#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 12:55 GMT TreeBASE (cc) 1994-2008 Study reference: Kabaktepe S., Akata I., Siahaan S., Takamatsu S., & Braun U. 2017. Powdery mildew (Ascomycota, Erysiphales) on Fontanesia phillyreoides and Jasminum fruticans in Turkey. Mycoscience, 58(1): 30-34. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S19439] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=30; TAXLABELS Erysiphe_aquilegiae_ex_Aquilegia_AY452800 Erysiphe_aquilegiae_ex_Aquilegia_EU047570 Erysiphe_aquilegiae_ex_Casuarina_JN003594 Erysiphe_aquilegiae_ex_Catharanthus_DQ335569 Erysiphe_aquilegiae_ex_Cimicifuga_AB000944 Erysiphe_aquilegiae_ex_Clematis_AB015929 Erysiphe_catalpae_ex_Catalpa_DQ359695 Erysiphe_cf._aquilegiae_ex_Jasminum_fruticans_HAL3134F_C Erysiphe_cf._aquilegiae_ex_Jasminum_fruticans_HAL3134F_M Erysiphe_circaeae_ex_Circaea_AB104517 Erysiphe_macleayae_ex_Macleaya__JQ681217 Erysiphe_macleayae_ex_Macleaya_AB016048 Erysiphe_sedi_ex_Kalanchoe_JX173288 Erysiphe_sedi_ex_Sedum_JX173290 Erysiphe_sp._ex_Delphinium_AY452802 Erysiphe_takamatsui_ex_Nelumbo_AB916688 Erysiphe_takamatsui_ex_Nelumbo_AB916689 Pseudoidium_hortensiae_ex_Hydrangea_JQ669944 Pseudoidium_neolycopersici_AB032484 Pseudoidium_neolycopersici_AB094991 Pseudoidium_neolycopersici_AB163913 Pseudoidium_neolycopersici_AB163927 Pseudoidium_neolycopersici_AF229019 Pseudoidium_neolycopersici_JQ972700 Pseudoidium_sp._ex_Chelidonium_HQ286645 Pseudoidium_sp._ex_Chelidonium_HQ286646 Pseudoidium_sp._ex_Dudleya_EU185639 Pseudoidium_sp._ex_Echeveria_EU185637 Pseudoidium_sp._ex_Sedum_EU185641 Pseudoidium_sp._ex_Solanum_AB473221 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=18; TAXLABELS Phyllactinia_fraxini_Fraxinus_excelsior_MUMH913 Phyllactinia_fraxini_Fraxinus_excelsior_MUMH914 Phyllactinia_fraxini_ex_Chionanthus_MUMH926 Phyllactinia_fraxini_ex_Fontanesia_phillyreoides_HAL3135F_C Phyllactinia_fraxini_ex_Fontanesia_phillyreoides_HAL3135F_M Phyllactinia_fraxini_ex_Fontanesia_phillyreoides_HAL3136F_C Phyllactinia_fraxini_ex_Fontanesia_phillyreoides_HAL3136F_M Phyllactinia_fraxini_ex_Fraxinus_MUMH911 Phyllactinia_fraxini_ex_Fraxinus_MUMH912 Phyllactinia_fraxini_ex_Fraxinus_MUMH915 Phyllactinia_fraxini_ex_Fraxinus_MUMH917 Phyllactinia_fraxini_ex_Syringa_MUMH907 Phyllactinia_fraxini_ex_Wisteria_MUMH908 Phyllactinia_fraxinicola_ex_Acer_SMK17216 Phyllactinia_fraxinicola_ex_Fraxinus_MUMH212 Phyllactinia_fraxinicola_ex_Fraxinus_MUMH426 Phyllactinia_fraxinicola_ex_Fraxinus_MUMH566 Phyllactinia_fraxinicola_ex_Fraxinus_SMK10643 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M36922] TITLE 'Powdery mildew (Ascomycota, Erysiphales) on Fontanesia phillyreoides and Jasminum fruticans Fig. 1'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1164; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Phyllactinia_fraxini_Fraxinus_excelsior_MUMH913 CAGAGCGTGAAGACTTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAA-CCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxini_Fraxinus_excelsior_MUMH914 CAGAGCGTGAAGACTTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAA-CCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxini_ex_Chionanthus_MUMH926 CAGAGCGTGAAGACCTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAA-CCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCACAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxini_ex_Fontanesia_phillyreoides_HAL3135F_C CAGAGCGTGAAGACCTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTTGAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxini_ex_Fontanesia_phillyreoides_HAL3135F_M CAGAGCGTGAAGACCTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTTGAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTG?GACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxini_ex_Fontanesia_phillyreoides_HAL3136F_C CAGAGCGTGAAGACCTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTTGAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxini_ex_Fontanesia_phillyreoides_HAL3136F_M CAGAGCGTGAAGACCTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTTGAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAACCCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxini_ex_Fraxinus_MUMH911 CAGAGCGTGAAGAC?TCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAA-CCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxini_ex_Fraxinus_MUMH912 CAGAGCGTGAAGACCTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGG{AT}ATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAA-CCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxini_ex_Fraxinus_MUMH915 CAGAGCGTGAAGACCTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAA-CCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxini_ex_Fraxinus_MUMH917 CAGAGCGTGAAGACCTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAA-CCCGACGCCGGCAAGGCGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxini_ex_Syringa_MUMH907 CAGAGCGTGAAGACCTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAA-CCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxini_ex_Wisteria_MUMH908 ??????????????????????????????????????????????????????????????????ACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCTGGCCCCCTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACCGTGGCGGTGCTGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACTGGACCCAGCCAAAA-CCCGACGCCGGCAAGGTGTCAACCCCCC-TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxinicola_ex_Acer_SMK17216 ???????????????????????????????????????????????????????????????TCGACCCTCCCACCCGTGTCGATTTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCCGGCCCCGTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTATCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACAGTGGCGGTGCCGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGTACCAGACCCAGCCAAAA-CCTGACGCCGACAAGGTGTCAACCCCCCTCTTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTGGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxinicola_ex_Fraxinus_MUMH212 CAGAGCGTGAAGACCTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCCCTTGGCACTCCGCCGGCCCCTTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCGGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAATACAGTGGCGGTGCCGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACCAGACCCAGCCAAAA-CCCGACGCCGGCAAGGTGTCAACCCCCC-CTTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGCAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxinicola_ex_Fraxinus_MUMH426 CAGAGCGTGAAGACCTCGGCCCCTCCCGCGGCGCAAGTCGAGGTGGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGATTTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCCGGCCCCGTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTAGCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCGCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACAGTGGCGGTGCCGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACCAGACCCAGCCAAAA-CCCGACGCCGGCAAGGTGTCAACCCCC--TCTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTGAGGGGG Phyllactinia_fraxinicola_ex_Fraxinus_MUMH566 CAGAGCGTGAAGACCTCGGCCCCT-CCGCGGCGCAAGTCGAGGTTGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCGCCCTTGGCACTCCGCCGGCCCCTTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTGTCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTT-AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCGGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAATACAGTGGCGGTGCCGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGCACCAGACCCAGCCAAAA-CCCGACGCCGGCAAGGTGTCAACCCCCC--TTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGCAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG Phyllactinia_fraxinicola_ex_Fraxinus_SMK10643 CAGAGCGTGAAGACCTCGGCCCCTCCCGCGGCGCAAGTCGAGGTGGAGGGGAACATGCCGGGGTCGACCCTCCCACCCGTGTCGATTTTATTCTCCTGTTGCTTTGGCAGGCCGGGGCG-CCTTGGCGCTCCGCCGGCCCCGTGGGCTGGAGCGTGCCTGCCAGAGAAAATGTTATCAACTCGTGTGATTGGTGAAGTCTGAGGAATCATGTGGGAAATTAGTTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAGGCCGCTCAGGCTTGGTCTTGGGGCTCGCCCGCCTTGGCGCGGCGGCCCTTAAACACAGTGGCGGTGCCGGTGGTGCTCTCCGCGTAGTCACGTTCTCGCGACAGGGCGGTACCAGACCCAGCCAAAA-CCTGACGCCGACAAGGTGTCAACCCCCCTCTTCTAGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTGGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCGAGGGGG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M36924] TITLE 'Powdery mildew (Ascomycota, Erysiphales) on Fontanesia phillyreoides and Jasminum fruticans Fig. 2'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=553; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_aquilegiae_ex_Aquilegia_AY452800 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_ex_Aquilegia_EU047570 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_ex_Casuarina_JN003594 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCCGGGCTACGTCGTCGCTGCCCGTAC-GACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACC-AACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_ex_Catharanthus_DQ335569 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_ex_Cimicifuga_AB000944 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGGTTTATTATAGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_ex_Clematis_AB015929 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_catalpae_ex_Catalpa_DQ359695 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_cf._aquilegiae_ex_Jasminum_fruticans_HAL3134F_C CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_cf._aquilegiae_ex_Jasminum_fruticans_HAL3134F_M CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_circaeae_ex_Circaea_AB104517 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCTGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTACTGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_macleayae_ex_Macleaya__JQ681217 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGAACCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_macleayae_ex_Macleaya_AB016048 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACGCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_sedi_ex_Kalanchoe_JX173288 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_sedi_ex_Sedum_JX173290 ???AGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_sp._ex_Delphinium_AY452802 CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGACCATTAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCCAAAGACCTATACAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCACGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_takamatsui_ex_Nelumbo_AB916688 ?????CGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_takamatsui_ex_Nelumbo_AB916689 ????GCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACGCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_hortensiae_ex_Hydrangea_JQ669944 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_neolycopersici_AB032484 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_neolycopersici_AB094991 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_neolycopersici_AB163913 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_neolycopersici_AB163927 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_neolycopersici_AF229019 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_neolycopersici_JQ972700 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_sp._ex_Chelidonium_HQ286645 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_sp._ex_Chelidonium_HQ286646 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_sp._ex_Dudleya_EU185639 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_sp._ex_Echeveria_EU185637 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_sp._ex_Sedum_EU185641 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Pseudoidium_sp._ex_Solanum_AB473221 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG ; END; BEGIN TREES; TITLE 'Powdery mildew (Ascomycota, Erysiphales) on Fontanesia phillyreoides and Jasminum fruticans Fig 2'; LINK TAXA = Taxa1; TRANSLATE 1 Erysiphe_aquilegiae_ex_Aquilegia_AY452800, 2 Erysiphe_aquilegiae_ex_Aquilegia_EU047570, 3 Erysiphe_aquilegiae_ex_Casuarina_JN003594, 4 Erysiphe_aquilegiae_ex_Catharanthus_DQ335569, 5 Erysiphe_aquilegiae_ex_Cimicifuga_AB000944, 6 Erysiphe_aquilegiae_ex_Clematis_AB015929, 7 Erysiphe_catalpae_ex_Catalpa_DQ359695, 8 Erysiphe_circaeae_ex_Circaea_AB104517, 9 Erysiphe_macleayae_ex_Macleaya__JQ681217, 10 Erysiphe_macleayae_ex_Macleaya_AB016048, 11 Erysiphe_sedi_ex_Kalanchoe_JX173288, 12 Erysiphe_sedi_ex_Sedum_JX173290, 13 Erysiphe_sp._ex_Delphinium_AY452802, 14 Erysiphe_takamatsui_ex_Nelumbo_AB916688, 15 Erysiphe_takamatsui_ex_Nelumbo_AB916689, 16 Erysiphe_cf._aquilegiae_ex_Jasminum_fruticans_HAL3134F_C, 17 Erysiphe_cf._aquilegiae_ex_Jasminum_fruticans_HAL3134F_M, 18 Pseudoidium_hortensiae_ex_Hydrangea_JQ669944, 19 Pseudoidium_neolycopersici_AB032484, 20 Pseudoidium_neolycopersici_AB094991, 21 Pseudoidium_neolycopersici_AB163913, 22 Pseudoidium_neolycopersici_AB163927, 23 Pseudoidium_neolycopersici_JQ972700, 24 Pseudoidium_sp._ex_Chelidonium_HQ286645, 25 Pseudoidium_sp._ex_Chelidonium_HQ286646, 26 Pseudoidium_sp._ex_Dudleya_EU185639, 27 Pseudoidium_sp._ex_Echeveria_EU185637, 28 Pseudoidium_sp._ex_Sedum_EU185641, 29 Pseudoidium_sp._ex_Solanum_AB473221, 30 Pseudoidium_neolycopersici_AF229019; TREE Fig._2 = [&R] ((1,2,3,4,5,6,7,8,9,(10,15),(11,12,18,(19,20,21,22,23,30),26,27,28,29),14,16,17,24,25),13); END; BEGIN TREES; TITLE 'Powdery mildew (Ascomycota, Erysiphales) on Fontanesia phillyreoides and Jasminum fruticans Fig 1'; LINK TAXA = Taxa2; TRANSLATE 1 Phyllactinia_fraxini_ex_Fontanesia_phillyreoides_HAL3135F_C, 2 Phyllactinia_fraxini_ex_Fontanesia_phillyreoides_HAL3135F_M, 3 Phyllactinia_fraxini_ex_Fontanesia_phillyreoides_HAL3136F_C, 4 Phyllactinia_fraxini_ex_Fontanesia_phillyreoides_HAL3136F_M, 5 Phyllactinia_fraxini_ex_Fraxinus_MUMH911, 6 Phyllactinia_fraxini_ex_Fraxinus_MUMH912, 7 Phyllactinia_fraxini_ex_Fraxinus_MUMH915, 8 Phyllactinia_fraxini_Fraxinus_excelsior_MUMH913, 9 Phyllactinia_fraxini_Fraxinus_excelsior_MUMH914, 10 Phyllactinia_fraxini_ex_Wisteria_MUMH908, 11 Phyllactinia_fraxini_ex_Fraxinus_MUMH917, 12 Phyllactinia_fraxini_ex_Chionanthus_MUMH926, 13 Phyllactinia_fraxini_ex_Syringa_MUMH907, 14 Phyllactinia_fraxinicola_ex_Fraxinus_SMK10643, 15 Phyllactinia_fraxinicola_ex_Acer_SMK17216, 16 Phyllactinia_fraxinicola_ex_Fraxinus_MUMH426, 17 Phyllactinia_fraxinicola_ex_Fraxinus_MUMH212, 18 Phyllactinia_fraxinicola_ex_Fraxinus_MUMH566; TREE Fig._1 = [&R] (((1,2,3,4),5,6,7,(8,9),10,11,12,13),(((14,15),16),(17,18))); END;