCGGGGG--TTC-GCCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CTTCTGTCGTGGAAGGCACCGACGCCCGGACCAGACCTACTGTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTA-T?G---GTTGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCAC 'Phaeophlebiopsis peniophoroides FP_150577' -TATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTATCATGGAAT--TCTCAA-----------------------------------------------------GGCTGTCCGAGTTGTAATCTGGAGAAGCGTTTTCTGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTATGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGTACTCAACCTGTCTTTT---GACT-GGTGCATTTACTAGTG-AACGGGCCAGCATCAGTTTTGGT-TGCGGGATAAAGTCTAGAGAAATGTGGCA-TCTTCG--GATGTGTT-ATAGTCTCTGGTCGTATACCGTGGCTGGGACTGAGGATCTCAGCACGCCTTTA-TGGCGGGGG--TTTTACCCACCT-TCGTGCTTCGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCTCTGTCGTGGAGAGCACCGACGCCCGGATCAGACCTTCTGTGACGATTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGG-T?G---GTTAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGAGTGTGTAACAACTCAC 'Phanerochaete affinis KHL_11839' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTCGAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTTGCATTA---GCTAAGGTGCACTTCCTAGTA-GACGGGCCAGCATCACTTTTGGC-TGCGGGAAAAAGGTCAGAGGAATGTGGCA-CCTCCG--GGTGTGTT-ATAGCCTCTGGCTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCCTTTA-TGGCGGGGC--TTC-GGCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGT-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTGAGTTCATCTAGACAGCATGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCGATAGCTCG 'Phanerochaete arizonica RLG_10248_Sp' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAA----GGCTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGACAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGCTGAACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTTGCCTCG---GCTT-GGTGCACTTCCTAGTACAACGGGCCAGCATCACTTTTGGC-TGCGGGAAAAAGGTCAGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTCTGGCTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCCTC-A-CGGCGGGGC--TTC-GGCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGAACCTCGGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGG-GAATGAACTAGCCCTGAAAAT-GGATGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGAT 'Phanerochaete australis HHB_105_Sp' TTATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCATTAGTAACTGCGAGTGAACCGGGAAAAGCTCAAATTTAAAATCTGGCAGCCTT-GGCTGTCCGAGTTGTAATCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTTGCCTCG---GCTT-GGTGCATTTCCTAGTA-GACGGGCCAGCATCACTTTTGGC-TGCGGGAAAAAGGTTAGAGGAATGTGGCA-CCCTCG--GGTGTGTT-ATAGCCTCTAGCTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCCTTC--TGGCGGGGC--TTC-GGCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Phanerochaete burtii HHB_4618' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGACAGTCTTTGGCTGTTCGAGTTGTAATCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTTCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTTGCCTCG---GCTT-GGTGCATTTCCTGGTTGAACGGGCCAGCATCACTTTTGGC-TGCGGGAAAAAGGTCAGGGGAATGTGGCA-CCTCCG--GGTGTGTT-ATAGCCTCTGGCTGCATACCGTGGCTGGGAGTGAGGAACTCAGCACGCCTTCA-TGGCGGGGC--TTC-GGCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGAACTTCGGTGACGGCTCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGG-GAATGAACTAGCCCTGAAAAT-GGATGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGAT 'Phanerochaete carnosa HHB_9195_Sp' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTATATTCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGTCAGTCTTTGGCTGTCCGAGTTGTAATCTGGAGAAGCGTTTTCTGTGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTTGTCTCG---GCTT-GGTGCATTTCCTAGTG-GACGGGCCAGCATCACTTTTGGC-TGCGGGAAAAAGGTCAGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTCTGGCTGCATACCGTGGCTGGGAGTGAGGAACTCAGCATGCCTTTA-TGGCGGGGC--TTC-GGCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACTTGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGAACTTCGGTGACGGCTCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Phanerochaete chrysosporium HHB_6251_Sp' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAATCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTGGTTTCG---GCCT-GGTGCACTTCCTAGTA-AACGGGCCAGCATCACTTTTGGC-TGCGGGAAAAAGGTTAGAGGAATGTGGCA-CCCTCG--GGTGTGTT-ATAGCCTCTAGCTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCCTC---TGGCGGGGC--TTC-GGCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGATAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Phanerochaete citrinosanguinea FP_105385' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCTCTGGT-ATTCCGGAGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGACAGTCTTTGGCTGTTCGAGTTGTAATCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTTGCCTCG---GCTT-GGTGCATTTCCTAGTG-AACGGGCCAGCATCACTTTTGGC-TGCGGGAAAAAGGTCAGAGGAATGTGGCA-CCTCCG--GGTGTGTT-ATAGCCTCTGGCTGCATACCGTGGCTGGGAGTGAGGAACTCAGCATGCCATTA-TGGCGGGGC--TTC-GGCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGAACCTCGGTGACGGCTCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGG-GAATGAACTAGCCCTGAAAAT-GGATGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGAT 'Phanerochaete ericina HHB_2288' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGTGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTTGCCTCG---GCTAAGGTGCATTTCCTAGTA-GACGGGCCAGCATCACTTTTGGC-TGCGGGAAAAAGGTCAGAGGAATGTGGCA-CCTCCG--GGTGTGTT-ATAGCCTCTGGCTGTATACCGTGGCTGGGAGTGAGGATCTCAGCACGCCTTCA-TGGCGGGGC--TTC-GGCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Phanerochaete laevis HHB_15519_Sp' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTTGCATTA---GCTAAGGTGCACTTCCTAGTA-GACGGGCCAGCATCACTTTTGGC-TGCGGGAAAAAGGTCAGAGGAATGTGGCA-CCTCCG--GGTGTGTT-ATAGCCTCTGGCTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCCTTTA-TGGCGGGGC--TTC-GGCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGT-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Phanerochaete magnoliae HHB_9829_Sp' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCATTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAG-CTTTGGCTGTCCGAGTTGTAATCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTTGCCTCG---GCTT-GGTGCACTTCCTAGTA-GACGGGCCAGCATCACTTTTGGC-TGCGGGAGAAAGATCAGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTCTGGTTGTATGCCGTGGCTGGGAGTGAGGATCTCAGCACGCCTT-A-TGGCGGGGC--TTC-GGCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCTCTGTCGTGGAGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Phanerochaete sordida KHL_12054' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTAC--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAATCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTTGCCTCG---GCTT-GGTGCACTTCCTAGTA-AACGGGCCAGCATCATTTTTGGC-TGCGGGAAAAAGGTCAGAGGAATGTGGCA-CCTTCG--GGTGTGTC-ATAGCCTCTGGCTGCATACCGTGGCTGGGAGTGAGGAACTCAGCACGCCTT-A-CGGCGGGGC--TTC-GGCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCGGTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCGATACCTCG 'Phanerochaete subceracea FP_105974_R' ATGTACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAAAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTAT--T{CT}TCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGATAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCACAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTTGCCTTG---GCTAAGGTGCATTTCCTAGTA-GACGGGCCAGCATCACTTTTGGC-TGCGGGAAAAAGGTCAGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTCTGGTTGTATACCGTGGCTGGGAGTGAGGATCTCAGCACGCCTTCA-TGGCGGGGC--TTC-GGCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGG-GAATGAACTAGCCCTGAAAAT-GGATGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGAT 'Phellinus ferrugineovelutinus Cui_10042' A-ATACAACTTTCAACAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGTTAA--TATCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGCTTT--GCTGTCCGAGTTGTAATCTGGAGAAGCGTTTTCCGCGTCGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCGATGCTTTGTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTGCAGGACTCAGCCTTGCTTCT---GCTT-GGTGTACTTCCTGTAG-GACGGGTCAACATCGATTTTGGT-CGACGGACAAAGGGGATGGGAATGTGGCAGTCTTCG-GGCTGTGTT-ATAGCCCTCTTCCGCATACGTCGACTGGGATCGAGGACCGCAGCGCGCCTTTAATGGCCGGGAGT-TCGCTCCACGTATCGCGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTGTTAGGGTGGA-AAACCCTTGCGCGTAATGAAAGTGAAAGTTGAGAACCTCCGCAAGGGGGTGCACCGACGCCCGGCCCTGAAGTTTACTGACGGTGCTGCGGTAGAGCACGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCTCTTAGTTGGACCGCTCGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTTGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGCTACCCATACCTCG 'Phlebia acerina FD_301' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTAT--CATCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTCGATCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTCGTCTAGAACTCAACCTGGCCTCG---GCTC-GGTGCATTTTCTAGTT-GACGGGCCAGCATCAGTTTTGAC-CGTTGGAAAAAGGTCCTTGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTTGGGTCGTATACGACGGTTGGGACTGAGGACCGCAGCACGCCTTTA-TGGCCGGGGC--TC-GCCCACGT-ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGT-AAACCCGAGCGCGTAACGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCACACCAGACCTTCTGTGACGGATGTGCGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTAATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Phlebia radiata AFTOL_ID_484' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTAT--CATCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTCGATCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTCGTCTAGAACTCAACCTTGCCTCG---GCTC-GGTGCATTTTCTAGTT-GACGGGCCAGCATCAGTTTTGAC-CGTTGGAAAAAGGTCCTTGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTCGGGTCGTATACGACGGTTGGGACTGAGGACCGCAGCACGCCTTTA-TGGCCGGGGT--TC-GCCCACGT-ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGT-AAACCCGAGCGCGTAACGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCACACCAGACCTTCTGTGACGGATGTGCGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTAATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Phlebia setulosa HHB_6891_Sp' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAAAT--CATCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTCGTCCAGAACTCAACCTGGCTTTT---GCTT-GGTGCACTTTCTGGTT-GACGGGCCAGCATCAGTTTCGGT-CGTCGGAGAAAGGCCTTTGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTTGGGTCATATACGACGGTTGGGACTGAGGACCGCAGCACGCCTTT--TGGCCGGGGT--TC-GCCCACGT-ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAACGAAAGTGAAAGTTGGGA-TCTCTGTCGCGGAGAGCACCGACGCCCACACCAGACCTTCTGTGACGGATGTGCGGTCGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCGGTTTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGTGAACGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Phlebia unica KHL_11786' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGTGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCTAGTACTCAGCCTGCCTTTT---GGTT-GGTGCATTTATTAGTA-TACGGGCCAGCATCAGTTTTGGC-TGCGGGATAAAGGTCAGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTCTGGTCATATACCGTGGCTGGGACTGAGGATCTCAGCACGCCTTTA-TGGCGGGGG--TTC-GCCCACCTTTCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGAAATGAAAGTGATAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTACTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGATCTAGCCCTGAAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Phlebiopsis flavidoalba FD_263' -TATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGAAT--TCTCAA----AACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGATTGTCCGAGTTGTAATCTGGAGAAGCGTCTTCTGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGAAACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCTAGTACTCAGCCTTCCTTCT---GGTT-GGTGCATTTACTAGTT-GACGGGCCAGCATCAGTTTTGGT-CGCGGGATAAAGGTCAGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTCTGGTCATATACCGTGGCTGGGACTGAGGATCTCAGCACGCCTTCA-TGGCGGGGG--TTC-GCCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTAATAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Phlebiopsis gigantea FP_70857_Sp' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGAAT--TCTCAA----AACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTAGC----GGTTGCCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTCTTCTAGTACTCAGCCTTCCTTTT---GGTT-GGTGCATTTACTAGTC-GACGGGCCAGCATCAGTTTTGGC-TGCGGGATAAAGATCAGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTTTGGTCATATACCGTGGCTGGGACTGAGGATCTCAGCACGCCTTTA-TGGCGGGGG--TTC-GCCCACCT-TCGTGCTTCGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGATAGTTGGGA-TCTCTGTCGTGGAGAGCACCGACGCCCGGACCAGACCTTTTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Pirex concentricus OSC_41587' ATATACAACTTTCAACAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCCTGGT-ATTCCGGGGAGCACGCCCGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGATTGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGCTGGACCGTGCACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGGCACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCTAGAACTCAGCCTTGCCTCG---GCTC-GGTGCATTTTCTAGTA-GACGGGCCAGCATCACTTTTGGC-TGCGGGATAAAGATCTCAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTGGGGTTGTATACCGTGGCTGGGAGTGAGGATCTCAGCACGCCTTTA-TTGGCGGGGGTTTGCGCCCACCT-TCGTGCTTCGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCTCTGTCGTGGAGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTGATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Rhizochaete brunnea MR_229b' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCTCTGGT-ATTCCGGAGAGCATGCCTGTTTGAGTGTCATGCAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTACTAGTACTCAGCCTGTCTTTTTTTGGGTGGGTGCATTTACTAGTA-AACGGGCCAGCATCAGTTTTGGC-CGCGGGATAAACGTTGAAGGAATGTGGCA-CCCTTG--GGTGTGTT-ATAGCCTTTGATCATATACCGTGGCTGGGACTGAGGATCTCAGCACGCCTTTA-TGGCGGGGG--TTC-GCCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTAATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCCATGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Rhizochaete fouquieriae KKN_121b' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCTCTGGT-ATTCCGGAGAGCATGCCTGTTTGAGTGTCATGAAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGCTAGTACTCAGCCTGTCTTTT----GATGGGTGCATTTACTAGTA-AACGGGCCAGCATCAGTTTTGGC-TGCGGGATAAAGGTCAGAGGAATGTGACA-CCTTCG--GGTGTGTT-ATAGCCTTCGATTATATACCGCGGCTGGGACTGAGGATCTCAGCACGCCTTTA-TGGCGGGGG--TTC-GCCCACCT-TCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTAATAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTACTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAACCCGTCACTTAATTGGACCGGTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Scopuloides rimosa HHB_15484' AAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAATCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTGTTCAGAACTCAACCTGGTTTT----ACTT-GGTGCACTTTCTGAAT-GACGGGCCAACATCAGTTTTGAC-TGTCGGATAAAAGCCTTTGGAATGTGGCA-CCTCCG--GGTGTGTT-ATAGCCTTTGGTTGTATACGATGGTTGGGATTGAGGACCGCAGCACGCCTTT--TGGCCGGGGT--TC-GCCCACGT-ACGTGCTTAGGATGTTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCATACCAGACCTTCTGTGACGGATATGTGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCTGTCACTTAATTGGACTGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCA 'Skeletocutis chrysella FD_305' AAATATAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCATCTTGCGCCCTTTGGT-ATTCCGAAGGGCATGCCCGTTTGAGTGTCATTGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT-GGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCGGAACTCAGCCTTGCTTTG---GCTT-GGTGTACTTTCTGGTT-AACGGGTCAGCATCGATTTTGAT-CGGTGGATAAAGGTTTGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTCAGATTGTATACATCGGTTGGGATCGAGGAACTCAGC----------------------TTCG------------GCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGGT-AAACCCAGGCGCGTAATGAAAGTGAAAGTCGAGA-CCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACCTTCTGTGACGGCTCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTATTACCCATACCTCA 'Spongipellis delectans HHB_10489_Sp' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCCCTTTGGT-ATTCCGAAGGGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAG-----GGCTGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTCGTGCAGAACTCAGCCTGGCTTTT---GCTT-GGTGTATTTTCTGCAT-GACGGGCCAGCATCAGTTTTGGC-CGCTGGAAAAGGGTTTCAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTGGGGTCGTATACAGCGGCTGGGACTGAGGATCGCAGTGCGCCTTTA-TGGCTGGGGT--TC-GCCCACATT-CGCACTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACACACCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTGTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCCGTCTCTTAATTGGACCGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Spongipellis pachyodon FD_314' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAATGCACCTTGCGCCTCCCGGT-ATTCCGGGAGGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGCGCCGGACCGTGTATAAGTCCCCTGGAATGGGGCGTCGTAGAGGGTGACAATCCCGTCTTTGACACGGACTCCCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTGCAGAACTCAGCCTGGCCTTG---GCCT-GGTGTATTTTCTGCAC-GACGGGCCAGCATCGATTTCGGT-CGCTGGAAAAGGGCCTCGGGAATGTGGCA-CCCTCG--GGTGTGTT-ATAGCCCGGGGTCGTATACAGTGGCTGGGATCGAGGAATGCAGCACGCCTTTA-TGGCTGGGGT--TC-GCCCACATT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGT-AAACCCGAGCGCGCAATGAAAGTGAAAGTCGGGA-TCCTCGCCA-GGGGAGCACCGACGCCCGGCCCAGACCTTTTGCGACGGTGCTGCGGTGGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCCGTCTCTTAATTGGACCGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGCTACCCATACCTCG 'Steccherinum ochraceum KHL_11902' TAATACAACTTTCAACAACGGATCTCTTGGCTCTACGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCTTGTTTGAGTGTCATGGTCT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGC-TTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCTGTGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGCGTCTTCTAGAACTCAGCCTGGCTTTT---GCTT-GGTGCATTTTCTAGTT-GACGGGCCAGCATCAGTTTCGAC-CGCTGGATAAAGGCTTTGGGAATGTGGCA-CCCTCG--GGTGTGTT-ATAGCCCAGAGTCACATACAGCGGTTGGGACTGAGGATCACAGCATGCCTTT--TGGCCGGGGT--TC-GCCCACGTT-CATGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGT-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGA-TCCCTGTCGCGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCGATACCTCG 'Terana caerulea FP_104073' TTATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCACGCCTGTTTGAGTGTCATGGAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTCGATTGTCCGAGTTGTAATCTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTTGGCTAGAACTCAGCCTTACCTCG---GTAT-GGTGTATTTTCTAGTG-AACGGGCCAGCATCACTTTTGGC-TGCCGGATAAAGGCCAGGGAAATGTGGCA-CCTTCG--GGTGTGTT-ATAGTCTCTGGTTGTATACGGTGGCTGGGAGTGAGGATCGCAGCACGCCTTTA-TGGCGGGGG--TTC-GCCCACCA-ACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGATAGTTGGGA-CCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG Trametes_hirsuta_RLG5133T TAATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATGCGCTCTCAAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGAGGTGAATTCCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCTTCG---GCTT-GGTGCACTTTCCGGTT-GACGGGCCAGCATCGATTTTGAC-CGCTGGAAAAGGGCTGGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTTCAGTCGCATACAGCGGTTGGGATCGAGGAACGCAGCACGCCTTAT--GGCTGGGG---TTCGCCCACAT-TCGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGA-CCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAAGTTTTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Trametes ochracea HHB_13445' TAATACAACTTTTAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATGCGCTCTCAAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGAGGTGAATTCCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCTTTGCTTCG---GCTT-AGTGCACTTTCCGGTT-GACGGGCCAGCATCGATTTTGAC-CGCTGGAAAAGGGCTGGAGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCTTCAGTCGCATACAGCGGTTGGGATCGAGGAACGCAGCGCGCCTTAT--GGCTGGGG---TTCGCCCACAT-TCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGA-CCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTTTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG 'Trametopsis cervina AJ_185' ATATACAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAG-CTTTTGTTGCCCGAGTTGTAGTCTAGAGAAGCGTCTTCCGCGTTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTAACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTAGCTAGAACTCAACCAGGC--TT---GCTT-GGTGCATTTTCTAGTTTAACGGGCCAGCATCAGTTTTGGC-TGCAGGATAAAGGTCAGAGAAATGTGGCA-GCTTCG--GCTGTGTT-ATAGTCTCTGGCTGCATACTGTGTCCGGGACTGAGGATCTCAGCACGCATTTG-TTGTT-----------------------GCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTATTTGGGTGATTAAACCCGAGTGCGTAATGAAAGTGAAAGTTGGGA-TCCCTGTCGTGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACAAGCCGTCACTTTGTTGGACCGCTTGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCA 'Tyromyces chioneus FD_4' CAATATAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCATCTTGCGCCCTTTGGT-ATTCCGAAGGGCATGCCCGTTTGAGTGTCATTGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGG-----GGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCCGGACCGTGTACAAGTCTCCTGGAA{CT}GGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCCTCG---GCTT-GGTGCACTTTCCGGTT-GACGGGCCAGCATCGATTTTGAT-CGGCGGATAAAGGTTCGAGGAATGTGGCA-CCCTCG--GGTGTGTT-ATAGCCTCGGATTGTATACGTCGGTTGGGATCGAGGAACTCAGC----------------------TTCG------------GCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGGT-AAACCCAGGCGCGTAATGAAAGTGAAAGTCGAGA-CCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACCTTCTGTGACGGCTCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCCTCACTTGATTGGAGCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGGGGTTAAGGTGCCGGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTATTACCCATACCCCA 'Xanthoporus higanensis AFTOL_ID_774' AAATATAACTTTCAGCAACGGATCTCTTGGCTCT-CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT-GAACGCACCTTGCGCTCCTTGGT-ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTAT--TCTCAATAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGC-TTTGGCTGTCCGAGTTGTAGTCTGGAGAAGCGTTTTCTGTGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACCGCCAGTGCTGTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACACTTGAAGTCAGTCGCGTTGGCCGGAACTCAGCCTGGCTTTT---GCCT-GGTGTATTTTCTGGTT-GACGGGCCAGCATCAATTTTGAC-CGTTGGACAAAGGCCGGGGGAATGTGGCA-CCTTCG--GGTGTGTT-ATAGCCCTTGGTCACATGCAATGGTTGGGATTGAGGATCTCAGCATGCCTTTA-TGGTCGGGGT--TC-GCCCACGTT-CATGCTTAGGATGCTGGCGTAATGGCTTTAAATGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGGGA-TCCCTGTCGCGGGGAGCACCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-GTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCC-GAATGAACTAGCCCTGAAAAT-GGATGGCGCTCAAGCGTGTTACCCATACCTCG ; END; BEGIN TREES; TITLE Geliporus_exilisporus_MP; LINK TAXA = Taxa1; TRANSLATE 1 'Heterobasidion annosum Korhonen_06129_6', 2 'Bondarzewia submesenterica Cui_10724', 3 Geliporus_exilisporus_Dai2172, 4 Inonotopsis_subiculosa_Dai14799, 5 Geliporus_exilisporus_Dai7528, 6 'Geliporus exilisporus Dai_15244', 7 'Geliporus exilisporus Dai_15248', 8 'Oxyporus corticola Dai_12632', 9 'Oxyporus populinus Dai_12793', 10 'Phellinus ferrugineovelutinus Cui_10042', 11 'Amyloporia xantha AFTOL_ID_1504', 12 'Fomitopsis pinicola AFTOL_ID_770', 13 'Antrodia albida CBS_308_82', 14 'Tyromyces chioneus FD_4', 15 'Skeletocutis chrysella FD_305', 16 'Obba rivulosa FP_135416_Sp', 17 'Gelatoporia subvermispora FD_354', 18 'Perenniporia medulla panis_Dai_10780', 19 'Perenniporia medulla panis_MUCL_49581', 20 'Megasporoporia hexagonoide Dai_12079', 21 'Megasporoporia major Cui_10253', 22 'Ceriporia crassitunicata Dai_10833', 23 'Ceriporia variegata Li_1780', 24 Trametes_hirsuta_RLG5133T, 25 'Trametes ochracea HHB_13445', 26 'Pirex concentricus OSC_41587', 27 'Junghuhnia fimbriatella Miettinen_2091', 28 'Junghuhnia pseudozilingiana Matti_Kulju_1004', 29 'Irpex oreophilus Niemela_7691', 30 'Steccherinum ochraceum KHL_11902', 31 'Antrodiella pallescens Miettinen_12611', 32 'Climacocystis borealis FD_31', 33 'Diplomitoporus crustulinus FD_137', 34 'Xanthoporus higanensis AFTOL_ID_774', 35 'Cerrena unicolor FD_299', 36 'Hyphoderma medioburiense FD_335', 37 'Hyphoderma setigerum FD_312', 38 'Hyphoderma mutatum HHB_15479_Sp', 39 'Hyphoderma litschaueri FP_101740_Sp', 40 'Panus lecomtei HHB_11042_Sp', 41 'Spongipellis delectans HHB_10489_Sp', 42 'Spongipellis pachyodon FD_314', 43 'Scopuloides rimosa HHB_15484', 44 'Phlebia radiata AFTOL_ID_484', 45 'Phlebia acerina FD_301', 46 'Phlebia setulosa HHB_6891_Sp', 47 'Crustodontia chrysocreas HHB_6333_Sp', 48 'Hydnophlebia omnivora KKN_112', 49 'Climacodon septentrionalis AFTOL_ID_767', 50 'Mycoacia fuscoatra KH_13275', 51 Mycoacia_nothofagi_KHL13750, 52 'Ceriporiopsis aneirina HHB_15629_Sp', 53 'Ceraceomyces serpens HHB_15692_Sp', 54 'Trametopsis cervina AJ_185', 55 'Efibula americana FP_102165', 56 'Byssomerulius corium FP_102382', 57 'Ceriporia lacerata Dai_10734', 58 Flavodon_flavus_LE295997, 59 'Bjerkandera adusta HHB_12826_Sp', 60 'Terana caerulea FP_104073', 61 'Phlebiopsis gigantea FP_70857_Sp', 62 'Phlebiopsis flavidoalba FD_263', 63 'Rhizochaete fouquieriae KKN_121b', 64 'Rhizochaete brunnea MR_229b', 65 Hyphodermella_corrugata_MA, 66 'Hyphodermella rosae MA_Fungi_22929', 67 'Hyphodermella rosae MA_Fungi_24292', 68 'Hyphodermella corrugata MA_Fungi_5527', 69 'Phaeophlebiopsis caribbeana HHB_6990', 70 'Phaeophlebiopsis peniophoroides FP_150577', 71 'Phanerochaete ericina HHB_2288', 72 'Phanerochaete laevis HHB_15519_Sp', 73 'Phanerochaete subceracea FP_105974_R', 74 'Phanerochaete australis HHB_105_Sp', 75 'Phanerochaete arizonica RLG_10248_Sp', 76 'Phanerochaete chrysosporium HHB_6251_Sp', 77 'Phanerochaete citrinosanguinea FP_105385', 78 'Phanerochaete carnosa HHB_9195_Sp', 79 'Phanerochaete burtii HHB_4618', 80 'Phanerochaete magnoliae HHB_9829_Sp', 81 'Phanerochaete sordida KHL_12054', 82 'Phanerochaete affinis KHL_11839', 83 'Phlebia unica KHL_11786', 84 'Meruliopsis taxicola Kuljok_00_75', 85 'Hyphodermella rosae FP_150552'; TREE 'PAUP_2' = [&R] ((2:400.0,65:414.0):402.5,((67:44.0,68:33.0):46.0,((69:52.0,70:49.0):27.0,((73:7.0,(75:6.0,(77:5.0,79:6.0):10.0):10.0):32.0,((((26:16.0,(66:2.0,85:0.0):13.0):4.0,(6:0.0,7:0.0,(3:0.0,5:1.0):2.0):7.0):11.0,((71:4.0,(72:0.0,82:4.0):5.0):2.0,((78:16.0,81:7.0):3.0,(80:7.0,(74:4.0,76:8.0):4.0):3.0):2.0):7.0):5.0,(((61:9.0,62:14.0):5.0,(83:7.0,(63:5.0,64:16.0):9.0):3.0):15.0,(60:19.0,(59:21.0,(((84:10.0,(22:9.0,23:5.0):29.0):8.0,(56:12.0,((53:27.0,55:16.0):8.0,((52:13.0,54:8.0):18.0,(57:8.0,58:9.0):17.0):6.0):11.0):15.0):13.0,(((13:12.0,(11:18.0,12:19.0):3.0):10.0,(((24:3.0,25:6.0):21.0,((18:6.0,19:10.0):13.0,(20:5.0,21:3.0):9.0):11.0):14.0,(((14:14.0,15:11.0):28.0,(16:15.0,17:8.0):15.0):12.0,(1:45.0,((4:18.0,10:18.0):33.0,(8:16.0,9:20.0):22.0):43.0):23.0):3.0):10.0):13.0,(((46:21.0,(44:2.0,45:2.0):14.0):10.0,(49:25.0,(48:22.0,(43:16.0,(47:23.0,(50:2.0,51:6.0):10.0):7.0):5.0):7.0):7.0):10.0,((40:13.0,(35:11.0,(41:21.0,42:39.0):8.0):19.0):11.0,((36:23.0,(38:16.0,(37:24.0,39:15.0):9.0):11.0):9.0,((32:21.0,33:16.0):5.0,(29:15.0,(34:14.0,(31:4.0,(30:18.0,(27:6.0,28:1.0):9.0):11.0):8.0):5.0):7.0):6.0):6.0):11.0):11.0):10.0):10.0):14.0):13.0):5.0):43.0):45.0):64.0):402.5):0.0; TREE 'PAUP_1' = [&R] ((2:400.0,65:414.0):402.5,((67:44.0,68:33.0):46.0,((69:52.0,70:49.0):27.0,((73:7.0,(75:6.0,(77:5.0,79:6.0):10.0):10.0):32.0,((((26:16.0,(66:2.0,85:0.0):13.0):4.0,(6:0.0,7:0.0,(3:0.0,5:1.0):2.0):7.0):11.0,((71:4.0,(72:0.0,82:4.0):5.0):2.0,((78:16.0,81:7.0):3.0,(80:7.0,(74:4.0,76:8.0):4.0):3.0):2.0):7.0):5.0,(((61:9.0,62:14.0):5.0,(83:7.0,(63:5.0,64:16.0):9.0):3.0):15.0,(60:19.0,(59:21.0,(((84:10.0,(22:9.0,23:5.0):29.0):8.0,(56:12.0,((53:27.0,55:16.0):8.0,((52:13.0,54:8.0):18.0,(57:8.0,58:9.0):17.0):6.0):11.0):15.0):12.0,(((12:15.0,(11:14.0,13:14.0):9.0):9.0,(((24:3.0,25:6.0):22.0,((18:6.0,19:10.0):13.0,(20:5.0,21:3.0):9.0):10.0):13.0,(((14:14.0,15:11.0):26.0,(16:14.0,17:9.0):17.0):13.0,(1:48.0,((4:17.0,10:19.0):34.0,(8:16.0,9:20.0):21.0):41.0):23.0):5.0):10.0):11.0,(((46:21.0,(44:2.0,45:2.0):14.0):10.0,(49:25.0,(48:22.0,(43:16.0,(47:23.0,(50:2.0,51:6.0):10.0):7.0):5.0):7.0):7.0):10.0,((40:13.0,(35:11.0,(41:21.0,42:39.0):8.0):19.0):11.0,((36:23.0,(38:16.0,(37:24.0,39:15.0):9.0):11.0):9.0,((32:21.0,33:16.0):5.0,(29:15.0,(34:14.0,(31:4.0,(30:18.0,(27:6.0,28:1.0):9.0):11.0):8.0):5.0):7.0):6.0):6.0):11.0):11.0):10.0):11.0):14.0):13.0):5.0):43.0):45.0):64.0):402.5):0.0; END;