#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:01 GMT TreeBASE (cc) 1994-2008 Study reference: Chandra A., & Huff D. 2007. Salmacisia, a new genus of Tilletiales: reclassification of Tilletia buchloƫana causing induced hermaphroditism in buffalograss. Mycologia, 100(1): 81-93. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1945] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=54; TAXLABELS Conidiosporomyces_ayresii Conidiosporomyces_verruculosus Erratomyces_patelii Exobasidium_rhododendri TIlletia_aegopogonis Tilletia_anthoxanthi Tilletia_asperifolia_AY818968 Tilletia_asperifolia_AY818969 Tilletia_barclayana_AY818970 Tilletia_barclayana_AY818971 Tilletia_boutelouae Tilletia_bromi_AY818992 Tilletia_bromi_AY819001 Tilletia_buchloeana_DQ659921 Tilletia_buchloeana_DQ659922 Tilletia_buchloeana_DQ659923 Tilletia_buchloeana_DQ659924 Tilletia_caries_AY819006 Tilletia_caries_AY819007 Tilletia_cerebrina Tilletia_chionachnes Tilletia_controversa Tilletia_ehrhartae Tilletia_eremopoae Tilletia_fusca_AY818996 Tilletia_fusca_AY818997 Tilletia_goloskokovii_AY818998 Tilletia_goloskokovii_AY818999 Tilletia_holci Tilletia_horrida_AY818974 Tilletia_horrida_AY818975 Tilletia_hyalospora Tilletia_indica Tilletia_iowensis Tilletia_ixophori Tilletia_kimberleyensis Tilletia_laevis_AY819004 Tilletia_laevis_AY819005 Tilletia_menieri Tilletia_obscuroreticulata Tilletia_olida Tilletia_opaca Tilletia_polypogonis Tilletia_rugispora_AY818982 Tilletia_rugispora_AY818983 Tilletia_savilei Tilletia_setariae Tilletia_sterilis Tilletia_sumatii_AY818986 Tilletia_sumatii_AY818987 Tilletia_vittata Tilletia_walkeri Tilletia_whiteochloae Ustilago_tritici ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=52; TAXLABELS Conidiosporomyces_ayresii Conidiosporomyces_verruculosus Erratomyces_patelii TIlletia_aegopogonis Tilletia_anthoxanthi Tilletia_asperifolia_AY818968 Tilletia_asperifolia_AY818969 Tilletia_barclayana_AY818970 Tilletia_barclayana_AY818971 Tilletia_boutelouae Tilletia_bromi_AY818992 Tilletia_bromi_AY819001 Tilletia_buchloeana_DQ659921 Tilletia_buchloeana_DQ659922 Tilletia_buchloeana_DQ659923 Tilletia_buchloeana_DQ659924 Tilletia_caries_AY819006 Tilletia_caries_AY819007 Tilletia_cerebrina Tilletia_chionachnes Tilletia_controversa Tilletia_ehrhartae Tilletia_eremopoae Tilletia_fusca_AY818996 Tilletia_fusca_AY818997 Tilletia_goloskokovii_AY818998 Tilletia_goloskokovii_AY818999 Tilletia_holci Tilletia_horrida_AY818974 Tilletia_horrida_AY818975 Tilletia_hyalospora Tilletia_indica Tilletia_iowensis Tilletia_ixophori Tilletia_kimberleyensis Tilletia_laevis_AY819004 Tilletia_laevis_AY819005 Tilletia_menieri Tilletia_obscuroreticulata Tilletia_olida Tilletia_opaca Tilletia_polypogonis Tilletia_rugispora_AY818982 Tilletia_rugispora_AY818983 Tilletia_savilei Tilletia_setariae Tilletia_sterilis Tilletia_sumatii_AY818986 Tilletia_sumatii_AY818987 Tilletia_vittata Tilletia_walkeri Tilletia_whiteochloae ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2975] TITLE 'nLSU-rDNA with outgroups and without gaps'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1203; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Conidiosporomyces_ayresii TTTGAAAGCTGGGCCGTGTCCGCATTGTAATCTCGAGAAGTAGTATCTGTGCTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCTGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCACGCAGTATTAGCTGTGTGCAGGCAGCATCGATTTTGTCTGCTGGAGAAGGGTGGCAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGCTACTGGATGCAGTGGAGGGATCGAGGACTGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGTAAACTCATGGCGCAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Conidiosporomyces_verruculosus TTTGAAAGCTGGGCCGTGTCCGCATTGTAATCTCGAGAAGTAGTATCTGTGCTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCTGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCACGCAGTATTAGCTGTGTGCAGGCAGCATCGATTTTGTCTGCTGGAGAATGGTGGCAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGCTACTGGATGCAGTGGAGGGATCGAGGACTGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGTAAACTCATGGCGCAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Erratomyces_patelii TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTGTTTTCTGTGTTGGGTCATGCACAAGTCCTTGGAAAGGGCATCAAAGAGGGTGATAATCCCGTACTTGGCATGAATCCAATGCTTTGTGATACGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGTAGGATTAGCTGTATGCAGGCAGCATCAGTTTTGACTGCTGGATAAGGGTATGAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTTGTACTTGATACAGCGATGGGACTGAGGAACGCAGTGCGCCGTATGGCGGGCCTTCGGGTACCTTCGCACTTTGGATGCTGGCGTAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCGGAATTTTTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGTATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGC Exobasidium_rhododendri TTTGAAAGCTGGAGCATGTCCGCGTTGTAATCTCGAGAGATGTTTTCCGCGCTGGACCACGTACAAGTTCTTGGAAAGGATGTCATAGAGGGTGAAAATCCCGTACTTGATGTGGACCCAGTGCTTTGTGATACGTCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCATTTGAAGTCAGACGTGTATGCAGTATTAGCTGTAGACAGGCAACATCAGTTTTGAGTGACGGATAAGGGTAGAGAGAATGTGGCATCCTCGGATGTGTTATAGCTCTTTACTGGATACGTCGTTGGGACTGAGGAACGCAGCGCGCCGCAAGGCAGACCCTCGGGTACTTTCGCGCTTAGGATGTTGGCGTAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTCTGCGAGTTTTTGGGTGGAAACCCGTAGCGCAATGAAAGTGAATGCAGGTGGGATCCGCAGAGCACCATCGACCGATCTTGATCTTTAGTGACGGATTTGAGTAAGAGCATATATGTTGGGACCCGAAAAATGGTGAACTATGCCTGAATGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATTTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTGTTACTTAGTGAACGTGGGCATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGGGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCCCACCGTTGAC TIlletia_aegopogonis TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGGCATGGATCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAAGGGTAAGGGGAATGTGGCACCCTCGGGTGTGTTATAGCTTTTTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATTCCTGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCACCGTCAGT Tilletia_anthoxanthi TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTGGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_asperifolia_AY818968 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAAGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCTCGTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATTCCTGGTGCACCATCGACCGATCCAGAATTGTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCACCGTCAGT Tilletia_asperifolia_AY818969 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAAGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCTCGTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATTCCTGGTGCACCATCGACCGATCCAGAATTGTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCACCGTCAGT Tilletia_barclayana_AY818970 TTTGAAAGCTGGACTGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTATGCAGGCAGCATCGATTTTGTCTGCTGGATAATAGTAGAAGGAATGTGGCATCTTCGGATGTGTTATAGCCTCTTACTTGATACAGTGGAGGGATCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_barclayana_AY818971 TTTGAAAGCTGGACTGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTATGCAGGCAGCATCGATTTTGTCTGCTGGATAATAATAGAAGGAATGTGGCATCTTCGGATGTGTTATAGCCTTTTATTTGATACAGTGGAGGGATCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_boutelouae TTTGAAAGCTGGATCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAGAAGGAATGTGGCATCCTCGGATGTGTTATAGCCTCTTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGCAAGGCGGCTCTTCGGAGACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_bromi_AY818992 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_bromi_AY819001 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCGTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_buchloeana_DQ659921 TTTGAAAGCTGGACCGTGTCCGCATTGTAATTTCGAGAAGCATTTTCTGTGTTGGCTTATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATAATGCCAATGCTTTAAGATATGCTCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTAAGGGAAAGATGAAAAGCACCTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAAGTTATGAACGCATGCAGCATTAGTTGTATGCGGGCAGCATCAGTTTTGGCTGCCGGAGAAGGGTACTAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGGTAATTGATACGGTGGCGGGACTGAGGACTGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCACACTTAGGATGCTGTCCAAATGACTTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGAGTGTAAACTCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAGTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_buchloeana_DQ659922 TTTGAAAGCTGGACCGTGTCCGCATTGTAATTTCGAGAAGCATTTTCTGTGTTGGCTTATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATAATGCCAATGCTTTAAGATATGCTCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTAAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAGTTGTCAAAAGGGAAGCGCTTGAAGTTATGAACGCATGCAGCATTAGTTGTATGCGGGCAGCATCAGTTTTGGCTGCCGGAGAAGGGTACTAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGGTAATTGATACGGTGGCGGGACTGAGGACTGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCACACTTAGGATGCTGTCCAAATGACTTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGAGTGTAAACTCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAGTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_buchloeana_DQ659923 TTTGAAAGCTGGACCGTGTCCGCATTGTAATTTCGAGAAGCATTTTCTGTGTTGGCTTATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATAATGCCAATGCTCTAAGATATGCTCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTAAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAAGTTATGAACGCATGCAGCATTAGTTGTATGCGGGCAGCATCAGTTTTGGCTGCCGGAGAAGGGTACTAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGGTAATTGATACGGTGGCGGGACTGAGGACTGCAGTGTGCCGCAAGGCGGCTCTTCGGAGACCTTCACACTTAGGATGCTGTCCAAATGACTTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGAGTGTAAACTCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAGTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_buchloeana_DQ659924 TTTGAAAGCTGGACCGTGTCCGCATTGTAATTTCGAGAAGCATTTTCTGTGTTGGCTTATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATAATGCCAATGCTTTAAGATATGCTCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTAAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAAGTTATGAACACATGCAGCATTAGTTGTATGCGGGCAGCATCAGTTTTGGCTGCCGGAGAAGGGTACTAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGGTAATTGATACGGTGGCGGGACTGAGGACTGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCACACTTAGGATGCTGTCCAAATGACTTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGAGTGTAAACTCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAGCTTTAAATATGTAAGAAGTCCTTGTTGCTTAGTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_caries_AY819006 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCGTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_caries_AY819007 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCGTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_cerebrina TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_chionachnes TTTGAAAGCTGGATCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTCCTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGCAAGGCGGCTCTTCGGAGACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_controversa TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCGTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_ehrhartae TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGCCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTATCTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGAAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATCTGCGAGTCTTTGGGTGGAAACCCATGGCGCAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCATATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTAGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAAT Tilletia_eremopoae TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_fusca_AY818996 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAAAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTTCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_fusca_AY818997 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTGGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_goloskokovii_AY818998 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_goloskokovii_AY818999 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_holci TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_horrida_AY818974 TTTGAAAGCTGGATCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTAGCTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAAGAGGAATGTGGCACCTTCGGGTGTGTTATAGCCTTTTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCGGAATTTTTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_horrida_AY818975 TTTGAAAGCTGGATCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTAGCTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAAGAGGAATGTGGCACCTTCGGGTGTGTTATAGCCTTTTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCGGAATTTTTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_hyalospora TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCCATGCATGCAGTATTAGCTGTTGGCAGGCAGCATCGGTTTTGTCTGCTAGATAATCGTAAGGGAAATGTGGCACCCTCGGGTGTGTTATAGACTCTTACTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACTCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_indica TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_iowensis TTTGAAAGCTGGACTGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCTTGGAAAGGACATCAAAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGCCTGCTGGATAATGATAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTTCTATTTGATACAGCGGGGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGCAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_ixophori TTTGAAAGCTGGACCGTGCCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAGAAGAAATGTGGCATCCTCGGATGTGTTATAGTCTTCTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGCAAGGCGGCTCTTCGGAGACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_kimberleyensis TTTGAAAGCTGGATCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTCTTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGCAAGGCGGCTCTTCGGAGACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTTTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_laevis_AY819004 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCGTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_laevis_AY819005 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCGTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_menieri TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_obscuroreticulata TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGCCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTAACTGTCTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTGTGAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTCATACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATTCCTGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCACCGTCAGT Tilletia_olida TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_opaca TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATTCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAGAAGAAATGTGGCATCCTCGGATGTGTTATAGTCTTCTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGCAAGGCGGCTCTTCGGAGACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_polypogonis TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCTTGGAAAGGACATCGGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAGCTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATCGTATGGGGAATGTGGCACCCTCGGGTGTGTTATAGCCCCGTACTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_rugispora_AY818982 TTTGAAAGCTGGATCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTAGCTGTTTGCAGGCAGCATCGGTTTCGTCTGCTGGATAATGGTAAGAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTCTTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCAGAATTTCTAGGACGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_rugispora_AY818983 TTTGAAAGCTGGATCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTAGCTGTTTGCAGGCAGCATCGGTTTCGTCTGCTGGATAATGGTAAGAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTCTTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCAGAATTTCTAGGACGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_savilei TTTGAAAGCTGGATCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAGAAGGAATGTGGCATCCTCGGATGTGTTATAGCCTCTTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_setariae TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGAAGGAATGTGGCATCCTCGGATGTGTTATAGCCTCTTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCTTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATTCCTGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATTCACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGATACCCATACCTCACCGTCAAT Tilletia_sterilis TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTAGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_sumatii_AY818986 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTCTTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGCAAGGCGGCTCTTCGGAGACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_sumatii_AY818987 TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTCTTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGCAAGGCGGCTCTTCGGAGACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_vittata TTTGAAAGCTGGGCCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCTCGCAGTATTAGCTGTGTGCAGGCAGCATCGGTTTTGTCTGCTGGAGAATGGTGGCAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGCTACTGGATGCAGTGGAGGGACCGAGGACCGCAGTGTGCCGTAAGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGAAAACTCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_walkeri TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTAACTGTTTGCAGGCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGTATGGCGGCTCTTCGGAGACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Tilletia_whiteochloae TTTGAAAGCTGGACCGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCTTGGAAAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATTCAGTATTAACTGTTGGCAGGCAGCATCGGTTTTGTCTGCTGGATAATGGTAGAAGAAATGTGGCATCCTCGGATGTGTTATAGTCTTCTACTTGATACAGTGGAGGGACCGAGGACCGCAGTGTGCCGCAAGGCGGCTCTTCGGAGACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAACCCATGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTACCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT Ustilago_tritici ATTGAAAGCTGGGTCGCGTCCGCATTGTAATCTCAAGAAGTGTTTTCCGCTTCGGACCATGCCTAAGTCCTTGGAAAGGGCATCATAGAGGGTGATAATCCCGTACATGGCATGGACCCGAAGCTTTGTGATACGCTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATGCCATCTAAGGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCCAAAAGGGAAGGGTAGGAGGTCAGAGATGCGGCTGGGATTAGCCAGATGCAGGCAACGTCGGTTTTGGGCGCTGGAGAAGGGTGGAAGGAATGTGGCACCTCTGGGTGTGTTATAGCCTTCTACTGGATACAGTGACGAGACCGAGGACAGCAGCGTACCGCAAAGCGGGCCTTCGGGCACCTTTACGCTTAGGGCGTTGGCATAATGGCCCTCTACCACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTATGCGAGTCTTTGGGTGGAAACCCATGGCGCAATGAAAGTGAATTCAGGTGGGATCCGCAGTGCACCATCGACCGATCCTCACTTTTTAAGGTGGATTTGAGTAAGAGCATACCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGAAGTAACTTCCTTAACCTATTCTCAAACTTTAAATGTGTAAGAAGCCCTTGTTACTTAGTGAACGAGGGCATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCTGAACCGAACGTTGGGTTAAGGTGCCAAAGTATACGCTCATCAGATACCAGAAAAGGTGTTATTTAGTCTAGACAGTGGGACGGTGGCCATGGAAGTCGGAAACCGCTAAGGAGTGTGTAACAACTCACCCACCGAATTAAGTACCCTGAAAATGGATGGCGCTCAAGCGTATCACCGATACCCAACCGTCAGT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'nLSU-rDNA with outgroups and without gaps') = N: 1-1203; CODONPOSSET CodonPositions (CHARACTERS = 'nLSU-rDNA with outgroups and without gaps') = N: 1-1203; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2974] TITLE 'nLSU-rDNA without outgroups and with gaps'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1340; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Conidiosporomyces_ayresii TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCGCCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTATCTGTGCTGGGCCATGTACAAGTTC{CT}TTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCTGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCACGCAGTATTCAGCCTTTCTTTTG---GAGGGTGTACTTGCTGTGTT--GCAGGCCAGCATCGATTTTGTCTGCTGGAGAAGGGTGGCAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGCTACTGGATGCAGTGGATGGGATCGAGGACTGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGTCAAACTCATAGGCGCAATGAAAGTGAATGCAGGTGGGATCCCCTTC---GGGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTG{AT}TTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Conidiosporomyces_verruculosus TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCGCCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTATCTGTGCTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCTGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCACGCAGTATTCAGCCTTTCTTTTG---GAGGGTGTACTTGCTGTGTT--GCAGGCCAGCATCGATTTTGTCTGCTGGAGAATGGTGGCAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGCTACTGGATGCAGTGGATGGGATCGAGGACTGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGTCAAACTCATAGGCGCAATGAAAGTGAATGCAGGTGGGATCCCCTTT---GGGG-TGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Erratomyces_patelii TAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTCGGTGTCCGCATTGTAATCTCGAGAAGTGTTTTCTGTGTTGGGTCATGCACAAGTCCCTTGGAAAAGGGCATCAAAGAGGGTGATAATCCCGTACTTGGCATGAATTCCAATGCTTTGTGATACGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGTAGGATTCAGCTTTTCTTTTG---AAGAGTGTATTTTCTGTAT---GCAGGCCAGCATCAGTTTTGACTGCTGGATAAGGGTATGAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTTGTACTTGATACAGCGATTGGGACTGAGGAACGCAGTGCGCCGTAT-GGC-GGGCCTTCGGGT-ACCTTCGCACTTTGGATGCTGGCGTAATGGCCTTAAGCGACCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCTT-----GGGGTGCACCATCGACCGATCCGGAATTTTTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGTATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGCGTTGTA TIlletia_aegopogonis TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGGCATGGATCCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAAGGGTAAGGGGAATGTGGCACCCTCGGGTGTGTTATAGCTTTTTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTATTGGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCAT?GGCGTAATGAAAGTGAATGCAGGTGGGATTCCTTC-----GGGATGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCACCGTCAGTGTTGTA Tilletia_anthoxanthi TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTGGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_asperifolia_AY818968 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTTTTTTGCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAAGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCTCGTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAT-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATTCCTTC-----GGGATGCACCATCGACCGATCCAGAATTGTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCACCGTCAGTGTTGTA Tilletia_asperifolia_AY818969 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTTTTTTGCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAAGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCTCGTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAT-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATTCCTTC-----GGGATGCACCATCGACCGATCCAGAATTGTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCACCGTCAGTGTTGTA Tilletia_barclayana_AY818970 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACTT---GTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTATT--GCAGGCCAGCATCGATTTTGTCTGCTGGATAATAGTAGAAGGAATGTGGCATCTTCGGATGTGTTATAGCCTCTTACTTGATACAGTGGATGGGATCGAGGACCGCAGTGTGCCGTAA-GGCAGGCTCTTCGGAGTACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTCC-----GGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_barclayana_AY818971 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACTT---GTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTATT--GCAGGCCAGCATCGATTTTGTCTGCTGGATAATAATAGAAGGAATGTGGCATCTTCGGATGTGTTATAGCCTTTTATTTGATACAGTGGATGGGATCGAGGACCGCAGTGTGCCGTAA-GGCAGGCTCTTCGGAGTACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTCC-----GGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_boutelouae TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCATCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAGAAGGAATGTGGCATCCTCGGATGTGTTATAGCCTCTTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGCAA-GGCAGGCTCTTCGGAGTACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCTT-----GGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_bromi_AY818992 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGACGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_bromi_AY819001 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCGTATTGGATACAGTGGA{CT}GGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGG{CT}AAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCTTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_buchloeana_DQ659921 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATTTCGAGAAGCATTTTCTGTGTTGGCTTATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATAATGTCCAATGCTTTAAGATATGCTCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTAAGGGAAAGATGAAAAGCACCTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAAGTTATGAACGCATGCAGCATT-AGT---------------------------TGTATT--GCGGGC-AGCATCAGTTTTGGCTGCCGGAGAAGGGTACTAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGGTAATTGATACGGTGGCTGGGACTGAGGACTGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCACACTTAGGATGCTGTCCAAATGACTTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGAGTGTCAAACTCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTTT------GGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAAGTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT------ Tilletia_buchloeana_DQ659922 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATTTCGAGAAGCATTTTCTGTGTTGGCTTATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATAATGTCCAATGCTTTAAGATATGCTCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTAAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAGTTGTCAAAAGGGAAGCGCTTGAAGTTATGAACGCATGCAGCATT-AGT---------------------------TGTATT--GCGGGC-AGCATCAGTTTTGGCTGCCGGAGAAGGGTACTAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGGTAATTGATACGGTGGCTGGGACTGAGGACTGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCACACTTAGGATGCTGTCCAAATGACTTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGAGTGTCAAACTCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTTT------GGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAAGTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT------ Tilletia_buchloeana_DQ659923 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATTTCGAGAAGCATTTTCTGTGTTGGCTTATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATAATGTCCAATGCTCTAAGATATGCTCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTAAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAAGTTATGAACGCATGCAGCATT-AGT---------------------------TGTATT--GCGGGC-AGCATCAGTTTTGGCTGCCGGAGAAGGGTACTAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGGTAATTGATACGGTGGCTGGGACTGAGGACTGCAGTGTGCCGCAA-GGC-GGCTCTTCGGAG-ACCTTCACACTTAGGATGCTGTCCAAATGACTTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGAGTGTCAAACTCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTTT------GGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAAGTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT------ Tilletia_buchloeana_DQ659924 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATTTCGAGAAGCATTTTCTGTGTTGGCTTATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATAATGTCCAATGCTTTAAGATATGCTCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTAAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAAGTTATGAACACATGCAGCATT-AGT---------------------------TGTATT--GCGGGC-AGCATCAGTTTTGGCTGCCGGAGAAGGGTACTAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGGTAATTGATACGGTGGCTGGGACTGAGGACTGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCACACTTAGGATGCTGTCCAAATGACTTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGAGTGTCAAACTCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTTT------GGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT-GGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAGCTTTAAATATGTAAGAAGTCCTTGTTGCTTAAGTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGT------ Tilletia_caries_AY819006 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCGTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_caries_AY819007 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCGTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_cerebrina TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGA{CT}GGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_chionachnes TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCATCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG---ATTGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTCCTACTTGATACAGTGGACGGGACCGAGGACCGCAGTGTGCCGCAA-GGCAGGCTCTTCGGAGTACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCTC-----GGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_controversa TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGG{CT}ACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCGTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_ehrhartae ------------------------------------------GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGCCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTCATCCTCTCTTTTG---ATTGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGAAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAT-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATCTGCGAGTCTTTGGGTGGCAAACCCATAGGCGCAATGAAAGTGAATGCAGGTGGGATCCCTCT-----GGG-TGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCATATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTAGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAATGTTGTA Tilletia_eremopoae -------------------------------------------------------------------TTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTC-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGACGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_fusca_AY818996 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAAAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACACCGGACCAAGGAGTCTAACATATTTTCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_fusca_AY818997 ----------------------------------------------------CGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAA{CT}AGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTGGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_goloskokovii_AY818998 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGACGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_goloskokovii_AY818999 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGACGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGC----TGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_holci TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTGTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_horrida_AY818974 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCATCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTCAGCCTTTCTTTTG---ATGGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAAGAGGAATGTGGCACCTTCGGGTGTGTTATAGCCTTTTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAT-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTCA-----CGGGTGCACCATCGACCGATCCGGAATTTTTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_horrida_AY818975 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCATCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTCAGCCTTTCTTTTG---ATGGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAAGAGGAATGTGGCACCTTCGGGTGTGTTATAGCCTTTTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAT-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTCA-----CGGGTGCACCATCGACCGATCCGGAATTTTTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_hyalospora TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCCATGCATGCAGTATTCAGCCTTTCTTTTGAGGGGGGGTGGATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTAGATAATCGTAAGGGAAATGTGGCACCCTCGGGTGTGTTATAGACTCTTACTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGGAAACTCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCTCAC---GGGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_indica TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GAG--GGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAT-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCT-----TAGGGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_iowensis TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACTT---GTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAAAGAGGGTGAGAATCCCGTACTTGACATGGATTCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGCCTGCTGGATAATGATAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTTCTATTTGATACAGCGGGTGGGACCGAGGACCGCAGTGTGCCGTAA-GGCAGGCTCTTCGGAGTACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGCAATGAAAGTGAATGCAGGTGGGATCCCCTC-----GGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_ixophori TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGTACCTTCGGTGCCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAGAAGAAATGTGGCATCCTCGGATGTGTTATAGTCTTCTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGCAA-GGCAGGCTCTTCGGAGTACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCTC-----GGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_kimberleyensis TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCATCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGAT{CT}CCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG---ATTGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTCTTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGCAA-GGCAGGCTCTTCGGAGTACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTTTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCTC-----GGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_laevis_AY819004 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCGTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_laevis_AY819005 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCGTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_menieri ------------------------------------------GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_obscuroreticulata TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGCCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTCTTT-GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTGTGAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTCATACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTATTGGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATTCCTTC-----GGGATGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCTATACCTCACCGTCAGTGTTGTA Tilletia_olida TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTC-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGACGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_opaca TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATTCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAGAAGAAATGTGGCATCCTCGGATGTGTTATAGTCTTCTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGCAA-GGCAGGCTCTTCGGAGTACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCTC-----GGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTA-CCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_polypogonis ------------------------------------------GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCCTTGGAATAGGACATCGGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAGCCCTTCTTCTG---GAGGGTGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATCGTATGGGGAATGTGGCACCCTCGGGTGTGTTATAGCCCCGTACTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAT-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCTC-----GGGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_rugispora_AY818982 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCATCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTCAGCCTTTCTTTTG---ATGGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTCGTCTGCTGGATAATGGTAAGAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTCTTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAT-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTT------TGGGTGCACCATCGACCGATCCAGAATTTCTAGGACGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_rugispora_AY818983 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCATCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTCAGCCTTTCTTTTG---ATGGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTCGTCTGCTGGATAATGGTAAGAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTCTTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAT-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTT------TGGGTGCACCATCGACCGATCCAGAATTTCTAGGACGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_savilei TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCATCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAGAAGGAATGTGGCATCCTCGGATGTGTTATAGCCTCTTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGCAGGCTCTTCGGAGTACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGAAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCTC-----GGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_setariae TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCATGCAGTATTCAACTTTTCTTTTG---ATGAGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGAAGGAATGTGGCATCCTCGGATGTGTTATAGCCTCTTACTTGATACAGTGGACGGGACCGAGGACCGCAGTGTGCCTTAT-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATTCCTTT-----GGA-TGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATTCACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGATACCCATACCTCACCGTCAATGTTATA Tilletia_sterilis TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCCGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGACCCCGGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GGATTGGCGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCTTCTTTATGGAGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAGTTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_sumatii_AY818986 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTCTTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGCAA-GGCAGGCTCTTCGGAGTACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCTC-----GGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_sumatii_AY818987 TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTCTTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGCAA-GGCAGGCTCTTCGGAGTACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCTC-----GGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_vittata TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCGCCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGCTATGCTCGCAGTATTCAGCCTTTCTTTTG---AAGGGTGTACTTGCTGTGTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGAGAATGGTGGCAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGCTACTGGATGCAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAA-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGACAAACTCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCTTT-----GGG-TGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_walkeri ------------AAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTTGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGCTGGACCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATCCCAGTGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATGCAGTATTCAACCTTTCTTTTG-GAG--GGTGTATTTGCTGTTTT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATAGTAGGAGAAATGTGGCATCCTCGGATGTGTTATAGTCTCTTATTGGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGTAT-GGC-GGCTCTTCGGAG-ACCTTCGCACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCT-----TAGGGGTGCACCATCGACCGATCCGGAATTTCTAGGATGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGCATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTGCTTAATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA Tilletia_whiteochloae TAAGCGGAGGAGAAAAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCACCTTCGGTGTCCGCATTGTAATCTCGAGAAGTAGTTTCTGTGTTGGGCCATGTACAAGTTCCTTGGAATAGGACATCAGAGAGGGTGAGAATCCCGTACTTGACATGGATTCCAATGCTTTGTGATCTGCTCTCTATGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTGAGGTTAGACATGCATTCAGTATTCAACCTTTCTTTTG---ATGGGTGTATTTGCTGTTGT--GCAGGCCAGCATCGGTTTTGTCTGCTGGATAATGGTAGAAGAAATGTGGCATCCTCGGATGTGTTATAGTCTTCTACTTGATACAGTGGATGGGACCGAGGACCGCAGTGTGCCGCAA-GGCAGGCTCTTCGGAGTACTTTCACACTTAGGATGCTGGCGTAATGGCCTTAAGCGGCCCGTCTTGAAACAC-GGACCAAGGAGTCTAACATATTTGCGAGTCTTTGGGTGGCAAACCCATAGGCGTAATGAAAGTGAATGCAGGTGGGATCCCCTC-----GGGGTGCACCATCGACCGATCCAGAATTTTTAGGAAGGATTTGAGTACGAGCACATATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCACATCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGATGTAACATCCTTAACCT-ATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACATGCGAATGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGATCGTGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGCACATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGTGCTAGCCCTGAAAATGGATGGCGCTTAAGCGTGTTACCCATACCTCACCGTCAGTGTTGTA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'nLSU-rDNA without outgroups and with gaps') = N: 1-1340; CODONPOSSET CodonPositions (CHARACTERS = 'nLSU-rDNA without outgroups and with gaps') = N: 1-1340; END; BEGIN TREES; TITLE Tb8768; LINK TAXA = Taxa2; TRANSLATE 1 Tilletia_whiteochloae, 2 Tilletia_walkeri, 3 Tilletia_vittata, 4 Tilletia_sumatii_AY818987, 5 Tilletia_sumatii_AY818986, 6 Tilletia_sterilis, 7 Tilletia_setariae, 8 Tilletia_savilei, 9 Tilletia_rugispora_AY818983, 10 Tilletia_rugispora_AY818982, 11 Tilletia_polypogonis, 12 Tilletia_opaca, 13 Tilletia_olida, 14 Tilletia_obscuroreticulata, 15 Tilletia_menieri, 16 Tilletia_laevis_AY819005, 17 Tilletia_laevis_AY819004, 18 Tilletia_kimberleyensis, 19 Tilletia_ixophori, 20 Tilletia_iowensis, 21 Tilletia_indica, 22 Tilletia_hyalospora, 23 Tilletia_horrida_AY818975, 24 Tilletia_horrida_AY818974, 25 Tilletia_holci, 26 Tilletia_goloskokovii_AY818999, 27 Tilletia_goloskokovii_AY818998, 28 Tilletia_fusca_AY818997, 29 Tilletia_fusca_AY818996, 30 Tilletia_eremopoae, 31 Tilletia_ehrhartae, 32 Tilletia_controversa, 33 Tilletia_chionachnes, 34 Tilletia_cerebrina, 35 Tilletia_caries_AY819007, 36 Tilletia_caries_AY819006, 37 Tilletia_buchloeana_DQ659924, 38 Tilletia_buchloeana_DQ659923, 39 Tilletia_buchloeana_DQ659922, 40 Tilletia_buchloeana_DQ659921, 41 Tilletia_bromi_AY819001, 42 Tilletia_bromi_AY818992, 43 Tilletia_boutelouae, 44 Tilletia_barclayana_AY818971, 45 Tilletia_barclayana_AY818970, 46 Tilletia_asperifolia_AY818969, 47 Tilletia_asperifolia_AY818968, 48 Tilletia_anthoxanthi, 49 TIlletia_aegopogonis, 50 Erratomyces_patelii, 51 Conidiosporomyces_verruculosus, 52 Conidiosporomyces_ayresii; TREE with_gaps = [&R] ((((((((22,11),(48,(41,32,17,16,36,35),42,34,(30,13),29,28,27,26,25,15,6)),(21,2)),(((((((20,(19,(12,1))),5,4),(33,18)),43),8),(45,44)),(31,7))),((49,(47,46)),14),((24,23),(10,9))),((52,51),3)),(40,39,38,37)),50); END; BEGIN TREES; TITLE Tb8767; LINK TAXA = Taxa1; TRANSLATE 1 Ustilago_tritici, 2 Tilletia_whiteochloae, 3 Tilletia_walkeri, 4 Tilletia_vittata, 5 Tilletia_sumatii_AY818987, 6 Tilletia_sumatii_AY818986, 7 Tilletia_sterilis, 8 Tilletia_setariae, 9 Tilletia_savilei, 10 Tilletia_rugispora_AY818983, 11 Tilletia_rugispora_AY818982, 12 Tilletia_polypogonis, 13 Tilletia_opaca, 14 Tilletia_olida, 15 Tilletia_obscuroreticulata, 16 Tilletia_menieri, 17 Tilletia_laevis_AY819005, 18 Tilletia_laevis_AY819004, 19 Tilletia_kimberleyensis, 20 Tilletia_ixophori, 21 Tilletia_iowensis, 22 Tilletia_indica, 23 Tilletia_hyalospora, 24 Tilletia_horrida_AY818975, 25 Tilletia_horrida_AY818974, 26 Tilletia_holci, 27 Tilletia_goloskokovii_AY818999, 28 Tilletia_goloskokovii_AY818998, 29 Tilletia_fusca_AY818997, 30 Tilletia_fusca_AY818996, 31 Tilletia_eremopoae, 32 Tilletia_ehrhartae, 33 Tilletia_controversa, 34 Tilletia_chionachnes, 35 Tilletia_cerebrina, 36 Tilletia_caries_AY819007, 37 Tilletia_caries_AY819006, 38 Tilletia_buchloeana_DQ659924, 39 Tilletia_buchloeana_DQ659923, 40 Tilletia_buchloeana_DQ659922, 41 Tilletia_buchloeana_DQ659921, 42 Tilletia_bromi_AY819001, 43 Tilletia_bromi_AY818992, 44 Tilletia_boutelouae, 45 Tilletia_barclayana_AY818971, 46 Tilletia_barclayana_AY818970, 47 Tilletia_asperifolia_AY818969, 48 Tilletia_asperifolia_AY818968, 49 Tilletia_anthoxanthi, 50 TIlletia_aegopogonis, 51 Exobasidium_rhododendri, 52 Erratomyces_patelii, 53 Conidiosporomyces_verruculosus, 54 Conidiosporomyces_ayresii; TREE Fig._20 = [&R] ((((((((((23,12),(49,(42,33,18,17,37,36),43,35,31,30,29,28,27,26,16,14,7)),(22,3)),(((((((21,(20,(13,2))),34),(6,5)),19),44),9),(46,45))),(32,8)),((((50,(48,47)),15),((25,24),(11,10))),((54,53),4))),(41,40,39,38)),52),51),1); END;