#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 14:37 GMT TreeBASE (cc) 1994-2008 Study reference: Takamatsu S., Masuya H., Divarangkoon R., & Nomura Y. 2007. Erysiphe fimbriata sp. nov.: a powdery mildew fungus found on Carpinus laxiflora. Mycoscience, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1960] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=99; TAXLABELS Arthrocladiella_mougeotii_ex_Lycium_AB022379 Arthrocladiella_mougeotii_ex_Lycium_AB329690 Blumeria_graminis_ex_Bromus_AB022362 Blumeria_graminis_ex_Hordeum_AB022399 Blumeria_graminis_ex_Triticum_AB022376 Brasiliomyces_trina_ex_Quercus_AB022350 Byssoascus_striatisporus_U17912 Caespitotheca_forestalis_ex_Schinopsis_AB193467 Cystotheca_lanestris_ex_Quercus_AB022353 Cystotheca_wrightii_ex_Quercus_AB022355 Erysiphe_abbreviata_ex_Quercus_AB271785 Erysiphe_adunca_ex_Salix_AB022374 Erysiphe_alphitoides_ex_Quercus_AB237811 Erysiphe_alphitoides_ex_Quercus_AB257431 Erysiphe_alphitoides_ex_Quercus_AB292699 Erysiphe_alphitoides_ex_Quercus_AB292707 Erysiphe_aquilegiae_ex_Cimicifuga_AB022405 Erysiphe_arcuata_ex_Carpinus_AB252463 Erysiphe_arcuata_ex_Carpinus_AB252473 Erysiphe_arcuata_ex_Carpinus_AB252474 Erysiphe_australiana_ex_Lagerstroemia_AB022407 'Erysiphe carpi-laxiflorae ex Carpinus AB252470' 'Erysiphe carpi-laxiflorae ex Carpinus AB252471' 'Erysiphe carpi-laxiflorae ex Carpinus AB252472' Erysiphe_carpinicola_ex_Carpinus_AB252467 Erysiphe_carpinicola_ex_Carpinus_AB252468 Erysiphe_carpinicola_ex_Carpinus_AB252469 Erysiphe_epigena_ex_Quercus_AB292717 Erysiphe_epigena_ex_Quercus_AB292718 Erysiphe_epigena_ex_Quercus_AB292720 Erysiphe_epigena_ex_Quercus_AB292722 Erysiphe_friesii_ex_Rhamnus_AB022382 Erysiphe_glycines_ex_Desmodium_AB022397 Erysiphe_gracilis_ex_Quercus_AB022357 Erysiphe_heraclei_ex_Daucus_AB022391 Erysiphe_hypogena_ex_Quercus_AB292725 Erysiphe_hypogena_ex_Quercus_AB292726 Erysiphe_hypogena_ex_Quercus_AB292727 Erysiphe_hypophylla_ex_Quercus_AB292715 Erysiphe_hypophylla_ex_Quercus_AB292716 Erysiphe_monoascigera_ex_Styrax_MUMH_3786 Erysiphe_mori_ex_Morus_AB022418 Erysiphe_nomurae_ex_Symplocos_MUMH_275 Erysiphe_paeoniae_ex_Paeonia_AB257438 Erysiphe_pseudocarpinicola_ex_Carpinus_AB252464 Erysiphe_pseudocarpinicola_ex_Carpinus_AB252465 Erysiphe_pseudocarpinicola_ex_Carpinus_AB252466 Erysiphe_pulchra_ex_Swida_AB022389 Erysiphe_quercicola_ex_Quercus_AB197135 Erysiphe_quercicola_ex_Quercus_AB292691 Erysiphe_quercicola_ex_Quercus_AB292694 Erysiphe_simulans_ex_Rosa_AB022395 Erysiphe_sp._ex_Carpinus_MUMH3694 Erysiphe_sp._ex_Quercus_AB292711 Erysiphe_sp._ex_Quercus_AB292712 Golovinomyces_adenophorae_ex_Adenophora_AB077632 Golovinomyces_cichoracearum_ex_Aster_AB077641 Golovinomyces_cichoracearum_ex_Dahlia_AB077628 Golovinomyces_cichoracearum_ex_Eupatorium_AB022387 Golovinomyces_cichoracearum_ex_Solidago_AB077650 Golovinomyces_orontii_ex_Nicotiana_AB022412 Golovinomyces_orontii_ex_Physalis_AB077646 Golovinomyces_orontii_ex_Rubia_AB077634 Golovinomyces_orontii_ex_Veronica_AB077651 Golovinomyces_sordidus_ex_Plantago_AB077657 Leveillula_saxaouli_ex_Haloxylon_AB080469 Leveillula_sp._ex_Chondrilla_AB080478 Leveillula_taurica_ex_Artemisia_AB080470 Neoerysiphe_cumminsiana_ex_Cacalia_AB329669 Neoerysiphe_galeopsidis_ex_Acanthus_AB329670 Neoerysiphe_galeopsidis_ex_Chelonopsis_AB022369 Neoerysiphe_galeopsidis_ex_Lamium_AB329674 Neoerysiphe_galii_ex_Galium_AB329681 Neoerysiphe_galii_ex_Galium_AB329682 Oidium_aloysiae_ex_Aloysia_AB329683 Oidium_baccharidis_ex_Baccharis_AB329684 Oidium_maquii_ex_Aristotelia_AB329686 Oidium_phyllanthi_ex_Phyllanthus_AB120754 Oidium_phyllanthi_ex_Phyllanthus_AB120755 Oidium_phyllanthi_ex_Phyllanthus_AB120758 Parauncinula_septata__ex_Quercus_AB183533 Parauncinula_septata_ex_Quercus_AB022420 Phyllactinia_fraxini_ex_Fraxinus_AB080451 Phyllactinia_fraxini_ex_Syringa_AB080436 Phyllactinia_guttata_ex_Alnus_AB080452 Phyllactinia_guttata_ex_Diospyros_AB022372 Phyllactinia_guttata_ex_Euptelea_AB080388 Phyllactinia_guttata_ex_Hamamelis_AB080410 Phyllactinia_guttata_ex_Morus_AB080372 Pleochaeta_shiraiana_ex_Celtis_AB022403 Pleochaeta_turbiana_ex_Platycyamus_AB218773 Podosphaera_filipendulae_ex_Filipendula_AB022384 Podosphaera_longiseta_ex_Prunus_AB022423 Podosphaera_pannosa_ex_Rosa_AB022347 Podosphaera_tridactyla_ex_Prunus_AB022393 Podosphaera_xanthii_ex_Melothria_AB022410 Sawadaea_polyfida_ex_Acer_AB022364 Sawadaea_tulasnei_ex_Acer_AB022366 Typhulochaeta_japonica_ex_Quercus_AB022415 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=31; TAXLABELS Brasiliomyces_trina_ex_Quercus_AB022351 Erysiphe_adunca_ex_Populus_AF011324 Erysiphe_adunca_ex_Salix_D84383 Erysiphe_aquilegiae_ex_Cimicifuga_AB000944 Erysiphe_arcuata_ex_Carpinus_AB252463 Erysiphe_arcuata_ex_Carpinus_AB252473 Erysiphe_arcuata_ex_Carpinus_AB252474 Erysiphe_australiana_ex_Lagerstroemia_AB022408 'Erysiphe carpi-laxiflorae ex Carpinus AB252470' 'Erysiphe carpi-laxiflorae ex Carpinus AB252471' 'Erysiphe carpi-laxiflorae ex Carpinus AB252472' Erysiphe_carpinicola_ex_Carpinus_AB252467 Erysiphe_carpinicola_ex_Carpinus_AB252468 Erysiphe_carpinicola_ex_Carpinus_AB252469 Erysiphe_flexuosa_ex_Aesculus_AB091774 Erysiphe_friesii_ex_Rhamnus_AB000939 Erysiphe_glycines_ex_Desmodium_AB015927 Erysiphe_gracilis_ex_Quercus_AB022358 Erysiphe_heraclei_ex_Daucus_AB000942 Erysiphe_japonica_ex_Swida_AB000941 Erysiphe_mori_ex_Morus_AB000946 Erysiphe_necator_ex_Vitis_AF073346 Erysiphe_prunastri_ex_Prunus_AB046983 Erysiphe_pseudocarpinicola_ex_Carpinus_AB252464 Erysiphe_pseudocarpinicola_ex_Carpinus_AB252465 Erysiphe_pseudocarpinicola_ex_Carpinus_AB252466 Erysiphe_simulans_ex_Rosa_AB015926 Erysiphe_sp._ex_Carpinus_laxiflora_MUMH3694 Erysiphe_togashiana_ex_Styrax_AB091775 Erysiphe_wadae_ex_Fagus_AB091776 Typhulochaeta_japonica_ex_Quercus_AB022416 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3793] TITLE 28S_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=831; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arthrocladiella_mougeotii_ex_Lycium_AB022379 AAGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTCTGCGGCCGCGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGTCG-TGGATCATCC-GAGG-TTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGACCCTAGGAACGTAGCTCCCTTC----GGGGCGTG--TTATAGCCTAGGGTGCAATGCAGCCTACCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTACGTGAGAACCCGTAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTACCAGCAT----------- Arthrocladiella_mougeotii_ex_Lycium_AB329690 AAGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTCTGCGGCCGCGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGTCG-TGGATCATCC-GAGG-TTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGACCCTAGGAACGTAGCTCCCTTC----GGGGCGTG--TTATAGCCTAGGGTGCAATGCAGCCTACCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Blumeria_graminis_ex_Bromus_AB022362 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGATCCATTA--GGAGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGCG-ACGAGTCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATGCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCACTG-TGGATCATCC-GAGG-TTCTCCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACCTGTGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATA------AGGGGGCATCATCGACCGATCCGGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Blumeria_graminis_ex_Hordeum_AB022399 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACC-CAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGGTTA-C-GGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGTA-GTGAGTCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAACCCCGTATGCGGCCGAGTACTCAGTGCC--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCACTG-TGGATCATCC-GAGG-TTCTCCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACC----------------------------------------------------------------------------------------------------------------------------------------------------------- Blumeria_graminis_ex_Triticum_AB022376 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGTTTA-C-GGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGTG-GCGAGTCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATGCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCACTG-TGGATCATCC-GAGG-TTCTCCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATA------AGGGGGCATCATCGACCGATCCGGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Brasiliomyces_trina_ex_Quercus_AB022350 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTGACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGAATCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGTT-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGG-CC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCTACCAGA-CTTGGGCGCTG-CCGATCATCC-CGAG-TTCTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCCTTC--GGGGCAGTG--TTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGTTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTTACATCAATGCGAGTGTTTGGGCGTGAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTGTAAAGGGGGTGCATCATCGACCGATCCTGATGT?TTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Byssoascus_striatisporus_U17912 ----------------------------------------------------------AAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCT---TTGGGGTCCGAGTTGTAATTTGGAGAAGATGCTTCGGGT-ACGGTCCCGGTCTAAGTTCCTTGGAACAGGAC---GTCACAGAGGGTGAGAATCCCGTACGTGGTCGGTGGC-CGTGCCC--GTGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCCATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGCGCGCGG-TCGATCATCC-TGGG-TTCGCCCGGGTGCACTCGGCCGCGCTCAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTCGGGAACGTGGCTCCCCTC----GGGGAGTG--TTATAGCCCGAGGTGCAATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Caespitotheca_forestalis_ex_Schinopsis_AB193467 TTGACCTCGGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCTGTC--GTCAGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGC-GCGGGCCCGGCCTAAGTTCCTTGGAACGGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCTGGTGCTCGT-GCCC--GGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTA-CCGATCACCC-AGAGTTCTGCTCTGGTGCACTCGGTAGCGTACAGGCCAGCATCGGTTCGGGCGGTCGGACAAGGGCCGTAGGAATGTATCTCTCCCTCA--CGGAAGAGTATTATAGCCTACGGCGCCATACGGCCTGCCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTGAAACCCATACGCGAAATGAAAGTGAACGTAGGTGAGAACCCCGTCAAAC--GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAGGAGCATAGCTGTTGGGA Cystotheca_lanestris_ex_Quercus_AB022353 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGAGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGT-ATGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCC-CTTGTCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGA-CTTGGGCGCTG-CTGATCCGCT-GGGG-TTCTCCCCGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGAGGAATGTAGCTGTCTCTC--GGGGCAGTG--TTATAGCCTCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCGTT------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Cystotheca_wrightii_ex_Quercus_AB022355 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCC-CTTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGA-CTTGGGCGCTG-CTGATCCGTC-GGGG-TTCTCCCCGGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGTGAGGGGAATGTAGCTGTCTCTC--GGGGCAGTG--TTATAGCCCCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTT------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_abbreviata_ex_Quercus_AB271785 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGACTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGTGCTG-CCGATCACCC-GGAG-TTCTCTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGCAGGTG------------------------------------------------------------------------------------- Erysiphe_adunca_ex_Salix_AB022374 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGCAGCTTTGGGTTGTGGGACCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCACCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGACACCA-CTGATCCGCG-AGGG-TTCTCTCTCGGGCACTCGGTGGGGTACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCCGAAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTTCGGTGCAATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTAAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTC-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_alphitoides_ex_Quercus_AB237811 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-TCGATCACCC-CGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACG------------------------------------------------------------------------------------------- Erysiphe_alphitoides_ex_Quercus_AB257431 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-TCGATCACCC-CGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT------------------------------------------------------------------------------------------------------------------------ Erysiphe_alphitoides_ex_Quercus_AB292699 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-TCGATCACCC-CGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_alphitoides_ex_Quercus_AB292707 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-TCGATCACCC-CGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACG------------------------------------------------------------------------------------------- Erysiphe_aquilegiae_ex_Cimicifuga_AB022405 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCATGGCC-CGCGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCC-CGAG-TTCTCTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC----GGGGAGTG--TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_arcuata_ex_Carpinus_AB252463 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCGCCT--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCACTG-CTGATCATCC-AGAG-TTCTCTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCATTT----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_arcuata_ex_Carpinus_AB252473 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCGCCT--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCACTG-CTGATCATCC-AGAG-TTCTCTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACG{CT}AGGTG------------------------------------------------------------------------------------- Erysiphe_arcuata_ex_Carpinus_AB252474 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCGCCT--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCACTG-CTGATCATCC-AGAG-TTCTCTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACG{CT}AGGTG------------------------------------------------------------------------------------- Erysiphe_australiana_ex_Lagerstroemia_AB022407 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTGGTAACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGGCT-TGCGCCT--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGA-CTTGGGCATCG-CTGATCATCC-GGGG-GTATCTCCGGTGCACTCGACGATGCACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCTGTGGGAACGTGGCTCCTTTC----GAGGAGTG--TTATAGCCCACGGTGCAATGCAGCCCATCCGGACCGAGGACCGCGCCCTTCGGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA 'Erysiphe carpi-laxiflorae ex Carpinus AB252470' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGACTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCAAGGTCCTGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTGGCTGATCATCC-AGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGATTCGGGTGGTTGGATAAAGGCCGGAGAAACGTAGCTCCTCTC----GGGGAGTG--TTATAGTCTACGGTGCCATGCAGCCCAGCCGGATCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACG{CT}AGGTGA------------------------------------------------------------------------------------ 'Erysiphe carpi-laxiflorae ex Carpinus AB252471' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGACTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCAAGGTCCTGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTGGCTGATCATCC-AGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGATTCGGGTGGTTGGATAAAGGCCGGAGAAACGTAGCTCCTCTC----GGGGAGTG--TTATAGTCTACGGTGCCATGCAGCCCAGCCGGATCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACG------------------------------------------------------------------------------------------- 'Erysiphe carpi-laxiflorae ex Carpinus AB252472' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGACTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCAAGGTCCTGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTGGCTGATCATCC-AGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGATTCGGGTGGTTGGATAAAGGCCGGAGAAACGTAGCTCCTCTC----GGGGAGTG--TTATAGTCTACGGTGCCATGCAGCCCAGCCGGATCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAGCCCCTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGA-CATAGCTGTTGGGA Erysiphe_carpinicola_ex_Carpinus_AB252467 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGCTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGACTCTGCGCCC--GGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGACGCTGGCTGATCATCCATGAGTTCGTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGCAACGTAGCTCCCTTC----GGGGAGTG--TTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCT------- Erysiphe_carpinicola_ex_Carpinus_AB252468 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGCTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGACTCTGCGCCC--GGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGACGCTGGCTGATCATCCATGAGTTCGTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGCAACGTAGCTCCCTTC----GGGGAGTG--TTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_carpinicola_ex_Carpinus_AB252469 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGCTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGACTCTGCGCCC--GGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGACGCTGGCTGATCATCCATGA?TTCGTCTCT?GTGCACTC?AC?GCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGCAACGTAGCTCCCTTC----GGGGAGTG--TTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATC----------------------------------------------------------- Erysiphe_epigena_ex_Quercus_AB292717 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGA-ACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCC-TGAG-TTCTCTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_epigena_ex_Quercus_AB292718 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCC-TGAG-TTCTCTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_epigena_ex_Quercus_AB292720 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCC-CGAG-TTCTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_epigena_ex_Quercus_AB292722 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCC-CGAG-TTCTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_friesii_ex_Rhamnus_AB022382 TTGACCTCGAATCAGGTAGGAATACCCGCTGAAC------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TACGCCC--GGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGCTG-CTGATCACCT-TGAGTTCTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_glycines_ex_Desmodium_AB022397 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGTT-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCACTG-TTGATCATCT-AGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT----GGGGAGTG--TTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAA-CCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCCTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_gracilis_ex_Quercus_AB022357 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCGCTC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCACTG-CTGATCATCCAGAGG-TTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTC--GGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATC-ACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_heraclei_ex_Daucus_AB022391 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---TGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGCTG-CTGATCACCT-TGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTTT---GGGGGCGCATCATCGACCGATCCTGA-------------------------------------------- Erysiphe_hypogena_ex_Quercus_AB292725 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCC-CGAG-TTCTCTCAGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_hypogena_ex_Quercus_AB292726 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCC-CGAG-TTCTCTCAGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTC---GGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_hypogena_ex_Quercus_AB292727 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCC-CGAG-TTCTCTCAGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATACGCGGAATGAAAGTGAACG------------------------------------------------------------------------------------------- Erysiphe_hypophylla_ex_Quercus_AB292715 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCC-CGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTGGCTCCCCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGT------------------------------------------------------------------------------------------ Erysiphe_hypophylla_ex_Quercus_AB292716 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCC-CGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTGGCTCCCCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT------------------------------------------------------------------------------------------------------------------------ Erysiphe_monoascigera_ex_Styrax_MUMH_3786 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAG???????????????????????????GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCT-CGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCAGACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_mori_ex_Morus_AB022418 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGACCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CTGATCATCC-AGAG-TTCTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTCTC--GGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGCAGGTG------------------------------------------------------------------------------------- Erysiphe_nomurae_ex_Symplocos_MUMH_275 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CAGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGAC---GTCACAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCC--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCATCT-CGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_paeoniae_ex_Paeonia_AB257438 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAATAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-TGCGCCT--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGA-CTTGGGCACTG-CCGATCACCC-TGAG-TTCTCTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTA----------------------------------------------------------------------------------------------------------------------- Erysiphe_pseudocarpinicola_ex_Carpinus_AB252464 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGACTCTGCGCTC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGACGCTGGCTGATCATCCATGAGTTTGTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGTCGGAGCAACGTAGCTCCCTTC----GAGGAGTG--TTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGA-------------------------------------------- Erysiphe_pseudocarpinicola_ex_Carpinus_AB252465 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGTCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGACT-TGTGCCT--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGACGCTG-CTGATCATCT-AGGGTTCTTCTCTAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCTGTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGT-------------------------------------------------------------------------------------- Erysiphe_pseudocarpinicola_ex_Carpinus_AB252466 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGTCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGACT-TGTGCCT--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGACGCTG-CTGATCATCT-AGGGTTCTTCTCTAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCTGTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTG------------------------------------------------------------------------------------- Erysiphe_pulchra_ex_Swida_AB022389 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAATAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGCTG-CCGATCACCC-AGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_quercicola_ex_Quercus_AB197135 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCT-TGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCC----------------------------------------------- Erysiphe_quercicola_ex_Quercus_AB292691 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCT-TGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_quercicola_ex_Quercus_AB292694 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCT-TGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_simulans_ex_Rosa_AB022395 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGCTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCTGAGGCC-CGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGACGCTG-CCGATCATTC-CGAG-TTCTCTCTGATGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGCAGAAAGACCGGAGGAACGTAGCTCCCCCCTCGGGAGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAC-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTC------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_sp._ex_Carpinus_MUMH3694 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGA---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTCCGGCCTAAGTTCCTTGGAATAGGAC---GTCGGAGAGGGTGAGAATCCCGTCTGTGGCCGAGGCC-TGCGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCACTG-CTGATCATCC-AGAG-TTTACTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC----GGGGAGTG--TTATAGCCTATGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGCAGGTGA------------------------------------------------------------------------------------ Erysiphe_sp._ex_Quercus_AB292711 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCC-CGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCC----------------------------------------------- Erysiphe_sp._ex_Quercus_AB292712 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCC-CGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGCTG-CCGATCACCC-CGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_adenophorae_ex_Adenophora_AB077632 TTGACCTCGAATCAGGTAGGGATACCCG------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGAGGTCGGCGCGGCCTAAGTTCCTTGGAACAGGAC---ATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-GACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGTCG-TCGATCATCC-GAGG-TTCTCCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGGGCGTCATGCAGCCCATCCGGACCGAGGACCGCGCC-TTT-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_cichoracearum_ex_Aster_AB077641 TTGACCTCGAATCAGGTAGGGATACCCGCTGAA-------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGAC---ATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-TCGATCATCC-GGGG-TTCTCCTCGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCCCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGAGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCC-TTT--GGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_cichoracearum_ex_Dahlia_AB077628 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGAC---ATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-TCGATCATCC-GGGG-TTCTCCTCGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCCCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGAGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCC-TTT--GGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_cichoracearum_ex_Eupatorium_AB022387 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGAC---ATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-TCGATCATCC-GGGG-TTCTCCTCGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCCCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGAGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCC-TTT--GGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTACGAGCATAGCTGTTGGGA Golovinomyces_cichoracearum_ex_Solidago_AB077650 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGAC---ATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGTCG-TCGATCATCC-GAGG-TTCTCCTCGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCGAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTCGGGCGCAATGCAACCCATCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGACGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_orontii_ex_Nicotiana_AB022412 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTGAGCTCGGCCTAAGTTCCTTGGAACAGGAC---ATCAGAGAGGGTGAGAATCCCGTATGTGCCCGTGGCC-TATGCCC--GTGTAAGGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGTCG-TCGATCATCC-GAGG-TTCTCCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGGGCGTAATGCAGCCTATCTGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTA------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTACGAGCATACCTGTTGGGA Golovinomyces_orontii_ex_Physalis_AB077646 ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATTTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGAC---ATCAGAGAGGGTGAGAATCCCGTATGTGGCCGCGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGTCG-TCGATCATCC-GAGG-TTCTCCTCGGTGCACTCGGCGATGCACAGGCCAGCATCGGTTTGGATGGCTGGAGAAAGGCGCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGGGCGTAATGCAGCCCATCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTT------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_orontii_ex_Rubia_AB077634 TTGACCTCGAATCAGGTAGGGATACCCG------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGAC---ATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-TACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGTCG-TCGATCATCC-GAGG-TTCTCCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_orontii_ex_Veronica_AB077651 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGGAGGCTCGGCCTAAGTTCCTTGGAACAGGAC---ATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCC-TCCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGTCG-TCGATCATCC-GAGG-TTCTCCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGGGCGTAATGCAGCCCATCGGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATC------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_sordidus_ex_Plantago_AB077657 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGGAGGCTCGGCCTAAGTTCCTTGGAACAGGAC---ATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGTC-TCCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGTCG-TCGATCATCC-GAGG-TTCTCCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCGCTTC----GGGGAGTG--TTATAGCCTAGGGCGGAATGCAGCCCATCTGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGG- Leveillula_saxaouli_ex_Haloxylon_AB080469 TTGACCTCGAATC-----------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGTCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGCG-CCTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-CTGATCATCC-AAAG-TTTTCTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC----GGGGAGTG--TTATAGCCTGCGACGCAATACCGCCTACTCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCAT--------------------------------------------------------- Leveillula_sp._ex_Chondrilla_AB080478 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGCG-CCTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-CTGATCATCC-AAAG-TTTTCTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGACGTGGGAACGTAGCTCCTTTC----GGGGAGTG--TTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTGATGTCTT-------------------------------------- Leveillula_taurica_ex_Artemisia_AB080470 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGCGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGCG-CCTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-CTGATCATCC-AAAG-TTTCCTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC----GGGGAGTG--TTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATACGCGCAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTGAT------------------------------------------- Neoerysiphe_cumminsiana_ex_Cacalia_AB329669 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTTCGGTCTAAGTTCCTTGGAACAGGGC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGACC-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCA-TGGATCATCC-GAGG-TTCTCCTCGGTGCACTCGATGACGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGA----GGGGAGTG--TTATAGTCTAGGGCGCAATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAAGTCTTCGGA--GA----TTTGAGT------------------- Neoerysiphe_galeopsidis_ex_Acanthus_AB329670 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGC---GTCATAGAGGGTGAGAATCCCGTCTGCGGCCGTGACC-TGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-TGGATCATCC-GAGG-TTCTCCTCGGTGCACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Neoerysiphe_galeopsidis_ex_Chelonopsis_AB022369 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGC---GTCATAGAGGGTGAGAATCCCGTCTGCGGCCGTGACC-TGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-TGGATCATCC-GAGG-TTCTCCTCGGTGCACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCTTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Neoerysiphe_galeopsidis_ex_Lamium_AB329674 TTGACCTCGAATCAGGTAGG--------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGC---GTCATAGAGGGTGAGAATCCCGTCTGCGGCCGTGACC-TGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-TGGATCATCC-GAGG-TTCTCCTCGGTGCACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGA----TTTGAGTA------------------ Neoerysiphe_galii_ex_Galium_AB329681 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTTGGTCTAAGTTCCTTGGAACAGGGC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGACC-TGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-TGGATCATCC-GAGG-TTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTCGGATGGCTGGAAAAAGGTCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGCAATGCAGCCCAACTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAA------------------------------------------- Neoerysiphe_galii_ex_Galium_AB329682 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTTGGTCTAAGTTCCTTGGAACAGGGC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGACC-TGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-TGGATCATCC-GAGG-TTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTCGGATGGCTGGAAAAAGGTCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGCAATGCAGCCCAACTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACG------------------------------------------------------------------------------------------- Oidium_aloysiae_ex_Aloysia_AB329683 -------------------------------------------------------------------------------------AACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGTTCGGTCTAAGTTCCCTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGACC-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCA-TGGATCACCC-GAGG-TTCTCCTCGGTGCACTCGATGACGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGTAATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Oidium_baccharidis_ex_Baccharis_AB329684 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG-------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTTCGGTCTAAGTTCCTTGGGACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGATC-TATGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCA-TGGATCATCC-GAGG-TTTTCCTCGGTGCACTCGATGATGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Oidium_maquii_ex_Aristotelia_AB329686 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGA----------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTTCGGTCTAAGTTCCTTGGAACAGGGC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGACC-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCA-TGGATCACCC-GAGG-TTCTCCTCGGTGCACTCGATGACGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGCAATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCACCCGTATGGGGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Oidium_phyllanthi_ex_Phyllanthus_AB120754 ----------------------------------------------------------------------------------------------------------AGCTCAAATTTGAAATCTGGCTCCTT---TGGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGTCGAGACCCTACGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGTTG-TTGATCATCC-GAGGTTCTGCCTCGGTGCACTCGACAATGTGCAGGCCAGCATCGGTTTGACTGGCTGGACAAAGGTCCTAGGAACGTAACTCCTCGC----GGGGAGTG--TTATAGCCTAGGGCGTCATGCAGCCCAGTCGGACCGAGGACCGCGCCTTTT-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTTA-----GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Oidium_phyllanthi_ex_Phyllanthus_AB120755 ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCTT---TGGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGTCGAGACCCTACGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGTTG-TTGATCATCC-GAGGTTCTGCCTCGGTGCACTCGACAATGTGCAGGCCAGCATCGGTTTGACTGGCTGGACAAAGGTCCTAGGAACGTAACTCCTCGC----GGGGAGTG--TTATAGCCTAGGGCGTCATGCAGCCCAGTCGGACCGAGGACCGCGCCTTTT-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTTA-----GGGTGCATCATCGACCGATCCTGATGTCTTCGGAT--------------------------------- Oidium_phyllanthi_ex_Phyllanthus_AB120758 ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTTCCT---CGGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTCTGCGGCCGAGACCCTACACCTATATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCATCG-TTGATCATCC-GAGGCTTTGCCTCGGTGCACTCAACAATGCACAGGCCAGCATCGGTTTGACTGGCTGGAAAAAGGCCCTAGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCTAGGGCGTCATGCAGCCCAGTTAGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTTA-----GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAGGAGCATAGCTGTTGGGA Parauncinula_septata__ex_Quercus_AB183533 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACAAGCTCAAATTTGAAATCTGGCGCCCT---CGGCGTCCGAGTTGTAATTTGTAGACGATGCTTTGGGC-TGGGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCC--GTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGA-CTTGGGGGCCG-TGGATCATCC-GGGCTTCGGGCCCGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTAGAGCGCCATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGTTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAA------GGGTGCATCATCGACCGATTCTGATGTCT--------------------------------------- Parauncinula_septata_ex_Quercus_AB022420 TTGACCTCGGATCA--------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTACTAGCTCAAATTTGAAATCTGGCGCCCT---CGGCGTCCGAATTGTAATTTGTAGACGATGCTTTGGGT-AGGGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCC--GTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGA-CTTGGGGGCCG-TGGATCATCC-AGGCTTCGGGCC-TGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTAGGGCGCCATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----T------------------------- Phyllactinia_fraxini_ex_Fraxinus_AB080451 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTG-GGTGCTC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-CTGATCATCC-AAAG-TTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTC----GGGGAGTG--TTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAACATAGCTGTTGGGA Phyllactinia_fraxini_ex_Syringa_AB080436 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGGTG-GGTGCTC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-CTGATCATCC-AAAG-TTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTC----GGGGAGTG--TTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTATGAGCATAGCTGTTGGGA Phyllactinia_guttata_ex_Alnus_AB080452 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA??????????????????????TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGTCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTGTC-GGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-CTGATCATCC-AAAGACTCTCTTTGGTGCACTCAACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC----GGAGAGTG--TTATAACCGGCGACGCAATACCGCCTACTCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTATGAGCATAGCTGTTGGGA Phyllactinia_guttata_ex_Diospyros_AB022372 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTC-GACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCATCG-CTGATCATCC-AAAG-TTCTCTTTGGTGCACTCGACGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC----GGAGAGTG--TTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCGTT-----AAGGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGG- Phyllactinia_guttata_ex_Euptelea_AB080388 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGTCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTGTC-GGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-CTGATCATCC-AAAGACTCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC----GGAGAGTG--TTATAGCCGGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTATGAGCATAGCTGTTGGGA Phyllactinia_guttata_ex_Hamamelis_AB080410 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTTTC-GACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-CTGATCATCC-AAAG-TTCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC----GGAGAGTG--TTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTT-----AAGGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Phyllactinia_guttata_ex_Morus_AB080372 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCAGTGTC-GGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTCG-CTGATCATCC-AAAG---CTCTTTGGTGCACTTGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC----GGAGAGTG--TTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTG--------------------------------------------- Pleochaeta_shiraiana_ex_Celtis_AB022403 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTCAC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTAGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCGGTGCC-TGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGA-CTTGGGCGTTG-GTGATCATCC-GGAG-TTTTCTCTGGTGCACTCGGCAATGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTAGGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCCTGGGCGCAATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------AGGGTGCATCATCGACCGATC------------------------------------------------ Pleochaeta_turbiana_ex_Platycyamus_AB218773 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAAAAGCTCAAATTTGAAATCTGACTTCCGAC-CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTACTAGACCTAGCCTAAGTTCCTTGGAACAGGACTCTGTCATAGAGGGTGAGAATCCCGTATGCGGCTCGAGTC-TGTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTTGGGCGTCA-TTGATCATCC-AGAGTTCTTCTCTGGTGCACTCGGCGACGCACAGGCCAGCATCGGTTTGGGCGGTTGGAGAAAGGTCTTGGGAAAGTAGCTCCTCTC----GGGGAGTG--TTATAGCCCGAGACGCAATGCAGCCAGCCCGGATCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTGAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTT-----AAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_filipendulae_ex_Filipendula_AB022384 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCC-CGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGA-CTTGGGCGCTG-TTGATCCGTT-AGGG-TTCTCCCTGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCA------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_longiseta_ex_Prunus_AB022423 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCC-CGTGCCC--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGA-CTTGGGCGCTG-TTGATCCGTT-AGGG-TTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTG------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_pannosa_ex_Rosa_AB022347 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCC-CGCGCCC--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGA-CTTGGGCGCTG-TTGATCCGTT-AGGG-TTCTCCCTGGGGTACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCA------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_tridactyla_ex_Prunus_AB022393 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCC-CGTGCCC--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGGAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGA-CTTGGGCGCTG-TTGATCCGTT-AGGG-TTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTG------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_xanthii_ex_Melothria_AB022410 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT----CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCC-CGTGCCC--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGA-CTTGGGCGCTG-TTGATCCGCT-AGGG-TTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTCTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCA------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Sawadaea_polyfida_ex_Acer_AB022364 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCC-CTCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGA-CTTGGGCGCTG-CTGATCCGCG-GGGG-TTCTCCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCCACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTC------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Sawadaea_tulasnei_ex_Acer_AB022366 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACC---------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCT----CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCC-CTCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGA-CTTGGGCGCTG-CTGATCCGCG-GGGG-TTCTCCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTC------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA Typhulochaeta_japonica_ex_Quercus_AB022415 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA--------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCT-TGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGA-CTTGGGCGCTG-CTGATCATCC-AGAG-TTCTCTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCAGAGGAACGTAGCTACCTTTC--GGGGGAGTGTTTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGA----TTTGAGTAAGAGCATAGCTGTTGGGA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 28S_rDNA) = N: 1-831; CODONPOSSET CodonPositions (CHARACTERS = 28S_rDNA) = N: 1-831; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3792] TITLE ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=499; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Brasiliomyces_trina_ex_Quercus_AB022351 CAGAGCGTGAGG-TCCAGC-CCTGGCAAT--TGTCGTGC-GCTGG----ATCGA--CCCTCC-ACCCGTGTCGATTCGTC--TTTTTGTTGCTTTGGCGGGCCCGGCCCACCGGCTGCGGCTGGAGCGCGTCCGCCAGAGACCTTCCAAACTCATGTTGTGTCCCCTGTAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACGCCCCCCC-TCAAGCTACCA----GTTTTGTGTGGCTGCGGTGTTGGGGCTCGCCGAATCT-------CGGCGGCCCTTAAATGCAGTGGCGG-TGCTGACGTCGGCTTTACGCGCAGTAC---AATAGCTCGCGACAGAGTGGCGAC-AGCGACTAGCC Erysiphe_adunca_ex_Populus_AF011324 ---------GAA-CATGAG-CGTGGCATT-GTGCTGCGC-TATGG----ATCGA--CCCTCC-ACCCGTGTCGACGTTATC--ATCTGTTGCTTTGGCGGATCGGGCCC-CTGGCTACGGCTGGAGCGAGTCCGCCAGAGACTTACCTAACTCATGTTTATTT----GTAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCC--TCGAGTCATCA------CTTGTGTGACTTCGGTGTTGGGGCTCGCCCATCG--------CGGCGGCCCTTAAAGACAGTGGCGG-TGCCGGCGTGAGCTCTACGCGTAGTAC--TTACTTCTCGCGACAGGGCAACGAC-GGCGGCTGGCC Erysiphe_adunca_ex_Salix_D84383 CCGAGTGTGAGA-TCAGGA-CGTAGC-TT-GTGCTGCGT-CGTGG----ATCGA-CCCCTCC-ACCCGTGTTGACTTTATC--ACCTGTTGCTTTGGCAGACCGGGCCCGCTGGCTACGGCTGGAGCGCGTCTGCCAGAGACGTACCTAACTCAAGTTTTACCT---GTAGTCTGAGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCC--TCAAGGCACCG------TTTGTGTGACTTTGGTGTTGGGGCTCGCCCATTC--------GGGTGGCCCTTAAAGACAGTGGCGG-TGCCGGCGTGGGCTCTACGCGTAGTAACCTTTTATCTCGCGACAGAGCACTGAC-GGCTGCTAGCC Erysiphe_aquilegiae_ex_Cimicifuga_AB000944 CAGAGCGTGAGG-CTCAGT-CGTGGCGTC--AGCTGCGT-GCTGG----GCCGA--CCCTCCCACCCGTGTCGATTTCTA---TCTTGTTGCTTTGGCGGGCCGGGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCT--AAAACTCATGTTGTCTTT---GTCGTCTCAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCC--TCCAGCTGCC-------TTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTG-------CGGCAGCTCTTAAAGACAGTGGCGG-TCCTGGCGTGGGCTCTACGCGTAGTAACCTTGCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCC Erysiphe_arcuata_ex_Carpinus_AB252463 CAGAGCGTAAGG-CTCAGC-CATGGCATC--TGTCGTGT-GCTGG----GCCGA--CCCTCCCACCCGTGTCGATTTATA---TCTTGTTGCTTTGGCGGACCGGGCCCACCGGCTTCGGCTGGGGCGTGTCCGCCAGAGACTCCCCAAACTCAAGTTGTCTT----GCAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCC-TCGAGCT---ACTTT-GAT---GTGGCTCTGGTGTTGGGGCTCGCCGCGAT?CG-----CGGTGGCCCTTAAAGACAGTGGCGGGCTTCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GAGGCCCTGCC Erysiphe_arcuata_ex_Carpinus_AB252473 CAGAGCGTAAGG-CTCAGC-CATGGCATC--TGTCGTGT-GCTGG----GCCGA--CCCTCCCACCCGTGTCGATTTATA---TCTTGTTGCTTTGGCGGACCGGGCCCACCGGCTTCGGCTGGGGCGTGTCCGCCAGAGACTCCCCAAACTCAAGTTGTCTT----GCAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCC-TCGAGCT---ACTTT-GAT---GTGGCTCTGGTGTTGGGGCTCGCCGCGATACG-----CGGTGGCCCTTAAAGACAGTGGCGGGCTTCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GAGGCCCTGCC Erysiphe_arcuata_ex_Carpinus_AB252474 CAGAGCGTAAGG-CTCAGC-CATGGCATC--TGTCGTGT-GCTGG----GCCGA--CCCTCCCACCCGTGTCGATTTATA---TCTTGTTGCTTTGGCGGACCGGGCCCACCGGCTTCGGCTGGGGCGTGTCCGCCAGAGACTCCCCAAACTCAAGTTGTCTT----GCAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCC-TCGAGCT---ACTTT-GAT---GTGGCTCTGGTGTTGGGGCTCGCCGCGAT?CG-----CGGTGGCCCTTAAAGACAGTGGCGGGCTTCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GAGGCCCTGCC Erysiphe_australiana_ex_Lagerstroemia_AB022408 CTGAGCGTGTGAGACCAGC-CGTCGTGGCATCTGCTACGTGCGCGCTGCGTCGAACCCCTCC-ACCCGTGCCGACTTTAAT-GTTTTGTTGCTTTGGCGGACCGGAGCCACCGGCTTAGGCTGGAGCGCGTCCGCCAGAGACTTGCCCAACTCGTGTTGTCAT----ATAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGG?ATGCCTGTTCGAGCGTCATATCAACCCTCTCTCGAGCCACTG------TTTGTGTGGCTGCGGTGTTGGGGCTCGTCGATCAAACTAGACCGACGGCCCTTAAGACAAGTGGCGG-TCTCGGTGTAGGCTCTACGCGTAGTAT--TTGTTTCTCGCGACAGAACGACACT-GATGGCTGGCC 'Erysiphe carpi-laxiflorae ex Carpinus AB252470' CAGAGCGTGAGG-CCCAGT-CGTAGCACC--TGCTGCGG-TCGGG----GCCGA--CCCTCCCACCCGTGTCGACTTCTA---TCATGTTGCTTTGGCGGACCGGATTTCGTTATGAGAGCTGGGTCGCGTCCGCCAGAGACCCAAAATACGTATGTTGTCCCT---GTAGTCTAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCC-TCAAGCTCCCACTTT-GGTGGTGTGGCTTCGGTGTTGGAGCTGCGCCAGTTGC------TGGCGGCTCTGAAAGGCAGTGGCGG-TCCCAGCTTCGGCTCTACGCGTAGTAC-TTTG-TTCTCGCGACAGGGTGAGGCT-GACGACTTGCC 'Erysiphe carpi-laxiflorae ex Carpinus AB252471' CAGAGCGTGAGG-CCCAGT-CGTAGCACC--TGCTGCGG-TCGGG----GCCGA--CCCTCCCACCCGTGTCGACTTCTA---TCATGTTGCTTTGGCGGACCGGATTTCGTTATGAGAGCTGGGTCGCGTCCGCCAGAGACCCAAAATACGTATGTTGTCCCT---GTAGTCTAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCC-TCAAGCTCCCACTTT-GGTGGTGTGGCTTCGGTGTTGGAGCTGCGCCAGTTGC------TGGCGGCTCTGAAAGGCAGTGGCGG-TCCCAGCTTCGGCTCTACGCGTAGTAC-TTTG-TTCTCGCGACAGGGTGAGGCT-GACGACTTGCC 'Erysiphe carpi-laxiflorae ex Carpinus AB252472' CAGAGCGTGAGG-CCCAGT-CGTAGCACC--TGCTGCGG-TCGGG----GCCGA--CCCTCCCACCCGTGTCGACTTCTA---TCATGTTGCTTTGGCGGACCGGATTTCGTTATGAGAGCTGGGTCGCGTCCGCCAGAGACCCAAAATACGTATGTTGTCCCT---GTAGTCTAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCC-TCAAGCTCCCACTTT-GGTGGTGTGGCTTCGGTGTTGGAGCTGCGCCAGTTGC------TGGCGGCTCTGAAAGGCAGTGGCGG-TCCCAGCTTCGGCTCTACGCGTAGTAC-TTTG-TTCTCGCGACAGGGTGAGGCT-GACGACTTGCC Erysiphe_carpinicola_ex_Carpinus_AB252467 CAGAGCGTGAGG-CTCAGG-CGTGGCACC--TGCCGCGA-TCTGG----GCCGA--CCCTCCCACCCGTGTCGACTTCTA---TCTCGTTGCTTTGGCGGACCGGATCTCGTGATGAGGGCTGGGTCGCGTCCGCCAGAGACCGAAAACACGTATGTTGTTCCT---GTAGTCTAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCC-TCGAGCCCCCATTTCTGATGGTGTGGTTCCGGCGTTGGAGTGCGTCCCCGCG-------GGGCGCCTCTGAAAACCAGTGGCGG-TTCCGGCGTGAGCTCTACGCGTAGTAC-AATACTCCCCGCGACAGAGAGACGACCGGCGACTTGCC Erysiphe_carpinicola_ex_Carpinus_AB252468 CAGAGCGTGAGG-CTCAGG-CGTGGCACC--TGCCGCGA-TCTGG----GCCGA--CCCTCCCACCCGTGTCGACTTCTA---TCTCGTTGCTTTGGCGGACCGGATCTCGTGATGAGGGCTGGGTCGCGTCCGCCAGAGACCGAAAACACGTATGTTGTTCCT---GTAGTCTAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCC-TCGAGCCCCCATTTCTGATGGTGTGGTTCCGG?GTTGGAGTGCGTCCCCGCG-------GGGCGCCTCTGAAAACCAGTGGCGG-TTCCGGCGTGAGCTCTACGCGTAGTAC-AATACTCCCCGCGACAGAGAGACGACCGGCGACTTGCC Erysiphe_carpinicola_ex_Carpinus_AB252469 CAGAGCGTGAGG-CTCAGG-CGTGGCACC--TGCCGCGA-TCTGG----GCCGA--CCCTCCCACCCGTGTCGACTTCTA---TCTCGTTGCTTTGGCGGACCGGATCTCGTGATGAGGGCTGGGTCGCGTCCGCCAGAGACCGAAAACACGTATGTTGTTCCT---GTAGTCTAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCC-TCGAGCCCCCATTTCTGATGGTGTGGTTCCGG?GTTGGAGTGCGTCCCCGCG-------GGGCGCCTCTGAAAACCAGTGGCGG-TTCCGGCGTGAGCTCTACGCGTAGTAC-AATACTCCCCGCGACAGAGAGACGACCGGCGACTTGCC Erysiphe_flexuosa_ex_Aesculus_AB091774 CCGAGCGTGAGG-TCCAGT-CATGGCAAT--TGTCGTGT-GCTGG----ATCGA--CCCTCC-ACCCGTGTCGACTTATA----TTTGTTGCTTTGGCGGGCCGGGCCCACCGGCTTCGGCTGGAACGCGTCCGCCAGAGACTTTCCAAACTCATGTTATTCCT---GTAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATAACAACCCTC--TCGAGCTACCC----TTTTGGTGTGGCTGCGGTGTTGGGGCTCGCCGTAT---------CGGCGGCTCTTAAAGGTAGTGGCAG-TGCCGGCGTCGGCTTTACGCGTAGTAA-AAAACGACTCGCGACAGAGTGGCGAC-GGCGACTAGCC Erysiphe_friesii_ex_Rhamnus_AB000939 CCGAGTGCGAGG-CTCAGT-CGTGGCGTC--TGCTGCGT-GCTGG----GCCGA--CCCTCCCACCCGTGTCGATTTGTA---TCTTGTTGCTTTGGCGGGCCGGGCCCACCGGTTTCGACTGGAGCGCGCCCGCCAAAGACCC-AAAAACTCATGTTGTTTGT---GTCGTCTTAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCC--TCCAGCTGCC-------GTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGACG-------CGGCGGCCCTTAAAGACAGTGCCGG-TCCCGGCGTGGGCTCTACGCGTAGTAACCTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCC Erysiphe_glycines_ex_Desmodium_AB015927 CAGAGCGTGAGG-CTCAGTCGCTGGCATC--TGCCACGT-GCTGG----GCCGA--CCCTCCCACCCGTGTCGATTTTATA--GATTGTTGCTTTGGCGGGCCGGGCCCACCGGCTTTGGCTGGAGCGTGTCCGCCAAAGACCCAAAACTCTTATATTTGTCATG--GTAGTCTAAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCC--TCGAGCTACC-------GTTGTGTGGCTGTGGTGTTGGGGCTCGCCGCGTCTCG-----CGGTGGCTCTTAAAGACAGTGGCGG-TCCCGGCGTGGGCTCTACGCGTAGTAACCTTGATTCTCGCGACAGAGTGACGAC-GATGATCAGCC Erysiphe_gracilis_ex_Quercus_AB022358 CAGAGCGTGAGG-TCCAGC-CATAGCAGT--TGCCGTGT-GCTGG----ATCGA--CCCTCC-ACCCGTGTCGACTTATA--TTTTTGTTGCTTTGGCGGGCCGGGCCCACCGGCTTCGGCTGGGGCGCGTCCGCCAGAGACCCTCCAAACTCATGTTGTCCTT---GTAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCC--TCGAGCTACCA-----TTTTGTGTGGCTGCGGTGTTGGGGCTCGCCGAATC--------CGGTGGCCCTTAAAGGTAGTGGCGG-TGCCGACGTCAGCTTTACGCGTAGTAA----ATAGCTCGCGACAGAGCGGCGAC-AGCGACTAGCC Erysiphe_heraclei_ex_Daucus_AB000942 CAGAGTGCGAGG-CTCAGT-CGTGGCATC--TGCTGCGC-GCTGG----GCCGA--CCCTCCCACCCGTGTCGATTTGTA---TCTTGTTGCTTTGGCGGGCCGGGCCCACCGGTTTCGACTGGAGCGCGCCCGCCAAAGACCCAAAAAACTCATGTTGTCTGT---GTCGTCTTAGCTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGGATGCCTGTTCGAGCGTCATAACA-CCCCC--TCCAGCTGCC-------GTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATG-------CGGCGGCCCTTAAAGACAGTGGCGG-TCCCGGCGTGGGCTCTACGCGTAGTAACCTTGCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCC Erysiphe_japonica_ex_Swida_AB000941 CAGAGCGTGAGG-CTCAGT-CGTGGCATT--TGCCGCGT-GCTGG----GCCGA--CCCTCCCACCCGTGTCGATTTATA---TCTTGTTGCTTTGGCGGGCCGGGCCCGCCGGCTTCGGCTGGAGCGCGTCCGCCAAAGACCCAAAAAACTCATGTTATCATT---GCAGTCTAAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACACCCCC--TCCAGCTGCC-------TTTGCGTGGCTGCGGTGTTGGGGCACGTCGCGGTG-------CGACGGCCCTGAAAGACAGTGGCGG-TCCCGGCGTGGGCTCTACGCGTAGTAACCTTGCTTCTCGCGACAGAGTGACGACGGTTGGCTTGCC Erysiphe_mori_ex_Morus_AB000946 CAGAGCGTGAGG-TCCAGC-CGTGGCAGT--TGTCGCGC-GCTGG----ATCGA-CCCTCCACACCCGTGTCGACTTGTA-TTTTTTGTTGCTTTGGCGGGCCGGGCCCACCGGCTTCGGCTGGAGCGCGTCCGCCAGAGACCTCCCAAACTCATGTTGTCCCCCT-GTAGTCTAAGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCC--TCGAGCTACCA-----TTCTGTGTGGCTGCGGTGTTGGGGCTCGCCGCATT--------TGGCGGCCCTTAAAGACAGTGGCGG-TACCGGCGCCGGCTCTACGCGTAGTAA----AAGACTCGCGACAGAGTGGCGATGGGCGACTAGCC Erysiphe_necator_ex_Vitis_AF073346 CAGAGCGAGAGG-CTCAGC-CATGACGGT--AGTCGTGT-GCTGG----GTCGA--CCCTCCCACCCGTGCCGATATGTA---TTTTGTTGCTTTGGCGGGCCGGGCCCACCGGCTTCGGCTGGAGCGTGCCCGCCAGAGACCTTCCAAACTCACGTTGTCAT----GTAGTCTAAGCTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCC--TCAAGCTGCCC------TTGTGGTGGCTTCGGTGTTGGGGCTCGTCGCAGTTTTG----CGCTGGCCCTTAAAGACAGTGGCGG-TCCCCGCGTGGGCTCTACGCGTAGTAA-CTTGTTCCTCGCGACAGAGTGACGCT-CGTGATCAGCC Erysiphe_prunastri_ex_Prunus_AB046983 CAGAGCGTGAGG-TTCAGC-CATGGCAAC--TGTCATGC-GCTGG----ATCGA--CCCTCC-ACCCGTGTCGACTTTATATATTTTGTTGCTTTGGCAGACCGGATCCACTGGCTTCGGCTGGAGCGCGTCCGCCAGAGACCTTCCAAACTCATGTTATCCCT---GTAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACAACCCCC--TCGAGTCATCC---TGTGTGGTGTGGCTGCGGTGTTGGGGCTCGCTGCATCGG------TGGCGGCCCTTAAAGGCAGTGGCGG-TACCGGCGTCGGCTTTACGCGTAGTAG----AAGACTCGCGACAGAGTGATGAC-GGTGACTAGCC Erysiphe_pseudocarpinicola_ex_Carpinus_AB252464 CAGAGCGTGATG-CTCAGGCCGTAGCATC--TGCTGCGG-GCTGG----GCCGA--CCCTCCCACCCGTGTCGACTTCTA---TCTCGTTGCTTTGGCGGACCGGATCTCGTGATGAGGGCTGGGTCGTGTCCGCCAGAGGATGAAAACACGTATGTCGTACCT---GTAGTCTAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCCC-TCGAGCCCCCATTTCTGGTGGTGTGGTTCCGGTGTTGGAGTGCGTCACGCTG-------TGGCGCCTCTGAAAGACAGTGGCGG-TTCCGGCGTGAGCTCTACGCGTAGTAC-ATTACTTCCCGCGACAGA?AGACGGACGGCGACTTGCC Erysiphe_pseudocarpinicola_ex_Carpinus_AB252465 CAGAGCGTGAAG-CCTAGT-CGTCGCATC--AGCGGCGT-GCTGG----GCCGA--CCCTCCCACCCGTGTCGATTTGTA---TTTTGTTGCTTTGGCGGGCCGGGCCCACCGGCTTCGGCTGGAGCGTGCCCGCCAGAGACTCACCAAACTCATGTTGTCTT----GCAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCC--TCAAGCTGCC-------TTGGTGTGGCTATGGTGTTGGGGCTCGCCGATTCG-------CGGCGGCTCTTAAAGAAAGTGGCGA-TCCGAGTGTGGGCTCTACGCGTAGTAC--TTGCTTCTCGCGACAGAGTGACGCC-GAGGATCCGCC Erysiphe_pseudocarpinicola_ex_Carpinus_AB252466 CAGAGCGTGAAG-CCTAGT-CGTCGCATC--AGCGGCGT-GCTGG----GCCGA--CCCTCCCACCCGTGTCGATTTGTA---TTTTGTTGCTTTGGCGGGCCGGGCCCACCGGCTTCGGCTGGAGCGTGCCCGCCAGAGACTCACCAAACTCATGTTGTCTT----GCAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCC--TCAAGCTGCC-------TTGGTGTGGCTATGGTGTTGGGGCTCGCCGATTCG-------CGGCGGCTCTTAAAGAAAGTGGCGA-TCCGAGTGTGGGCTCTACGCGTAGTAC--TTGCTTCTCGCGACAGAGTGACGCC-GAGGATCCGCC Erysiphe_simulans_ex_Rosa_AB015926 CAGAGCGTGAGG-TCCAGC-CATGGCACTAGTGTCGTGC-GTTGG----ATCGA--CCCTCC-ACCCGTGTCGACTTATA--ATTTTGTTGCTTTGGCGGGCCGGGCCCACCGGCTTCGGCTGGAGCGTGCCCGCCAGAGACCTCCCAAACTCATGTTGTCCCT---GTAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACAACCCCC--TCGAGCTACCA-----TTTTGTGTGGCTCCGGTGTTGGGGCTCGCTGCAG---------TGGCGGCCCTTAAAGGCAGTGGCGG-TGTCGACGTCGGCTTTACGCGTAGTAA----ATAACTCGCGACAGAGTGGCGAC-GGCAACTAGCC Erysiphe_sp._ex_Carpinus_laxiflora_MUMH3694 ----------------------------------------------------------------------------------------TTGCTTTGGCGGGCCGGGCCCACCGGCTTCGGCTGGAGCGCGTCCGCCAGAGACCTCTCAAACTCATGTTGTTTTTT--GTAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCTC--TCGAGCT---ACTTT--GT--TGTGGCTGCGGTGTTGGAGCTCGTCGAGAAAT------CGGCGGCTCTTAAAGACAGTGGCGG-ACCCGACGTGGGCTCTACGCGTAGTAC-CTTGCTTCTCGCGACAGAGTGACGAC-GGCGACTTGCC Erysiphe_togashiana_ex_Styrax_AB091775 CAGAGTGCGAGG-CTCAGG-CGTGGCATC--AGCTGCGG-TCTGG----G?CGA--CCCTCCCACCCGTGTCGACTTCTA---TCGTGTTGCTTTGGCGGCCCGGATCTCGTGATGAGGGCTAGGTCGCGGCCGCCAGAGACCCAAAATACGCATGTTGTTCCT---GTAGTCT??AGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCC--TCGAGCTGCCC--GGTTGTGGTGTGGCTCCGGTGTCGGAGTGCGTCGCGTGT-------CGGCGGCTCTGAAAGACAGTGGCGG-TCTCGGCGTGAGCTCTACGCGTAGTAC-TTTACTTCTCGCGACAGAGAGACGAC-GGTGACTTTGT Erysiphe_wadae_ex_Fagus_AB091776 CAGAGCGTGAGG-TCCAGCCAATGGCAGT--TGTCGTGC-GCTGG----ATCGA--CCCTCC-ACCCGTGTCGACTTATA--TTTTTGTTGCTTTGGCGGGCCGGGCCCACCGGCTTCGGCTGGAGCGTGCTCGCCAGAGACTTCCCAAACTCATGTGCAGTCTCT-GTAGTCTAAGGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCTC--TCGCGCTACCA-----TTTAGTGTGGCGGCGGTGTTGGGGCTCGCCGGAG---------TGGCGGCCCTTAAAAATAGTGGCGG-TGCCGACGTCGGCTTTACGCGTAGTAG----AAGACTCGCGACAGAGTGGCGAC-GGCGACTAGCC Typhulochaeta_japonica_ex_Quercus_AB022416 CAGAGCGAGAGG-TCCAGC-CATGGCAGT--TGTCGTGC-GCTGG--ATCTCGA--CCCTCC-ACCCGTGTCGACTTGTA--TTTTTGTTGCTTTGGCGGGCCGGGTCCACCGGCTTAGGCTGGAGCGCGTCCGCCAGAGACCTCCCAAACTCATGTTGTCCCCCCTGTTGTCTAAGGAAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCC--TCGAGCTACCA----TTTTTGTGTGGCTACGGTATTGGGGCTCGCTGAATCT-------CGGCGGCCCTTAAAGGCAGTGGCGG-GGCTAACGTCGGCTCTACGCGTAGTAA-TAGATAGCTCGCGACAGAGCGGCGAC-AGCGACTAGCC ; END; BEGIN TREES; TITLE Tb8796; LINK TAXA = Taxa2; TRANSLATE 1 Erysiphe_australiana_ex_Lagerstroemia_AB022408, 2 Erysiphe_adunca_ex_Salix_D84383, 3 Erysiphe_adunca_ex_Populus_AF011324, 4 Erysiphe_prunastri_ex_Prunus_AB046983, 5 Erysiphe_necator_ex_Vitis_AF073346, 6 Brasiliomyces_trina_ex_Quercus_AB022351, 7 Typhulochaeta_japonica_ex_Quercus_AB022416, 8 Erysiphe_togashiana_ex_Styrax_AB091775, 9 Erysiphe_flexuosa_ex_Aesculus_AB091774, 10 Erysiphe_simulans_ex_Rosa_AB015926, 11 Erysiphe_wadae_ex_Fagus_AB091776, 12 Erysiphe_gracilis_ex_Quercus_AB022358, 13 Erysiphe_mori_ex_Morus_AB000946, 14 Erysiphe_japonica_ex_Swida_AB000941, 15 Erysiphe_pseudocarpinicola_ex_Carpinus_AB252465, 16 Erysiphe_pseudocarpinicola_ex_Carpinus_AB252466, 17 Erysiphe_pseudocarpinicola_ex_Carpinus_AB252464, 18 Erysiphe_carpinicola_ex_Carpinus_AB252468, 19 Erysiphe_carpinicola_ex_Carpinus_AB252467, 20 Erysiphe_carpinicola_ex_Carpinus_AB252469, 21 'Erysiphe carpi-laxiflorae ex Carpinus AB252470', 22 'Erysiphe carpi-laxiflorae ex Carpinus AB252471', 23 'Erysiphe carpi-laxiflorae ex Carpinus AB252472', 24 Erysiphe_arcuata_ex_Carpinus_AB252474, 25 Erysiphe_arcuata_ex_Carpinus_AB252473, 26 Erysiphe_arcuata_ex_Carpinus_AB252463, 27 Erysiphe_sp._ex_Carpinus_laxiflora_MUMH3694, 28 Erysiphe_friesii_ex_Rhamnus_AB000939, 29 Erysiphe_glycines_ex_Desmodium_AB015927, 30 Erysiphe_aquilegiae_ex_Cimicifuga_AB000944, 31 Erysiphe_heraclei_ex_Daucus_AB000942; TREE Fig._2 = [&R] (((((((((31,28),30),14),(29,((26,25,24),(16,15)))),((23,22,21),(((20,19,18),17),8))),((13,(((12,(7,6)),(11,10)),(9,4))),5)),27),(3,2)),1); END; BEGIN TREES; TITLE Tb8795; LINK TAXA = Taxa1; TRANSLATE 1 Erysiphe_australiana_ex_Lagerstroemia_AB022407, 2 Erysiphe_adunca_ex_Salix_AB022374, 3 Typhulochaeta_japonica_ex_Quercus_AB022415, 4 Erysiphe_simulans_ex_Rosa_AB022395, 5 Erysiphe_mori_ex_Morus_AB022418, 6 Brasiliomyces_trina_ex_Quercus_AB022350, 7 Erysiphe_gracilis_ex_Quercus_AB022357, 8 Erysiphe_pseudocarpinicola_ex_Carpinus_AB252466, 9 Erysiphe_pseudocarpinicola_ex_Carpinus_AB252465, 10 Erysiphe_pseudocarpinicola_ex_Carpinus_AB252464, 11 Erysiphe_carpinicola_ex_Carpinus_AB252468, 12 Erysiphe_carpinicola_ex_Carpinus_AB252467, 13 Erysiphe_carpinicola_ex_Carpinus_AB252469, 14 'Erysiphe carpi-laxiflorae ex Carpinus AB252471', 15 'Erysiphe carpi-laxiflorae ex Carpinus AB252470', 16 'Erysiphe carpi-laxiflorae ex Carpinus AB252472', 17 Erysiphe_arcuata_ex_Carpinus_AB252474, 18 Erysiphe_arcuata_ex_Carpinus_AB252473, 19 Erysiphe_arcuata_ex_Carpinus_AB252463, 20 Erysiphe_sp._ex_Carpinus_MUMH3694, 21 Erysiphe_friesii_ex_Rhamnus_AB022382, 22 Erysiphe_alphitoides_ex_Quercus_AB292699, 23 Erysiphe_monoascigera_ex_Styrax_MUMH_3786, 24 Erysiphe_nomurae_ex_Symplocos_MUMH_275, 25 Erysiphe_pulchra_ex_Swida_AB022389, 26 Erysiphe_glycines_ex_Desmodium_AB022397, 27 Erysiphe_heraclei_ex_Daucus_AB022391, 28 Erysiphe_aquilegiae_ex_Cimicifuga_AB022405, 29 Erysiphe_paeoniae_ex_Paeonia_AB257438, 30 Erysiphe_abbreviata_ex_Quercus_AB271785, 31 Erysiphe_hypogena_ex_Quercus_AB292726, 32 Erysiphe_hypogena_ex_Quercus_AB292727, 33 Erysiphe_hypogena_ex_Quercus_AB292725, 34 Erysiphe_epigena_ex_Quercus_AB292722, 35 Erysiphe_epigena_ex_Quercus_AB292720, 36 Erysiphe_epigena_ex_Quercus_AB292717, 37 Erysiphe_epigena_ex_Quercus_AB292718, 38 Erysiphe_sp._ex_Quercus_AB292711, 39 Erysiphe_sp._ex_Quercus_AB292712, 40 Oidium_phyllanthi_ex_Phyllanthus_AB120754, 41 Oidium_phyllanthi_ex_Phyllanthus_AB120755, 42 Oidium_phyllanthi_ex_Phyllanthus_AB120758, 43 Arthrocladiella_mougeotii_ex_Lycium_AB022379, 44 Arthrocladiella_mougeotii_ex_Lycium_AB329690, 45 Neoerysiphe_cumminsiana_ex_Cacalia_AB329669, 46 Neoerysiphe_galii_ex_Galium_AB329682, 47 Neoerysiphe_galii_ex_Galium_AB329681, 48 Neoerysiphe_galeopsidis_ex_Acanthus_AB329670, 49 Neoerysiphe_galeopsidis_ex_Chelonopsis_AB022369, 50 Neoerysiphe_galeopsidis_ex_Lamium_AB329674, 51 Oidium_aloysiae_ex_Aloysia_AB329683, 52 Oidium_maquii_ex_Aristotelia_AB329686, 53 Oidium_baccharidis_ex_Baccharis_AB329684, 54 Golovinomyces_orontii_ex_Nicotiana_AB022412, 55 Golovinomyces_cichoracearum_ex_Eupatorium_AB022387, 56 Golovinomyces_cichoracearum_ex_Solidago_AB077650, 57 Golovinomyces_cichoracearum_ex_Aster_AB077641, 58 Golovinomyces_cichoracearum_ex_Dahlia_AB077628, 59 Golovinomyces_orontii_ex_Physalis_AB077646, 60 Golovinomyces_adenophorae_ex_Adenophora_AB077632, 61 Byssoascus_striatisporus_U17912, 62 Caespitotheca_forestalis_ex_Schinopsis_AB193467, 63 Parauncinula_septata__ex_Quercus_AB183533, 64 Parauncinula_septata_ex_Quercus_AB022420, 65 Blumeria_graminis_ex_Bromus_AB022362, 66 Blumeria_graminis_ex_Triticum_AB022376, 67 Blumeria_graminis_ex_Hordeum_AB022399, 68 Cystotheca_lanestris_ex_Quercus_AB022353, 69 Cystotheca_wrightii_ex_Quercus_AB022355, 70 Podosphaera_filipendulae_ex_Filipendula_AB022384, 71 Podosphaera_pannosa_ex_Rosa_AB022347, 72 Podosphaera_tridactyla_ex_Prunus_AB022393, 73 Podosphaera_longiseta_ex_Prunus_AB022423, 74 Podosphaera_xanthii_ex_Melothria_AB022410, 75 Sawadaea_tulasnei_ex_Acer_AB022366, 76 Sawadaea_polyfida_ex_Acer_AB022364, 77 Golovinomyces_orontii_ex_Rubia_AB077634, 78 Golovinomyces_sordidus_ex_Plantago_AB077657, 79 Golovinomyces_orontii_ex_Veronica_AB077651, 80 Pleochaeta_turbiana_ex_Platycyamus_AB218773, 81 Pleochaeta_shiraiana_ex_Celtis_AB022403, 82 Leveillula_saxaouli_ex_Haloxylon_AB080469, 83 Leveillula_sp._ex_Chondrilla_AB080478, 84 Leveillula_taurica_ex_Artemisia_AB080470, 85 Phyllactinia_fraxini_ex_Syringa_AB080436, 86 Phyllactinia_fraxini_ex_Fraxinus_AB080451, 87 Phyllactinia_guttata_ex_Morus_AB080372, 88 Phyllactinia_guttata_ex_Euptelea_AB080388, 89 Phyllactinia_guttata_ex_Alnus_AB080452, 90 Phyllactinia_guttata_ex_Hamamelis_AB080410, 91 Phyllactinia_guttata_ex_Diospyros_AB022372, 92 Erysiphe_hypophylla_ex_Quercus_AB292716, 93 Erysiphe_hypophylla_ex_Quercus_AB292715, 94 Erysiphe_quercicola_ex_Quercus_AB292694, 95 Erysiphe_quercicola_ex_Quercus_AB292691, 96 Erysiphe_quercicola_ex_Quercus_AB197135, 97 Erysiphe_alphitoides_ex_Quercus_AB257431, 98 Erysiphe_alphitoides_ex_Quercus_AB237811, 99 Erysiphe_alphitoides_ex_Quercus_AB292707; TREE Fig._1 = [&R] ((((((((((91,90),((89,88),87)),(86,85))Phyllactinia,((84,83),82)Leveillula),80),81)Tribe_Phyllactinieae,((((((((79,78),77,54),60),59),((58,57,55),56))Golovinomyces,(44,43)Arthrocladiella),((53,(((52,51),45),((50,49,48),(47,46))))Neoerysiphe,(42,(41,40))Oidium_phyllanthi)),(((((((((((((24,23),((96,95,94),(27,21))),(22,99,98,97),(39,38)),(93,92)),30),(((37,36),(33,32,31)),(35,34))),28),25),29),(((26,(9,8)),20),((((16,14),15),((13,12,11),10)),(((7,(6,4)),3),5)))),((19,17),18)),2),1)Tribe_Erysipheae)),((((76,75)Sawadaea,(69,68)Cystotheca),((74,(73,72)),(71,70))Podosphaera)Tribe_Cystotheceae,((67,66),65)Tribe_Blumerieae)),((64,63),62)),61); END;