#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:46 GMT TreeBASE (cc) 1994-2008 Study reference: Kyoko W., Sekiguchi M., Kaneko S., Sato T., Tanaka K., Hsiang T., Kanda M., Naoko F., & Shunsuke N. 2016. Phylogenetic analysis of the synnema-producing genus Synnemapestaloides. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S19528] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=12; TAXLABELS Discosia_artocreas_NBRC8975 Seimatosporium_botan_NBRC104200 Seimatosporium_discosioides_NBRC104201 Seimatosporium_foliicola_AB593734 Synnemapestaloides_rhododendri_MAFF239201 Synnemapestaloides_rhododendri_MAFF243052 Synnemapestaloides_rhododendri_MAFF243053 Synnemapestaloides_rhododendri_MAFF243054 Synnemapestaloides_rhododendri_MAFF245058 Synnemapestaloides_rhododendri_MAFF245156 Synnemapestaloides_rhododendri_MAFF245157 Synnemapestaloides_rhododendri_TAMA492 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=35; TAXLABELS Discosia_artocreas_AB593705 Discosia_artocreas_AB593711 Discosia_artocreas_AB593720 Discosia_brasiliensis_AB593707 Discosia_pini_AB593708 Discosia_pleurochaeta_AB593709 Discosia_pleurochaeta_AB593713 Discosia_tricellulare_AB593728 Discosia_yakushimense_AB593721 Discostroma_fuscellum_AB593739 Discostroma_stoneae_AB593729 Discostroma_tostum_AB593727 Pestalotiopsis_sp._FJ1402 Pestalotiopsis_sp._LC047750 Sarcostroma_restionis_DQ278925 Seimatosporium_biseptatum_JN871208 Seimatosporium_botan_AB593731 Seimatosporium_discosioides_AB593732 Seimatosporium_elegans_AB593733 Seimatosporium_eucalypti_JN871212 Seimatosporium_foliicola_AB593734 Seimatosporium_hakeae_AB593736 Seimatosporium_kriegerianum_AB593738 Seimatosporium_mariae_AB593740 Seimatosporium_obtusum_JN871215 Seimatosporium_parasiticum_AB593741 Seimatosporium_pistaciae_KP004491 Seimatosporium_sp._LC047752 Synnemapestaloides_rhododendri_MAFF239201 Synnemapestaloides_rhododendri_MAFF243052 Synnemapestaloides_rhododendri_MAFF245156 Synnemapestaloides_rhododendri_MAFF245157 Synnemapestaloides_rhododendri_MAFF245158 Synnemapestaloides_rhododendri_TAMA492 Truncatella_angustata_AF382383 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=45; TAXLABELS Bartalinia_laurina Bartalinia_pondoensis Bartalinia_robillardoides Broomella_vitalbae Discosia_aff._pleurochaeta Discosia_artocreas Discosia_pini Discosia_tricellulare Discosia_yakushimense Discostroma_tostum Hymenopleella_hippophaeicola Immersidiscosia_eucalypti Lepteutypa_fuckelii Lepteutypa_sambuci Monochaetia_kansensis Neoestalotiopsis_protearum Neopestalotiopsis_rosae Pestalotiopsis_knightiaegi Pestalotiopsis_malayana Phlogicylindrium_uniforme Pseudopestalotiopsis_cocos Robillarda_africana Robillarda_sessilis Seimatosporium_biseptatum Seimatosporium_botan Seimatosporium_discosioides Seimatosporium_eucalypti Seimatosporium_foliicola Seimatosporium_hakeae Seimatosporium_hypericinumgi Seimatosporium_mariae Seimatosporium_obtusum Seimatosporium_parasiticum Seimatosporium_pistaciae Seiridium_marginatumi Seiridium_phylicae Strickeria_kochii Synnemapestaloides_rhododendri_MAFF239201 Synnemapestaloides_rhododendri_MAFF243052 Synnemapestaloides_rhododendri_MAFF245156 Synnemapestaloides_rhododendri_MAFF245157 Synnemapestaloides_rhododendri_MAFF245158 Synnemapestaloides_rhododendri_TAMA492 Truncatella_hartigii Zetiasplozna_acaciae ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M39410] TITLE Synnemapestaloides_ITS_LSU_NJ_MP_ML_45x1117; LINK TAXA = Taxa3; DIMENSIONS NCHAR=1117; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bartalinia_laurina GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCTTT-GTTGCCTCGGCAGTA-GTTGCTGGGCGAGC-CTACCCGGGAACGAGCTACCCTGTAGCGAGTTACCCTGGAACGACTTACCCT------GGAAC--GC-CTGCCGGTGGACTACTAAACTCTTGTTATTTTT-AAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAATCGA-C-------------------TTTACT---------GT-CGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTTTTTCTCGTTTTTG--AAATACTATAAACCTC--AGCCGCTAAACCCCCAA-TTTCTTA-TGGTTGACCTCGGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTAGGAATGTGGCTTCCCTCCGGGAGTGTTATAGCCTATTGTATAATACACTGCTGGGGGT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Bartalinia_pondoensis GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCTTT-GTTGCCTCGGCAGTA-GTTGCTGGGCGAGC-CTACCCGGGAACGAGCTACCCTGTAGCGAGTTACCCTGGAACGACTTACCCT------GGAAC--GC-CTGCCGGTGGACTACTAAACTCTTGTTATTTTT-AAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAATCGA-C-------------------TTTACT---------GT-CGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTTTTTCTCGTTTTTG--AAATACTATAAACCTC--AGCCGCTAAACCCCCAA-TTTCTTA-TGGTTGACCTCGGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTAGGAATGTGGCTTCCCTCGGGAAGTGTTATAGCCTATTGTATAATACACTGCTGGGGGT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Bartalinia_robillardoides GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCTTT-GTTGCCTCGGCAGTA-GTTGCTGGGCGAGC-CTACCCGGGAA---------------------ATCCTGGGACGACTTACCCT------GTAAC--GC-CTGCCGGTGGACTACTAAACTCTTGTTATTTTT-AAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAATCGA-C-------------------TTTACT---------GT-CGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTTTTTCTCGTTTTTG--AAATACTATAAACCTC--AGCCGCTAAACCCCCAA-TTTCTTA-TGGTTGACCTCGGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTAGGAATGTGGCTTCCCTCGGGAAGTGTTATAGCCTATTGTATAATACACTGCTGGGGGT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Broomella_vitalbae GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTTAACTTACCACT-GTTGCCTCGGCAGAGAGCTGCTGGGCAGAC-CTACCCGGGAGCG-GCTACCCTGTAGCT-GCCACCCTGGAAGGGC-TACCCT------GAAAC--AATCTGCCGGTGGACTACTAAACTCTTGTTATTTTAAAAGTAATCTGAGCGTCTTATTTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCTTAGCTTAGTATTGGGAGCTGG-C-------------------TGTACT---------GC-CACTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTT-TATCTCGTTTTTG--AAATACTGTAAACCTC--AGCCGCTAAACCCCCAA--TTTTTAATGGTTGACCTCGGCTCAAATTTGAAATCTGGCACTTGTGTCCGAGTTGTAATTTGCAGAAGATGATTTTGGTTAGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGGATGCCGAGCCTTTGTAAATCTCTTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTCTAGGCCAGCATCGACTTTCGGCGGCGGATAAAAGCTTCAGGAATGTGACTCCCTACGGGGAGTGTTATAGCCTGTTGTATAATACGCTGCTGGGGGT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Discosia_aff._pleurochaeta GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATTTGTTGCCTCGGCAGAG-CCTACCCGGTACC---TACCCTGGAGCAG-CTACCCTGTAGC----TACCCTGGAGCGGGTTACCCT------GTAGCG--TCCTGCCGGTGGACCTTTAAACTCTTGTTATTTTA-TAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTA-C-------------------TGTATT---------GT-AGTTCCTGAAATATAACGGCGGATCTGTAATATCCTCTGAGCGTAGTAATTTTTTTC-TCGCTTTGGTTAGGTGTTGCAGCTCTC--AGCCGCTAAACCCCCCAATTTT--AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGACTACCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGGATCACCCGGTGTTCTCACCGGTGCACTTCGCTTAGTTTAGGCCAGCATCGATTTTCGGTGGGGGATAAAAGCTTTAGGAATGTGGCTCCT--CCGGGAGTGTTATAGCCTATTGTATAATACCCTACTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Discosia_artocreas GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATTTGTTGCCTCGGCAGAG-CCTACCCGGTAAC---TGTTC-GGAGAAG-CTACCCTGTAGC----TACCCTGTAACGGCCTACCCT------GTAAC--GCACTGCCGGTGGACTTTTAAACTCTTGTTATTTTA-TAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTA-C-------------------TGTATT---------GT-AGTTCCTGAAATACAACGGCGGATCTGTAATATCCTCTGAGCGTAGTAATTTTTTTC-TCGCTTTGGTTAGGTGTTGCAGCTCTC--AGCCGCTAAACCCCCCAATTTT--AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAGTTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCTCAGTTTAGGCCAGCATCGATTTTCGGTGGGGGATAAAAGCTTTAGGAATGTGGCTCCT--CCGGGAGTGTTATAGCCTATTGTATAATACCCTACTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Discosia_pini GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATTTGTTGCCTCGGCAGAG-CCTACCCGGTAAC---TGTTC-GGAGAAG-CTACCCTGTAGC----TACCCTGTAACGGCCTACCCT------GTAACG--CACTGCCGGTGGACTTTTAAACTCTTGTTATTTTA-TAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTA-C-------------------TGTATT---------GT-AGTTCCTGAAATACAACGGCGGATCTGTAATATCCTCTGAGCGTAGTAATTTTTTTC-TCGCTTTGGTTAGGTGTTGCAGCTCTC--AGCCGCTAAACCCCCCAATTTT--AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAGTTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCTCAGTTTAGGCCAGCATCGATTTTCGGTGGGGGATAAAAGCTTTAGGAATGTGGCTCCT--CCGGGAGTGTTATAGCCTATTGTATAATACCCTACTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Discosia_tricellulare GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATTTGTTGCCTCGGCAGAG-GCTACCCGGTACC---TACCCTGGAGCAG-CTACCCTGTAGC----TACCCTGGAACGGCCTACCCT------GTAGCGCATCCTGCCGGTGGACCTTTAAACTCTTGTTATTTTA-AAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTA-C-------------------TGTATT---------GT-AGTTCCTGAAATATAACGGCGGATCTGTAATGTCCTCTGAGCGTAGTAATTTTTTTCCTCGCTTTGGTTAGGTGTTGCAGCTCTC--AGCCGCTAAACCCCCCAATTT---AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAGTTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGACTACCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCCTAGTTTAGGCCAGCATCGATTTTCGGTGGGGGATAAAAGCCTTAGGAATGTGGCTCCT--CCGGGAGTGTTATAGCCTATTGTATAATACCCTACTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Discosia_yakushimense GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATTTGTTGCCTCGGCAGAG-CCTACCCGGTACC---TACCCTGGAGCAG-CTACCCTGTAGC----TACCCTGGAGCGGCCTACCCT------GTAGCGCATCCTGCCGGTGGACCTTTAAACTCTTGTTATTTTA-TAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTA-C-------------------TGTATT---------GT-AGTTCCTGAAATATAACGGCGGATCTGTAATATCCTCTGAGCGTAGTAATTTTTTTC-TCGCTTTGGTTAGGTGTTGCAGCTCTC--AGCCGCTAAACCCCCCAATTTT--AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGACTACCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCCTAGTTTAGGCCAGCATCGATTTTCGGTGGGGGATAAAAGCTTTAGGAATGTGGCTCCT--CCGGGAGTGTTATAGCCTATTGTATAATACCCTACTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Discostroma_tostum GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACTATT-GTTGCCTCGGCAGAA-CCTACCCGGTACC---TACCCTGTAACGACCTACCCTGTAGCGAGTTATCCGGGAACGGCCTACCCC------GTAGC--GCGCTGCCGGTGGACTTCTAAACTCTTGTTATTT-A-TTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTA-C-------------------TGTATT---------GT-AGCTCCCCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTCAGGTGCCGCAGCTCTC--AGCCGCTAAACCCCCAATTTTTTTAATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGATCCCAATTGTAATTTGTATTGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTCAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTGTTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Hymenopleella_hippophaeicola GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTTAACTTACCTTT-GTTGCCTCGGCAGT-----TTTGGGCGAGC-CTACCC------------------------------TGTAGCTGCTTACCCT------GTAAC--GA-CTGCCGGTGGACTATCAAACTCTTGTTATTTTT-AAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAATCGA-C-------------------TTTACT---------GT-CGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATTTTACACCTCGTTTTTG--AAATACTATAAACCTC--AGCCGCTAAACCCCCAAATTTTCTA-TGGTTGACCTCGGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGATTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTTAGTTTAGGCCAGCATCGACTTTCGGCGGCGGATAAAAGCTTCAGGAATGTGGCTCCCCTAGGGGAGTGTTATAGCCTGTTGTATAATACGCTGCTGGGGGT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Immersidiscosia_eucalypti GATCATTACAGAGTTATA--AAA-CTCCCAAA-CCCATGTGAACTTACC-TATGTTGCCTCGGCGGAG-CCTACCCGGTACC------------------------------------------------TACCCT------GTAAC--GCTCCGCCGGTGGACCTTTAAACTCTTGTTATTTTA-TAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAATTTA-C-------------------TGTATT---------GT-AATTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTTATCTCGCTTTGGTAAGGTGCTGCAGCTCTC--AGCCGCTAAACCCCCCCAATTTTTAATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGGATGCCTAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCCCAGTTTAGGCCAGCATCGGTTTTCGGTGGGGGATAAAAGCTTTAGGAATGTGGCTCTT--TCGGGAGTGTTATAGCCTATTGTATAATACCCTACTGGGGAC-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Lepteutypa_fuckelii GATCATTATAGAGTTAT--AAAA-CTCCCAA--CCCATGTGAACTTACCATT-GTTGCCTCGGCGGAG-CCTACCCGGAAGGACCTACCC-GGAACGAGTTACCTTGTAGCGAGTTTCCCGGAACGGCCTACCCTG-------TA-GC-GGTCCGCCGGTGGATTTTTAAACTATTGTTATTTTA-T-GTTATCTGAGCGTCTTATTT-AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTATTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTA-CTGTCCGGGTGGAGCTACCCTGTAGCGCCTACCCTGT-AGTTCCTGAAAACCAACGGCGGACTTGCAGTGTCCTCTGAGCGTAGTAATTA-TTATCTCGCTTCTGTTAGGTGCTGTAATTCT---AGCCGCTAAAC-CCTTAATTTCT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGCTTTTGGTTAGGTACCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGGATACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTTTTCTAGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGTCTAGTTTAGGCCAGCATCGGTTTCTGTAGGGGGATAAAATTAGCAGGAATGTGGCTCCT--TCGGGAGTGTTATAGCCTGTTAAATAATACCTTTACGGGGAC-CGAGGTTCGCGCT-CTGCAAGGATGCTGGCGTAATGGTCATCAACGACCCGTCTTG--AAACACGG-ACC Lepteutypa_sambuci GATCATTAGAGAGTTATT-AAAA-CTCCCAA--CCCATGTGAACTTACCATT-GTTGCCTCGGCGG-G-CCTACCCGGATCGACCTACCC-GGAGCGACCTACCCTGTAGCGAGCTACCCGGA-----------------------GC-GGACCGCCGGTGGATTTTTCAACTCTTGTTATTTTA-G-TGAATCTGAGCGTCTTATTT-AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCAAGAGTATTCTCTTGGGCATGCCTGTTCGAGCGTCATTTCGACCCTTAAGCCTAGCTTAGTGTTGGGAATCTA-CTG-----------------------------CCTGT-AGTTCCTGAAAACCAACGGCGGATTTGTAGCATCCTCTGAGCGTAGTAATTA-TCATCTCGCTTCTGTTAGGTGCTGTGACTCC---AGCCGCTAAAC-CCCCTATTTTT-AAAGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGCTTTTGGTTAGGTACCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTTTTCTAGGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGTCTAGTTTAGGCCAACATCGGTTTCTGTAGGGGGATAAAATCGGTAGGAACGTAGCTCCC--TCGGGAGTGTTATAGCCTGTCGAATAATACCTTTACGGGGAC-CGAGGTTCGCGCT-CTGCAAGGATGTTGGCATAATGGTCATCAACGACCCGTCTTG--AAACACGG-ACC Monochaetia_kansensis GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCATTGTGAACTTACCATTTGTTGCCTCGGCAGAA-CCTACCCTGTACC---TACCCGGGAACGAGCTACCCTGTAGCG--CCGACCCGGTGTGGGCTACCCT------GTAGT--GGGCTGCCGGTGGACTACTAAACTCT-GTTATACTA-TTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAATCTAAC-------------------CGCAAG---------GTTAGTTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAAATTTTTATCTCGCTTTTGTTAGGTGCCGCTGCTCTC--AGCCGCTAAACCCCCCAATTTTT-TGTGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGGATACCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCAGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTCCGGAGGGGGATAAAAGCTTTAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTATTGTATAATACCTTTCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Neoestalotiopsis_protearum GATCATTATAGAGTTTTC--TAAACTCCCAA--CCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAA-GTTAT----------------------------------------------------AGGTCTTCTT------ATAGC--TGC-TGCCGGTGGACCATTAAACTCTTGTTATTTTA-T-GTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTA-C-------------------TTCTCTTA-GGAGTTGT-AGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAATTTTTTT-CTCGCTTTTGTTAGGTGCTATAACTCCC--AGCCGCTAAA-CCCCCAATTTTC-TGTGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCTCTACGGGGAGTGTTATAGCCTATTGTATAATACCGCGCTGGGGAC-CGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Neopestalotiopsis_rosae GATCATTATAGAGTTTTC--TAAACTCCCAA--CCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAA-GTTAT----------------------------------------------------AGGTCTTCTT------ATAGC--TGC-TGCCGGTGGACCATTAAACTCTTGTTATTTTA-T-GTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTA-C-------------------TTCTTTTA-TTAGTTGT-AGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAATTTTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCC--AGCCGCTAAA-CCCCCAATTTTT-TGTGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCTCTACGGGGAGTGTTATAGCCTATTGTATAATACCGCGCTGGGGAC-CGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Pestalotiopsis_knightiaegi GATCATTATAGAGTTTTC--TAAACTCCCAA--CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAA-GCTGCTCGGTACACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCT------GTAGC--GGC-TGCCGGTGGACTACCAAACTCTTGTTATTTTA-TTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTA-C-------------------TGCTTTTA-CTAGCTGT-AGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAATTTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCCCTACGGGGAGTGTTATAGCCCATTGTATAATACGCTGCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Pestalotiopsis_malayana GATCATTATAGAGTTTTC--TAAACTCCCAA--CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAA-GCTGCTCGGTGCACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCT------GCAAC--GGC-TGCCGGTGGACTACTAAACTCTTGTTATTTTA-TTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTA-C-------------------TGCTTTTG-CTAGCGGT-AGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAATTTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCCCCTCGGGGAGTGTTATAGCCCATTGTATAATACGCTGCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Phlogicylindrium_uniforme GATCATTACAGAGTCGTAAAAAA-CTCCCAAA-CCCATGTGAACTTACCTTT-GTTGCCTCGGCGG------ACC----------TACCC-GGT---AACTACCCTGTAGC----TACCCTGT---------------------------AACCGTCGAAGGACCATTCAACTCTTGTTATTATA-TATGAATCTGAGCGTCTTATTA-AATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTATTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAATCTA-CTAT--GAGCGGTGCTACCCTGTAGC---TACCCTGT-AGTTCCTCAAATCGAACGGCGGAGTTCTA-TTCCCTCTGAGCGCAGTAATTACTTATAACGCTATGGA-AG-TGGTAGAGTCCCC--AGCCGTAAAACACCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCTTCTGGTCCGAATTGTAATTTGTAGAGGACGATTTTGGTGCGGTACTTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGGATGCCTAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTAGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTTTTCTAGGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGGTTTTCGTAGGGAGATAAAAGCTTCAGGAACGTGACTCCT--CCGGGAGTGTTATAGCCTGTTGTATAATATCCTTATGGAGAC-CGAGGTACGCGCT-CTGCAAGGATGCTGGCATAATGGTCATCAACGACCCGTCTTG--AAACACGG-ACC Pseudopestalotiopsis_cocos GATCATTATAGAGTTTTC--TAAACTCCCAA--CCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAG-GCTACCTGGT-------------------------------------ACCTGGAGACAGGTTACCCT------GTAGC--AGC-TGCCGGTGGACTACTAAACTCTTGTTATTTTA-T-GTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCTTAGCTTAGTGTTGGGAATTTA-C-------------------AGTTAT---------GT-AATTCCTGAAATACAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAAATTATTT-CTCGCTTTTGTCAGGTGCTGCAGCTCCC--AGCCGCTAAA-CCCCCAATTTTT-TGTGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGGGGGATAAAAGCAGTAGGAATGTGGCTCCCTACGGGGAGTGTTATAGCCTGTTGTATAATACCCTGCTGGGGAC-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Robillarda_africana GATCATTATAGAGTTTTC--TAAACTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAA-CCTACCCGGTACC---TACCCTGGAACTAGCTACCCTGTAGC----TACCCAGGAACGGACTACCCT------GTAAC--GTCCTGCCGGTGGACTTCTAAACTCTTGTTATTT-A-TAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTG-C-------------------TGTAAA---------GC-AGTTCCTCAAATACAACGGCGGATCTGTAACATCCTCTGAGCGTAGTAAATTTTTATCTCGCTTTTGTCAGGTGTTGCAGCTCTC--AGCCGCTAAACCCCCCAATTTTT--GTGGTTGACCTCGGCTCAAATTTGAAATCTGGCCTTCTGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGGATGCCTAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGTCTAGTTTAGGCCAGCATCGATTTTCGGCAGCGGATAAAAGCTTCAGGAATGTGGCTCCT--CCGGGAGTGTTATAGCCTGTTGTATAATACGCCGCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Robillarda_sessilis GATCATTATAGAGTTTTC--TAAACTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAG-CCTACCCGGTACC---TACCCTGGAACTAGCTACCCTGTAGC----TACCCAGGAACGGGCTACCCT------GTAAC--GTCCTGCCGGTGGACTTCTAAACTCTTGTTATTT-A-TAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTG-C-------------------TGTATT---------GC-AGTTCCTCAAATACAACGGCGGATCTGTAACATCCTCTGAGCGTAGTAAATTTTTATCTCGCTTTTGTTAGGTGTTGCAGCTCTC--AGCCGCTAAACCCCCCAATTTTT--GTGGTTGACCTCGGCTCAAATTTGAAATCTGGCCTTCTGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGGATGCCTAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGTCTAGTTTAGGCCAGCATCGATTTTCGGCAGCGGATAAAAGCTTCAGGAATGTGGCTCCT--CCGGGAGTGTTATAGCCTGTTGTATAATACGCCGCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seimatosporium_biseptatum GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACC-GTTGTTGCCTCGGCAGAAACCTACCCGGTACC---TACCCTGTAACGACCTACCCTGTAGCGAGTTACCCGGGAACGGCCTACCCT------GTAGC--GATCTGCCGGCGGACATCTTAACTCTTGTTATTTTA-TTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGCCGTCTG-C-------------------TGTATC---------GC-AGTGGCCCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TCTTTTTCTCGCTTTTGTTAGGTGCCGCAGCTCCC--AGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTCATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGTGGGATAAAAGCTTTAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTATTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seimatosporium_botan GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAA-CCTACCCGGTACC---TTCCCTGTAACGACCTACCCTGTAGTGAGTTACCCGGGAACGGCCTACCCT------GTAGT--GCGCTGCCGGTGGACTTCTAAACTCTTGTTATTA-A-TTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGTCTA-C-------------------TGAGCAAT-CG----GT-AGTTCCCCAAATTCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCCCAATTTTA-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGAGGCGGGATAAAAGCTTCAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTGTTGTATAATACCGCCTTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seimatosporium_discosioides GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAA-CCTACCCGGTACC---TACCCTGTAACGACCTACCCTGTAGCGAGTTACCCGGGAACGGCCTACCCT------GTAGT--GCGCTGCCGGTGGACTTCTAAACTCTTGTTATTT-A-TTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTA-C-------------------CGAGCAAT-CG----GT-AGTTCCCCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAAACCCCCAATTTTTTAATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGAGGCGGGATAAAAGCTTCAGGAATGTGGCTCTT--TCGGGAGTGTTATAGCCTGTTGTATAATACCGCCTTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seimatosporium_eucalypti GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAA-CCTACCCGGTACC---TACCCTGTAACGAGCTACCCTGTAGCGAGTTGCCCGGAACCGTACTGC--G------GCGGG--CGCCTGCCGGTGGACTTCTAAACTCTTGTTATTT-A-TAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGCCGCCTA-C-------------------TATATT---------GT-AGTGGCCCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCAATCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTATTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seimatosporium_foliicola GATCATTACAGAGTTTT---TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGCGCTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGG-CTACCCT------GTAGTA-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTA-TTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGTTTA-C-------------------CCTCGG---------GT-AACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCCCAATTTTTTAATGGTTGACCCCGGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCAATCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTATTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seimatosporium_hakeae GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAA-CCTACCCGGTACC---TACCCTGTA---------------------------------------------------GC--GTTTTGCCGGTGGACATCTAAACTCTTGTTATTTAA-TAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGCCGTCTG-C-------------------TTTATT---------GC-AGTAGCCCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTTTCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCCAATTTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCCT--TCGGGAGTGTTATAACCTATTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seimatosporium_hypericinumgi GATCATTATAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAA-CCTACCCGGTACC---TACCCTGTAACGAGCTACCCTGTAGCGACTTACCCGGGAACGGCC-ACCTT------GTAGC--GTGCTGCCGGTGGACTTCTAAACTCTTGTTATTT-A-TTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGAGAATCTA-C-------------------TGTATT---------GT-AGTTCTCTAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCTC--GGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGCTTAGGCCAGCATCGATTTTCGGGGTGGGATAAAAGCTTTAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTATTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seimatosporium_mariae GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAA-CCTACCCGGTACC---TACCCTGTA---------------------------------------------------GC--GTTTTGCCGGTGGACTTCTAAACTCTTGTTATTT-A-TAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGCCGTCTG-C-------------------TGTATT---------GC-AGTGGCCCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTTTCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCCAATTTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGTGGGATAAAAGCTTCAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTGTTGCATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seimatosporium_obtusum GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAAACCTACCCGGTACC---TACCCTGTAGAG-----------------------------------------------------GTCTGCCGGTGGACTTCTAAACTCTTGTTATTT-A-TAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGCCGCCTA-C-------------------TGTATT---------GT-AGTGGCCCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCATTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGTGGGATAAAAGCTTTAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTATTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seimatosporium_parasiticum GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAA-CCTACCCGGTACC---TACCCTGTAACGACCTACCCTGTAGCGAGTTACCCGGGAACGGCCTACCCT------GTAGC--GCGCTGCCGGTGGACTTCTAAACTATTGTTATTT-A-TTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTA-C-------------------TGTATT---------GT-AGCTCCCCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTAAGGTGCCGCAGCTCTC--AGCCGCTAAACCCCCCAATTTTTTAATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGAGGCGGGATAAAAGCTTCAGGAATGTGGCTCCC--TCGGGAGTGTTATAACCTGTTGTATAATACCGCCTTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seimatosporium_pistaciae GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAA-CCTACCCGGTACC---TACCCTGTAACGACCTACCCTGTAGCGAGTTACCCGGGAACGGCCTACCCT------GTAGT--GCGCTGCCGGTGGACATCTAAACTCTTGTTATTT-A-TTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAATCTA-C-------------------TGTATT---------GT-AGTTCCCCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCTC--AGCCGCTAAACCCCCCAATTTTTTAATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTCCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTCAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTGTTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seiridium_marginatumi GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCTTT-GTTGCCTCGGCAGAA-GTTACCCTGTACC---TACCCTGTAGCGAGCTACCCTGTAGCGACCTAC-CTGGAACGGCTACCCCG----TAGCGCC--ATTCTGCCGGTGGACCACTAAACT---ATTATTTTA-TTGTACTCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAATCTA-C-------------------TGTACT---------GT-AGTTCCTCAAATCCAACGGCGGATCTGTGGTGTCCTCTGAGCGTAGTAAATTCTTATCTCGCTTTTGTCAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTTCGGATAGGGATAAAAGCTTTAGGAATGTGGCTCCC--CCGGGAGTGTTATAGCCTATTGTATAATACCTTTCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Seiridium_phylicae GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCTTT-GTTGCCTCGGCAGAA-GCTACT-TGTACC---TACC-TGGAACAGCCTACC-TGGAGCGATCCGGGCTGGCCTACCTGGAACGGGTCTGGTGGT--CGACTGCCGGTGGACCATTCAACTCTTGTTATTTTA-TTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGTCTA-C-------------------TGTATT---------GT-AGTTCCTCAAATTCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAAATCTTTATCTCGCTTTTGTCAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCCAAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTTCGGAGAGGGATAAAAGCTTTGGGAATGTGGCTCCT--CCGGGAGTGTTATAGCCCATTGTATAATACCTTTCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Strickeria_kochii GATCATTATAGAGTTTTC--TAA-CTCCCAAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAA-CCTACCCTGTACC---TACCCTGGAGCGG-CTACCCTGTAGC----TACCCCGGAGCGGGCTACCCT------GTAGC--GTTTTGCCGGCGGACCACTAAACTCTTGTTATTT-A-TTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCACTAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAACTTA-C-------------------TCTCCT---------GT-AATTCCTCAAATTCAACGGCGGATCTGTGGTGTCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCTC--GGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCACTTGTGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTCTGGTTTAGGCCAGCATCGATTTTTGGGGCTGGATAAAAGCTTTGGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCCATTGTATAATACAGCTTCGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Synnemapestaloides_rhododendri_MAFF239201 GATCATTACAGAGTTTT---TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGG-CTACCCT------GTAGT--GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTA-TTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTA-C-------------------CCTCGG---------GT-AACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTTGTTTAGTTTAGGCCAGCATCGATTTTCGGGGTGGGATAAAAGCTTTAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTATTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTGG-AAAACACGGGACC Synnemapestaloides_rhododendri_MAFF243052 GATCATTACAGAGTTTT---TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGG-CTACCCT------GTAGT--GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTA-TTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTA-C-------------------CCTCGG---------GT-AACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTTGTTTAGTTTAGGCCAGCATCGATTTTCGGGGTGGGATAAAAGCTTTAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTATTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTGG-AAAACACGG-ACA Synnemapestaloides_rhododendri_MAFF245156 GATCATTACAGAGTTTT---TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGG-CTACCCT------GTAGT--GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTA-TTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTA-C-------------------CCTCGG---------GT-AACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTTGTTTAGTTTAGGCCAGCATCGATTTTCGGGGTGGGATAAAAGCTTTAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTATTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTG--AAAACACGG-ACC Synnemapestaloides_rhododendri_MAFF245157 GATCATTACAGAGTTTT---TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGG-CTACCCT------GTAGT--GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTA-TTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTA-C-------------------CCTCGG---------GT-AACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTTGTTTAGTTTAGGCCAGCATCGATTTTCGGGGTGGGATAAAAGCTTTAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTATTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTGGAAAAACACGG-ACC Synnemapestaloides_rhododendri_MAFF245158 GATCATTACAGAGTTTT---TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGG-CTACCCT------GTAGT--GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTA-TTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTA-C-------------------CCTCGG---------GT-AACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCC-AATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTTGTTTAGTTTAGGCCAGCATCGATTTTCGGGGTGGGATAAAAGCTTTAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTATTGTATAATACCGCCCTGGGGAT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG-AAAACACGGGACC Synnemapestaloides_rhododendri_TAMA492 GATCATTACAGAGTTTT---TAA-CTCCCAAA-CCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGG-CTACCCT------GTAGT--GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTA-TTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTA-C-------------------CCTCGG---------GT-AACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAA-TTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCC--AGCCGCTAAACCCCC-AATTTTT-AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTTGTTTAGTTTAGGCCAGCATCGATTTTCGGGGTGGGATAAAAGCTTTAGGAATGTGGCTCCC--TCGGGAGTGTTATAGCCTATTGTATAATACCGCCCTGGGGATTCGAGGTACGCACTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Truncatella_hartigii GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCTTTTGTTGCCTCGGTAGT--------------GC-CTACCCTGTAGCGAG---------------TTACCCTGTAACGACCTACCCT------GTAGC--GC-CTGCCGATGGACCATTAAACTCTTGTTATTTTT-AAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGTCGA-C-------------------TGTACT---------GT-CGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATCTT-TATCTCGTTTTTG--AAATACTATAAACCTC--AGCCGCTAAACCCCCCAATTTT--AATGGTTGACCTCGGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGATTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTCTTTCTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTCAGGAATGTAGCTCCCCTCGGGGAGTGTTATAGCCTGTTGTATAATACGCTGCTGGGGGT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC Zetiasplozna_acaciae GATCATTACAGAGTTATC--TAA-CTCCCAAA-CCCATGTGAACTTACCTTT-GTTGCCTCGGCAGT------TTGGGCGAGC-CTACCCTGTAGCGAGTTACCCTGTAACGAGTTACCCTGTAGCTGCTTACCCT------GTAAC--GG-CTGCCGACGGACTACTAAACTCTTGTTATTTTTTAAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTGA-C-------------------TTTACT---------GT-CACTCTTCAAATTCAACGGCGGATTTATAGCAATCTCTGAACGTAGTAATCTC-TATCTCGTTTTTG--AAATACTGTAAACCTC--AGCCGCTAAACCCCCAAATTTTTTAATGGTTGACCTCGGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTAGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGG-TGAGAGCCCCGTACGATTGGATGCCGAGCTTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTCAGTTTAGGCCAGCATCGACTTTCAGCGGCGGATAAAAGCTTTAGGAATGTGGCTTCCCTCGGGAAGTGTTATAGCCTACTGTATAATACGCTGCTGGGGGT-CGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTG--AAACACGG-ACC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M37519] TITLE Synnemapestaloides_35x519; LINK TAXA = Taxa2; DIMENSIONS NCHAR=519; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Discosia_artocreas_AB593705 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGTAGGGTATTATACAATAGGCTATAACACTCCCG--GAGGAGCCACATTCCTAAAGCTTTTATCCCCCACCGAAAATCGATGCTGGCCTAAACTGAGCGAAGTGCACCGGTGAGAACACCGGATGATCCGCCCAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAACTCGGACCCAAGGGCCAGATTTCAAATTTGAG Discosia_artocreas_AB593711 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGTAGGGTATTATACAATAGGCTATAACACTCCCG--GAGGAGCCACATTCCTAAAGCTTTTATCCCCCACCGAAAATCGATGCTGGCCTAAACTGAGCGAAGTGCACCGGTGAGAACACCGGATGATCCGCCCAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGTAGTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAACTCGGACCCAAGGGCCAGATTTCAAATTTGAG Discosia_artocreas_AB593720 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGTAGGGTATTATACAATAGGCTATAACACTCCCG--GAGGAGCCACATTCCTAAAGCTTTTATCCCCCACCGAAAATCGATGCTGGCCTAAACTGAGCGAAGTGCACCGGTGAGAACACCGGATGATCCGCCCAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGTAGTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAACTCGGACCCAAGGGCCAGATTTCAAATTTGAG Discosia_brasiliensis_AB593707 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGTAGGGTATTATACAATAGGCTATAACACTCCCG--GAGGAGCCACATTCCTAAAGCTTTTATCCCCCACCGAAAATCGATGCTGGCCTAAACTGAGCGAAGTGCACCGGTGAGAACACCGGATGATCCGCCCAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAACTCGGACCCAAGGGCCAGATTTCAAATTTGAG Discosia_pini_AB593708 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGTAGGGTATTATACAATAGGCTATAACACTCCCG--GAGGAGCCACATTCCTAAAGCTTTTATCCCCCACCGAAAATCGATGCTGGCCTAAACTGAGCGAAGTGCACCGGTGAGAACACCGGATGATCCGCCCAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAACTCGGACCCAAGGGCCAGATTTCAAATTTGAG Discosia_pleurochaeta_AB593709 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGTAGGGTATTATACAATAGGCTATAACACTCCCG--GAGGAGCCACATTCCTAAAGCTTTTATCCCCCACCGAAAATCGATGCTGGCCTAAACTAAGCGAAGTGCACCGGTGAGAACACCGGGTGATCCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGTAGTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Discosia_pleurochaeta_AB593713 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGTAGGGTATTATACAATAGGCTATAACACTCCCG--GAGGAGCCACATTCCTAAAGCTTTTATCCCCCACCGAAAATCGATGCTGGCCTAAACTAAGCGAAGTGCACCGGTGAGAACACCGGATGATCCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGTAGTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Discosia_tricellulare_AB593728 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGTAGGGTATTATACAATAGGCTATAACACTCCCG--GAGGAGCCACATTCCTAAGGCTTTTATCCCCCACCGAAAATCGATGCTGGCCTAAACTAGGCGAAGTGCACCGGTGAGAACACCGGATGATCCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGTAGTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAACTCGGACCCAAGGGCCAGATTTCAAATTTGAG Discosia_yakushimense_AB593721 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGTAGGGTATTATACAATAGGCTATAACACTCCCG--GAGGAGCCACATTCCTAAAGCTTTTATCCCCCACCGAAAATCGATGCTGGCCTAAACTAGGCGAAGTGCACCGGTGAGAACACCGGATGATCCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGTAGTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Discostroma_fuscellum_AB593739 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGGTTATAACACTCCCG--AGGGAGCTACATTCCTAAAGCTTTTATCCCGCCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Discostroma_stoneae_AB593729 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAACAGGCTATAACACTCCCG--AAGGAGCCACATTCCTGAAGCTTTTATCCCGCCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACACAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCGAAGGCCAGATTTCAAATTTGAG Discostroma_tostum_AB593727 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAACAGGCTATAACACTCCCG--AGGGAGCCACATTCCTGAAGCTTTTATCCCGCCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCAATACAAATTACAATTGGGATCCAAGGGCCAGATTTCAAATTTGAG Pestalotiopsis_sp._FJ1402 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGAACCTCGG-TCCCCAGCGCGGTATTATACAATAGGCTATAACACTCCCCGTAGAGAGCCACATTCCTACTGCTTTTATCCCACGCCGAAAACCGATGCTGGCCTTTACTGGGCGAAGTGCACCGGAGAGAACCCCGGATGATCCGCCCAGAAAAAGTCTGGTCACAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAATATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGATTTACAGAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAATCATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Pestalotiopsis_sp._LC047750 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGCAGCGTATTATACAATGGGCTATAACACTCCCCGTAGGGAGCCACATTCCCACTGCTTTTATCCGCCGCCGAAAATCGATGCTGGCCTTTACTGGGCAAAGTGCACCGGAGAGAACCCCGGATGATCCGCCCAGAAAAAGTCTGGTCACAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAATATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGATTTACAGAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAATCATCCTCTACAAATTACAATTCGGACCCGAGGGCCAGATTTCAAATTTGAG Sarcostroma_restionis_DQ278925 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGTTTATAACACTCCCG--AAGGAGCCACATTCCTAAAGCTTTTATCCCGCCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Seimatosporium_biseptatum_JN871208 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGGCTATAACACTCCCG--AGGGAGCCACATTCCTAAAGCTTTTATCCCACCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATGAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCGAGGGCCAGATTTCAAATTTGAG Seimatosporium_botan_AB593731 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAAGGCGGTATTATACAACAGGCTATAACACTCCCG--AGGGAGCCACATTCCTGAAGCTTTTATCCCGCCTCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Seimatosporium_discosioides_AB593732 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAAGGCGGTATTATACAACAGGCTATAACACTCCCG--AAAGAGCCACATTCCTGAAGCTTTTATCCCGCCTCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Seimatosporium_elegans_AB593733 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAACAGGCTATAACACTCCCG--AGGGAGCCACATTCCTGAAGCTTTTATCCCGCCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCGAGGGCCAGATTTCAAATTTGAG Seimatosporium_eucalypti_JN871212 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGGCTATAACACTCCCG--AGGGAGCCACATTCCTAAAGCTTTTATCCCGCCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGATTGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCGAGGGCCAGATTTCAAATTTGAG Seimatosporium_foliicola_AB593734 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGGCTATAACACTCCCG--AGGGAGCCACATTCCTAAAGCTTTTATCCCGCCCCGAAAATCGATGCTGGCCTAGACTAGACAAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATGAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Seimatosporium_hakeae_AB593736 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGGTTATAACACTCCCG--AAGGAGCCACATTCCTAAAGCTTTTATCCCGCCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Seimatosporium_kriegerianum_AB593738 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAACAGGCTATAACACTCCCG--AGGGAGCCACATTCCTGAAGCTTTTATCCCGCCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACACAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCGAAGGCCAGATTTCAAATTTGAG Seimatosporium_mariae_AB593740 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGGTTATAACACTCCCG--AGGGAGCCACATTCCTAAAGCTTTTATCCCGCCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Seimatosporium_obtusum_JN871215 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGGCTATAACACTCCCG--AGGGAGCCACATTCCTAAAGCTTTTATCCCACCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAATGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCGAGGGCCAGATTTCAAATTTGAG Seimatosporium_parasiticum_AB593741 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAAGGCGGTATTATACAACAGGTTATAACACTCCCG--AGGGAGCCACATTCCTGAAGCTTTTATCCCGCCTCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Seimatosporium_pistaciae_KP004491 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAACAGGCTATAACACTCCCG--AGGGAGCCACATTCCTGAAGCTTTTATCCCGCCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGGAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Seimatosporium_sp._LC047752 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATGCAATAGGCTATAACACTCCCG--AGGGAGCCACATTCCTAAAGCTTTTATCCCGCCCCGAAAATCGATGCTGGCCTAAACTAAACGAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCCAAAACATCCTCTACAAATTACAATTCGGACCCGAGGGCCAGATTTCAAATTTGAG Synnemapestaloides_rhododendri_MAFF239201 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGGCTATAACACTCCCG--AGGGAGCCACATTCCTAAAGCTTTTATCCCACCCCGAAAATCGATGCTGGCCTAAACTAAACAAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Synnemapestaloides_rhododendri_MAFF243052 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGGCTATAACACTCCCG--AGGGAGCCACATTCCTAAAGCTTTTATCCCACCCCGAAAATCGATGCTGGCCTAAACTAAACAAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Synnemapestaloides_rhododendri_MAFF245156 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGGCTATAACACTCCCG--AGGGAGCCACATTCCTAAAGCTTTTATCCCACCCCGAAAATCGATGCTGGCCTAAACTAAACAAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Synnemapestaloides_rhododendri_MAFF245157 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGGCTATAACACTCCCG--AGGGAGCCACATTCCTAAAGCTTTTATCCCACCCCGAAAATCGATGCTGGCCTAAACTAAACAAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Synnemapestaloides_rhododendri_MAFF245158 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-TCCCCAGGGCGGTATTATACAATAGGCTATAACACTCCCG--AGGGAGCCACATTCCTAAAGCTTTTATCCCACCCCGAAAATCGATGCTGGCCTAAACTAAACAAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Synnemapestaloides_rhododendri_TAMA492 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGTGCGTACCTCGAATCCCCAGGGCGGTATTATACAATAGGCTATAACACTCCCG--AGGGAGCCACATTCCTAAAGCTTTTATCCCACCCCGAAAATCGATGCTGGCCTAAACTAAACAAAGTGCACCGGTGAGAACACCGGATGATTCGCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGTTTTACAAAGGCTAGGCATTCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGATACCGCACCAAAAACATCCTCTACAAATTACAATTCGGACCCAAGGGCCAGATTTCAAATTTGAG Truncatella_angustata_AF382383 GTGATTGATAACCATTACGCCAGCATCCTTGCAGAAGCGCGTACCTCGA-CCCCCAGCAGTGTATTATACAATAGGCTATAACACTCCCCGAAAGGAGCCACATTCCCAAAGCTTTTATCCACCGCCGAAAGTCGATGCTGGCCTAGACTAGAAGAAGTGCACCGGTGAGAACACCGGATGATCCTCCTAGAAAAAGTCTGGTCATAAATCCTTCCCTTTCAACAATTTACCGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGATTTACAAAGGCTCGGCATCCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCTGTTCCAAGGAACTCGGAAGGTACCTAACCAAAATCATCCTCTGCAAATTACAACTCGGACCCAAGCGCCAGATTTCAAATTTGAG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M37520] TITLE Synnemapestaloides_rhododendri_ITS_BT_12x1004; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1004; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Discosia_artocreas_NBRC8975 GATCATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACCATTTGTTGCCTCGGCAGAGC-CTACC---CGGTAACTGTT-CGGAGAAGC-TACCCTGTAGC----TACCCTGTAACGGCCTACCCTGTAAC-GCACTGCCGGTGGACTTTTAAACTCTTGTTATTTTATAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTAC----TGTATTGTAGTTCCTGAAATACAACGGCGGATCTGTAATATCCTCTGAGCGTAGTAATTTTTTTCTCGCTTTGGTTAGGTGTTGCAGCTCTCAGCCGCTAAACCCCCCAATTTT--AATGGTTGACCTCGGCGATCTGGCTCTAGAGGAACATTAGCTGACCATGGCCCTTCTTCATCTCAACAGGTTCACCTTCA-----------GACCGGTCAG----------------------------------TGCGGTAACCAGATTGGTGCTGCTTTCT-----GGCAGACCATCTCCGGCGAGCACGGTCTCGACAGCAATGGTGT------------------------------------------------------------------CTACAATGGCACCTCGGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCCCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCCTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGTGCTGGAAACAACTGGGCCAAGGGT Seimatosporium_botan_NBRC104200 GATCATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAAC-CTACC---CGGTACCTTCCCTGTAACGACCTACCCTGTAGTGAGTTACCCGGGAACGGCCTACCCTGTAGT-GCGCTGCCGGTGGACTTCTAAACTCTTGTTATTA-ATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGTCTACTGAGCAATCGGTAGTTCCCCAAATTCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTA-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGTTACCACCGATTAT-GCACGAGTCCAGATCGAAAGATTTTCCGCCG----TCGAAAGAATACCTCAAAAACA------------------ATAATGGGAAATACAAACATCGGAATACTGACGGATTTACCACAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAACGGTGTGTACGTAAAAAATCTCTCCCATCAATTATTCG-GGTAAGAACCAGGCTGACTGTGCTG-TTTGCAGCTACAATGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGCGTCCGGTAACAAGTACGTCCCGCGTGCCGTCCTCGTCGATCTCGAGCCTGGTACCATGGACGCCGTCCGTGCTGGTCCTTTCGGTCAACTCTTCCGTCCCGACAACTTCGTCTTCGGTCAATCCGGTGCTGGAAACAACTGGGCCAAGGGT Seimatosporium_discosioides_NBRC104201 GATCATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAAC-CTACC---CGGTACCTACCCTGTAACGACCTACCCTGTAGCGAGTTACCCGGGAACGGCCTACCCTGTAGT-GCGCTGCCGGTGGACTTCTAAACTCTTGTTATTT-ATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACCGAGCAATCGGTAGTTCCCCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAAACCCCCAATTTTTTAATGGTTGACCTCGGTG--CTGCTTTTTGGTATGTCACTACCCATCTC-GCACGAGTCCAAGCCAAAAAAAAAACCGTCGACGATCGAAAGGACGCCTCCGACACA------------------GCAATGACATACACGAACATGGAAATACTGACGGCTTCTCACTAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAACGGTGTGTACGTACAAAAGCTCTACATTCAATGATTGGAGGCAGGGACCAGGCTGACTGTGATG-TTTGCAGTTACAATGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCGTCCGGTAACAAGTACGTTCCTCGTGCCGTCCTCGTCAATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGTCCCTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTCTTCGGTCAGTCTGGTGCCGGAAACAACTGGGCCAAGGGT Seimatosporium_foliicola_AB593734 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGCGCTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGTAGTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGTTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTTTAATGGTTGACCCCGGT---CTGCTTTCTGGTATGT----GCCCACCGT-CCACG-----------ACACCTTCTTCGCGA-----CGAAACGACGAGCTCGGACGA-----------------CACAATTCAAGACGTGGGAAACAAGATGCTAACGGTTCTTGCATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAACGTCCCATCGACCAGATAGTAGGTTGAAACATCAGGCTGACTGTGTACCTCTGCAGCTACAACGGTACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCTGGTAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTTTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF239201 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCATATT--CACGACTCGAAAGCGACAGCCCCTTCACGA-----CGAAACGACGAGCTCGGACGA------------------ATGATCCAAGACGGGGGAAACAAGATGCTAACAGTTCTTGTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATCTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF243052 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCACATT--CACGACTCGAAAGCGACAGCCTCTTCGCGA-----CGAAACGACGAGCTCGGACGAATGATCCAAGTCGGACGAATGATCCAAGACGGGGGAAACAAGATGCTAATAGTTCTTCTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATGTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF243053 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTATAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCACATT--CACGACTCGAAAGCGACAGCCTCTTCGCGA-----CGAAACGACGAGCTCGGACGAATGATCCAAGTCGGACGAATGATCCAAGACGGGGGAAACAAGATGCTAATAGTTCTTCTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATGTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF243054 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCACATT--CACGACTCGAAAGCGACAGCCTCTTCGCGA-----CGAAACGACGAGCTCGGACGAATGATCCAAGTCGGACGAATGATCCAAGACGGGGGAAACAAGATGCTAATAGTTCTTCTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATGTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF245058 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCC-AATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCACATT--CACGACTCGAAAGCGACAGCCTCTTCGCGA-----CGAAACGACGAGCTCGGACGA------------------ATGATCCGAGACGGGGGAAACAAGATGCTAATAGTTCTTCTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGCACAATGTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF245156 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCATATT--CACGACTCGAAAGCGACAGCCCCTTCACGA-----CGAAACGACGAGCTCGGACGA------------------ATGATCCAAGACGGGGGAAACAAGATGCTAACAGTTCTTGTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATCTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF245157 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCATATT--CACGACTCGAAAGCGACAGCCCCTTCACGA-----CGAAACGACGAGCTCGGACGA------------------ATGATCCAAGACGGGGGAAACAAGATGCTAACAGTTCTTGTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATCTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_TAMA492 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCC-AATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCACATT--CACGACTCGAAAGCGACAGCCCCTTCACGA-----CGAAACGACGAGCTCGGACGA------------------ATGATCCAAGACGGGGGAAACAAGATGCTAACAGTTCTTGTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATCTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M39411] TITLE Synnemapestaloides_NJ_MP_ML_12x1004; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1004; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Discosia_artocreas_NBRC8975 GATCATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACCATTTGTTGCCTCGGCAGAGC-CTACC---CGGTAACTGTT-CGGAGAAGC-TACCCTGTAGC----TACCCTGTAACGGCCTACCCTGTAAC-GCACTGCCGGTGGACTTTTAAACTCTTGTTATTTTATAGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTAC----TGTATTGTAGTTCCTGAAATACAACGGCGGATCTGTAATATCCTCTGAGCGTAGTAATTTTTTTCTCGCTTTGGTTAGGTGTTGCAGCTCTCAGCCGCTAAACCCCCCAATTTT--AATGGTTGACCTCGGCGATCTGGCTCTAGAGGAACATTAGCTGACCATGGCCCTTCTTCATCTCAACAGGTTCACCTTCA-----------GACCGGTCAG----------------------------------TGCGGTAACCAGATTGGTGCTGCTTTCT-----GGCAGACCATCTCCGGCGAGCACGGTCTCGACAGCAATGGTGT------------------------------------------------------------------CTACAATGGCACCTCGGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCCCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCCTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAATCCGGTGCTGGAAACAACTGGGCCAAGGGT Seimatosporium_botan_NBRC104200 GATCATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAAC-CTACC---CGGTACCTTCCCTGTAACGACCTACCCTGTAGTGAGTTACCCGGGAACGGCCTACCCTGTAGT-GCGCTGCCGGTGGACTTCTAAACTCTTGTTATTA-ATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGTCTACTGAGCAATCGGTAGTTCCCCAAATTCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTA-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGTTACCACCGATTAT-GCACGAGTCCAGATCGAAAGATTTTCCGCCG----TCGAAAGAATACCTCAAAAACA------------------ATAATGGGAAATACAAACATCGGAATACTGACGGATTTACCACAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAACGGTGTGTACGTAAAAAATCTCTCCCATCAATTATTCG-GGTAAGAACCAGGCTGACTGTGCTG-TTTGCAGCTACAATGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTTTACTTCAACGAGGCGTCCGGTAACAAGTACGTCCCGCGTGCCGTCCTCGTCGATCTCGAGCCTGGTACCATGGACGCCGTCCGTGCTGGTCCTTTCGGTCAACTCTTCCGTCCCGACAACTTCGTCTTCGGTCAATCCGGTGCTGGAAACAACTGGGCCAAGGGT Seimatosporium_discosioides_NBRC104201 GATCATTACAGAGTTATCTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAAC-CTACC---CGGTACCTACCCTGTAACGACCTACCCTGTAGCGAGTTACCCGGGAACGGCCTACCCTGTAGT-GCGCTGCCGGTGGACTTCTAAACTCTTGTTATTT-ATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACCGAGCAATCGGTAGTTCCCCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAAACCCCCAATTTTTTAATGGTTGACCTCGGTG--CTGCTTTTTGGTATGTCACTACCCATCTC-GCACGAGTCCAAGCCAAAAAAAAAACCGTCGACGATCGAAAGGACGCCTCCGACACA------------------GCAATGACATACACGAACATGGAAATACTGACGGCTTCTCACTAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAACGGTGTGTACGTACAAAAGCTCTACATTCAATGATTGGAGGCAGGGACCAGGCTGACTGTGATG-TTTGCAGTTACAATGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCGTCCGGTAACAAGTACGTTCCTCGTGCCGTCCTCGTCAATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGTCCCTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTCTTCGGTCAGTCTGGTGCCGGAAACAACTGGGCCAAGGGT Seimatosporium_foliicola_AB593734 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGCGCTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGTAGTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGTTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTTTAATGGTTGACCCCGGT---CTGCTTTCTGGTATGT----GCCCACCGT-CCACG-----------ACACCTTCTTCGCGA-----CGAAACGACGAGCTCGGACGA-----------------CACAATTCAAGACGTGGGAAACAAGATGCTAACGGTTCTTGCATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAACGTCCCATCGACCAGATAGTAGGTTGAAACATCAGGCTGACTGTGTACCTCTGCAGCTACAACGGTACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCTGGTAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTTTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF239201 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCATATT--CACGACTCGAAAGCGACAGCCCCTTCACGA-----CGAAACGACGAGCTCGGACGA------------------ATGATCCAAGACGGGGGAAACAAGATGCTAACAGTTCTTGTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATCTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCTGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF243052 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCACATT--CACGACTCGAAAGCGACAGCCTCTTCGCGA-----CGAAACGACGAGCTCGGACGAATGATCCAAGTCGGACGAATGATCCAAGACGGGGGAAACAAGATGCTAATAGTTCTTCTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATGTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF243053 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTATAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCACATT--CACGACTCGAAAGCGACAGCCTCTTCGCGA-----CGAAACGACGAGCTCGGACGAATGATCCAAGTCGGACGAATGATCCAAGACGGGGGAAACAAGATGCTAATAGTTCTTCTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATGTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF243054 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCACATT--CACGACTCGAAAGCGACAGCCTCTTCGCGA-----CGAAACGACGAGCTCGGACGAATGATCCAAGTCGGACGAATGATCCAAGACGGGGGAAACAAGATGCTAATAGTTCTTCTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATGTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF245058 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCC-AATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCACATT--CACGACTCGAAAGCGACAGCCTCTTCGCGA-----CGAAACGACGAGCTCGGACGA------------------ATGATCCGAGACGGGGGAAACAAGATGCTAATAGTTCTTCTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGCACAATGTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF245156 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCATATT--CACGACTCGAAAGCGACAGCCCCTTCACGA-----CGAAACGACGAGCTCGGACGA------------------ATGATCCAAGACGGGGGAAACAAGATGCTAACAGTTCTTGTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATCTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_MAFF245157 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCATATT--CACGACTCGAAAGCGACAGCCCCTTCACGA-----CGAAACGACGAGCTCGGACGA------------------ATGATCCAAGACGGGGGAAACAAGATGCTAACAGTTCTTGTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATCTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT Synnemapestaloides_rhododendri_TAMA492 GATCATTACAGAGTT-TTTAACTCCCAAACCCATGTGAACTTACCATT-GTTGCCTCGGCAGAGC-CTACCCTGCAGCAGTTACCCTGTAGCGACCTACCCGGTAGC----TACCCTGTAACGGC-TACCCTGTAGT-GTTTTGCCGGTGGACTTCTAAACTATTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTATTGGGAGCTTAC----CCTCGGGTAACTCCTCAAATCCAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAATTTTTATCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAACCCCC-AATTTTT-AATGGTTGACCTCGGTG--CTGCTTTCTGGTATGT----ACCCACATT--CACGACTCGAAAGCGACAGCCCCTTCACGA-----CGAAACGACGAGCTCGGACGA------------------ATGATCCAAGACGGGGGAAACAAGATGCTAACAGTTCTTGTATAGGCAAACTATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACAATCTCCCATCAGCCAAGTTTTAG-ATTGAACGTCAGACTGACTCTGCTCCTTTGTAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCCTCTGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGT ; END; BEGIN TREES; TITLE Synnemapestaloides_NJ_MP_ML_12x1004; LINK TAXA = Taxa1; TRANSLATE 1 Discosia_artocreas_NBRC8975, 2 Seimatosporium_botan_NBRC104200, 3 Seimatosporium_discosioides_NBRC104201, 4 Seimatosporium_foliicola_AB593734, 5 Synnemapestaloides_rhododendri_MAFF239201, 6 Synnemapestaloides_rhododendri_MAFF245058, 7 Synnemapestaloides_rhododendri_MAFF245156, 8 Synnemapestaloides_rhododendri_MAFF245157, 9 Synnemapestaloides_rhododendri_MAFF243052, 10 Synnemapestaloides_rhododendri_MAFF243053, 11 Synnemapestaloides_rhododendri_MAFF243054, 12 Synnemapestaloides_rhododendri_TAMA492; TREE NJ = [&R] (1:0.04196601,((2:0.02799079,3:0.02231988)0.9970:0.02130019,(4:0.00852766,((12:7.572E-5,(5:0.00114283,(7:0.0,8:0.0)0.5930:4.061E-5)0.6750:0.00110912)0.9080:0.00227193,(6:-5.316E-5,(11:-1.071E-5,(9:-1.071E-5,10:0.00119414)0.3770:1.071E-5)0.7640:0.00123396)0.9740:0.00127719)0.9960:0.00716322)1.0000:0.04732037):0.04196601); TREE MP = [&R] (1,((2,3)0.9720,(4,((12,(7,(5,8)0.4630)0.7540)0.9250,(6,(9,(10,11)0.4600)0.7980))0.8300)0.9980)1.0000); TREE ML = [&R] (1:0.067982905,((2:0.03213179,3:0.02509346)0.9060:0.03574295,(4:0.00658939,((12:0.0,(7:0.0,(5:0.00117548,8:0.0)0.2900:0.0)0.6540:0.00117548)0.8520:0.0024156,(6:0.0,(10:0.00117545,(9:0.0,11:0.0)0.2660:4.6E-7)0.6540:0.00117545)0.7680:0.00112918)0.9480:0.00965434)1.0000:0.06601442):0.067982905); END; BEGIN TREES; TITLE Synnemapestaloides_ITS_LSU_NJ_MP_ML_45x1117; LINK TAXA = Taxa3; TRANSLATE 1 Bartalinia_laurina, 2 Bartalinia_pondoensis, 3 Bartalinia_robillardoides, 4 Broomella_vitalbae, 5 Discosia_artocreas, 6 Discostroma_tostum, 7 Hymenopleella_hippophaeicola, 8 Immersidiscosia_eucalypti, 9 Monochaetia_kansensis, 10 Neoestalotiopsis_protearum, 11 Neopestalotiopsis_rosae, 12 Pestalotiopsis_knightiaegi, 13 Pestalotiopsis_malayana, 14 Pseudopestalotiopsis_cocos, 15 Robillarda_africana, 16 Robillarda_sessilis, 17 Seimatosporium_biseptatum, 18 Seimatosporium_hakeae, 19 Seimatosporium_obtusum, 20 Seimatosporium_pistaciae, 21 Seimatosporium_botan, 22 Seimatosporium_discosioides, 23 Seimatosporium_eucalypti, 24 Seimatosporium_foliicola, 25 Seimatosporium_hypericinumgi, 26 Seimatosporium_mariae, 27 Seimatosporium_parasiticum, 28 Seiridium_marginatumi, 29 Seiridium_phylicae, 30 Strickeria_kochii, 31 Synnemapestaloides_rhododendri_MAFF239201, 32 Synnemapestaloides_rhododendri_MAFF243052, 33 Synnemapestaloides_rhododendri_MAFF245156, 34 Synnemapestaloides_rhododendri_MAFF245157, 35 Synnemapestaloides_rhododendri_MAFF245158, 36 Synnemapestaloides_rhododendri_TAMA492, 37 Truncatella_hartigii, 38 Zetiasplozna_acaciae, 39 Discosia_yakushimense, 40 Discosia_tricellulare, 41 Discosia_aff._pleurochaeta, 42 Discosia_pini, 43 Phlogicylindrium_uniforme, 44 Lepteutypa_fuckelii, 45 Lepteutypa_sambuci; TREE NJ = [&R] ((43:0.04398033,(44:0.01314727,45:0.02368787)1.0000:0.02143249)1.0000:0.010663975,((4:0.01893438,((7:0.0078501,37:0.01034124)0.6550:0.0020779,(38:0.01695004,(1:1.7285E-4,(2:0.0,3:0.0)0.9010:0.00193769)0.9450:0.00457307)0.4710:9.8891E-4)0.8370:0.00471813)1.0000:0.02896656,((15:0.0,16:0.0)1.0000:0.01617184,(((12:0.00109704,13:0.0)1.0000:0.01675897,(14:0.0069197,(10:0.0,11:0.0)1.0000:0.01127163)0.5540:0.00163306)0.9940:0.01493111,((9:0.01428415,(28:0.00595569,29:0.00788834)0.8850:0.00294775)0.6740:0.00407641,((8:0.01738436,((5:0.0,42:0.0)1.0000:0.00356793,(41:0.0014788,(39:1.9694E-4,40:0.00403225)0.6350:6.41E-4)0.9870:0.00441544)0.9880:0.00719289)0.1970:0.00205901,(30:0.02562509,((24:0.00485367,(35:0.0,(36:0.00105688,(34:0.0,(31:0.0,(32:0.00105557,33:0.0)0.2220:1.0E-6)0.2060:1.0E-6)0.6520:0.00105369)0.6110:1.5E-5)1.0000:0.00256487)0.9470:0.00482937,(((19:0.00237636,23:0.00291103)0.9170:0.00209679,(18:0.00446573,(17:0.00896694,26:0.00379951)0.5000:8.579E-4)0.8850:0.00486873)0.6920:0.00289946,(25:0.00829082,(20:0.00408,((6:0.00556667,27:0.00291562)0.6840:0.00184665,(21:0.00234096,22:0.00295093)0.8400:0.00244224)0.4970:6.9635E-4)0.7240:0.00244135)0.4860:0.00204843)0.5650:0.00243953)0.9230:0.00544324)0.7550:0.00547389)0.0390:2.8586E-4)0.1730:0.00240381)0.3690:0.0018182)0.3510:0.001702):0.010663975); TREE MP = [&R] ((43:37.51470588,(44:14.08333333,45:20.58333333)0.9980:26.00980392):12.06617647,(((15:0.0,16:0.0)1.0000:14.34313725,(4:15.93137255,(37:9.39215686,(7:5.78186275,(38:16.4754902,(1:1.5,(2:0.0,3:0.0)0.6760:0.5)0.8950:4.20833333)0.6260:5.36764706)0.4450:2.83333333)0.8200:8.12009804)1.0000:27.93137255)0.5530:6.24754902,(((8:14.66176471,((5:0.0,42:0.0)0.9960:2.66176471,(39:0.0,(40:4.0,41:2.0)0.2080:0.0)0.9510:6.33823529)0.9630:8.0)0.2720:6.29411765,((9:13.5,(28:5.0,29:8.0)0.7770:2.5)0.3590:1.5,((12:1.0,13:0.0)1.0000:15.0,(14:4.0,(10:0.0,11:0.0)1.0000:13.0)0.8170:2.0)0.9970:17.0)0.3720:3.89705882)0.2440:3.38235294,(30:25.55147059,((20:2.0,((6:6.0,27:2.0)0.7870:3.5,(21:2.5,22:2.5)0.6700:2.0)0.6920:2.5)0.7990:3.28186275,(25:7.33333333,(((19:2.0,23:3.0)0.9230:2.83333333,(26:4.0,(17:7.0,18:5.0)0.7450:1.0)0.9290:4.16666667)0.8870:4.5,(24:4.5,((35:0.0,36:1.0)0.7990:0.0,(34:0.0,(31:0.0,(32:1.0,33:0.0)0.1520:0.0)0.3050:0.0)0.9190:1.0)0.9740:2.5)0.9600:6.83333333)0.5360:3.33333333)0.0760:1.05147059)0.8290:7.16666667)0.7430:6.55147059)0.3790:6.70588235)1.0000:12.06617647); TREE ML = [&R] ((43:0.06698581,(44:0.01168605,45:0.03273641)1.0000:0.04070528)1.0000:0.019591945,((4:0.02301719,((7:0.00822303,37:0.01293028)0.6510:3.299E-4,(38:0.02169871,(1:0.00154258,(2:0.0,3:0.0)0.9210:7.477E-4)0.9640:0.00412577)0.4180:0.00640365)0.8080:0.00845394)1.0000:0.04876018,((15:0.0,16:0.0)1.0000:0.02087355,(((12:0.00112021,13:0.0)1.0000:0.02003461,(14:0.00470438,(10:0.0,11:0.0)1.0000:0.015859)0.5290:6.9694E-4)0.9970:0.02247437,((8:0.01986216,((5:0.0,42:0.0)1.0000:0.0013646,(41:0.00138497,(39:0.0,40:0.00460539)0.6280:8.9982E-4)0.9700:0.00822086)0.9850:0.01070291)0.2620:0.00975394,((9:0.01705422,(28:0.00567017,29:0.01006244)0.8860:0.00267453)0.6620:1.0E-7,(30:0.03305115,((24:0.00580933,(36:0.00113264,(35:0.0,(31:0.0,(33:0.0,(32:0.00113384,34:0.0)0.1560:0.0)0.1230:0.0)0.6560:0.00113403)0.2910:0.0)1.0000:0.00233542)0.9570:0.00779389,(((19:0.00182678,23:0.00391538)0.9120:0.00465868,(26:0.00409726,(17:0.00842698,18:0.00571086)0.4640:0.00168002)0.8580:0.00356442)0.6630:0.00695767,(25:0.00936603,(20:0.0043384,((6:0.00809405,27:0.00118626)0.6680:0.00426688,(21:0.0024867,22:0.00327199)0.8130:5.3708E-4)0.5210:0.00303647)0.7150:0.00444598)0.5150:0.0)0.5150:0.00338765)0.9430:0.01051433)0.7610:0.01352063)0.1300:0.0058043)0.1950:0.0)0.4080:0.01313174)0.4640:0.0):0.019591945); END; BEGIN TREES; TITLE Synnemapestaloides; LINK TAXA = Taxa2; TRANSLATE 1 Synnemapestaloides_rhododendri_MAFF239201, 2 Synnemapestaloides_rhododendri_MAFF245158, 3 Synnemapestaloides_rhododendri_MAFF245156, 4 Synnemapestaloides_rhododendri_MAFF245157, 5 Synnemapestaloides_rhododendri_TAMA492, 6 Synnemapestaloides_rhododendri_MAFF243052, 7 Seimatosporium_foliicola_AB593734, 8 Seimatosporium_biseptatum_JN871208, 9 Seimatosporium_botan_AB593731, 10 Seimatosporium_discosioides_AB593732, 11 Seimatosporium_elegans_AB593733, 12 Seimatosporium_eucalypti_JN871212, 13 Seimatosporium_hakeae_AB593736, 14 Seimatosporium_kriegerianum_AB593738, 15 Seimatosporium_mariae_AB593740, 16 Seimatosporium_obtusum_JN871215, 17 Seimatosporium_parasiticum_AB593741, 18 Seimatosporium_sp._LC047752, 19 Discostroma_fuscellum_AB593739, 20 Discostroma_stoneae_AB593729, 21 Discostroma_tostum_AB593727, 22 Sarcostroma_restionis_DQ278925, 23 Discosia_artocreas_AB593711, 24 Discosia_artocreas_AB593720, 25 Discosia_artocreas_AB593705, 26 Discosia_brasiliensis_AB593707, 27 Discosia_pleurochaeta_AB593709, 28 Discosia_pleurochaeta_AB593713, 29 Discosia_pini_AB593708, 30 Discosia_yakushimense_AB593721, 31 Discosia_tricellulare_AB593728, 32 Seimatosporium_pistaciae_KP004491, 33 Pestalotiopsis_sp._FJ1402, 34 Pestalotiopsis_sp._LC047750, 35 Truncatella_angustata_AF382383; TREE ML = [&R] ((((((((((9:6.5187E-4,17:0.00208561)0.4460:0.0,10:0.00418063)0.7610:0.00418093,(21:0.00847324,32:0.00207829)0.6890:7.3515E-4)0.6290:0.00418091,11:0.0)0.0190:0.0,(14:7.9634E-4,20:0.00208257)0.8480:0.00419454)0.5230:0.00418075,(12:0.00420255,(18:0.00421933,(19:0.00208353,(15:0.0,(13:0.0,22:0.002091)0.7030:0.00208561)0.0700:7.3821E-4)0.6490:0.00420187)0.1560:0.00208112)0.0030:0.0)0.2470:0.00208507,8:0.00418122)0.0820:0.0,16:0.00209172)0.3260:0.0020902,(7:0.00840153,((5:0.00208561,6:0.0)0.0880:0.0,(4:0.0,(3:0.0,(1:0.0,2:0.0)0.1130:0.0)0.0350:0.0)0.0580:0.0)0.8510:4.0969E-4)0.4510:0.0020864)0.9540:0.02161788,(((26:0.0,29:0.0)0.2800:0.0,25:0.0)0.8330:0.0,((23:0.0,24:0.0)0.8250:0.00416185,(28:0.0,(27:0.00208561,(30:0.0,31:0.00418061)0.5020:0.00208561)0.0200:0.0)0.5610:0.00628396)0.4850:0.00419298)0.8360:0.00541021,(35:0.04794742,(33:0.01588758,34:0.01210532)0.9860:0.02413978)0.8280:0.01309708); TREE MP = [&R] ((((((((((13,22)0.8270,19)0.3670,15)0.6880,(8,16)0.4370)0.0330,18)0.0680,12)0.1330,(((14,20)0.9410,11)0.8590,((21,32)0.8120,(10,(9,17)0.4260)0.8640)0.6580)0.5280)0.3750,(7,(2,(6,(5,(4,(1,3)0.3480)0.3320)0.4030)0.3810)0.7750)0.5090)0.9100,((((30,31)0.5260,27)0.1870,28)0.4190,((23,24)0.8470,(26,(25,29)0.5040)0.8140)0.6150)0.8520)0.7210,(33,34)0.9920,35); TREE NJ = [&R] ((((((((((((9:2.9104E-4,10:0.00359018)0.4750:2.2059E-4,17:0.00172637)0.7670:0.00359128,(21:0.00791633,32:0.00187513)0.7690:3.4113E-4)0.5860:0.0017012,(11:1.2893E-4,(14:3.2282E-4,20:0.00161644)0.8660:0.00376416)0.7160:0.00208907)0.5200:0.0024713,((13:0.0,22:0.00196634)0.6610:0.00181248,(15:0.0,19:0.00196045)0.5840:1.348E-4)0.6610:0.00262608)0.1670:5.6589E-4,(8:0.00248148,18:0.00530649)0.3050:8.4199E-4)0.1320:3.1277E-4,12:0.00508113)0.1120:7.1063E-4,16:0.00269934)0.4380:0.00183385,(4:0.0,(2:0.0,(1:0.0,(3:0.0,(5:0.00194773,6:0.0)0.1680:2.49E-6)0.0710:1.87E-6)0.0840:1.87E-6)0.1740:1.87E-6)0.8620:0.00168492)0.3520:0.0010926,7:0.00520326)0.9800:0.01123856,(((27:0.00197354,28:0.0)0.7230:2.7621E-4,(30:9.778E-5,31:0.00378843)0.5260:0.00167035)0.4370:0.00153996,((23:0.0,24:0.0)0.8510:0.00346168,(25:0.0,(26:0.0,29:0.0)0.3150:0.0)0.8610:4.3187E-4)0.5490:0.00335946)0.9610:0.00821747)0.8400:0.00689062,(33:0.01087507,34:0.01485846)0.9880:0.0200188,35:0.04066455); END; BEGIN TREES; TITLE Synnemapestaloides_rhododendri_ITS_BT; LINK TAXA = Taxa1; TRANSLATE 1 Discosia_artocreas_NBRC8975, 2 Seimatosporium_botan_NBRC104200, 3 Seimatosporium_discosioides_NBRC104201, 4 Seimatosporium_foliicola_AB593734, 5 Synnemapestaloides_rhododendri_MAFF239201, 6 Synnemapestaloides_rhododendri_MAFF245058, 7 Synnemapestaloides_rhododendri_MAFF245156, 8 Synnemapestaloides_rhododendri_MAFF245157, 9 Synnemapestaloides_rhododendri_MAFF243052, 10 Synnemapestaloides_rhododendri_MAFF243053, 11 Synnemapestaloides_rhododendri_MAFF243054, 12 Synnemapestaloides_rhododendri_TAMA492; TREE ML = [&R] ((((12:0.0,(7:0.0,(8:0.0,5:0.00117548)0.2900:0.0)0.6540:0.00117548)0.8520:0.0024156,(6:0.0,(10:0.00117545,(9:0.0,11:0.0)0.2660:4.6E-7)0.6540:0.00117545)0.7680:0.00112918)0.9480:0.00965434,4:0.00658939)1.0000:0.06601442,(2:0.03213179,3:0.02509346)0.9060:0.03574295,1:0.13596581); TREE MP = [&R] (((((2,3)0.9720,1)1.0000,4)0.9980,(12,(7,(5,8)0.4630)0.7540)0.9250)0.8300,6,(9,(10,11)0.4600)0.7980); TREE NJ = [&R] ((((((7:0.0,8:0.0)0.5930:4.061E-5,5:0.00114283)0.6750:0.00110912,12:7.572E-5)0.9080:0.00227193,(6:-5.316E-5,(11:-1.071E-5,(9:-1.071E-5,10:0.00119414)0.3770:1.071E-5)0.7640:0.00123396)0.9740:0.00127719)0.9960:0.00716322,4:0.00852766)1.0000:0.04732037,(2:0.02799079,3:0.02231988)0.9970:0.02130019,1:0.08393202); END;