#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 3:33 GMT TreeBASE (cc) 1994-2008 Study reference: Jaklitsch W.M., & Voglmayr H. 2016. Hidden diversity in Thyridaria and a new circumscription of the Thyridariaceae. Studies in Mycology, 85: 35-64. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S19648] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=89; TAXLABELS 'Alternaria alternata CBS_916.96' 'Amniculicola lignicola CBS_123094' Anteaglonium_parvulum_SMH5223 'Arthopyrenia salicis CBS_368.94' 'Cyclothyriella rubronotata CBS_419.85' Cyclothyriella_rubronotata_TR Cyclothyriella_rubronotata_TR1 Cyclothyriella_rubronotata_TR3 Cyclothyriella_rubronotata_TR9 Cyclothyriella_rubronotata_TR9a 'Dendryphion europaeum CPC_22943' 'Herpotrichia diffusa CBS_250.62' Hobus_wogradensis_TI 'Karstenula rhodostoma CBS_690.94' 'Leptosphaeria doliolum CBS_505.75' 'Lophiostoma macrostomum KT_508' 'Lophiotrema nucula CBS_627.86' Massaria_campestris_M28 Massaria_inquinans_M19 'Massarina eburnea CBS_473.64' 'Massariosphaeria phaeospora CBS_611.86' 'Mauritiana rhizophorae BCC_28866' 'Melanomma pulvis pyrius CBS_124080' 'Neooccultibambusa chiangraiensis MFLUCC_12_0559' 'Neoroussoella bambusae MFLUCC_11_0124' Nigrograna_fuscidula_MF1 Nigrograna_fuscidula_MF1a Nigrograna_fuscidula_MF3 Nigrograna_fuscidula_MF7 Nigrograna_fuscidula_MF8 Nigrograna_fuscidula_MF9 'Nigrograna mackinnonii CBS_110022' 'Nigrograna mackinnonii CBS_674.75' Nigrograna_mackinnonii_E9303e Nigrograna_mycophila_MF5 Nigrograna_mycophila_MF6 Nigrograna_mycophila_TDK Nigrograna_norvegica_TR8 Nigrograna_obliqua_BW4 Nigrograna_obliqua_KE Nigrograna_obliqua_MF2 Nigrograna_obliqua_MRP 'Occultibambusa bambusae MFLUCC_13_0855' 'Occultibambusa fusispora MFLUCC_11_0127' 'Occultibambusa pustula MFLUCC_11_0502' Ohleria_modesta_MGC Ohleria_modesta_OM 'Paradictyoarthrinium diffractum MFLUCC_13_0466' 'Paradictyoarthrinium tectonicola MFLUCC_13_0465' 'Parathyridaria percutanea CBS_128203' 'Parathyridaria percutanea CBS_868.95' Parathyridaria_ramulicola_MF4 Parathyridaria_ramulicola_MRR1 'Pleomassaria siparia CBS_279.74' 'Roussoella angustior MFLUCC_15_0186' 'Roussoella chiangraina MFLUCC_10_0556' 'Roussoella hysterioides CBS_546.94' 'Roussoella intermedia NBRC_106245' 'Roussoella japanensis MAFF_239636' 'Roussoella magnatum MFLUCC_15_0185' 'Roussoella mexicana CPC_25355' 'Roussoella neopustulans MFLUCC_11_0609' 'Roussoella nitidula MFLUCC_11_0182' 'Roussoella nitidula MFLUCC_11_0634' 'Roussoella pustulans MAFF_239637' 'Roussoella scabrispora MFLUCC_11_0624' Roussoella_scabrispora_RSC 'Roussoella siamensis MFLUCC_11_0149' 'Roussoella sp. CBS_170.96' 'Roussoella thailandica MFLUCC_11_0621' 'Roussoella verrucispora CBS_125434' 'Roussoellopsis macrospora MFLUCC_12_0005' 'Roussoellopsis sp. NBRC_106246' 'Roussoellopsis tosaensis MAFF_239638' 'Seriascoma didymospora MFLUCC_11_0179' Teichospora_trabicola_C134 'Tetraplosphaeria sasicola HHUF_27566' 'Thyridaria acaciae CBS_138873' Thyridaria_broussonetiae_TB Thyridaria_broussonetiae_TB1 Thyridaria_broussonetiae_TB1a Thyridaria_broussonetiae_TB2 'Torula herbarum CBS_111855' 'Torula herbarum CBS_140066' 'Torula hollandica CBS_220.69' 'Trematosphaeria pertusa CBS_122368' Ulospora_bilgramii_CBS_110020 'Versicolorisporium triseptatum JCM_14775' 'Westerdykella ornata CBS_379.55' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=89; TAXLABELS 'Alternaria alternata CBS_916.96' 'Amniculicola lignicola CBS_123094' Anteaglonium_parvulum_SMH5223 'Arthopyrenia salicis CBS_368.94' 'Cyclothyriella rubronotata CBS_419.85' Cyclothyriella_rubronotata_TR Cyclothyriella_rubronotata_TR1 Cyclothyriella_rubronotata_TR3 Cyclothyriella_rubronotata_TR9 Cyclothyriella_rubronotata_TR9a 'Dendryphion europaeum CPC_22943' 'Herpotrichia diffusa CBS_250.62' Hobus_wogradensis_TI 'Karstenula rhodostoma CBS_690.94' 'Leptosphaeria doliolum CBS_505.75' 'Lophiostoma macrostomum KT_508' 'Lophiotrema nucula CBS_627.86' Massaria_campestris_M28 Massaria_inquinans_M19 'Massarina eburnea CBS_473.64' 'Massariosphaeria phaeospora CBS_611.86' 'Mauritiana rhizophorae BCC_28866' 'Melanomma pulvis pyrius CBS_124080' 'Neooccultibambusa chiangraiensis MFLUCC_12_0559' 'Neoroussoella bambusae MFLUCC_11_0124' Nigrograna_fuscidula_MF1 Nigrograna_fuscidula_MF1a Nigrograna_fuscidula_MF3 Nigrograna_fuscidula_MF7 Nigrograna_fuscidula_MF8 Nigrograna_fuscidula_MF9 'Nigrograna mackinnonii CBS_110022' 'Nigrograna mackinnonii CBS_674.75' Nigrograna_mackinnonii_E9303e Nigrograna_mycophila_MF5 Nigrograna_mycophila_MF6 Nigrograna_mycophila_TDK Nigrograna_norvegica_TR8 Nigrograna_obliqua_BW4 Nigrograna_obliqua_KE Nigrograna_obliqua_MF2 Nigrograna_obliqua_MRP 'Occultibambusa bambusae MFLUCC_13_0855' 'Occultibambusa fusispora MFLUCC_11_0127' 'Occultibambusa pustula MFLUCC_11_0502' Ohleria_modesta_MGC Ohleria_modesta_OM 'Paradictyoarthrinium diffractum MFLUCC_13_0466' 'Paradictyoarthrinium tectonicola MFLUCC_13_0465' 'Parathyridaria percutanea CBS_128203' 'Parathyridaria percutanea CBS_868.95' Parathyridaria_ramulicola_MF4 Parathyridaria_ramulicola_MRR1 'Pleomassaria siparia CBS_279.74' 'Roussoella angustior MFLUCC_15_0186' 'Roussoella chiangraina MFLUCC_10_0556' 'Roussoella hysterioides CBS_546.94' 'Roussoella intermedia NBRC_106245' 'Roussoella japanensis MAFF_239636' 'Roussoella magnatum MFLUCC_15_0185' 'Roussoella mexicana CPC_25355' 'Roussoella neopustulans MFLUCC_11_0609' 'Roussoella nitidula MFLUCC_11_0182' 'Roussoella nitidula MFLUCC_11_0634' 'Roussoella pustulans MAFF_239637' 'Roussoella scabrispora MFLUCC_11_0624' Roussoella_scabrispora_RSC 'Roussoella siamensis MFLUCC_11_0149' 'Roussoella sp. CBS_170.96' 'Roussoella thailandica MFLUCC_11_0621' 'Roussoella verrucispora CBS_125434' 'Roussoellopsis macrospora MFLUCC_12_0005' 'Roussoellopsis sp. NBRC_106246' 'Roussoellopsis tosaensis MAFF_239638' 'Seriascoma didymospora MFLUCC_11_0179' Teichospora_trabicola_C134 'Tetraplosphaeria sasicola HHUF_27566' 'Thyridaria acaciae CBS_138873' Thyridaria_broussonetiae_TB Thyridaria_broussonetiae_TB1 Thyridaria_broussonetiae_TB1a Thyridaria_broussonetiae_TB2 'Torula herbarum CBS_111855' 'Torula herbarum CBS_140066' 'Torula hollandica CBS_220.69' 'Trematosphaeria pertusa CBS_122368' Ulospora_bilgramii_CBS_110020 'Versicolorisporium triseptatum JCM_14775' 'Westerdykella ornata CBS_379.55' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M37463] TITLE 'Thyridaria combined ITS-LSU-SSU-rpb2-tef1'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=4877; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Alternaria alternata CBS_916.96' -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCGGAGGAAAAGAAACCA?CAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTT------AGAGTCCGAGTTGTAATTTGCAGAGGGCGC-TTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGG-TTTCT-ACCCG-GTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGG-ATAAAGGTCTCTGTCACGTACCTCCTTTC--GGGGAGGCCTTATAGGG-GAGACGACATACTACCAGCCTGGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGC---------AAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTT-TTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCC-TTCCTT-CTGAAGAACCTCATGCCCTTCACTGGGCGTGCTGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAACCGATACACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAA------GAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCG------GAGCGA---TCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGCCTATACTCATTGCGAGATTCATCCGGCTATGATTCTCGGTATCTGTGCCAGTATCAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTCCTCGCTTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCATCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTC?GTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCTGGTTACGCCCCAGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATG 'Amniculicola lignicola CBS_123094' --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--CCTT-----GGGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGTATTAGCTGTGGTCTAAGACCCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTATGTGGCCAGCAGCTCTTGCCTTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGTTCATCTAGG-CTCTT-GCCTA-GTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCAGGCGGTCGG-ATAAAGGCCTTGGGAATGTGGCTCCTTTC--GGGGAGTG-TTATAGCCCAGGGTGCCATGCGGCCAGCCTGAACTGAGG-TCCGCGCTTCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAGCCAATGCCC-TCCGGGGCTC-TTTGGTGATTCATAGTAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGT-CGGCCGGGCCTTTCCTT-CTGGAGAACCCCATGCCCTTCACTGGGTGTGCGGGGGAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGATCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTGGGGATCGGTCGATGTTTCTATCTTGACTCGCTCGGCACCCTTGTTCCGAGTTCTCTTCGTCAAGCTGGGCAAGGATGTATACAAATACCTCCAGCGATGCGTTGAAAACAATCAGGAGTTTAACGTTCAGATGGCGGTTAAGGCTAGCGTTATTACCAATGGTCTCAAGTATTCTTTGGCCACTGGAAATTGGGGCGATCAGAAGAAGGCGGCTGCCGCGAAAGCGGGTGTATCACAGGTGCTCAACAGGTACACCTATGCATCTACGCTTTCGCATTTGCGACGAACAAATACACCAGTCGGACGTGATGGCAAACTCGCCAAACCCCGTCAGCTACACAACACTCATTGGGGTCTCGTGTGCCCTGCTGAGACACCAGAAGGACAAGCTTGTGGTCTGGTGAAGAATCTCTCTCTCATGTGCTACGTCAGTGTTGGAAGCGAAAGCACACCTATTACCGACTTCATGAGTCAGCGCCAGATGGAATTGCTAGAAGAGTACGACCCAGTCGTCAACCCTAGCGCTACCAAAGTCTTCGTTAACGGTGTTTGGGTGGGTGTTCACACGAACCCAACGCAGCTTGTGCAAGTCGTGCAAGAGCTCCGACGGAACGGAGTACTGTCTTACGAGATGAGTCTTGTTCGAGACATCCGAGACCGCGAGTTCAAGATCTTCACAGACGCCGGTCGAGTGATGAGGCCGCTGTTCGTTGTCGAGACAGATTACCGAAAGCCTACTCGCGGAAGTCTAATCCTCAACAAGACTCATATCCAGAAACTGCTGGACGACAAAGACCAAGCTGGAGAGCTTGCA------GGGATGAACGATGCTGACCGAGCTATGAATACGTTCGGTTGGAAGGGTCTAATTCATAGTGGTTGTATCGAGTATCTGGACGCAGAAGAGGAAGAGACAGCTATGATAGTCATGACTCCTGAGGATCTTGAGGACCACCGGAACC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCTCGCCTACACTCTGGGTGTGA?GCAGCTCATTGTTGCCATCAACAAGATGGACACCACCAAGTGGACCGAGGACCGCTTCCAGGAGATTATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTCCCCTTTGTCCCCATCTCTGGCTTCAACGGTGACAACATGATCGAGCCCTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGTCCACTGGCAAGACCCTCCTCGAGGCCATCGATGCCATTGATCCCCCGTCCCGTCCCTCCGACAAGCCCCTCCGCCTGCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTGGAGATGCACCACGAGCAGCTTGTCGAGGGTGTC---CCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGACCCGCCCAAGGGTGCTGAGTCCTTCAACGCTCAGGTCATCGTCCTTAACCACCCCGGTCAGGTCGGTGCTGGTTACGCTCCCGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGATCGCCGAACTGGCAAGTCTGTTGA?GACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATG Anteaglonium_parvulum_SMH5223 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--CCCT-----GGGTGCCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGCGTCGGCAGCGGCCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAACCCCGTACGTGGCCGCCCGCCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCGGTTGTTC-------------------------TTCTTCCGTGGGCAGGCCAGCATCAGTCTGGGCGGTCGG-ATAAAGGCCTCGGGAATGTAGCTCTCTTC--GGGGAGTG-TTATAGCCCGGGGCGCCATGCGGCCAGCTCGGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCC---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTCGCCTACACTCTCGGTGTCAAGCAACTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGTTTCAACGAGATCATCAAGGAGACCTCCAATTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGCCCTCCAGCAACGCCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCGTCTGGCAAGACCCTCCTCGAGGCCATTGACGCCATCGACACCCCGTCCCGCCCGGTTGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGCC---GTC---CGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCTTCCAACGTCACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAACAGCTCGCCGATGGTGGCAAGCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCTGGTGACTCTAAGAACGACCCGCCCAAGGGTGCCGATTCTTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTATGCCC----------------------------------------------------------------------------------------------------------------------------------------- 'Arthopyrenia salicis CBS_368.94' CCGCCACACGCG-------TTTATCACCCTTG--ACTTTGAGCACC-----TTTCGTTTCCTCGGCGGGTT-CGC-------CCGCCA-----------------GC-GAGGACCCC---------CCAAA-CCCTTT-GTAAT--AGCAATATTTGTCTGAAAAA----CAACCAATAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-ACCCCTCAAGCCTAGCTTGGTATTGGGTGCTTGTCCCGC--CTCTCGCGCGGCGACTCACCTCAAAGTCA-TTGGCAGCCCGCATCTCGCCG---GCCGTGAGCGCAGCAC----AGAC-GCGCTC--TTGGCAACGGT-GGATCGGCTCTCCAAAAG-C-----------TTATTTCAACCACTGACC??????????????????AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGTGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCCATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACGACCAGCCTGAACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCT------------------------------------------------------------------------------------------------------GCGAGCGTCATCACGAACGGATTGAAGTACTCCCTCGCCACTGGTAACTGGGGTGACCAGAAGAAGGCGGCTTCAGCAAAGGCTGGAGTATCTCAGGTGTTGAACAGGTATACATATGCCTCAACTCTATCCCATCTTCGTCGTACGAATACCCCAATTGGACGTGATGGAAAGCTCGCCAAACCGCGCCAGCTACACAACACCCATTGGGGTTTGGTGTGTCCTGCTGAGACTCCCGAAGGTCAGGCTTGTGGTTTGGTCAAGAATCTGTCCTTGATGTGCTACGTCAGTGTTGGGTCCGAGAGTACTCCAATCACTGACTTCATGAGCCAACGAAACATGGACCTTCTTGAAGAGTATGATCCTGTGGTTAATCCGTCAGCGACCAAGGTCTTTGTCAACGGTGTATGGGTGGGTGTTCACTCACAGCCTTCGCAACTCGTATCCGTGGTGCAAGAGCTCCGACGTAACGGAACTCTATCATACGAGATGAGTTTGGTCAGAGACATCCGAGATCGAGAGTTCAAAATCTTCACAGACGCAGGCCGCGTCATGCGACCGTTGTATATCGTCGAAACGGACTATCGCAAACCCAATCGCGGATCTCTAGTTCTCAACAAGGGTCACATTCAAAAGCTTATCGATGACACCATG------ATCGATACCTCA------GGTTATAACGACGAAGACGCTCAGGCCATGAAATTCGGTTGGAAGGGGCTCCTGCACGGTGGTGTAGTAGAGTACCTAGACGCAGAAGAAGAGGAAACATCTATGATCATCATGACACCTGAGGATCTTAGCGAACATCGCGACCTCATGCAAGGTATTCCTGCGCCC------GATGCA---CCTTCGGAGG------ATCGTCATAGGCGAATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTCGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGTCTGAGTCCCGTTTCCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCAAGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAAGCCTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTACCGGAAAGACCCTCCTCGAGGCCATCGATGCCATCGACAACCCCGTCCGTCCCTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCATCACGAGCAGCTCGTCGAGGGTGTT---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGAAACGTCGCTGGTGACTCCAAGAACGATCCCCCCAAGGGCGCCGACTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTCGGTGCTGGATACGCTCCCGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTACTGAGAGCAGCCCTAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATG 'Cyclothyriella rubronotata CBS_419.85' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGCATGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGG-CTCTT-GCCTG-GGGCACTCTTCTACGGGTAGGCCAGCATCAGTTTGGGCGGCTGG-AGAAAGGCCTCTGTCACGTATCTCCCTCC--GGGGTGACCTTATAGGG-GAGGCGTAATGCAGCCAGCTCAGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGA--CCTT---------CGGGG-GCACCATCGACCGATCCTGATGTCTT-GGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATCTGCAGAAATGCGTTGAAAACAACCAAGATTTCAACGTTCAGATGGCTGTGAAGGCAAGCATCATCACGAATGGTCTCAAGTATTCGTTGGCTACAGGAAATTGGGGAGATCAAAAGAAAGCGGCTTCCGCTAAAGCGGGTGTCTCTCAGGTGTTGAATCGTTACACTTATGCGTCCACCCTCTCCCATCTTCGCCGAACGAATACCCCAGTTGGCCGTGATGGCAAGCTAGCTAAACCTCGCCAACTTCACAATACTCATTGGGGCTTGGTGTGTCCAGCTGAAACCCCCGAAGGTCAAGCCTGTGGACTGGTGAAGAATCTGTCATTGATGTGCTACGTCAGTGTCGGAACTGAGAGCACGCCCATAACCGACTTCATGAGCCAGCGAAATATGGAGCTTCTCGAGGAGTATGACCCAGTTGTGAACCCAAATGCTACAAAGGTATTTGTAAATGGTGTCTGGGTCGGAGTGCACTCTCAGCCAGCACAACTAGTCTCCGTTGTCCAAGAGCTTCGTCGCAACGGAACTCTTTCTTATGAAATGAGTCTTATCCGAGAAATCCGTGACCGGGAGTTCAAAATCTTCACAGATGCTGGGCGAGTCATGAGGCCGTTGTTCGTTGTCGAGAACGATGTTCGAAAACCAAACCGAAACTCTTTGGTTCTGAATAAGGGCCACATTCAGAAGCTGCTTGAAGATAAAGAA------CTCGATCTACAG------GGATTAAACGATGAAGATACTGCGAATTCGAAGTTCGGTTGGAGGGGCCTCATTCAGAACGGTGTCGTCGAGTACCTCGATGCTGAAGAAGAAGAGACTGCCATGATCGTGATGACACCTGAGGATTTGGATGAGTGGCGCGAACTTCGACAGGGCATACCGCCAACG------GACAGT---CATGCACAAG------ACCGCCACAGGCGCATTAAACCGAAGCCTAATCCTACAGTTCACGCCTACACCCATTGCGAGATTCACCCGAGTATGATACTCGGTATCTGTGCTAGTATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTTCTTGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAAATTATCAAGGAGACCACCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATTGACACCCCCGTCCGTCCTTCCTCCAAGCCTCTCCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGCACAGTTCCCGTCGGTCGTGTCGAGACTGGTGTGATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTCTC---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGTCTGACCCGCCAAAGGGTGCTGAGTCCTTCAATGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGATCGGTGCCGGTTACGCTCCCGTCTTGGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTGCTCGAGAAGATCGATCGACGAACTGGAAAGTCCGTCGAGAGCGGTCCCAAGTTCATCAAGTCTGGTGATGCCGCCATCGTCAAGATG Cyclothyriella_rubronotata_TR TCCCCCCTCGGG------GGGCCTACCCTTTG--TCTACGAGTACC----TAGTTGTTTCCTCGGCAGCCT-TGT------GCTGCCA-----------------AT-GGGGACCTT---------AAACC-CTTTTT-GTAGTG-AGAAGTTTCT-TCTGAAA-----ACAGTAAATTATTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TATTCCACTGGGCATGCCTGTTCGAGCGTCATTGACAATCTTCAAGCTCTGCTTGGTGTTGGGTGGTTGTCGCGG--CTTT-GAGCCCCGACTCGCCTTAAAATAA-TTGGCAGCTCATGTG-GGTTG---GTTCCTTGCGCAGCAC----AGTACGCGCTC--TGGGTCGCCCC----GTGAATATCCAAAAG----CCTTTTTTT-CAACTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGCATGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGG-CTCTT-GCCTG-GGGCACTCTTCTACGGGTAGGCCAGCATCAGTTTGGGCGGCTGG-AGAAAGGCCTCTGTCACGTATCTCCCTCC--GGGGTGACCTTATAGGG-GAGGCGTAATGCAGCCAGCTCAGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTCCGAATTCTGTTCCTCAAGCTGACGAAGGATGTCTACAAATATCTGCAGAAATGCGTTGAAAACAACCAAGATTTCAACGTTCAGATGGCTGTGAAGGCAAGCATCATCACGAATGGTCTCAAGTATTCGTTGGCTACAGGAAATTGGGGAGATCAAAAGAAAGCGGCTTCCGCTAAAGCGGGTGTCTCTCAGGTGTTGAATCGTTACACTTATGCGTCCACCCTCTCCCATCTTCGCCGAACGAATACCCCAGTTGGCCGTGATGGCAAGCTAGCTAAACCTCGCCAACTTCACAATACTCATTGGGGCTTGGTGTGTCCAGCTGAAACCCCCGAAGGTCAAGCCTGTGGACTGGTGAAGAATCTGTCATTGATGTGCTACGTCAGTGTCGGAACTGAGAGCACGCCCATAACCGACTTCATGAGCCAGCGAAATATGGAGCTTCTCGAGGAGTATGACCCAGTTGTGAACCCAAATGCTACAAAGGTATTTGTAAATGGTGTCTGGGTCGGAGTGCACTCTCAGCCAGCACAACTAGTCTCCGTTGTCCAAGAGCTTCGTCGCAACGGAACTCTTTCTTATGAAATGAGTCTTATCCGAGAAATCCGTGACCGGGAGTTCAAAATCTTCACAGATGCTGGGCGAGTCATGAGGCCGTTGTTCGTTGTCGAGAACGATGTTCGAAAACCAAACCGAAACTCTTTGGTTCTGAATAAGGGCCACATTCAGAAGCTGCTTGAAGATAAAGAA------CTCGATCTACAG------GGATTAAACGATGAAGATACTGCGAATGCGAAGTTCGGTTGGAGGGGCCTCATTCAGAACGGTGTCGTCGAGTACCTCGATGCTGAAGAAGAAGAGACTGCCATGATCGTGATGACACCTGAGGATTTGGATGAGTGGCGCGAACTTCGACAGGGCATACCGCCAACG------GACAGT---CATGCACAAG------ACCGCCACAGGCGCATTAAACCGAAGCCTAATCCTACAGTTCACGCCTACACCCATTGCGAGATTCACCCGAGTATGATACTCGGTATCTGTGCTAGTATTATTCTTGCAACGTCGCCTCAGAGAACAAGTCGGTCTC---AATTTTGGCTTATC--TCT-GAGGGGCAATTTC--CTTGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAGTCCACATCG-GGCTACTCGCCAA--CACCGACCCTATGACGCACAGCCCATTTCATCACCATGCTAACTCTGTCTCTTAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTAAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTTACCGTCATTGGTATGTTTCACCTCTACCACACCCAATCCTCCTGCTGACTC--CCCATAGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTTCTTGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAAATTATCAAGGAGACCACCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATTGACACCCCCGTCCGTCCTTCCTCCAAGCCTCTCCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGCACAGTTCCCGTCGGTCGTGTCGAGACTGGTGTGATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTCTC---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGTCTGACCCGCCAAAGGGTGCTGAGTCCTTCAATGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGATCGGTGCCG-------------------------------------------------------------------------------------------------------------------------------------------------- Cyclothyriella_rubronotata_TR1 TCCCCCCTCGGG------GGGCCTACCCTTTG--TCTACGAGTACC----TAGTTGTTTCCTCGGCAGCCT-TGT------GCTGCCA-----------------AT-GGGGACCTT---------AAACC-CTTTTT-GTAGTG-AGAAGTTTCT-TCTGAAA-----ACAGTAAATTATTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TATTCCACTGGGCATGCCTGTTCGAGCGTCATTGACAATCTTCAAGCTCTGCTTGGTGTTGGGTGGTTGTCGCGG--CTTT-GAGCCCCGACTCGCCTTAAAATAA-TTGGCAGCTCATGTG-GGTTG---GTTCCTTGCGCAGCAC----AGTACGCGCTC--TGGGTCGCCCC----GTGAATATCCAAAAG----CCTTTTTTT-CAACTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGCATGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGG-CTCTT-GCCTG-GGGCACTCTTCTACGGGTAGGCCAGCATCAGTTTGGGCGGCTGG-AGAAAGGCCTCTGTCACGTATCTCCCTCC--GGGGTGACCTTATAGGG-GAGGCGTAATGCAGCCAGCTCAGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTCCGAATTCTGTTCCTCAAGCTGACGAAGGATGTCTACAAATATCTGCAGAAATGCGTTGAAAACAACCAAGATTTCAACGTTCAGATGGCTGTGAAGGCAAGCATCATCACGAATGGTCTCAAGTATTCGTTGGCTACAGGAAATTGGGGAGATCAAAAGAAAGCGGCTTCCGCTAAAGCGGGTGTCTCTCAGGTGTTGAATCGTTACACTTATGCGTCCACCCTCTCCCATCTTCGCCGAACGAATACCCCAGTTGGCCGTGATGGCAAGCTAGCTAAACCTCGCCAACTTCACAATACTCATTGGGGCTTGGTGTGTCCAGCTGAAACCCCCGAAGGTCAAGCCTGTGGACTGGTGAAGAATCTGTCATTGATGTGCTACGTCAGTGTCGGAACTGAGAGCACGCCCATAACCGACTTCATGAGCCAGCGAAATATGGAGCTTCTCGAGGAGTATGACCCAGTTGTGAACCCAAATGCTACAAAGGTATTTGTAAATGGTGTCTGGGTCGGAGTGCACTCTCAGCCAGCACAACTAGTCTCCGTTGTCCAAGAGCTTCGTCGCAACGGAACTCTTTCTTATGAAATGAGTCTTATCCGAGAAATCCGTGACCGGGAGTTCAAAATCTTCACAGATGCTGGGCGAGTCATGAGGCCGTTGTTCGTTGTCGAGAACGATGTTCGAAAACCAAACCGAAACTCTTTGGTTCTGAATAAGGGCCACATTCAGAAGCTGCTTGAAGATAAAGAA------CTCGATGTACAG------GGATTAAACGATGAAGATACTGCGAATGCGAAGTTCGGTTGGAGGGGCCTCATTCAGAACGGCGTCGTCGAGTACCTCGATGCTGAAGAAGAAGAGACTGCCATGATCGTGATGACACCTGAGGATTTGGATGAGTGGCGCGAACTTCGACAGGGCATACCGCCAACG------GACAGT---CATGCACAAG------ACCGCCACAGGCGCATTAAACCGAAGCCTAATCCTACAGTTCACGCCTACACCCATTGCGAGATTCACCCGAGTATGATACTCGGTATCTGTGCTAGTATTATTCTTGCAACGTCGCCTCAGAGAACAAGTCGGTCTC---AATTTTGGCTTATC--TCT-GAGGGGCAATTTC--CTTGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAGTCCACATCG-GGCTACTCGCCAA--CACCGACCCTATGACGCACAGCCCATTTCATCACCATGCTAACTCTGTCTCTTAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTAAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTTACCGTCATTGGTATGTTTCACCTCTACCACACCCAATCCTCCTGCTGACTC--CCCATAGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTTCTTGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAAATTATCAAGGAGACCACCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATTGACACCCCCGTCCGTCCTTCCTCCAAGCCTCTCCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGCACAGTTCCCGTCGGTCGTGTCGAGACTGGTGTGATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTCTC---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGTCTGACCCGCCAAAGGGTGCTGAGTCCTTCAATGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGATCGGTGCCG-------------------------------------------------------------------------------------------------------------------------------------------------- Cyclothyriella_rubronotata_TR3 TCCCCCCTCGGG------GGGCCTACCCTTTG--TCTACGAGTACC----TAGTTGTTTCCTCGGCAGCCT-TGT------GCTGCCA-----------------AT-GGGGACCTT---------AAACC-CTTTTT-GTAGTG-AGAAGTTTCT-TCTGAAA-----ACAGTAAATTATTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TATTCCACTGGGCATGCCTGTTCGAGCGTCATTGACAATCTTCAAGCTCTGCTTGGTGTTGGGTGGTTGTCGCGG--CTTT-GAGCCCCGACTCGCCTTAAAATAA-TTGGCAGCTCATGTG-GGTTG---GTTCCTTGCGCAGCAC----AGTACGCGCTC--TGGGTCGCCCC----GTGAATATCCAAAAG----CCTTTTTTT-CAACTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGCATGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGG-CTCTT-GCCTG-GGGCACTCTTCTACGGGTAGGCCAGCATCAGTTTGGGCGGCTGG-AGAAAGGCCTCTGTCACGTATCTCCCTCC--GGGGTGACCTTATAGGG-GAGGCGTAATGCAGCCAGCTCAGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTCCGAATTCTGTTCCTCAAGCTGACGAAGGATGTCTACAAATATCTGCAGAAATGCGTTGAAAACAACCAAGATTTCAACGTTCAGATGGCTGTGAAGGCAAGCATCATCACGAATGGTCTCAAGTATTCGTTGGCTACAGGAAATTGGGGAGATCAAAAGAAAGCGGCTTCCGCTAAAGCGGGTGTCTCTCAGGTGTTGAATCGTTACACTTATGCGTCCACCCTCTCCCATCTTCGCCGAACGAATACCCCAGTTGGCCGTGATGGCAAGCTAGCTAAACCTCGCCAACTTCACAATACTCATTGGGGCTTGGTGTGTCCAGCTGAAACCCCCGAAGGTCAAGCCTGTGGACTGGTGAAGAATCTGTCATTGATGTGCTACGTCAGTGTCGGAACTGAGAGCACGCCCATAACCGACTTCATGAGCCAGCGAAATATGGAGCTTCTCGAGGAGTATGACCCAGTTGTGAACCCAAATGCTACAAAGGTATTTGTAAATGGTGTCTGGGTCGGAGTGCACTCTCAGCCAGCACAACTAGTCTCCGTTGTCCAAGAGCTTCGTCGCAACGGAACTCTGTCTTATGAAATGAGTCTTATCCGAGAAATCCGTGACCGGGAGTTCAAAATCTTCACAGATGCTGGGCGAGTCATGAGGCCGTTGTTCGTTGTCGAGAACGATGTTCGAAAACCAAACCGAAACTCTTTGGTTCTGAATAAGGGCCACATTCAGAAGCTGCTTGAAGATAAAGAA------CTCGATCTACAG------GGATTAAACGATGAAGATACTGCGAATGCGAAGTTCGGTTGGAGGGGCCTCATTCAGAACGGTGTCGTCGAGTACCTCGATGCTGAAGAAGAAGAGACTGCCATGATCGTGATGACACCTGAGGATTTGGATGAGTGGCGCGAACTTCGACAGGGCATACCGCCAACG------GACAGT---CATGCACAAG------ACCGCCACAGGCGCATTAAACCGAAGCCTAATCCTACAGTTCACGCCTACACCCATTGCGAGATTCACCCGAGTATGATACTCGGTATCTGTGCTAGTATTATTCTTGCAACGTCGCCTCAGAGAACAAGTCGGTCTC---AATTTTGGCTTATC--TCT-GAGGGGCAATTTC--CTTGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAGTCCACATCG-GGCTACTCGCCAA--CACCGACCCTATGACGCACAGCCCATTTCATCACCATGCTAACTCTGTCTCTTAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTAAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTTACCGTCATTGGTATGTTTCACCTCTACCACACCCAATCCTCCTGCTGACTC--CCCATAGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTTCTTGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAAATTATCAAGGAGACCACCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATTGACACCCCCGTCCGTCCTTCCTCCAAGCCTCTCCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGCACAGTTCCCGTCGGTCGTGTCGAGACTGGTGTGATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTCTC---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGTCTGACCCGCCAAAGGGTGCTGAGTCCTTCAATGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGATCGGTGCCG-------------------------------------------------------------------------------------------------------------------------------------------------- Cyclothyriella_rubronotata_TR9 TCCCCCCTCGGG------GGGCCTACCCTTTG--TCTACGAGTACC----TAGTTGTTTCCTCGGCAGCCT-TGT------GCTGCCA-----------------AT-GGGGACCTT---------AAACC-CTTTTT-GTAGTG-AGAAGTTTCT-TCTGAAA-----ACAGTAAATTATTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TATTCCACTGGGCATGCCTGTTCGAGCGTCATTGACAATCTTCAAGCTCTGCTTGGTGTTGGGTGGTTGTCGCGG--CTTT-GAGCCCCGACTCGCCTTAAAATAA-TTGGCAGCTCATGTG-GGTTG---GTTCCTTGCGCAGCAC----AGTACGCGCTC--TGGGTCGCCCC----GTGAATATCCAAAAG----CCTTTTTTT-CAACTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGCATGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGG-CTCTT-GCCTG-GGGCACTCTTCTACGGGTAGGCCAGCATCAGTTTGGGCGGCTGG-AGAAAGGCCTCTGTCACGTATCTCCCTCC--GGGGTGACCTTATAGGG-GAGGCGTAATGCAGCCAGCTCAGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCC-TTCGGGGCTG-CTTGGTGATTCATGATAACTTTTCAGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCTTTGTTCCGAATTCTGTTCCTCAAGCTGACGAAGGATGTCTACAAATATCTGCAGAAATGCGTTGAAAACAACCAAGATTTCAACGTTCAGATGGCTGTGAAGGCAAGCATCATCACGAATGGTCTCAAGTATTCGTTGGCTACAGGAAATTGGGGAGATCAAAAGAAAGCGGCTTCCGCTAAAGCGGGTGTCTCTCAGGTGTTGAATCGTTACACTTATGCGTCCACCCTCTCCCATCTTCGCCGAACGAATACCCCAGTTGGCCGTGATGGCAAGCTAGCTAAACCTCGCCAACTTCACAATACTCATTGGGGCTTGGTGTGTCCAGCTGAAACCCCCGAAGGTCAAGCCTGTGGACTGGTGAAGAATCTGTCATTGATGTGCTACGTCAGTGTCGGAACTGAGAGCACGCCCATAACCGACTTCATGAGCCAGCGAAATATGGAGCTTCTCGAGGAGTATGACCCAGTTGTGAACCCAAATGCTACAAAGGTATTTGTAAATGGTGTCTGGGTCGGAGTGCACTCTCAGCCAGCACAACTAGTCTCCGTTGTCCAAGAGCTTCGTCGCAACGGAACTCTTTCTTATGAAATGAGTCTTATCCGAGAAATCCGTGACCGGGAGTTCAAAATCTTCACAGATGCTGGGCGAGTCATGAGGCCGTTGTTCGTTGTCGAGAACGATGTTCGAAAACCAAACCGAAACTCTTTGGTTCTGAATAAGGGCCACATTCAGAAGCTGCTTGAAGATAAAGAA------CTCGATCTACAG------GGATTAAACGATGAAGATACTGCGAATGCGAAGTTCGGTTGGAGGGGCCTCATTCAGAACGGTGTCGTCGAGTACCTCGATGCTGAAGAAGAAGAGACTGCCATGATCGTGATGACACCTGAGGATTTGGATGAGTGGCGCGAACTTCGACAGGGCATACCGCCAACG------GACAGT---CATGCACAAG------ACCGCCACAGGCGCATTAAACCGAAGCCTAATCCTACAGTTCACGCCTACACCCATTGCGAGATTCACCCGAGTATGATACTCGGTATCTGTGCTAGTATTATTCTTGCAACGTCGCCTCAGAGAACAAGTCGGTCTC---AATTTTGGCTTATC--TCT-GAGGGGCAATTTC--CTTGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAGTCCACATCG-GGCTACTCGCCAA--CACCGACCCTATGACGCACAGCCCATTTCATCACCATGCTAACTCTGTCTCTTAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTAAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTTACCGTCATTGGTATGTTTCACCTCTACCACACCCAATCCTCCTGCTGACTC--CCCATAGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTTCTTGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAAATTATCAAGGAGACCACCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATTGACACCCCCGTCCGTCCTTCCTCCAAGCCTCTCCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGCACAGTTCCCGTCGGTCGTGTCGAGACTGGTGTGATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTCTC---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGTCTGACCCGCCAAAGGGTGCTGAGTCCTTCAATGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGATCGGTGCCG-------------------------------------------------------------------------------------------------------------------------------------------------- Cyclothyriella_rubronotata_TR9a TCCCCCCTCGGG------GGGCCTACCCTTTG--TCTACGAGTACC----TAGTTGTTTCCTCGGCAGCCT-TGT------GCTGCCA-----------------AT-GGGGACCTT---------AAACC-CTTTTT-GTAGTG-AGAAGTTTCT-TCTGAAA-----ACAGTAAATTATTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TATTCCACTGGGCATGCCTGTTCGAGCGTCATTGACAATCTTCAAGCTCTGCTTGGTGTTGGGTGGTTGTCGCGG--CTTT-GAGCCCCGACTCGCCTTAAAATAA-TTGGCAGCTCATGTG-GGTTG---GTTCCTTGCGCAGCAC----AGTACGCGCTC--TGGGTCGCCCC----GTGAATATCCAAAAG----CCTTTTTTT-CAACTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGCATGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGG-CTCTT-GCCTG-GGGCACTCTTCTACGGGTAGGCCAGCATCAGTTTGGGCGGCTGG-AGAAAGGCCTCTGTCACGTATCTCCCTCC--GGGGTGACCTTATAGGG-GAGGCGTAATGCAGCCAGCTCAGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTGCAACGTCGCCTCAGAGAACAAGTCGGTCTC---AATTTTGGCTTATC--TCT-GAGGGGCAATTTC--CTTGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAGTCCACATCG-GGCTACTCGCCAA--CACCGACCCTATGACGCACAGCCCATTTCATCACCATGCTAACTCTGTCTCTTAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTAAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTACGTTACCGTCATTGGTATGTTTCACCTCTACCACACCCAATCCTCCTGCTGACTC--CCCATAGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGCGCTATCCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTTCTTGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAAATTATCAAGGAGACCACCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATTGACACCCCCGTCCGTCCTTCCTCCAAGCCTCTCCGTCTGCCCCTTCAGGACGTGTACAAGATTGGCGGTATCGGCACAGTTCCCGTCGGTCGTGTCGAGACTGGTGTGATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTCTC---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGTCTGACCCGCCAAAGGGTGCTGAGTCCTTCAATGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGATCGGTGCCG-------------------------------------------------------------------------------------------------------------------------------------------------- 'Dendryphion europaeum CPC_22943' CCCCGG-CGCGA-----TGCGTTC-ACCCTGA--CCTTTGAGTACCCTATTTTCCTCCCCCCGGCCGGGGC-AAC-------CCGCCG-----------------GA-CGGGACAACAAA------ACAAA-CCTCTT-GCATT--AGCAGTCACTGTCAGTACA----AAACAAAATTATTAAAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGCGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTTC-AACCTTCAAGCTCAGCTTGGTGTTGGGTGTTTGTCCCGC--CCCCCGCGCGTGGACTCGCCTCAAATTGA-TTGGCAGCCGCATC--CCCCC---GCCGCGAGCGCAGCAC----AGTC-GCGCTT--ACGACGAGGGCGGGTCGG-CGCTCCAGAAG---CCTATTTCAA-CGTCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAT??????????????????????????????-?CTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--CTTC------GGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTTGGTGTTGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCCTCGCCTTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACGTGCCCGCGGTTGTTCATCTGGG-CTCTC-GCCCG-GTGCACTCCTCCGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGG-ACAAAGGTCTCTGTCACGTACCACCCCTC--GGGGTGGCCTTATAGGG-GAGACGCAACACGGCCAGCCTGGACTGAGGTTCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCAGC----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Herpotrichia diffusa CBS_250.62' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC--CTTT------GGGGCCCGAGTTGTAATTTGGAGAGGGTGC-TTTGGTGTCGGCAGTGGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCCGATTGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGTAGTTGCTCATCTGGG-GATCT-CCCCA-GTGCACTCTTCTACAGGCAGGCCAGCATCAGTCCGGGCGGTTGG-AGAAAGGCCTGTGTCACGTAGCTGCCTTC--GGGC-AGTGTTATAGGG-CAGGTGGAATACGACCAGCCTGGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTC-----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-------------ATCAGTTATCGTTTATTTGATAGTACCT---TACCACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGGAGGGGTGTGTTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACCTAACGGATCGCATGGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTAGCGGGTCCGCCTCACCGCGTGCACTTGTCCGGCTGGACCTTTCCTT-CTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGATCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTGGGGGATCGAAG------------------------------------------------------------------------------------------------------------------------------CAAATATTTGCAGAAATGTGTAGAA?ACAATGCCGACTTCAATGTCCAGATGGCCGTCAAGGCTAGCGTTATTACCAATGGGCTCAAATATTCTCTAGCCACGGGGAACTGGGGCGATCAGAAGAAGGCCGCATCAGCTAAGGCTGGTGTCTCACAGGTGCTGAATCGTTACACATATGCGTCAACTCTCTCCCACCTTCGTCGAACCAACACCCCTGTTGGACGTGATGGAAAATTGGCAAAGCCCCGACAACTACATAATTCGCATTGGGGCCTGGTGTGTCCTGCTGAGACTCCGGAAGGGCAGGCTTGTGGTTTAGTCAAGAATCTGTCACTGATGTGTTACGTCAGTGTAGGCTCGGAGAGCACTCCCATCACAGATTTCATGAGTCAGCGTAACATGGAGCTTCTCGAAGAGTACGATCCAGTCCAGAACCCCAATGCCACCAAGGTCTTTGTCAACGGAGTCTGGGTTGGTGTGCATTCGGCACCTTCGCAACTTGTCAACGTTGTGCAGGAGCTTCGACGGAATGGAACCTTGTCCTACGAGATGAGCCTTATCCGAGACATTCGAGATCGAGAGTTCAAGATCTTTACAGATGCGGGCCGAGTCATGAGACCTCTATTCGTTGTCGAGACCAACTACCAAAAGCCAAACCGGAACCACCTCGTACTCAATAGAAGTCACATCCAGCAACTGATAAAGGATAAAGAG------ACAGACGTTTCG------GGGATGAACGATGAGGACATTTCGAAGACCACATTCGGCTGGCGAGGA?TGATCCATAATGGTGTGGTAGAATACCTTGATGCTGAAGAAGAAGAGACTGCCATGATAGTCATGACGCCTGATGATTTGGTTGAGTGGCGCGATCTCAAAGCGGGACATCCGGCCATG------GATGCGATGAATGAGAACG------ACCGACTTAGACGGGTCAAGCCCAAG?CCAATCCGGCAATTCACGCCTACACTCATTGCGAGATCCATCCTAGTATGATACTCGGTATCTG?GCCAGCATCAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCATTATCGCCGCCGGTACCGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCCAGTGGTCCGAGTCCCGTTTCCAGGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTTGGATACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCTGGCTTCAACGGTGACAACATGATCGACGTCTCCAGCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGCAAGACCCTTCTTGAGGCCATTGATGCCATCGACCCACCCAGCCGTCCCACCGATAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACTGGTATCATCAAGGCTGGTATGGTTGTGACCTTCGCCCCCGCTGGTGTCACCACTGAAGTTAAGTCGGTCGAAATGCACCACGAACAGCTTACCGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAGATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGAGTCTTTCAATGCCCAAGTCATTGTCCTTAACCACCCTGGTCAGGTCGGCGCTGGCTACGCTCCCGTCCTCGATTGCCACACTGCTCATATTGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATCGATCGCCGAACTGGCAAGGCCACCGAGGCTAACCCCAAGTTCATCAAGTCTGGTGACGCTGCCATCGTCAAGATG Hobus_wogradensis_TI GCGCTCTATTGG-------GATAGAACCCTTG--CATTTGAGTACCT---TTCTTGTTTCCTCGGCGATATACGCTCAGTTGTCGCCG-----------------AT-GGGGACCTA---------TCAAA-ACCTTT-GCATT--AGCAGTATCA-TCTGACAA----AACATAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-ATTTCCTTAGGGCATGCCTGTTCGAGCGTCATTTA-AATCCTCAAGCTCAGCTTGGTGTTGGGTGTTTGTTTCAT--TCGT------GAGACTCGCCTTGAAAACA-TTGGCAGCCGGTA---CATTGTTTGGCTTAAGCGCAGCAG----AAAC-GCGTCT--GAAGGCCCGCT-GGATCGGTTCTCCACAAG---GACTCTTTTA-AAGTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCTGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCAGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGGGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCGGG-CTCTT-GCCTG-GTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGCTGG-ATAAAGACCTCTATCATGTATCTTCCTTC--GGGATGACCTTATAGGG-GGGGTATAATACAGCCAGCCCGGACTGAGG-TCCGCGCTTCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTACGGTCGTGGCCTACCATGGTTTCAACGGGTAACGGGAGATTAGGGTTTGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGTCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCTCTGTTCCGAATTCTGTTCCTTAAATTGACCAAGGACGTTTTCAAGTACTTGCAGAAGTGCGTGGAGAGTAACCAAGATTTCAATGTTCAGATGGCGGTGAAAGCTAGTATCATTACAAACGGTCTCAAATACTCGCTGGCTACTGGAAATTGGGGTGATCAAAAGAAGGCGGCTTCAGCAAAAGCAGGCGTCTCTCAAGTGCTTAACCGGTACACCTACGCGTCAACCTTGTCCCATCTTCGTCGTACCAACACTCCGGTTGGTCGTGACGGCAAGTTGGCCAAACCGCGACAACTGCATAACACCCATTGGGGCTTGGTGTGTCCCGCTGAGACGCCCGAAGGGCAAGCTTGTGGCTTGGTGAAAAATCTATCACTCATGTGCTACGTCAGCGTCGGGAGTGAGAGCACCCCCATCACTGATTTCATGAGTCAGCGAAACATGGACCTACTTGAAGAGTATGACCCCGTTGTCAATCCAACAGCTACCAAAGTGTTTGTCAATGGTGTCTGGGTCGGTGTGCATTCAGCGCCACAACAGCTTGTTAGTGTCGTTCAAGAGCTTCGACGGAACGGGACCTTGTCCTACGAGATGAGTCTCATTCGAGATATTCGTGATAGAGAGTTCAAGATCTTCACAGACGCGGGGCGTGTCATGAGGCCTTTGTTTGTCGTGGAGACAGATGTGCGAAAATCGAATCGCGGAAGTCTTGCCCTGAATAAGACGCATGTTCAAAAGCTTCTCGAAGACAAGGAA------ATTGATACTTCG------GGCTATAGCGACGAAGATACCGCGAGCATGAAATTTGGCTGGCGAGGTCTGATTCACAGCGGTGTTGTTGAGTACCTCGACGCGGAGGAGGAAGAAACCGCTATGATCATTATGACTCCAGAAGATCTGGATGAACACCGAGACCTCATGCAAGGTATTCCGGCTCCG------GATGGT---TTGGCGGCTG------ACCGTCACAAGCGAATCAAGCCAAAACCGAATCCTTCAGTGAAGACCTACACCCACTGCGAGATTCATCCTAGTATGATTCTGGGCATTTGTGCCAGCATTATCCTTGAAGCCC----------------TGAGCTAG---AATTTT-GCTTATC--GCT-GAGGGGCAATTTG--CATGGTGGGG-TGTGCGAACTTTTACGCGCTAGCGCTAAACCCGATCC-GGCTGTTCGCCAA--CTGCAACACCATGACGCACAACTTTCCGCGACACGATGCTAACGTC-CGCCCTAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTCGACAAGCTGAAAGCCGAGCGTGAGCGAGGTATTACCATTGACATTGCCCTCTGGAAGTTTGAGACACCGAAGTATTACGTTACCGTCATTGGTACGGCTCCCCCCTTGTCTCGTTCAGACTCCTGTTAACGC--CGCCCAGATGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATTCTCATCATCGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACTCTCGGTGTCAAGCAGCTCATCGTTGCCATCAATAAGATGGACACCACTAAGTGGAGCGAGGACCGTTTCCAGGAGATCATCAAGGAGACATCTAACTTCATCAAGAAGGTTGGATACAACCCTAAGACTGTGCCTTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGATCGATGTCTCGACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACTGGTAAGACCCTCCTCGAGGCCATCGATGCTATCGACACTCCTTCCCGTCCCTCCGACAAGCCCCTTCGTCTGCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTCCCAGTCGGTCGTGTCGAGACCGGTGTCATTAAGGCTGGTATGATCGTCACCTTCGCACCCGCTGGTGTCACCACCGAAGTCAAGTCCGTGGAGATGCACCACGAGCAGCTTGTTGAGGGTGTT---CCCGGTGACAATGTCGGTTTCAATGTCAAGAACGTCTCCGTTAAGGAGATTCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCATTTAATGCCCAGGTTATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- 'Karstenula rhodostoma CBS_690.94' --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TCTTT----GGGGGTCCGAGTTGTAATTTGCAGAGGATGC-TTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGCCTGCCTTTGCCGTGTAAAG-CTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCAGG-CTTTG-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGG-ATAAAGGCCTCTGTCACGTATCTCCCTTC--GGGGTGACCTTATAGGG-GAGGCGCAATGCAACCAGCCCGGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTT---------TTGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCG------AATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATGATAACTTCTCAGATCGCATGGCTTTACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATTCCGATACGGAGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTTCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGGTGTTTCTATTGTGACCCGCTCGGCACC-TTGTTCCGCATCCTGTTCCTCAAGCTCACCAAGGACGTCTACAAATATCTCCAGCGATGCGTGGAGAACAACCAGGATTTCAACGTTCAGATGGCTATTAAAGCTAGTATCCTTACTAACGGACTGAAGTACTCCCTGGCAACTGGCAACTGGGGTGACCAGAAGAAGGCAGCCTCCGCCAAAGCTGGTGTGTCACAAGTGTTGAACCGGTATACCTACTCATCCACCTTGTCCCATCTTCGACGGACAAACACTCCCGTCGGTCGAGACGGCAAGCTAGCCAAACCGCGCCAGCTTCACAACAGTCATTGGGGTCTTGTCTGCCCTGCCGAGACACCCGAAGGACAAGCTTGTGGACTCGTCAAGAACTTGTCACTTATGTGCTACGTCAGTGTAGGAAGTGAAAGTGCGCCTATCATTGACTATATGACGGGCCGTAACATGGAGCTGCTCGAGGAATACGACCCGATGATGAATCCTAGTGCTACCAAGGTTTTCGTTAACGGTGTCTGGGTCGGAACACACAGCAACCCGCAACAGCTGGTTACAAACGTGCAAGAGCTTCGCCGAAATGGAACCCTGTCATACGAAATGAGTCTGGTCCGAGACATTCGAGATCGCGAGTTCAAGATTTTCACCGATGCTGGTCGCGTCATGAGGCCGCTCTTTACCGTTGAAAACGATTCTAAGAAGCCGAACAAAGATCAATTGGTCTTCAACAGGACTCATCTCGAGAAACTCTTGTCAGATAAAGAA------GTGGACACATCT------GGCTTGAACGAAGAAGACACTGACGCTGCGCAATATGGATGGAAAGGTCTGCTTCACGATGGCTGCGTTGAGTATCTCGATGCTGAGGAAGAAGAGAGTGCTATGATTGTCATGTCGCCTGAAGATTTGACTGATTGGCGTCAAGTGGCCAAAGAGGGCCAGCCAGAG------CCTGGA---AAGCCGGATT------ATACGCTGGAAGAGTACAAGCCTCTGCGTCTTGCGCCTCTCAAACCTCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Leptosphaeria doliolum CBS_505.75' --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTT------AGGGTCCGAGTTGTAATTTGCAGAGGGCGC-TTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAG-CCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGG-CTTTT-GCCTG-GTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGG-ATAAAGGTCTCTGTCATGTACCTCCTTTC--GGGGAGGCCTTATAGGG-GAGACGACATGCAACCAGCCTGGACTGAGG-TCCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTT---------AAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTAATAGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCC-TTCGGGGCTT-CTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCC-TTCCTT-CTGGAGAACCTCATGCCCTTTACTGGGCGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGGTCTTGTCTGCCCTGCCGAGACACCAGAAGGACAGGCCTGTGGCCTCGTCAAGAACTTGTCTCTTATGTGTTACGTCAGTGTTGGTAGCGACGCTGAGCCCATCACCGACTTCATGCAACAACGAAACATGCAACTTCTCGAAGAGTACGATCAGAACCAAAATCCCGACGCTACGAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTTCACTCCAACGCACAACAGCTTGTCTCAGTTGTACAAGAGCTCCGGAGAAACGGCACTCTGTCCTACGAGATGAGCTTAATTCGTGACATTCGTGATCGAGAGTTCAAGATTTTCACGGATGCTGGGCGTGTCATGAGGCCATTGTTTGTTGTCGAAACCAACTCCAGTAAGCCAAACCGGAACCAGCTCATCTTTACCAAAGAGATCAGCAAAAAGCTACACTCCGAACAACAG------AACCAGGACTCTCGTCAAGGGTGGAGTGATCAGCAAGTAGCCGACGCCACATATGGGTGGAAGGGACTCATTCAAGACGGTGTGATCGAGTATCTTGATGCTGAGGAAGAAGAGACCGCCATGATCACATTTTCACCCGAAGATCTGGACGAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCTACACCCTTGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCTTCCTTCATCAAGAAGGTCGGTTACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGCTTCAACGGTGACAACATGATCGACAACTCCCCCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACCAAGACCAAGACCACCGGAAAGACCCTCCTCGAGGCCATTGATGCCATCGACCCCCCCAGCCGTCCCACCGACAAGCCCCTCCGCCTTCCCCTCCAGGATGTGTACAAGATTGGTGGCATTGGCACGGTTCCCGTCGGCCGTGTCGAGACTGGTATCATCAAGTCCGGCATGGTCGTCACCTTCGCTCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCGAGGGTGTT---CCCGGTGACAACGTAGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCTCCCGTTCTCGATTGCCATACCGCCCATATTGCGTGCAAGTTCTCCGAGCTCCTCGAGAAGATTGACCGCCGTACCGGTAAGGCCACCGAGACCAACCCCAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATG 'Lophiostoma macrostomum KT_508' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGATACCCGCTGAACTTAAGCATATCA????????????????????????????????-????????ACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--CTTC------GGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGTTGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCAGCCTCCGCCGTGTAAAG-CCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCTAGACGTGCCTTGGGTTGATCAGCCGGG-CTTTT-GCCCG-GTGCACTCTTCCCTTGGCAGGCCAGCATCAGTTTGGGCGGCTGG-ATAAAGGTCTGTTAAACGTGACTTCCTTC--GGGGAGAGCTTATAGGG-CAGACGACATGCAGCCAGCCTGAACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCATAATAGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTAAACGGAGGTGGGAACCTTT----------TAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC----------TAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCTGACTTCGGAAAGGGTGTATTTATTAGATAAAAAACCAATGCCC--TTTGGGCTC-TTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCTGGCCGGGCCTTTCCTT-CTGGAGAACCTCATGCCCTTCAGTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCAC--TTGTTCCGCATTTTGTTCCTGAAGCTGACGAAGGACGTTTATAAATATTTGCAAAAGTGTGTGGAGAGCAACAGCGAGTTCAACGTCCAAATGGCTGTGAAGGGCAGCGTCATCACAAACGGCCTGAAATACTCGCTCGCTACTGGCAACTGGGGCGACCAGAAGAAGGCTGCGTCGGCCAAGGCAGGCGTTTCTCAGGTGCTTAACCGATATACCTACGCATCTACCTTGTCTCACTTGCGGCGAACGAACACTCCCGTTGGCCGTGATGGTAAGCTGGCAAAACCACGACAACTGCACAATACTCACTGGGGCTTGGTGTGTCCCGCTGAGACCCCGGAAGGCCAAGCATGCGGTTTGGTAAAGAACCTTTCACTCATGTGCTACGTCAGTGTCGGTAGCGAGAGCACGCCCATCACTGATTTCATGAGTCAACGGAACATGGAGCTTCTTGAAGAGTACGATCCCGTCGTCAATCCCACGGCCACCAAAGTATTTGTCAATGGTGTCTGGGTGGGCGTGCATTCGCAACCATCCCAACTAGTCTCCGTCGTGCAGGAGCTGCGGAGAAACGGAACTCTATCTTACGAAATGAGTTTGATCCGCGACATTCGAGATCGAGAATTCAAGATCTTTACAGACGCAGGCCGAGTGATGCGACCGCTTTTCGTCGTGGAGACGGACTTCCAGAAACCAAATCGCGGGAGTCTCGTTCTAAATAAGTCTCATATACAGAGGCTCCTCAACGACAAGACA------ATCGATGTGGCT------GGGTTAAACGACGAAGATACAGCAGCGACTAGGTTCGGATGGAGAGGCCTCATCCATAGTGGCACGGTTGAGTATCTTGATGCTGAGGAGGAGGAAACAGCCATGATTATCATGACGCCCGAGGATTTGGAAGAGCACCGGGACCTCATGCAAGGTATTCCTGCGCCG------GACGGT---GTCAGCCAGG------AAAAACACAAACGGATCAAGCCAAAACCGAACCCATCAGTAAGAACCTACACTCACTGTGAGATTCATCCTAGTATGATCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lophiotrema nucula CBS_627.86' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCC--TCTC------AGGGCCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGCGTCGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAACCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGAG-CTCTC-GCTCG-GTGCACTCTTCTATAGGCAGGCCAGCATCAGTCCGGGCGGTCGG-ATAAAGGCCTCGGGAATGTAGCTCCCCTC--GGGGAGTG-TTATAGCCCGGGGTGCCATGCGACCAGCCTGGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACTCGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAACCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAGCCGCATGCCCTTCACTGGGTGTGCCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCTTTATTCCGTATCCTCTTTTTGAAGATGACCAAGGATGTCTTCAAATATCTGCAGAAGTGCGTTGAGAACAACCAGGACTTCAACGTCCAGATGGCCGTTAAAGCTAGCGTCATCACCAATGGCCTCAAGTATTCGCTCGCTACGGGTAATTGGGGCGACCAGAAAAAGGCTGCATCCGCCAAAGCAGGTGTGTCACAGGTGCTCAACCGCTACACTTATGCTTCGACCCTGTCGCATCTACGGCGGACGAATACTCCCGTAGGTCGCGACGGCAAGCTGGCCAAACCACGTCAGCTGCATAATACCCATTGGGGCCTGGTCTGTCCTGCCGAAACGCCCGAAGGACAAGCATGCGGCTTGGTCAAGAATTTGTCCCTGATGTGCTATGTGAGCGTCGGAAGCGAGAGCACACCGATTACGGATTTCATGACTCAGCGCAACATGGATCTTTTGGAAGAGTACGATCCGATTGTTAATCCTGCTGCCACAAAGGTCTTCGTCAACGGCGTTTGGGTAGGTGTCCATTCGCGGCCTTCGCAGCTTGTTTCTGTAGTGCAAGAGCTCCGGCGGAACGGCACACTGTCCTACGAAATGAGTCTTATTCGCGACATTCGAGACAGAGAGTTCAAGATCTTCACAGACGCAGGACGAGTCATGAGACCACTCTTTGTTGTCGAGACAGACTTCAAAAACCCCGATCGGGGCAATCTAGTTCTCAACAAGACTCATATTCAGAGACTCGCGGCAGATAAAGAG------ATCGATACCTCG------AATATGAATGATGAGGATACCCAAGAAGCCACATATGGCTGGAGGGGCTTAATTCATTCCGGCGTTGTCGAATACCTCGACGCTGAAGAGGAGGAAACTGCCATGATCATCATGTCACCAGAGGACCTTGAGGAGCATCGAGACATGCTGCAAGGCGTGGCGCCACCC---------------GTCACCGTAG------ATCAACATTCTCGTATCAAGCCCAAACCGAATTCTTCGGTGAATACATACACCCATTGCGAAATCCATCCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGCTCTGCTCGCCTACACTCTCGGTGTCAAGCAGCTTATCGTTGCCATCAACAAGATGGATA-CACGAAGTGGAGCGAAGACCGCTACAACGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGTTTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGACCTCCGGCAAGACCCTCCTTGAGGCCATCGACGCCATCGACCAGCCGTCCCGTCCTTCCGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTTCCTGTCGGCCGTGTCGAGACTGGTGTTATCAAGTCCGGCATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACCGAAGTCAAGTCCGTCGAGATGCATCACGAGCAGCTTGTTGAGGGTGTC---CCAGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTTAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCGCCCAAGGCCGCCGAGTCCTTCAACGCCCAGGTTATCGTCCTCAACCACCCTGGCCAGGTCGGTGCTGGTTACGCTCCAGTCTTGGATTGCCACACTGCCCATATCGCCTGCAAGTTCGCCGAGCTCCTCGAGAAGATCGATCGCCGAACTGGCAAGTCTGTTGAGTCTGCGCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGA-- Massaria_campestris_M28 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTCTCCTTTTGG---GGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTCGGCGTTGGCCTTGGTCTAAGTTCTTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCCAGTGGTCTTCGCCATGTGAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTATATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCTTGCAGTTGCTCATCTAGG-CTTTTTGCCTG-GTGCACTCTTCTGCAGGCAGGCCAGTATCAGTTCGGGCGGTTGG-ATAAAGACGTTGGGAATGTAGCACTCCTC--GGAGTG-TGTTATAGCCCAGCGTGTAATACAGCCAGCCTGGACTGAGG-TCCGCGCTTTG-GCTAGGATACTGGCGTAATGGTTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGGCGCGTAATGAAAGTGAACGGAGGTAGGAACCTTTTC-------GGAGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGTCAGAGGAAACTCTGATGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTCGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCTTT-CTGGAGATCCCCATGCCCTTCACTGGGTGTGGTGGGGAACCAGGACTTTTACTGAGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATTCCAGCTTGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTGTTTTTTTGACTCGCTCGGCACCTCTGTTCCGAATCCTGTTCCTCAAACTGACAAAGGACATGTACAAATACCTTCAGAGGTGCGTCGAGAACAACGCGGATTTCAATGTGCAAATGGCTGTAAAAGCCAGTATAATCACGAACGGTCTGAAGTATTCATTGGCGACTGGAAATTGGGGCGACCAGAAGAAGGCAGCCTCCTCCAAGGCGGGTGTATCCCAGGTGCTTAATCGTTACACCTATGCCTCGACTCTATCTCATCTCCGCCGGACAAATACCCCTGTCGGTCGTGACGGCAAGCTTGCAAAACCCCGCCAGTTGCACAACACTCATTGGGGCCTGGTGTGCCCCGCAGAGACACCAGAGGGACAAGCCTGCGGCTTGGTGAAGAACCTGTCATTAATGTGCTACGTTAGCGTTGGGTCTGAAAGCACGCCTATCACGGATTTTATGAGCCAGAGGAACATGGAGCTTCTCGAAGAGTACGACCCGACTTTGAATCCTACGGCCACCAAAGTTTTCGTCAATGGCGTCTGGGTGGGTGTACACTCACAACCGTCACAGCTTGTGAGCGTTGTGCAGGAACTCCGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCCTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAATTCGAAACCCCGAAGTACTATGTCACCGTCATTGGTAAGTC------------------------------------CTCGCAGACGCCCCCGGTCACCGTGACTTCATCAAGAACATGATCACGGGTACCTCGCAGGCCGACTGTGCTATTCTCATCATCGCCGCTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGATGGCCAGACGCGTGAGCACGCCCTGCTTGCCTACACGCTCGGTGTCAAGCAACTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTTCAACGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGATGCCTCGAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTACTGGTAAGACGCTCCTGGAGGCCATCGACAGCATCGACCCCCCGTCCCGTCCCTCTGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTCCCCGTCGGCCGTGTCGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACGGAAGTAAAGTCGGTTGAGATGCACCACGAGCAGCTCGTCGAGGGTCTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGCAAGACCCCCCCAAGGGCTGCGAGTCTTTCAACGCCCAAGTCATTGTCCTCAACCACCCTGGCCAGGTCGGTGCTGGTTACGCTCCCGTCTTGGATTGCCACACTGC------------------------------------------------------------------------------------------------------------------- Massaria_inquinans_M19 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCCTTCCTTTTTG---GGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTCGGCGTTGGCCTTGGTCTAAGTTCTTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCCAGTGGTCTTCGCCATGTGAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTATATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCTTGCAGTTGCTCATCTAGG-CTTTTTGCCTG-GTGCACTCTTCTGTAGGCAGGCCAGTATCAGTTCGGGCGGTTGG-ATAAAGACGTTGGGAATGTAGCACTCCTC--GGAGTG-TGTTATAGCCTGGCGTGTAATACAACCAGCCTGGACTGAGG-TCCGCGCTTCG-GCTAGGATACTGGCGTAATGGTTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGGCGCGTAATGAAAGTGAACGGAGGTAGGACCCTTTTC-------GGAGGTGCACTATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGTCAGAGGAAACTCTGATGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTCGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCTTT-CTGGAGATCCCCATGCCCTTCACTGGGTGTGGTGGGGAACCAGAACTTTTACTGAGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATTCCAGCTTGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTGTTTTTTTGACTCGCTCGGCACCTCTATTCCGAATCCTGTTCCTCAAACTGACAAAGGACATGTACAAATACCTTCAGAGGTGCGTCGAGAATAACTCGGATTTCAACGTGCAAATGGCTGTAAAAGCCAGTATAATCACGAACGGTCTGAAGTACTCATTGGCGACTGGAAATTGGGGCGACCAGAAGAAGGCAGCCTCCTCCAAGGCGGGTGTGTCCCAGGTACTTAATCGTTACACCTATGCCTCGACTCTATCTCATCTCCGCCGGACAAATACCCCTGTCGGTCGTGACGGCAAGCTTGCAAAACCCCGCCAGTTGCACAACACTCATTGGGGCCTGGTGTGCCCCGCAGAGACACCAGAAGGACAGGCCTGCGGCTTGGTGAAGAACCTGTCATTAATGTGCTACGTTAGCGTTGGGTCCGAAAGCACACCTATCACGGATTTCATGAGCCAGCGGAACATGGAGCTTCTCGAAGAGTACGACCCGAGTCTGAATCCTACGGCCACCAAAGTTTTCGTCAATGGCGTCTGGGTGGGTGTACACTCACAACCGTCACAGCTTGTGAGCGTCGTGCAGGAACTCCGGCGGAATGGCACGCTTTCTTATGAGATGAGTCTTGTCCGAGACATCCGCGATCGCGAATTCAAGATTTTCACCGATGCCGGACGTGTCATGAGACCCTTGTTCGTTGTTGACCAAAATAACACCAACCCGAACACAGGAGGCCTTGTTCTCGGCAGACATCATATTGACAGGCTCACAAAAGACAAGGAA------ATTGACACCCAA------GGTATGAGCGACGAGGACGCTGCAACTATGAAGTACGGATGGAGGGGGCTCATCAACGATGGTGTCGTCGAATACGTCGACGCCGAAGAGGAAGAGACCGCTATGATCGTCATGTCTCCAGAGGATTTAGAGGACCACCGTGCCTTGAAACAAGGAGAAAAGGTCGAG------CAAGAG---ACTGGCGGCG------ATCCCCATAAGCGGCTCAAACCACCCCCGAATCCAGCTGTCAAGGCATACACCCACTGCGAGATCCATCCGAGTATGCTTCTCGGAATCTGTGCCAGTATCAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCCTGGGTGCTCGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAATTCGAAACCCCGAAGTACTATGTCACCGTCATTGGTATGTC------------------------------------CTCGCAGACGCCCCCGGTCACCGTGACTTCATCAAGAACATGATCACGGGTACCTCGCAGGCCGACTGCGCTATTCTCATCATCGCTGCTGGGACGGGTGAGTTCGAAGCCGGTATCTCCAAGGATGGCCAGACGCGTGAGCACGCCCTGCTTGCCTACACGCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACGACCAAGTGGTCCGAGGAGCGTTTCAACGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCCTCGACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTACTGGTAAGACCCTCCTCGAGGCCATCGACAGCATCGACCCCCCGTCCCGTCCCTCCGACAAGCCCCTCCGTCTGCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCTGTCGGCCGTGTTGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCCGCTGGTGTCACCACTGAAGTGAAGTCGGTTGAGATGCACCACGAGCAGCTCGTTGAGGGTCTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGCAAGACCCCCCCAAGGGCTGCGACTCTTTCAACGCCCAGGTCATTGTCCTCAACCACCCTGGCCAGGTCGGTGCTGGTTACGCTCCAGTCTTGGACTGCCACACTGC------------------------------------------------------------------------------------------------------------------- 'Massarina eburnea CBS_473.64' --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TCTTT----GGGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGCGTAGGCGGCGGTCTAAGTTCCTTGGAACAGGGCATCGCAGAGGGTGAGAATCCCGTATGTGGTCGCCTGCCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATAAGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGG-CTTTT-GCCTG-GGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTTCGGCGGTCGG-ATAAAGGTCTCTCTCACGTACCTGCCTAC--GGGTAG-CCTTATAGGG-GAGACGACATGCGACCAGCTGGGACTGAGG-TCCGCGCTTCG-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCTTA-----------GGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACATGGATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTGTTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACCTCTCAGATCGCATAGCCTTGAGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCTACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGTTAGCCTGAGAAACGGCTAACACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGATACAGGGAGGTAGTGACAATAAATACTGATAGGGAGC-TCTTTTGGGTTTCCTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTTTTT-CTGGAGAACCGCATGCTCTTCACTGGGTGTGTTGGGG-ACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATTACAGCATGGAATAATAGAATAGGACGT-CGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATTAGTATTCAATGGTCAGAGGTGAAATTCTTGGATTCTTTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATCAACTATGCCGACTAGGGATCGGGCGGTGTTATTATTTTGACTCGCTCGGCACCT----------------TCCTGAAGTTCACCAAGGACGTCTACATGTACCTCCAGCGGTGTGTGGAGAACAGCACCGACTTCAACGTACAGATGGCCATCAAAGGCGGCATCATCACCAATGGCCTCAAGTACTCTCTTGCCACGGGAAACTGGGGTGATCAGAAGAAGGCTGCTTCGGCCAAGGCAGGCGTTTCGCAGGTGTTGAATCGCTACACCTATGCTTCCACCTTGTCCCATCTTCGGCGTACTAACACACCCGTTGGTCGTGACGGCAAGCTGGCCAAACCCCGACAGCTGCACAACAGTCATTGGGGTCTGGTCTGTCCCGCCGAGACGCCCGAGGGACAGGCGTGTGGCCTCGTCAAGAACTTGTCCCTTATGTGCTACGTCAGCGTAGGCAGCGAAAGTCAGCCCATCACAGACTTCATGTCAGGCCGAAATATGGAATTGCTCGAGGAGTTCGATCCGCAAATGAACCCGAATGCCACCAAGGTGTTCGTCAACGGTGTCTGGGTCGGCACACATAACAACCCTCAACAACTAATCACAACTGTGCAGGAGCTTCGGCGGAATGGTACCTTGTCTTACGAGATGAGTTTAGTCCGAGATATCCGCGATCGAGAGTTCAAGATCTTCACAGATGCTGGGCGTGTCATGAGGCCACTATTCGTGGTGGACAATGACGTCCGCAGCCCGAACCAGAACCGCCTAGTGTTCAACAGGGAGCATTTCCAAGCAATCCTGAATGACGAAACT------GTCGAAGTAGCT------GGCATGAGCGAAGAAGAGGCAAGCAGAGCGCGGTTCGGCTGGAAGGGCCTTCTCCAGAGTGGCTGCGTTGAGTATCTTGACGCGGAAGAAGAGGAATCAGCCATGATCGTAATGTCACCCGAAGATCTGGATGAATGGCGCGAGATGAAACAGGGCAACCCAGAGCCTCCACAAGAAAAG---ACTGGTGAGA------AGCGACTGGCGCCAGTCAAGCCGAAGCCCAACTCTGCCGTTGCCGCCTACACGCACTGCGAGATTCATCCTGCTATGATCCTTGGTATCTGTGCCAGTATCAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGACGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACTCTCGGTGTTAGGCAGATCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACAAGGAGATTGTCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGCACATTCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGACTCCTCTACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGTTACCGGCAAGACCCTCCTCGATGCCATTGATGCCATCGACCCCCCGTCCCGTCCCTCCGACAAGCCCCTCCGCCTGCCCCTCCAGGATGTCTACAAGATTGGTGGCATTGGCACGGTTCCCGTCGGACGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCGAGGGTCTT---CCCGGAGACAACGTTGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAGATCCGTCGTGGAAACGTTGCCGGTGACTCCAAGCAGGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCTCCCGTCCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTGCTCGAGAAGATCGACCGCCGTACCGGCAAGTCTGTTGAGGCTTCTCCCAAGTTCATCAAGTCCGGTGACGCTGCCATCGTCAAGATG 'Massariosphaeria phaeospora CBS_611.86' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAACAGGGATTG-CCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC--TTTT------AGAGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGTGTTGAAGGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCCAATCTTCACCATGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCTGTG-TTTTT-ACGCG-GGGTACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGCTGG-ATAAAGATCTCTGGAACGTTCCTTCCTTC--GGGTTGGCCTTATATGG-GAGATGTCATGCAGCCAGCTTGAACTGAGG-TCCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCTTGTAA-----AAGAGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATGATAACTTCTCAGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGACTCCGGAGAGGGGGCCTAAGAAATAGCCACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACACTAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGTACTCGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCTCATGCCCTTCACTGGGTGTGCTGGGGAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGATCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGGTGTTTCTATATTGACCCGCTCGGCACCT---------------------------------------------TACCTGCAGAAGTGTGTGGAGAATAACCAGGACTTCAACGTGCAGATGGCCGTGAAAGCCAGCATCATCACGAATGGTCTGAAATACTCGTTGGCCACCGGGAACTGGGGTGACCAAAAGAAGGCCGGCACGGCGAAGGCAGGCGTCTCACAGGTGTTGAATCGCTATACGTATGCGTCTACGCTTTCTCATCTCCGGCGAACGAATACTCCTGTCGGTCGTGACGGTAAGCTGGCTAAGCCTCGACAGCTCCACAACTCTCACTGGGGGCTGGTATGTCCTGCCGAGACGCCTGAAGGACAGGCTTGTGGATTGGTGAAGAACCTTTCCTTGATGTGCTATGTCAGCGTCGGTAGCGAGAGTAAACCGATTACAGACTTCATGAGCCAACGAAACATGGAAGTTCTGGAGGAATACGACCCTGTTGCCAACCCGACCGCTACCAAGGTCTTCGTCAATGGTGTATGGGTAGGCGTACATTCACAACCGGCCCAGCTTGTGCAAGTCGTGCAAGAACTACGAAGGAATGGAACACTCTCCTACGAAATGAGTCTTATTCGCGATATTCGTGATCGAGAGTTCAAAATCTTCACCGATGCTGGGCGTGTCATGAGACCGCTGTTTGTAGTCGAGAACGATGTCAAGAAACCCAATCGAAACTGTCTTGTTCTTAACAAGGGTCATGTCCAGCGGCTACTCGAGGATAAAGAG------CTAGACACCAGA------GGTTTGAATGACGAGGACTCAGCGAATGCAAAGTTCGGCTGGAGGGGCCTCGTGCACGAAGGTGTCGTTGAGTATCTGGATGCCGAGGAAGAAGAGGGTGCCATGATTGTTATGTCACCCGAGGATCTGGACGAGTGGCGCGATTTGAAGCAAGGCATCCCAACGGCT------GATGGT---CCTCCTGAAG------ACAGACACAGGCGCATTAAGCCAAAGGCGAACGCGTCCATCCACGCCTATACACATTGCGAAATCCACCCTAGCATGATTCTTGGTGTCTGTGCCAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Mauritiana rhizophorae BCC_28866' -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTT------AGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TATGGCGTTGGCCGCGGTCTAAGTTCCTTGGAACAGGGCGTCGCAGAGGGTGAGAACCCCGTACGTGGCCGCCGGCCCTCGCCGTGTATAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTCGCCCGCGGTTGCTCAGCCGGG-CTTCT-GCCCG-GTGCACTCTTCCGCGGGCGGGCCAGCATCAGTTCGGGCGGTCAG-ACAAAGGCACGCGGCAGGTACCCATCTAC--GGGTGGGACTTATAGGG-TGTGCGGCATATGACCAGCCAGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGATCCCTC-----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCGGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAGCCCCATGCCCTTCACTGGGTGTGAGGGGAATCCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCAATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTCACTGGGGCTTGGTGTGTCCTGCGGAGACTCCGGAAGGCCAGGCTTGTGGACTGGTAAAAAACCTCTCTTTAATGTGCTACGTCAGCGTTGGGAGTGAGAGTACCCCGATCACCGACTTCATGACCCAGCGGAACATGGATCTACTTGAAGAATACGACCCTGTGGTGAATCCCACAGCTACTAAGGTGTTCGTCAACGGTGTCTGGGTTGGAGTTCACTCGCAACCTTCGCAGCTTGTCTCTGTCGTCCAGGAGCTGCGACGGAACGGAACACTTTCGTATGAAATGAGCCTTATTCGAGATATTCGGGACCGAGAATTCAAGATCTTCACAGATGCAGGCCGAGTGATGAGGCCGCTATTCGTGGTAGAGACAGACTATCGGAAGCCCAACCGCGGCGAACTTGTGCTCAACAAGAGTCACATCCAGAAGCTCCTCGAGGACAAAGAG------ATTGATGTTTCA------GGGTATAATGACGAGGATACAGCGAACATGACATACGGCTGGAGGGGACTTATACATGACGGTGTCGTTGAATACCTCGACGCTGAGGAAGAAGAGACGGCTATGATTGTCATGACACCTGAAGATCTAGACGAACACCGAGATCTTATGCTGGGTGTCAAAGGTGCC------GAAGCA---GGCGACAATG------ATCG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGCCATCTTCATCATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTCGGTGTCAAGCAACTCATCGTTGCTATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGTTTCAACGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTTGGCTACAACCCCAAGACCGTCCCTTTCGTCCCCATCTCCGGTTTCAACGGTGATAACATGATCGACGCCTCCTCCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGTAAGACTCTTCTCGAGGCCATCGATGCCATCGACCCTCCCTCGCGTCCTTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTCCCTGTCGGCCGTGTCGAGACCGGTACCATCAAGGCCGGTATGGTCGTTACCTTCGCCCCGGCTGGTGTCACGACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTGACCGAGGGTGTG---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTCGCCGGTGACTCCAAGAACGACCCGCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCCCCTGTCTTGGATTGCCACACTGCCCACATCGCCTGCAAGTTCTCCGAGCTTCTCGAGAAGATCGACCGACGAACTGGCAAGTCCGTTGAATCTTCCCCCAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATG 'Melanomma pulvis pyrius CBS_124080' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAACAGGGATTG-CCCCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTC--TTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGCGC-TTTGGTGTCGGCAGCGGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCTGCTTGTCTTCACCGTGTAAAG-CCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGTAGTTGCTCATCTGGG-GATTT-CCCCA-GTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-AGAAAGACCTGTGTCACGTAGCTCTCTTC--GGGG-AGTGTTATAGGG-CAGGTGGAATGCAACCAGCCTGGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACCACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTGTTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACCTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATATAGGGC-TCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTAGCGGGTCCGCCTCACCGCGTGCACTTGTCCGGCTGGACCTTTCCTT-CTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGATCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCT---TTCCGCATCTTGTTCCTTAAGTTGACCAAAGACGTCTACAAATATCTCCAGAAGTGCGTGGAGAACAATCAGGACTTCAACGTCCAGATGGCGATCAAGGCTAGCGTCATCACGAATGGTCTTAAGTATTCACTGGCTACAGGAAACTGGGGTGATCAGAAGAAAGCTGCTTCGGCCAAAGCCGGTGTCTCGCAGGTGTTGAATCGTTACACCTACGCATCAACACTCTCCCATCTCCGTCGAACCAACACCCCGGTCGGTCGTGATGGAAAGCTCGCCAAGCCCCGCCAACTGCACAACACGCATTGGGGCTTGGTGTGTCCTGCCGAGACTCCGGAAGGGCAGGCTTGTGGCTTGGTGAAGAATCTCTCATTGATGTGTTACGTTAGTGTCGGTAGCGAAAGTACGCCCATCACGGATTTCATGAGCCAGCGAAACATGGACCTCCTAGAAGAGTACGACCCGGTGGTCAATCCAAACGCTACCAAGGTTTTCGTCAACGGCGTTTGGGTGGGTGTACACTCGGCACCATCACAGCTGGTCGGTGTTGTGCAGGAGCTGCGCCGGAACGGAACTTTGTCTTACGAAATGAGTCTTATCCGAGACATTCGAGACCGAGAATTCAAGATCTTCACCGACGCAGGCCGAGTCATGAGACCTTTGTTCGTCGTCGAGACCAACTATCAAAAACCTAATCGTGGATGTCTAGTCCTCAATAAGGGCCACATCCAGAAACTGGAAAACGACAAGTAT------GTCGAAACGGGT------GGGATGAACGATGAGGATTCCGCAAATGCAAAGTTCGGGTGGAGGGGTCTAATCCATAATGGCGTGGTGGAATATCTCGACGCCGAAGAAGAGGAAACTGCCATGATAGTCATGACACCCGATGATTTGGTAGAGTGGCGCGACATTCAACTAGGCCATGCACCAGCC------GAGGCT---AACGAAAAGG------ATCGACACAGGCGGGTCAAGCCCAAGGCGAATCCCTCAATCCACGCGTACACTCATTGCGAGATTCACCCCAGTATGATACTGGGTATCTGCGCCAGCATCAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCTGCTTGCCTACACTCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCTCGTTTCCAGGAGATCATCAAGGAAACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTGCCCTTCGTCCCCATCTCTGGTTTCAACGGCGATAACATGATCGACAACTCTCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTACCGGCAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCCCCGTCGCGTCCCACTGACAAGCCCCTCCGCCTTCCCCTCCAGGATGTGTACAAGATTGGCGGCATTGGCACGGTTCCCGTCGGACGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTGACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAACAGCTTGTCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCTCCCGTCTTGGATTGCCACACTGCCCACATCGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATCGATCGCCGAACTGGTAAGGCCACTGAGACCAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATG 'Neooccultibambusa chiangraiensis MFLUCC_12_0559' TTCTCCCCTCGA-------GATAGCACCCTTG--ATTTCTAGTACC----TACGTGTTTCCTCGGCGGGTT-CGC-------CCGCCG-----------------AA-GGACCTCTT---------CAAAACCTAGTT-GCAGT--AGCAGTACCT-TCTGATAAAC---AAACAAAAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TATTCCTTAGGGCATGCCTGTTCGAGCGTCATTGA-AACCCTCAAGCGCAGCTTGGTGTTGGGCGTCTGTCCTCC--CCC-----GGGGGACTCGCCTCAAATGCA-TTGGCAGCCGGCA---CGTTG---GCCCCGAGCGCAGCAG----AATC-GCGCCC--GGCGTCTGGCGGTGCCCGGCTCTCCAGGAA----GCCTCTTCC-CAAGATGACCTCG-ATCAG-TA?????????????AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGCCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTCGGCGGCGGTCTGAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAGCCCCATACGTGGCCGCGCGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGG-CCCAC-GCCCG-GTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGAGCGGCCGG-ACAAAGACCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCGGCCAGCTCGGATTGAGG-CCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC--------------------------------------CCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAGCCTCGACTTCGGGAGAGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGGATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGTGAGCCTCATGCCCTTCACTGGGTGTGCTGGGGAACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATGAAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTACACTCTCGGTGTCAAGCAACTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGTTACCAGGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCTGGCTTCAACGGTGACAACATGATTGAGCCATCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACTAAGACCAAGTCCTCTGGTAAGACTCTCCTCGAGGCCATCGACGCCATCGACGCCCCAACTCGTCCCTCCGACAAGCCGCTCCGTCTTCCCCTCCAGGACGTGTACAAGATCGGTGGTATTGGCACGGTGCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTTACCACTGAAGTCAAGTCCGTCGAAATGCATCACGAGCAGCTTGTCGAGGGTCTC---CCCGGAGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAAGAGATCCGTCGTGGTAACGTCGCCGGTGACTCCAAGAACGATCCACCAAAGGGCTGCGACTCCTTCAACGCCCAGGTCATCGTCCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Neoroussoella bambusae MFLUCC_11_0124' --GAGCCGGGCC-------CCTACCACCCTTG--ACTTTGAGCACC----TTTTTGTTTCCTCGGCGGGGA-CGC-------CCGCCA-----------------GC-GAGGACCCC---------CAAAA-CCCTTTTGCAGTT-GGCAGTATTTGTCTGAAAAA----TAACAAATCGTTAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTGG-AAAATTCAAGCGCAGCTTGGTGTTGGGTGCTTGACCCGC--CTCC-GCGCGGAGTCTCACCCCAAAATCA-TTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCAC----AGTC-GCGCCC--AGGTATCTGGC-GGATCGGCTCTCCAGAAA----GCCCCTCTC-TTAGCTAGACCTCGATCACGTA?????????????????????????????????????????????????????GGGATTG-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--CCTC------GGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGCGTTGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCTGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTATCACGTACCACCCTTC--GGGGTGTCCTTATAGGG-GAGGCGCAACACGGCCAGCTCGAACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCTTA-------CGGGGTGCACCATCGACCGATCCTGAAGTTTACGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATA-GGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGTTCCGTATCCTGTTCCTCAAGCTTACAAAGGACGTCTTCAGCTTCCTTCAGAGATGCGTGGAGAGCAATCAAGACTTCAACGTTCAGATGGCTGTCAAAGCCAGCGTGATCACGAATGGGCTCAAATACTCGCTTGCCACAGGAAATTGGGGTGACCAGAAGAAAGCTGCTTCGGCTAAGGCTGGTGTATCTCAAGTGCTGAATAGGTATACATATGCCTCCACTCTTTCTCATCTTCGTCGTACGAATACTCCGATTGGCCGTGACGGAAAGCTCGCCAAACCACGACAGCTACACAACACTCACTGGGGATTGGTGTGCCCTGCTGAGACTCCGGAAGGTCAGGCCTGTGGTCTCGTGAAGAATCTTTCGTTGATGTGCTACGTCAGTGTCGGTAGTGAGAGTACTCCTATCACCGACTTTATGAGCCAGCGAAACATGGATCTTCTTGAAGAGTACGATCCAGTCGTCAATCCAACAGCCACCAAGGTTTTCGTCAACGGTGTCTGGGTCGGTGTACACTCACAACCCTCGCAGCTCGTGTCTGTCGTACAGGAACTCCGACGAAATGGAACATTATCTTATGAGATGAGTCTTGTCCGCGATATTCGAGACCGAGAATTCAAGATTTTCACAGACGCAGGCCGAGTCATGCGCCCTCTATATATTGTCGAGACTGATTACCGAAAACCCAATCGGGGTGCCCTTGTTTTAAGCAAAGGTCACATCAACAAGCTCATCGAGGATCTCCAA------ATTGATACTTCT------GGCTACAATGACGAGGATGCTCAAGCTATGAAATTTGGCTGGAAAGGACTTCTGCACGGTGGCGTGGTGGAATACCTTGATGCTGAAGAGGAAGAAACTTCCATGATCATCATGACACCCGAGGACCTCAACGAGCATCGTGATCTAATGCAGGGCATTCCTGCGTCT------GATGCA---CCCGATAAAG------ATCGTCACAAACGGATCAAGCAAAAGCCCAATCCTTCGGTGAAGACATACACTCATTGCGAAATACAGCCTAGCATGATACTTGGTATTTGTGCCAGTATCAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGCTATTCTCATCATTGCCGCTGGTACTGGTGAGTTCGAAGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTCGCCTACACTCTCGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGAGCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGATGCCTCTTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGCAAGACCCTCCTCGAGGCCATCGATGCCATTGATGCCCCCACCCGTCCCTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACCGGTACCATCAAGGCTGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTCCCGAGGGTCTC---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGACTCCTTCAACGCCCAGGTCATCGTTCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCACCCGTCCTCGATTGCCATACCGCCCATATCGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATTGACCGACGAACTGGCAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAATCTGGTGATGCCGCTATCGTCAAGATG Nigrograna_fuscidula_MF1 GCTCCAATCTGG-------GATAGAACCCTTG--CCTTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCG----------TAAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTTA-AACATTCAAGCCCAGCTTGGTGTTGGGTGCTTGCCCTCC--CTCG---TGGTGGACTCACCTTAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTTCGAGCGCAGTAG----AAAC-GCGCCA--GACGTCCCGAC-ATGCTGGTCCCCCACAAG---ACCATTATTT-TAGCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGCTCATCTGGA-CTTTT-GTCCG-GTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCAGGCGGCTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGATTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTC---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGATCCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCTTTGTTCCGAATCTTGTTCTTGAAGATGACCAAAGACGTCTACAAGTACCTCCAGAGGTGCGTCGAGAATAACCAGGATTTCAATGTACAGATGGCAGTAAAAGCCAGCCTAATTACCAATGGTCTTAAATACTCGCTGGCCACCGGTAACTGGGGTGATCAGAAGAAGGCTGCCTCTGCCAAGGCTGGTGTCTCCCAGGTGCTGAACCGGTACACCTACGCATCAACACTCTCTCACCTTAGACGAACAAACACTCCTGTTGGTCGAGATGGCAAGCTCGCTAAGCCTCGACAGCTTCACAATACGCATTGGGGTTTGGTTTGCCCTGCCGAGACCCCGGAAGGACAAGCTTGCGGTCTAGTCAAGAACCTTTCGTTGATGTGCTATGTCAGTGTCGGTAGCGAAAGCACTCCAATCACAGATTTCATGAGTCAACGAAACATGGATTTATTGGAGGAATACGACCCAGTCGTCAACCCGACCGCAACAAAGGTTTTTGTCAATGGCGTTTGGGTAGGGGTGCATTCGCAACCATCACAGTTGGTGTCCGTAATGCAAGATCTCCGTCGCAACGGGACTTTGTCATACGAAATGAGTCTCATTCGTGACATTCGAGATAGAGAGTTTAAGATTTTCACGGACGCGGGCCGAGTAATGAGACCTCTGTTCGTTGTTGAGACCGACCCGCGCAAACCTAACCGCGGAAACCTCGTGCTCAACAAGAGTCATATCCATAACCTGGTCAATGATAAGGAG------GTCGACACTTCA------GGTTACAATGATGAGGATGCAGCGGCTATGAAATTCGGCTGGAGAGGCCTCATTCAAAGCGGTGCGGTCGAGTACCTTGATGCTGAAGAAGAAGAGACCGCTATGATCATCATGACACCCGAAGATCTCGACGAACATCGGGAGTTGATGCAAGGCAATCCGGTAGCT------GAAGGC---GTTGCTGAAG------ATCGCCACAAACGCATTAAGCCAAAGCCAAACCCATCCGTCAGGACTTATACTCACTGTGAGATTCATCCGAGCATGATTTTAGGCATCTGCGCCAGCATCATCCTCTTAGCGCT---------------CGAGCCAT---AATTTTGGCTTATC--GCTGGAGGGGCAATTTG--GATGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAGACCTGATTC-GGTCGTTCGCCAA--CAACACCACGATGACGCACATATCGAGTGCGAATTATGCTAATC---CTACGTAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTTGACAAGCTCAAGGCCGAGCGCGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAAACCCCACGTTACTATGTGACTGTCAGTAAGTAGCTCCTTCTTTATCATCATCAGCAGCATTGACGACAT--CTAGTTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATTTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTAGGTGTCCGACAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCTCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACTGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGCAAGACCCTCCTTGAGGCTATCGACGCCATCGACCCCCCTAGCCGTCCTTCTGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACTGTCCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACTGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGACGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGAGTCTTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- Nigrograna_fuscidula_MF1a GCTCCAATCTGG-------GATAGAACCCTTG--CCTTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCG----------TAAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTTA-AACATTCAAGCCCAGCTTGGTGTTGGGTGCTTGTCCTCC--CTCG---TGGTGGACTCACCTTAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTTCGAGCGCAGTAG----AAAC-GCGCCA--GACGTCCCGAC-ATGCTGGTCCCCCACAAG---ACCATTATTT-TAGCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGCTCATCTGGA-CTTTT-GTCCG-GTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCAGGCGGCTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGATTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTC---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTCTTAGCGCT---------------CGAGCCAT---AATTTTGGCTTATC--GCTGGAGGGGCAATTTG--GATGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAGACCTGATTC-GGTCGTTCGCCAA--CAACACCACGATGACGCACATATCGAGTGCGAATTATGCTAATC---CTACGTAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTTGACAAGCTCAAGGCCGAGCGCGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAAACCCCACGTTACTATGTGACTGTCAGTAAGTAGCTCCTTCTTTATCATCATCAGCAGCATTGACGACAT--CTAGTTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATTTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTAGGTGTCCGACAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCTCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACTGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGCAAGACCCTCCTTGAGGCTATCGACGCCATCGACCCCCCTAGCCGTCCTTCTGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACTGTCCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACTGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGACGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGAGTCTTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- Nigrograna_fuscidula_MF3 GCTCCAATCTGG-------GATAGAACCCTTG--CCTTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCG----------TAAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTTA-AACATTCAAGCCCAGCTTGGTGTTGGGTGCTTGTCCTCC--CTCG---TGGTGGACTCACCTTAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTTCGAGCGCAGTAG----AAAC-GCGCCA--GACGTCCCGAC-ATGCTGGTCCCCCACAAG---ACCATTATTT-TAGCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGCTCATCTGGA-CTTTT-GTCCG-GTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCAGGCGGCTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGATTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTC---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTCTTAGCGCT---------------CGAGCCAT---AATTTTGGCTTATC--GCTGGAGGGGCAATTTG--GATGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAGACCTGATTC-GGTCGTTCGCCAA--CAACACCACGATGACGCACATATCGAGTGCGAATTATGCTAATC---CTACGTAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTTGACAAGCTCAAGGCCGAGCGCGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAAACCCCACGTTACTATGTGACTGTCAGTAAGTAGCTCCTTCTTTATCATCATCAGCAGCATTGACGACAT--CTAGTTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATTTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTAGGTGTCCGACAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCTCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACTGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGCAAGACCCTCCTTGAGGCTATCGACGCCATCGACCCCCCTAGCCGTCCTTCTGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACTGTCCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACTGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGACGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGAGTCTTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- Nigrograna_fuscidula_MF7 GCTCCAATCTGG-------GATAGAACCCTTG--CCTTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCG----------TAAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTTA-AACATTCAAGCCCAGCTTGGTGTTGGGTGCTTGTCCTCC--CTCG---TGGTGGACTCACCTTAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTTCGAGCGCAGTAG----AAAC-GCGCCA--GACGTCCCGAC-ATGCTGGTCCCCCACAAG---ACCATTATTT-TAGCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGCTCATCTGGA-CTTTT-GTCCG-GTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCAGGCGGCTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGATTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTC---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTCTTAGCGCT---------------CGAGCCAT---AATTTTGGCTTATC--GCTGGAGGGGCAATTTG--GATGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAGACCTGATTC-GGTCGTTCGCCAA--CAACACCACGATGACGCACATATCGAGTGCGAATTATGCTAATC---CTACGTAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTTGACAAGCTCAAGGCCGAGCGCGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAAACCCCACGTTACTATGTGACTGTCAGTAAGTAGCTCCTTCTTTATCATCATCAGCAGCATTGACGACAT--CTAGTTGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATTTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTAGGTGTCCGACAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCTCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACTGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGTCCACCGGCAAGACCCTCCTTGAGGCTATCGACGCCATCGACCCCCCTAGCCGTCCTTCTGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACTGTCCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACTGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGACGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGAGTCTTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- Nigrograna_fuscidula_MF8 GCTCCAATCTGG-------GATAGAACCCTTG--CCTTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCG----------TAAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTTA-AACATTCAAGCCCAGCTTGGTGTTGGGTGCTTGTCCTCC--CTCG---TGGTGGACTCACCTTAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTTCGAGCGCAGTAG----AAAC-GCGCCA--GACGTCCCGAC-ATGCTGGTCCCCCACAAG---ACCATTATTT-TAGCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGCTCATCTGGA-CTTTT-GTCCG-GTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCAGGCGGCTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGATTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTC---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Nigrograna_fuscidula_MF9 GCTCCAATCTGG-------GATAGAACCCTTG--CCTTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCG----------TAAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTTA-AACATTCAAGCCCAGCTTGGTGTTGGGTGCTTGTCCTCC--CTCG---TGGTGGACTCACCTTAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTTCGAGCGCAGTAG----AAAC-GCGCCA--GACGTCCCGAC-ATGCTGGTCCCCCACAAG---ACCATTATTT-TAGCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGCTCATCTGGA-CTTTT-GTCCG-GTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCAGGCGGCTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGATTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTC---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Nigrograna mackinnonii CBS_110022' GCTCCAATCTGG-------GATAGAACCCTTG--CCTTTGAGTACC----TTCTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCA----------TAAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTTA-AACATTCAAGCTCGGCTTGGTGTTGGGTGCTTGTCCTCC--CCCG---CGGTGGACTCACCTTAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTTCGAGCGCAGTAG----AAAC-GCGCCA--GACGTCCTGAC-ATGCTGGTCCCCCATAAG---ACTATTCTTT-TAGCTTGACC??????????????????????????????????????????????????????????????ACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGCTCATCTGGA-CTCTT-GTCCG-GTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCAGGCGGCTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGATTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTC---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGATCCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACCTACGCATCAACACTCTCTCACCTTAGACGAACGAACACTCCTGTTGGTCGAGATGGCAAGCTTGCTAAGCCTCGACAGCTTCACAATACGCATTGGGGTTTGGTTTGCCCTGCCGAGACCCCGGAAGGACAAGCTTGCGGTCTAGTCAAGAACCTTTCGTTGATGTGCTATGTCAGTGTCGGTAGCGAAAGCACTCCAATCACAGATTTCATGAGCCAACGAAACATGGATCTATTGGAGGAATATGACCCAGTTGTCAACCCGACCGCAACAAAGGTTTTTGTCAATGGCGTTTGGGTAGGCGTGCATTCGCAACCATCACAGTTGGTGTCCGTCATGCAAGATCTCCGTCGCAACGGGACTTTGTCATACGAAATGAGTCTCATTCGTGACATCCGAGATAGAGAGTTCAAGATTTTCACGGACGCTGGCCGAGTAATGAGGCCCCTGTTCGTTGTTGAGACCGACCCGCGCAAACCTAACCGCGGAAACCTCGTGCTCAACAAGAGTCATATCCATAACTTGGTCAATGATAAGGAG------GTCGACACTTCA------GGCTACAATGATGAGGACGCAGCGGCTATGAAATTCGGCTGGAGAGGTCTCATTCAAAGCGGTGCAGTCGAGTACCTCGATGCTGAAGAAGAAGAGACCGCTATGATCATCATGACACCCGAAGATCTAGACGAGCATCGGGAGTTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTCGGTGTCCGACAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACTGTCCCCTTCGTCCCTATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGTCCAAGGCCACTGGCAAGACCCTCCTTGAGGCTATCGACTCCATCGACCCCCCTAGCCGTCCTTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACTGTCCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTTACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACTGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAAATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGAGTCTTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTCGGTGCTGGTTACGCTCCAGTCTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCTTGGAGAAGATTGACCGACGAACTGGCAAGTCTGTTGAAGACAGCCCCAAGTTCATCAAGTCTGGTGATGCTGCCATCGTTAAGATG 'Nigrograna mackinnonii CBS_674.75' GCTCCAATCTGG-------GATAGAACCCTTG--CCTTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCA----------TAAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTTA-AACATTCAAGCCCAGCTTGGTGTTGGGTGCTTGTCCTCC-CCCCG---CGGTGGACTCACCTCAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTTCGAGCGCAGTAG----AAAC-GCGCCA--GACGTCCTGAC-ATGCTGGTCCCCCACAAG---ACCATTCTTT-TAGCTTGACC??????????????????????????????????????????????????????????????ACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGCTCATCTGGA-CTTTT-GTCCG-GTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCAGGCGGCTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGATTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTT---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGATCCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACCTACGCATCAACACTCTCTCACCTTAGACGAACAAACACTCCTGTTGGTCGAGATGGCAAGCTTGCTAAGCCTCGACAGCTTCACAATACGCATTGGGGTTTGGTTTGCCCTGCTGAGACCCCGGAAGGACAAGCTTGCGGTCTAGTCAAGAACCTTTCGTTGATGTGCTATGTCAGTGTCGGTAGCGAAAGCACTCCAATCACAGATTTCATGAGCCAACGAAACATGGATCTATTGGAGGAATATGACCCAGTTGTCAACCCGACCGCAACAAAGGTTTTTGTCAATGGCGTTTGGGTAGGCGTGCATTCGCAACCATCACAGTTGGTGTCCGTCATGCAAGATCTCCGTCGCAACGGGACTTTGTCATACGAAATGAGTCTCATTCGTGACATCCGAGATAGAGAGTTCAAGATTTTCACGGACGCCGGCCGAGTAATGAGACCCCTGTTCGTTGTTGAGACCGACCCGCGGAAACCTAACCGCGGAAACCTCGTGCTCAACAAGAGTCATATCCATAACTTGGTCAATGATAAGGAG------GTCGACACCTCA------GGCTACAATGATGAGGACGCAGCGGCTATGAAATTCGGCTGGAGAGGTCTCATTCAAAGCGGTGCAGTCGAGTACCTCGATGCTGAAGAAGAAGAGACCGCTATGATCATCATGACACCCGAAGATCTAGACGAGCATCGGGAGTTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTCGGTGTCCGACAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGTTACCAGGAGATCATCAAGGAGACCTCCAATTTCATCAAGAAGGTCGGATACAACCCCAAGACTGTCCCCTTCGTCCCTATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGTCCAAGGCCACCGGCAAGACCCTCCTTGAGGCTATCGACTCCATCGACCCCCCCAGCCGTCCTTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACTGTCCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTTCTGAGGGTGTT---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGAGTCTTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTCGGTGCTGGTTACGCTCCAGTCTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCTTGGAGAAGATTGACCGACGAACTGGCAAGTCTGTTGAAGACAGCCCCAAGTTCATCAAGTCTGGTGATGCTGCCATCGTTAAGATG Nigrograna_mackinnonii_E9303e GCTCCAATCTGG-------GATAGAACCCTTG--CCTTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCA----------TAAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTTA-AACATTCAAGCCCAGCTTGGTGTTGGGTGCTTGTCCTCC--CCCG---CGGTGGACTCACCTCAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTTCGAGCGTAGTAG----AAAC-GCGCCA--GACGTCCTGAC-ATGCTGGTCCCCCACAAG---ACCATTCTTT-TAGCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGCTCATCTGGA-CTTTT-GTCCG-GTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCAGGCGGCTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGATTGTAAGCGGCCCGTCTTGAAACACGAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTT---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGATCCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCT---------------------------------------------------------------------AACCAGGATTTCAATGTACAGATGGCGGTAAAAGCTAGCCTAATCACTAATGGTCTTAAATACTCGCTGGCCACCGGAAACTGGGGTGATCAGAAGAAGGCCGCGTCTGCCAAGGCTGGTGTCTCCCAGGTGCTGAACCGGTATACCTACGCATCAACACTCTCTCACCTTAGACGAACAAACACTCCTGTTGGTCGAGATGGCAAGCTTGCTAAGCCTCGACAGCTTCACAATACGCATTGGGGTTTGGTTTGCCCTGCTGAGACCCCGGAAGGACAAGCTTGCGGTCTAGTCAAGAACCTTTCGTTGATGTGCTATGTCAGTGTCGGTAGCGAAAGCACTCCAATCACAGATTTCATGAGCCAACGAAACATGGATCTATTGGAGGAATATGACCCAGTTGTCAACCCGACCGCAACAAAGGTTTTTGTCAATGGCGTTTGGGTAGGCGTGCATTCGCAACCATCACAGTTGGTGTCCGTCATGCAAGATCTCCGTCGCAACGGGACTTTGTCATACGAAATGAGTCTCATTCGTGACATCCGAGATAGAGAGTTCAAGATTTTCACGGACGCCGGCCGAGTAATGAGACCCCTGTTCGTTGTTGAGACCGACCCGCGGAAACCTAACCGCGGAAACCTCGTGCTCAACAAGAGTCATATCCATAACTTGGTCAATGATAAGGAG------GTCGACACCTCA------GGCTACAATGATGAGGACGCAGCGGCTATGAAATTCGGCTGGAGAGGTCTCATTCAAAGCGGTGCAGTCGAGTACCTCGATGCTGAAGAAGAAGAGACCGCTATGATCATCATGACACCCGAAGATCTAGACGAGCATCGGGAGTTGATGCAAGGCAATCCGGTAGCT------GAAGGC---GTTGCTGAAG------ATCGCCACAAACGCATTAAGCCAAAGCCAAACCCATCCGTCAGGACATATACTCACT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTCGGTGTCCGACAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAAGACCGTTACCAGGAGATCATCAAGGAGACCTCCAATTTCATCAAGAAGGTCGGATACAACCCCAAGACTGTCCCCTTCGTCCCTATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGTCCAAGGCCACCGGCAAGACCCTCCTTGAGGCTATCGACTCCATCGACCCCCCCAGCCGTCCTTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACTGTCCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTTCTGAGGGTGTT---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGAGTCTTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTCGGTGCTGGTTACGCTCCAGTCTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCTTGGAGAAGATTGACCGACGAACTGGCAAGTCTGTTGAAGACAG-CCCAAGTTCATCAAGTCTGGTG-------------------- Nigrograna_mycophila_MF5 GCTCC-ATCTGG-------GATAGAACCCTTG--AATTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCA-----------AAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAAA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTAG-AAACTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCGCCG-CCCG---CGGCGGACTCACCTCAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTAC-AGCGCAGTAC-----AAC-GCGTCT--GGCGTCTTGAT-ACACTGGTCCTCCAGAAG----CCCCTTCTT-TGACTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCTGTAGAGGTTCTACCGGT-CCAAC-GACCGTGTGCATTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGCTAG-ATAAAGACCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGTAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGTTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTGTAGCGCC---------------TCCGCCATC--ATTTTTGGCTTATC--GCT-GAGGGGCAATTTA--CATGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAATCCCGATTCGGGTCGTTCGCCAA--CAACACCATGATGACGCACATATCGAGTCCGAACGATGCTAACT---TCGAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCCCGAAGTACTATGTTACCGTCATTGGTATGTCTTGTTTGCATAAATGTCAACATCGATGCTAATCT--TCTGCAGACGCCCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTCGGTGTCCGACAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTCCCCTTCGTCCCTATCTCCGGCTTCAACGGTGACAACATGATCGAGCCCTCTCCCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATCGACCCCCCTAGCCGTCCCTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTTACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCAATGGTGGACAGCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAAATCCGACGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCGCCAAAGGGCTGTGAATCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- Nigrograna_mycophila_MF6 GCTCC-ATCTGG-------GATAGAACCCTTG--AATTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCA-----------AAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAAA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTAG-AAACTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCGCCG-CCCG---CGGCGGACTCACCTCAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTAC-AGCGCAGTAC-----AAC-GCGTCT--GGCGTCTTGAT-ACACTGGTCCTCCAGAAG----CCCCTTCTT-TGACTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCTGTAGAGGTTCTACCGGT-CCAAC-GACCGTGTGCATTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGCTAG-ATAAAGACCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGTAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGTTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTGTAGCGCC---------------TCCGCCATC--ATTTTTGGCTTATC--GCT-GAGGGGCAATTTA--CATGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAATCCCGATTCGGGTCGTTCGCCAA--CAACACCATGATGACGCACATATCAAGTCCGAACGATGCTAACT---TCGAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCCCGAAGTACTATGTTACCGTCATTGGTAGGTCTTGTTTGCATAAATGTCAACATCGATGCTAATCT--TCTGCAGACGCCCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTTCTTGCCTACACTCTCGGTGTCCGACAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTCCCCTTCGTCCCTATCTCCGGCTTCAATGGCGACAACATGATCGAGCCCTCTCCCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATCGACCCCCCTAGCCGTCCCTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTCACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCAATGGTGGACAGCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAAATCCGACGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCGCCAAAGGGCTGTGAATCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- Nigrograna_mycophila_TDK GCTCC-ATCTGG-------GATAGAACCCTTG--AATTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCA-----------AAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAAA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTAG-AAACTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCGCCG-CCCG---CGGCGGACTCACCTCAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTAC-AGCGCAGTAC-----AAC-GCGTCT--GGCGTCTTGAT-ACACTGGTCCTCCAGAAG----CCCCTTCTT-TGACTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCTGTAGAGGTTCTACCGGT-CCAAC-GACCGTGTGCATTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGCTAG-ATAAAGACCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGTAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCCGGCGTAATGGTTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGATCCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCTTTGTTCCGAATTCTGTTCTTGAAGATGACCAAGGACGTCTACAAGTACCTCCAGAAGTGCGTAGAGAACAACCAGGACTTCAATGTCCAAATGGCAGTAAAAGCGAGCCTCATCACGAATGGTCTCAAATATTCGCTAGCCACCGGCAACTGGGGTGACCAGAAGAAGGCCGCATCCGCCAAGGCTGGTGTCTCCCAGGTGCTCAATCGTTACACCTACGCGTCCACACTTTCTCATCTTCGAAGAACAAATACCCCCGTTGGCCGTGACGGCAAGCTTGCGAAACCGCGTCAGCTCCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACTCCGGAAGGACAGGCTTGTGGCCTAGTCAAAAACTTGTCATTGATGTGCTATGTCAGTGTCGGTAGTGAGAGCACTCCGATCACAGATTTCATGAGTCAGCGAAACATGGATCTGTTGGAAGAATACGATCCAGTCGTCAACCCCGCAGCGACGAAGGTGTTTGTCAACGGCGTCTGGGTCGGCGTCCACTCGCAACCATCACAACTGGTATCCGTCATGCAAGAGCTCAGGCGGAACGGGACTCTATCTTATGAAATGAGTCTCATTCGTGACATCCGAGATCGAGAATTCAAGATTTTCACCGACGCTGGCAGGGTGATGAGACCTTTATTTGTTGTCGAGACCGATTATCGCAAGCCGAATCGTGGAAGTCTCGTACTCAACAAGAGCCACGTACAGAGACTTCTTGAGGACAAGGAC------ATTGATACGTCA------GGTTACAACGACGATGATACCGCGGCTATGAAGTTTGGCTGGAGGGGTCTCATCCAAAGTGGTGTGGTAGAATATGTCGATGCCGAGGAAGAGGAGACCGCTATGATCATCATGACACCCGAGGATTTGGACGAGCATCGGGAACTAATGCAGGGCATTCCAGTAGCT------GAAGGC---GTTGCTGAAG------ACCGCCACAAGAGGATTAAACCCAAGCCAAACCCGTCCGTCAAGACTTACACTCACTGCGAGATCCATCCAAGTATGATTTTAGGCATCTGTGCCAGTATCATTCTTGTAGCGCC---------------TCCGCCATC--ATTTTTGGCTTATC--GCT-GAGGGGCAATTTA--CATGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAATCCCGATTCGGGTCGTTCGCCAA--CAACACCATGATGACGCACATACCGAGTCCGAACGATGCTAACT---TCGAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCCCGAAGTACTATGTTACCGTCATTGGTATGTCTTGTTTGCATAAATGTCAACATCGATGCTAATCT--TCTGCAGACGCCCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTCGGTGTCCGACAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAGATCATCAAGGAGACTTCCAACTTCATTAAGAAGGTCGGATACAACCCCAAGACCGTCCCCTTCGTCCCTATCTCCGGCTTCAACGGTGACAACATGATCGAGCCCTCTCCCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATCGACCCCCCTAGCCGTCCCTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTTACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTCAATGGTGGACAGCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAAATCCGACGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCGCCAAAGGGCTGTGAATCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- Nigrograna_norvegica_TR8 GCTCCAATCCGG-------GATAGAACCCTTG--CCATTTGAGTAC----CTTTCGTTTCCTCGGCGGGCT-GGC-------CCGTCG-----------------GT-GGACAACCA-----------AAA-CCCTTT-GTAAT--AGCAGTATCT-TCTGAG------AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTAG-TATATTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCTCC--CCCG---CGGCGGACTCACCTCAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTTCGAGCGCAGTAG----AAAC-GCGCCC--GGCGTCCTGAC-GTGCTGGTCCTCCACGAG---ACC-TTCTTT-TAGCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGTCC--TTTC------AGGGCCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGCAGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGTTCCGCCGGG-TTCTT-GCCCG-GTGTACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGCTGG-AGAAAGACCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCAGCCAGCCCGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGATTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGT---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACGCGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGATCCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCTTTGTTCCGAATTTTGTTCTTAAAGATGACCAAGGATGTCTACAAGTATCTACAGAGATGCGTAGAGAACAACCAGGACTTCAACGTTCAAATGGCAGTGAAGGCCAGTCTTATCACGAATGGACTCAAATACTCGCTAGCCACTGGAAACTGGGGTGATCAGAAGAAGGCTGCCTCTGCCAAGGCTGGTGTCTCCCAAGTGCTAAACCGGTACACGTATGCATCAACACTGTCCCATCTTCGACGAACGAACACGCCTGTTGGCCGTGACGGCAAGCTGGCCAAGCCACGACAACTCCATAATACGCATTGGGGTTTGGTTTGCCCGGCCGAGACTCCGGAAGGTCAGGCTTGCGGTCTCGTCAAGAACTTGTCATTGATGTGCTACGTCAGTGTCGGTAGCGAGAGCACTCCAATCACAGATTTCATGAGCCAGCGAAACATGGACTTGCTAGAAGAGTACGACCCGGTCGTAAATCCTACGGCAACGAAAGTGTTCGTCAACGGTGTATGGGTTGGAGTGCATTCGCAACCTTCGCAACTGGTGTCTGTCATGCAAGAGCTCAGGCGAAATGGTACCTTGTCGTACGAAATGAGTCTCATTCGTGACATCAGAGACCGAGAGTTCAAGATATTCACCGACGCTGGCAGGGTAATGAGACCTTTGTTCGTTGTCGAGACCGACTATCGCAAGCCTAACCGGGGGAGCCTTGTACTGAACAAGAGCCATGTTCAAAGGCTTCTTGATGACAAAGAC------GTTGATACTTCT------GGCTACAACGACGAAGACACCGCATCTATGAAATTTGGATGGAGGGGTCTCATCCAAAGTGGTGTGGTTGAGTATCTCGATGCCGAGGAAGAGGAGACGGTCATGATCATCATGACGCCCGAGGATCTGGATGAGCATCGGGAACTGATGCAAGGCATTCCAGTTGCT------GAAGGT---GTTGCGGAAG------ACCGTCACAAGAGGATCAAGCCAAAGCCAAACCCGTCCGTCAAGACCTACACTCACTGTGAGATTCACCCGAGCATGATCCTAGGCATCTGTGCCAGCATCAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Nigrograna_obliqua_BW4 GCTCC-ATCTGG-------GATAGAACCCTTG--AATTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCA-----------AAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTAG-GAACTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCGCCG-CCCG---CGGCGGACTCACCTCAAATGCA-TTGGCGGCTGGTA---TGTTG---GCTAC-AGCGCAGTAC-----AAC-GCGTCT--GGCGTCTTGAT-ATACTGGTCCTCCAGAAG----CCCCTTTTT-TGACTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCTGCAGTTGCTCATCCGGT-CTTCT-GACCG-GTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGCTAG-ATAAAGACCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGTAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGTTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTCTAGCGCC---------------TCCGCCATC--ATTTTTGGCTTATC--GCT-GAGGGGCAATTTA--CATGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAATCCCGATTCGGGTCGTTCGCCAA--CAATACCATGATGACGCACATATCGAGTCCAAACGATGCTAACT---TGAAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCCCGAAGTACTATGTTACCGTCATTGGTATGTCTTTTTTGCGTAAATGTCTACATCGATGCTAATCT--TCTCCAGACGCCCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTCGGTGTCCGACAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTCCCCTTCGTCCCTATCTCCGGCTTCAACGGTGACAACATGATCGAGCCCTCTCCCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACCAAGTCCAAGTCGACTGGTAAGACTCTCCTCGAGGCCATCGATGCCATCGACCCCCCCAGCCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTGACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCAACGGTGGACAGCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGACGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCTAAGGGCTGTGAATCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- Nigrograna_obliqua_KE GCTCC-ATCTGG-------GATAGAACCCTTG--AATTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCA-----------AAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTAG-GAACTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCGCCG-CCCG---CGGCGGACTCACCTCAAATGCA-TTGGCGGCTGGTA---TGTTG---GCTAC-AGCGCAGTAC-----AAC-GCGTCT--GGCGTCTTGAT-ATACTGGTCCTCCAGAAG----CCCCTTTTT-TGACTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCTGCAGTTGCTCATCCGGT-CTTCT-GACCG-GTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGCTAG-ATAAAGACCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGTAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGTTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGATCCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCTTTGTTCCGAATTCTGTTCTTGAAGATGACCAAGGATGTCTACAAGTACCTCCAGAAGTGCGTAGAGAACAACCAGGACTTCAATGTCCAAATGGCAGTAAAGGCCAGCCTCATCACGAATGGTCTCAAATATTCGCTAGCCACCGGTAACTGGGGTGACCAGAAGAAGGCTGCATCCGCCAAGGCTGGTGTCTCGCAGGTGCTCAATCGTTACACCTACGCGTCAACACTTTCTCATCTTCGAAGAACAAATACCCCCGTTGGCCGTGACGGCAAGCTTGCAAAACCCCGTCAGCTCCACAACACGCATTGGGGTTTGGTCTGCCCAGCTGAGACTCCGGAAGGACAGGCTTGTGGCCTAGTCAAAAACTTGTCATTGATGTGCTATGTCAGTGTCGGTAGTGAGAGCACTCCGATCACAGATTTCATGAGTCAGCGAAACATGGATCTGTTGGAAGAATACGATCCAGTCGTCAACCCCGCAGCGACGAAGGTGTTTGTCAACGGCGTCTGGGTCGGCGTCCACTCGCAACCATCACAACTGGTATCTGTCATGCAAGAGCTCAGGCGGAACGGGACTCTATCTTATGAAATGAGTCTCATTCGTGACATCCGAGATCGAGAATTCAAGATTTTCACCGATGCTGGCAGGGTGATGAGACCTTTGTTTGTTGTCGAGACCGATTATCGCAAGCCGAATCGCGGAAGTCTCGTACTCAACAAGAGCCACGTACAGAGACTTCTTGAGGACAAGGAC------ATCGATACCTCA------GGTTACAACGACGATGATACCGCGGCTATGAAGTTTGGCTGGAGGGGTCTCATCCAAAGTGGTGTGGTAGAATATGTCGATGCCGAGGAAGAGGAGACCGCTATGATCATCATGACACCTGAGGATTTGGACGAGCATCGGGAACTAATGCAGGGCATTCCAGTTGCC------GAAGGC---GTTGCTGAAG------ACCGCCACAAGAGGATCAAACCCAAGCCAAACCCGTCCGTCAAGACTTATACTCACTGCGAGATCCATCCAAGTATGATTTTAGGCATCTGTGCCAGTATCATTCTTCTAGCGCC---------------TCCGCCATC--ATTTTTGGCTTATC--GCT-GAGGGGCAATTTA--CATGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAATCCCGATTCGGGTCGTTCGCCAA--CAATACCATGATGACGCACATATCGAGTCCAAACGATGCTAACT---TCAAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCCCGAAGTACTATGTTACCGTCATTGGTATGTCTTTTTTGCGTAAATGTCTACATCGATGCTAATCT--TCTCCAGACGCCCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTCGGTGTCCGACAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTCCCCTTCGTCCCTATCTCCGGCTTCAACGGTGACAACATGATCGAGCCCTCTCCCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACCAAGTCCAAGTCGACTGGTAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCCCCCAGCCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTGACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCAACGGTGGACAGCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGACGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCTAAGGGCTGTGAATCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- Nigrograna_obliqua_MF2 GCTCC-ATCTGG-------GATAGAACCCTTG--AATTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACTA-----------AAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTAG-GAACTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCGCCG-CCCG---CGGCGGACTCACCTTAAATGCA-TTGGCGGCCGGTA---TGTTG---GCTAC-AGCGCAGTAC-----AAC-GCGTCT--GGCGTCTTGAT-ATACTGGTCCTCCAGAAG----CCCCTTTTT-TGACTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCTGCAGTTGCTCATCCGGT-CTTCT-GACCG-GTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGCTAG-ATAAAGACCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGTAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGTTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTCCGAATTCTGTTCTTGAAGATGACCAAGGATGTCTACAAGTACCTCCAGAAGTGCGTAGAGAACAACCAGGACTTCAATGTCCAAATGGCAGTAAAGGCCAGCCTCATCACGAATGGTCTCAAATATTCGCTAGCCACCGGTAACTGGGGTGACCAGAAGAAGGCTGCATCCGCCAAGGCTGGTGTCTCGCAGGTGCTCAATCGTTACACCTACGCGTCAACACTTTCTCATCTTCGAAGAACAAATACCCCCGTTGGCCGTGACGGCAAGCTTGCAAAACCCCGTCAGCTCCACAACACGCATTGGGGTTTGGTCTGCCCAGCTGAGACTCCGGAAGGACAGGCTTGTGGCCTAGTCAAAAACTTGTCATTGATGTGCTATGTCAGTGTCGGTAGTGAGAGCACTCCGATCACAGATTTCATGAGTCAGCGAAACATGGATCTGTTGGAAGAATACGATCCAGTCGTCAACCCCGCAGCGACGAAGGTGTTTGTCAACGGCGTCTGGGTCGGCGTCCACTCGCAACCATCACAACTGGTATCTGTCATGCAAGAGCTCAGGCGGAACGGGACTCTATCTTATGAAATGAGTCTCATTCGTGACATCCGAGATCGAGAATTCAAGATTTTCACCGATGCTGGCAGGGTGATGAGGCCTTTGTTTGTTGTCGAGACCGATTATCGCAAGCCGAATCGCGGAAGTCTCGTACTCAACAAGAGCCACGTACAGAGACTTCTTGAGGACAAGGAC------ATCGATACCTCA------GGTTACAACGACGATGATACCGCGGCTATGAAGTTTGGCTGGAGGGGTCTCATCCAAAGTGGTGTGGTAGAATATGTCGATGCCGAGGAAGAGGAGACCGCTATGATCATCATGACACCTGAGGATTTGGATGAGCATCGGGAACTAATGCAGGGCATTCCAGTTGCC------GAAGGC---GTTGCTGAAG------ACCGCCACAAGAGGATCAAACCCAAGCCAAACCCGTCCGTCAAGACTTATACTCACTGCGAGATCCATCCAAGTATGATTTTAGGCATCTGTGCCAGTATCATTCTTCTAGCGCC---------------TCCGCCATC--ATTTTTGGCTTATC--GCT-GAGGGGCAATTTA--CATGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAATCCCGATTCGGGTCGTTCGCCAA--CAATACCATGATGACGCACATATCGAGTCCAAACGATGCTAACT---TCAAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCCCGAAGTACTATGTTACCGTCATTGGTATGTCTTTTTTGCGTAAATGTCTACATCGATGCTAATCT--TCTCCAGACGCCCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTCGGTGTCCGACAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAAGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTCCCCTTCGTCCCTATCTCCGGCTTCAACGGTGACAACATGATCGATTCCTCTTCCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCGACTGGTAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCCCCCAGCCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTCACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCAACGGTGGACAGCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGACGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCTAAGGGCTGTGAATCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- Nigrograna_obliqua_MRP GCTCC-ATCTGG-------GATAGAACCCTTG--AATTTGAGTACC----TTTTCGTTTCCTCGGTGGGCT-CGC-------CCGCCG-----------------GT-GGACAACCA-----------AAA-CTCTTT-GTAAT--AGCAGTATCT-TCTGAGA-----AAAACAAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTTGGGCATGCCTGTTCGAGCGTCATTAG-GAACTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCGCCG-CCCG---CGGCGGACTCACCTCAAATGCA-TTGGCGGCTGGTA---TGTTG---GCTAC-AGCGCAGTAC-----AAC-GCGTCT--GGCGTCTTGAT-ATACTGGTCCTCCAGAAG----CCCCTTTTT-TGACTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCTGCAGTTGCTCATCCGGT-CTTCT-GACCG-GTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGCTAG-ATAAAGACCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGTAGCCAGCCTGGATTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGTTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTCCGAATTCTGTTCTTGAAGATGACCAAGGATGTCTACAAGTACCTCCAGAAGTGCGTAGAGAACAACCAGGACTTCAATGTCCAAATGGCAGTAAAGGCCAGCCTCATCACGAATGGTCTCAAATATTCGCTAGCCACCGGTAACTGGGGTGACCAGAAGAAGGCTGCATCCGCCAAGGCTGGTGTCTCGCAGGTGCTCAATCGTTACACCTACGCGTCAACACTTTCTCATCTTCGAAGAACAAATACCCCCGTTGGCCGTGACGGCAAGCTTGCAAAACCCCGTCAGCTCCACAACACGCATTGGGGTTTGGTCTGCCCAGCTGAGACTCCGGAAGGACAGGCTTGTGGCCTAGTCAAAAACTTGTCATTGATGTGCTATGTCAGTGTCGGTAGTGAGAGCACTCCGATCACAGATTTCATGAGTCAGCGAAACATGGATCTGTTGGAAGAATACGATCCAGTCGTCAACCCCGCAGCGACGAAGGTGTTTGTCAACGGCGTCTGGGTCGGCGTCCACTCGCAACCATCACAACTGGTATCTGTCATGCAAGAGCTCAGGCGGAACGGGACTCTATCTTATGAAATGAGTCTCATTCGTGACATCCGAGATCGAGAATTCAAGATTTTCACCGATGCTGGCAGGGTGATGAGACCTTTGTTTGTTGTCGAGACCGATTATCGCAAGCCGAATCGCGGAAGTCTCGTACTCAACAAGAGCCACGTACAGAGACTTCTTGAGGACAAGGAC------ATCGATACCTCA------GGTTACAACGACGATGATACCGCGGCTATGAAGTTTGGCTGGAGGGGTCTCATCCAAAGTGGTGTGGTAGAATATGTCGATGCCGAGGAAGAGGAGACCGCTATGATCATCATGACACCTGAGGATTTGGACGAGCATCGGGAACTAATGCAGGGCATTCCAGTTGCC------GAAGGC---GTTGCTGAAG------ACCGCCACAAGAGGATCAAACCCAAGCCAAACCCGTCCGTCAAGACTTATACTCACTGCGAGATCCATCCAAGTATGATTTTAGGCATCTGTGCCAGTATCATTCTTCTAGCGCC---------------TCCGCCATC--ATTTTTGGCTTATC--GCT-GAGGGGCAATTTA--CATGGTGGGGTTGTGCGAACTTTTACGCGCTAGCGCTAATCCCGATTCGGGTCGTTCGCCAA--CAATACCATGATGACGCACATATCGAGTCCAAACGATGCTAACT---TGAAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCCCGAAGTACTATGTTACCGTCATTGGTATGTCTTTTTTGCGTAAATGTCTACATCGATGCTAATCT--TCTCCAGACGCCCCCGGCCATCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTTGCCTACACTCTCGGTGTCCGACAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACCGTCCCCTTCGTCCCTATCTCCGGCTTCAACGGTGACAACATGATCGAGCCCTCTCCCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACCAAGTCCAAGTCGACTGGTAAGACTCTCCTCGAGGCCATCGATGCCATCGACCCCCCCAGCCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTGACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTCAACGGTGGACAGCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAAATCCGACGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCTAAGGGCTGTGAATCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- 'Occultibambusa bambusae MFLUCC_13_0855' GCCCCGAGAGAG-----ACTGGGAAACCCAGA--TTTTCGCACACTT---CTTAAGTTGCCTCGGCGGGCT-CGC-------CCGCCC-----------------GG-CAGACACCC---------GAAAC-TCTTGT-GTAAT--GGCAGTAACT-TCTGACAAGC--AAAGCAAAAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGG-TATTCCTTAGGGCATGCCTGTTCGAGCGTCATTGT-TAACTTCAAGCTCTGCTTGGTGTTGGGCGCCTGTCCCCCGAACTCTCCGGGCGGACTCGCCTCAAATACA-TTGGCAGCCGGTA---CGTCA---ACCTCGAGCGCAGCAG----AATCAGCGCCC--GTCGCCCCGCG-CACCAGGCTCTCCAGGAA---GCACTTTCAT-CAGCT????????????????????????????????????AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--CTTT------GGGGCCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTCGGTCGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCGGTCCGCCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCGAG-CCTTCGGCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCAGGCGGCCGG-ACAAAGACCTCTGTCACGTATCTTCCTTC--GGGTTGACCTTATAGGG-GAGGTGTAATGCGGCCAGCCTGGATTGAGG-TCCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCG-TTATTTGATAGTACCT---TACTACTTGGATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTGTTTATTAGATAAAAAACCAATGCCT-TTCGGGGCTCCTTTGGTGATTCATGATAACCTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTCTTGGCTTACCATGGTTTCAACGGGTAACGGGGAGTTAGGGCTCGACTCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACGCGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCTTT-CTGGGGAGTCGCATGCCCTTCACTGGGTGTGTCGGCGGACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGATCGCCGTAATGATTAATAGGCTCAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCT--------AATCCTGTTCCTGAAGTTGACCAAAGATGTCTACAAGTACTTGCAAAAGTGCGTGGAGAACAACCAAGATTTCAATGTCCAGATGGCCGTCAAAGCTAGTGTCATCACGAACGGTCTCAAATATTCTCTTGCCACAGGAAACTGGGGCGACCAGAAGAAAGCTGCCTCAGCCAAGGCCGGTGTCTCCCAGGTGCTCAACCGTTACACATATGCCTCGACCCTTTCCCATCTGCGTCGAACAAATACTCCAGTTGGCCGTGACGGGAAGCTCGCGAAACCGCGTCAGCTACACAACACGCATTGGGGATTGGTGTGCCCTGCGGAAACTCCAGAAGGGCAGGCTTGTGGCTTGGTGAAAAATTTGTCCCTAATGTGTTACGTTAGTGTTGGCACTGAAAGTACTCCCATCACGGACTTCATGGGCCAGCGAAACATGGATCTCTTGGAGGAGTACGACCCAGTTGTCAACCCAACGGCAACAAAGGTATTCGTGAACGGCGTGTGGGTCGGTGTGCACTCACAGCCATCTCAACTTGTCTCTGGTATGCAAGAGCTTCGCCGGAACGGAACTCTACATTACGAGATGAGTCTTATCCGAGACATTCGAGATCGAGAGTTCAAGATTTTCACCGATGCCGGGAGAGTAATGAGGCCTCTCTTCGTAGTTGAGACCGACTATCGCAAGCCTAATAGGGGAAGCTTGGTGCTAAATAAGGGTCACATCCAAAGACTCGTCGAAGACAAAGAC------GTTGACACCTCT------GGATACAATGATGAAGACGCCGCAGCCATGAAATTTGGATGGAGAGGCCTGCTCCAGAGCGGTGTCATCGAATATCTTGACGCAGAAGAAGAGGAGACTGCCATGATCATCATGACACCTGAGGATCTCGATGAGCATCGCGAACTGATGCAGGGCATTCCTGTTGCG------GAGGGA---ATTACAGCTG------ATCGTCATAGGCGCATTAAGCCCAAGCCGAACCCAACGGTCAAGACTTATACTCATTGCGAGATTCATCCCAGTATGATTCTCGGCATTTGTGCCAGTATCAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGAGCCATCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACTGGTAAGACTCTCCTCGAGGCCATCGACTCCATCGATGCCCCAACCCGTCCCTCCGACAAGCCCCTCCGTCTCCCTCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTGCCCGTCGGCCGTGTCGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTGCCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGACTCCTTCAACGCTCAGGTCATCGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCCCCAGTCTTGGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGATCGCCGAACTGGCAAGTCTGTTGAGAACGCTCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATG 'Occultibambusa fusispora MFLUCC_11_0127' CCCCCCCCGCAA-------GATCAAACCCTTG-CGTTTCGAGTACC----CACCCGTTTCCTCGTCGGGCT-CGC-------CCGTCA-----------------GT-GGACCTCCA---------GAAAC-CTCTCT-GTAAT--AGCAGTATCT-TCTGAGAAGC--AAAGCAAAAAGTCAAAACTTTCAACGACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TATTCCTTAGGGCATGCCTGTTCGAGCGTCATTTA-ACCCCTCAAGCTCAGCTTGGTGTTGGGCGCCTGTCACCC--CTCCCGCGGGTCGACTCGCCTCAAATGCAGATGGCAGCCGGAT---CGTTG---GCTTCGAGCGCAGCAG----AAA????????--???????????-??????????????????---??????????-??????????????????????????????????????????????????????????????????????????????????-????????????????????????????AGCTCAAATTTGAAATCTGGCCC--CCTC------GGGGCCCGAGTTGTAATTTGTAGAGGGTGC-TTCGGCGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGCCAGCCCCCGCCGTGTGAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTCGCTCACCCGGGTCCTTC-ACCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGCCGG-ACAAAGACCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCGGCCAGCCCGGATTGAGG-TCCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGATCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCCCC-------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTCCGAATCCTCTTCCTCAAGATGACCAAAGATGTTTACAAGTACTTGCAAAAGTGCGTGGAAAACAGTCAGGATTTCAACGTCCAGATGGCTGTCAAAGCTAGTGTCATTACAAATGGCCTCAAATATTCGCTTGCCACAGGAAACTGGGGCGACCAGAAGAAAGCTGCCTCAGCCAAGGCGGGTGTCTCCCAGGTGTTGAACCGTTACACGTACGCCTCGACATTGTCCCATCTTCGTCGAACGAACACTCCAGTCGGTCGTGACGGGAAGCTCGCGAAACCTCGTCAGCTCCACAACACGCACTGGGGCTTGGTGTGTCCCGCTGAGACTCCAGAAGGGCAGGCTTGTGGCTTGGTGAAAAATTTGTCTCTAATGTGTTTCGTTAGTGTTGGTAGTGAGAGCACTCCAATCACGGACTTCATGGGTCAGCGAAACATGGACCTTCTGGAGGAGTACGATCCAATTGTCAATCCTACAGCAACCAAGGTATTCGTGAACGGTGTGTGGGTCGGTGTACACTCGCAGCCTTCACAACTTGTCTCTGGTATGCAAGAGCTTCGACGAAATGGCACCTTACCCTATGAGATGAGTCTTATTCGAGATATCCGAGATCGAGAGTTCAAAATTTTCACGGATGCTGGCCGAGTAATGAGACCTCTCTTCGTCGTCGAGACCGATTATCGTAAACCCAACCGAGGAAGTTTGGTGCTGAACAAGGGTCACGTGCAGAAGCTCCTTGAAGATAAAGAA------GTCGACACCTCA------GGATACAATGATGAAGACGCGGCTGCCATGAAGTTTGGGTGGAGAGGGCTCCTCCAGAGCGGTGTCATCGAGTATCTTGACGCAGAAGAAGAGGAGACTGCCATGATTATCATGACACCCGAAGACCTCGATGAACATCGCGAGCTGATGCAAGGCATTCCAGTTGCC------GACGGC---ATCGCGGCAG------ACCCTCATAAGCGCATTAAGCCCAAGCCGAACCCGTCAGTCAAGACCTACACTCACTGCGAGATCCACCCAAGTATGATTCTCGGCATTTGTGCCAGCATCAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGCTATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTTCTTGCCTACACCCTCGGTGTCAAGCAACTCATTGTTGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGAGCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCTTCTGGTAAGACCCTCCTTGAGGCCATCGACAACATCGATCCCCCAACCCGTCCCTCCGACAAGCCCCTCCGTCTCCCTCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTCCCAGTCGGTCGTGTCGAGACCGGTACCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTTCCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGACTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCTCCAGTCTTGGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCCGAGCTCTTGGAGAAGATTGACCGACGTACCGGCAAGTCTGTTGAGAACGCTCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATG 'Occultibambusa pustula MFLUCC_11_0502' GCCCTGAGAGAG-----ACTGGGAAACCCAGA--TTTTCGCACACTT---CTTAAGTTGCCTCGGCGGGCT-CGC-------CCGCCC-----------------GG-CAGACACCC---------GAAAC-TCTTCT-GTAAT--GGCAGTAACT-TCTGATAAGC--AAAGCAAAAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGG-TATTCCTTAGGGCATGCCTGTTCGAGCGTCATTGT-TAACTTCAAGCTCTGCTTGGTGTTGGGCGCCTGTCCCCCGAACCCCCCGGGCGGACTCGCCTCAAATGCA-TTGGCAGCCGGTA---CGTCA---GCCTCGAGCGCAGCAG----AATCAGCGCCC--GTCGCCCCGCG-GACCAGGCTCTCCAGGAA---G?????????-?????????????????????????????????????????AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TCTC------GGGGCCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGCGTCGGTCGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCGGTCCGTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCGAG-CCTTCGGCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCAGGCGGCCGG-ACAAAGACCTCTGTCACGTATCATCCTTC--GGGCTGACCTTATAGGG-GAGGTGTAATGCGGCCAGCCTGGATTGAGG-TCCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCC---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTGTTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTCTCTTGGTGATTCATGATAACCTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTCTTGGCTTACCATGGTTTCAACGGGTAACGGGGAGTTAGGGCTCGACTCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCTTT-CTGGGGAGTCGCATGCCCTTCACTGGGTGTGTCGGCGGACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGATCGCCGTAATGATTAATAGGCTCAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Ohleria_modesta_MGC GTGCTCCATCGA-------GATAGAACCCTTG-CCTTTTGAGTACC----CTCATGTTTCCTTGGTGGGCT-CGC-------CCGCCA-----------------AC-GGGGACTCC---------CCAAA-ACCCTT-GTATT--AGCGGTATCAGTCTGAAT-----AAAAGCAAATATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TACTCCTTAGGGCATGCCTGTTCGAGCGTCATTTA-AACCTTCAAGCCCCGCTTGGTATTGGGCGCTTGTCCCGC--CTGTAGTGTGTGGACTCGCCTTAAAGTCA-TTGGCAGCCGGTA---CGTTG---GCTTCGAGCGCAGCAC----AATA-GCGACT--CTCGACCCTGC-GGACTGGCT-TCCAGAAGC--CACTCTTCAC-GATTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGAGCCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCTGTGGTCTAAGTTCCTTGGAACAGGACGTCGCGGAGGGTGAGAATCCCGTATGTGGCCGCCAGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGG-CTCTT-GCCCG-GTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGTGGTTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACAGCCAGCTCGAACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTCCGAATCCTGTTCCTTAAGCTTACTAAGGATGTCTTTAAGTACTTACAAAAGTGCGTCGAGAACAACCAGGATTTCAATGTCCAAATGGCGGTAAAAGCTAGCGTTATCACGAACGGCCTCAAGTACTCTCTGGCTACGGGAAATTGGGGTGATCAAAAGAAGGCGGCTTCGGCGAAGGCTGGCGTCTCGCAGGTGCTTAACCGGTATACCTACGCCTCGACGTTGTCCCATCTGCGTCGCACAAACACTCCGGTCGGCCGTGACGGCAAACTGGCTAAACCACGACAACTGCACAACACTCACTGGGGTTTAGTGTGTCCCGCTGAGACTCCCGAAGGACAGGCTTGTGGCTTGGTCAAAAACTTATCATTGATGTGTTACGTCAGTGTCGGTAGTGAGAGTACACCCATCACCGACTTCATGAGTCAGCGAAACATGGATCTCCTTGAAGAGTACGACCCAGTTGTCAATCCGTCAGCCACTAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACAATCAACCAGCACAGCTTGTCTCTGTCGTGCAGGAGCTCCGACGGAATGGAACGCTGTCTTACGAAATGAGTCTTATCCGAGACATTCGAGACAGAGAATTTAAGATCTTCACAGATGCCGGACGCGTGATGAGGCCTCTCTTCGTTGTCGAGACCGATTATCGGAAACCTAATCGTGGAAGTTTAGTCCTCAACAAGAGCCATGTTCAGAAGCTCCTCGAAGACAAAGAC------ATAGATACTTCC------GGTTACAACGATGAAGACACCGCGGCCATGAAGTTCGGTTGGAGGGGTCTCATCCACAGCGGTGTAGTGGAATACCTTGACGCCGAGGAAGAGGAGACGGCCATGATCATCATGACGCCTGAAGATTTGGACGAACACAGAGACCTTATACAAGGCACTCCGCAGCCT------GAAGTT---GCAAATGCAG------ACCGCCACAGGCGAATCAAGCCGAAGCCTAACCCCTCAGTGAGAACTTACACTCACTGCGAGATCCATCCCAGTATGATTCTGGGTATCTGCGCCAGTATCATCCTCCAGGCGC----------------TCAGCCAT---AATTTTGGCTTATC--GCT-GAGGGGCAATTTG--GGTGGTGGGGTTGTGCGAACTTTTACGCGCTAGCACTAGGCCCGATCG-GGTAGTTCGCCAA--CCTCTACCCCATGACGCACATTTCATATCGTCTCGATGCTAACGCC-GCTCGCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACCCCGAAGTACTACGTTACCGTCATCGGTGAGGACGCCGCTCCCTTGCTTCTATGCTGCTGCTAACTC--CGTCCAGATGCCCCCGGTCACCGTGACTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCCGCTGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTCGGCGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAAGAGCGTTACAACGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGCCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCTCTGGCAAGACACTCCTCGAGGCCATCGATGCCATCGACCCCCCGTCCCGTCCTTCCGACAAGCCCCTCCGTCTCCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCCGTTGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCGGCCGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTGACCGAGGGTCTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCAGTCAAGGAGATCCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGACCCGCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGCCAGGTTGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- Ohleria_modesta_OM GTGCTCCATCGA-------GATAGAACCCTTG-CCTTTTGAGTACC----CTCATGTTTCCTTGGTGGGCT-CGC-------CCGCCA-----------------AC-GGGGACTCC---------CCAAA-ACCCTT-GTATT--AGCGGTATCAGTCTGAAT-----AAAAGCAAATATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TACTCCTTAGGGCATGCCTGTTCGAGCGTCATTTA-AACCTTCAAGCCCCGCTTGGTATTGGGCGCTTGTCCCGC--CTGTAGTGTGTGGACTCGCCTTAAAGTCA-TTGGCAGCCGGTA---CGTTG---GCTTCGAGCGCAGCAC----AATA-GCGACT--CTCGACCCTGC-GGACTGGCT-TCCAGAAGC--CACTCTTCAC-GATTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGAGCCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCTGTGGTCTAAGTTCCTTGGAACAGGACGTCGCGGAGGGTGAGAATCCCGTATGTGGCCGCCAGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGG-CTCTT-GCCCG-GTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGTGGTTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACAGCCAGCTCGAACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TCCGGGGCTC-TTTGGTGATTCATGATAACTCAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTTAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACGGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCCCATGCCCTTCACTGGGTGTGCGGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCTTTGTTCCGAATCCTGTTCCTTAAGCTTACTAAGGATGTCTTTAAGTACTTACAAAAGTGCGTCGAGAACAACCAGGATTTCAATGTCCAAATGGCGGTAAAAGCTAGCGTTATCACGAACGGCCTCAAGTACTCTCTGGCTACGGGAAATTGGGGTGATCAAAAGAAGGCGGCTTCGGCGAAGGCTGGCGTCTCGCAGGTGCTTAACCGGTATACCTACGCCTCGACGTTGTCCCATCTGCGTCGCACAAACACTCCGGTCGGCCGTGACGGCAAACTGGCTAAACCACGACAACTGCACAACACTCACTGGGGTTTAGTGTGTCCCGCTGAGACTCCCGAAGGACAGGCTTGTGGCTTGGTCAAAAACTTATCATTGATGTGTTACGTCAGTGTCGGTAGTGAGAGTACACCCATCACCGACTTCATGAGTCAGCGAAACATGGATCTCCTTGAAGAGTACGACCCAGTTGTCAATCCGTCAGCCACTAAGGTCTTCGTCAACGGTGTATGGGTCGGTGTGCACAATCAACCAGCACAGCTTGTCTCTGTCGTGCAGGAGCTCCGACGGAATGGAACGCTGTCTTACGAAATGAGTCTTATCCGAGACATTCGAGACAGAGAATTTAAGATCTTCACAGATGCCGGACGCGTGATGAGGCCTCTCTTCGTTGTCGAGACCGATTATCGGAAACCTAATCGTGGAAGTTTAGTCCTCAACAAGAGCCATGTTCAGAAGCTCCTCGAAGACAAAGAC------ATAGATACTTCC------GGTTACAACGATGAAGACACCGCGGCCATGAAGTTCGGTTGGAGGGGTCTCATCCACAGCGGTGTAGTGGAATACCTTGACGCCGAGGAAGAGGAGACGGCCATGATCATCATGACGCCTGAAGATTTGGACGAACACAGAGACCTTATACAAGGCACTCCGCAGCCT------GAAGTT---GCAAATGCAG------ACCGCCACAGGCGAATCAAGCCGAAGCCTAACCCCTCAGTGAGAACTTACACTCACTGCGAGATCCATCCCAGTATGATTCTGGGTATCTGCGCCAGTATCATCCTCCAGGCGC----------------TCAGCCAT---AATTTTGGCTTATC--GCT-GAGGGGCAATTTG--GGTGGTGGGGTTGTGCGAACTTTTACGCGCTAGCACTAGGCCCGATCG-GGTAGTTCGCCAA--CCTCTACCCCATGACGCACATTTCATATCGTCTCGATGCTAACGCC-GCTCGCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTGCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACCCCGAAGTACTACGTTACCGTCATCGGTGAGGACGCCGCTCCCTTGCTTCTATGCTGCTGCTAACTC--CGTCCAGATGCCCCCGGTCACCGTGACTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCCGCTGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTCGGCGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAAGAGCGTTACAACGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGCCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCTCTGGCAAGACACTCCTCGAGGCCATCGATGCCATCGACCCCCCGTCCCGTCCTTCCGACAAGCCCCTCCGTCTCCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCCGTTGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCGGCCGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTGACCGAGGGTCTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCAGTCAAGGAGATCCGTCGTGGCAACGTCGCTGGTGACTCCAAGAACGACCCGCCCAAGGGCGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGCCAGGTTGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- 'Paradictyoarthrinium diffractum MFLUCC_13_0466' CCCCTTGAGGGGGCACCCCATCACTACCCTTG--CCTTTGAGTACC-----TTCTGTTTCCTCGGCGGGTT-CGC-------CCGCCA-----------------AT-GGGGACTAATC-------CCAAA-CTCTTT-GCAGTA-GGCAGTGCAG-TCTGAAAAAA--AAGTAAAACTTTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TATTCCATAGGGCATGCCTGTTCGAGCGTCATTTA-AACCCTCAAGCTCAGCTTGGTGTTGGGTGTTTGTCCCGC--CTGCCGCGCGAGGACTCGCCTCAAAAGTA-TTGGCAGCCGGAA---CGTTG---GCTTTGAGCGCAGCAG----AATA-GCGCCC--CTGGCCTCGTT--GTCCGGTTCTCCAGGAAGCCTGTACCTCCA-TGTCTTGACCTCGGATC?????????????????????????????????????????????AAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGCGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGCATGCCTTGGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGG-CTCCT-GCCCG-GGGCACTCTTCTGTAGGCAGGCCAGCATCAGTCCGGGCGGTCGG-AAAATGGCCTCTATCACGTATATTCCCTC--GGGAAGACCTTATAGGG-GAGGCGTAATGCGTCCAGCCTGGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTT----------TGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCA-TAAATCAGTTATCG-TTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAGCCGCATGCCCTTCACTGGGTGTGCCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGATCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTTCATCTTGACTCGCTC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Paradictyoarthrinium tectonicola MFLUCC_13_0465' CCCCTTAAGGGGGCATCCCATCACTACCCTTG--CCTTTGAGTACC-----TTCTGTTTCCTCGGCGGGTT-CGC-------CCGCCA-----------------AT-GGGGACCAATC-------CCAAA-CTCCTT-GCAGT--AGCAGTGCAG-TTTGAAAAAAAAAAGTAATTCTTTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TATTCCATAGGGCATGCCTGTTCGAGCGTCATTTA-AACCCTCAAGCTCAGCTTGGTGTTGGGTGTTTGTCCCGC--CCGCCGCGTGAGGACTCACCTCAAAAGCA-TTGGCAGCCGGGA---CGTTG---GCTTTGAGCGCAGCAG----AATA-GCGCCC--CTAGCCTCGTT--GTCCGGTTCTCCAGGAAGCCTGTACCTCCA-TGTCTTGACCTCGGATCAGG?????????????????????AGCATATCA-TA-GCG-AGGAAA-GAAACCA-CAGGGATTG-CCCTAGT-ACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC----CTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGCGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGCATGCCTTGGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCAGTTGCTCACCCGGG-CTCCT-GCCCG-GGGCACTCTTCTGTAGGCAGGCCAGCATCAGTCCGGGCGGTCGG-AAAATGGCCTCTATCACGTATCTTCCCTC--GGGAAGACCTTATAGGG-GAGGCGTAATGCGTCCAGCCTGGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTC----------TGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAG-TATCGTTTATTGATAGTAACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTTCGGGGCTC-TTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAGCCGCATGCCCTTCACTGGGTGTGCCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGATCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTTCATCTTGACTCGCTC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Parathyridaria percutanea CBS_128203' CGCGTACACGCA-------TTATCCACCCTTG--ACTTTGAGCACC-----GTTTGTTTCCTCGGCGGGGA-CGC-------CCGCCA-----------------GC-GAGGACCCCA--------TTGAA-CCCTTT-GCAGT--AGCAGTATTTGTCTGAAAAA---AAACACAAAAATCACAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCTTGGGGCATGCCTGTTCGAGCGTCATTTA-ACCCTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCCGC--CTCCCGCGCGGCGACTCACCTCAAAGTCA-TTGGCAGCCCGCACC-CGCCG---GCCATGAGCGCAGCAC----AGTC-GCGCTC--CGGGCTCCGGCAGGGTCGGCTCCCCATAAG----CAACCCCCC-AAAATTGACC???????????????????????????????????????????????????????????????????????G-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTCGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCATGTGAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTCGG-ATAAAGGCCTCTGTCACGTACCACCCTCC--GGGGTGGCCTTATAGGG-GAGGCGCAACACGGCCAGCCTGAACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGTAGGTGGGAACCCTT---------CGGGGCGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTAGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCTAGCTGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGCGTGCCGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCAGTTCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACACCTATGCCTCAACTCTATCCCATCTTCGTCGCACCAACACTCCAATTGGCCGTGATGGAAAGTTAGCCAAACCTCGACAGCTACACAACACTCACTGGGGACTTGTTTGTCCTGCTGAAACACCAGAAGGGCAGGCTTGTGGCTTGGTTAAAAACCTTTCCTTGATGTGCTACGTCAGTGTCGGTAGCGAGAGTACTCCCATCACCGATTTCATGAGCCAACGGAATATGGATCTTCTTGAAGAGTACGATCCAATTGTTAATCCTACTGCCACCAAAGTATTCGTTAACGGCGTCTGGGTTGGTGTTCATTCACAACCTTCGCAATTAGTATCCGTTGTTCAAGAGCTTCGACGTAATGGAACTCTTTCGTACGAAATGAGCCTGGTCCGAGACATTCGAGACCGAGAGTTCAAGATTTTCACCGACGCGGGCCGAGTAATGAGACCACTGTATATCGTTGAAACCGATTATCGAAAACCCAACCGCGGTGCTCTTGTTCTCAACAAAGGCCACATTCAAAGGCTTCTCGAGGACACAGAG------GTTGACACCTCG------GGTTATAACGATGAGGATATCCAGAAGAAGACGTTTGGCTGGAAGGGACTTCTTCACAGCGGCGTAGTGGAATATCTAGATGCCGAAGAGGAAGAAACGTCCATGATCATTATGACACCAGAAGATCTGAATGAGCACCGCGACCTC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCATCATCGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCCCTTCTCGCCTACACCCTTGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTACAACGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGCAAGACCCTCCTCGAGGCCATCGACGCCATTGACCCCCCGTCCCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTGGCCGAGGGTGTG---CCAGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCTCCCGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATTGACCGACGAACTGGCAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATG 'Parathyridaria percutanea CBS_868.95' CGCGTACACGCA-------TTATCCACCCTTG--ACTTTGAGCACC-----GTTTGTTTCCTCGGCGGGGA-CGC-------CCGCCA-----------------GC-GAGGACCCCA--------TTGAA-CCCTTT-GCAGT--AGCAGTATTTGTCTGAAAAAA--AAACACAAAAATCACAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCTTGGGGCATGCCTGTTCGAGCGTCATTTA-ACCCTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCCGC--CTCCCGCGCGGCGACTCACCTCAAAGTCA-TTGGCAGCCCGCACC-CGCCG---GCCATGAGCGCAGCAC----AGTC-GCGCTC--CGGGCTCCGGCAGGGTCGGCTCCCCATAAG----CAACCCCCC-AAAATTGACC???????????????????????????????????????????????????????????????????????G-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTCGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCATGTGAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTCGG-ATAAAGGCCTCTGTCACGTACCACCCTCC--GGGGTGGCCTTATAGGG-GAGGCGCAACACGGCCAGCCTGAACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGTAGGTGGGAACCCTT---------CGGGGCGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTAGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCTAGCTGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGCCGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCAGTTCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACACCTATGCCTCAACTCTATCCCATCTTCGTCGCACCAACACTCCAATTGGCCGTGATGGAAAGTTAGCCAAACCTCGACAGCTACACAACACTCACTGGGGACTTGTTTGTCCTGCTGAAACACCAGAAGGGCAGGCTTGTGGCTTGGTTAAAAACCTTTCCTTGATGTGCTACGTCAGTGTCGGTAGCGAGAGTACTCCCATCACCGATTTCATGAGCCAACGGAATATGGATCTTCTTGAAGAGTACGATCCAATTGTCAATCCTACTGCCACCAAAGTATTCGTTAACGGCGTCTGGGTTGGTGTTCATTCACAACCTTCGCAATTAGTATCTGTTGTTCAAGAGCTTCGACGTAATGGAACTCTTTCGTACGAAATGAGCCTGGTCCGAGACATTCGAGACCGAGAGTTCAAGATTTTCACCGACGCGGGCCGAGTAATGAGACCACTGTATATCGTTGAAACCGATTATCGAAAACCCAACCGCGGCGCTCTTGTTCTCAACAAAGGCCACATTCAAAGGCTTCTCGAGGACACAGAG------GTTGATACCTCG------GGCTATAACGATGAGGATATCCAGAAGAAGACGTTTGGCTGGAAGGGACTTCTTCACAGCGGCGTAGTGGAATATCTAGATGCCGAAGAGGAAGAAACGTCCATGATCATTATGACACCAGAAGATCTGAATGAGCACCGCGACCTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGCTGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCCCTTCTCGCCTACACCCTTGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGAGCGTTACAACGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGCAAGACCCTCCTCGAGGCCATCGACGCCATTGACCCCCCGTCCCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTCTCCGAGGGTGTG---CCAGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCTCCCGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATTGACCGACGAACTGGCAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATG Parathyridaria_ramulicola_MF4 CGCGAACATGCA------TTCAACCACCCTTG--ACTTTGAGCACC-----GTTTGTTTCCTCGGCAGGGA-CGC-------CTGCCA-----------------GC-GGGGACCCC---------ATCGA-ACACTT-GCAAT--AGCAGTATTTGTCTGAGAAA---AAACACAAAAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-ACCCTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCCGC--CTCC-GCGCGGCGACTCACCTCAAAGTCA-TTGGCAGCCCGCACC-CGCCG---GCCACGAGCGCAGCAC----AGTC-GCGCTC--CAGGCCAC-GCAGGGGCGGCTCTCCAGAAG----CACCCCCCC-AATATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--CTTC------GGGGTCCGAGTTGTAATTTGCAGAGGGTGT-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAA-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTGTCACGTACCACCCCCTCGGGGGCGGCCTTATAGGG-GAGGCGCAACACGACCAGCCCGAACTGAGG-ACCGCGCATTATGCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGCGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTCAGGCGG----------------TAGGCCAT---ATTTTTGGCTTATC--ACT-GAGGGGCAAAATG--GATGGTGGGGTTGTGCGAACTTTT-CGCGCTAGCGCTAGGCCACATAT-GGC-ATTCGCCAA--CACCAACCCTATGACGCACATTGCATTTTTACATGATGCTAACGCC-TCTTACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGTTAAAGGCCGAGCGCGAGCGTGGTATCACCATCGATATCGCCCTCTGGAAGTTCGAGACCCCGAAGTACTATGTCACCGTCATTGGTATGCTCCCTGGGACGCATCTTGCTTCGCAATGCTAACCT--ACTACAGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGCGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTTCTCGCCTACACCCTCGGTGTGAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGTTTCCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGACGTCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACCGGAAAGACCCTCCTCGAGGCCATCGATGCCATCGACACCCCGTCCCGTCCGTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGAGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTACCATCAAGGCCGGTATGGTCGTGACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTTGCTGGTGTG---CCAGGAGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCAAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- Parathyridaria_ramulicola_MRR1 CGCGAACATGCA------TTCAACCACCCTTG--ACTTTGAGCACC-----GTTTGTTTCCTCGGCAGGGA-CGC-------CTGCCA-----------------GC-GGGGACCCC---------ATCGA-ACACTT-GCAAT--AGCAGTATTTGTCTGAGAAA---AAACACAAAAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-ACCCTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCCGC--CTCC-GCGCGGCGACTCACCTCAAAGTCA-TTGGCAGCCCGCACC-CGCCG---GCCACGAGCGCAGCAC----AGTC-GCGCTC--CAGGCCAC-GCAGGGGCGGCTCTCCAGAAG----CACCCCCCC-AATATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--CTTC------GGGGTCCGAGTTGTAATTTGCAGAGGGTGT-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAA-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTGTCACGTACCACCCCCTCGGGGGCGGCCTTATAGGG-GAGGCGCAACACGACCAGCCCGAACTGAGG-ACCGCGCATTATGCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGCGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGCCGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCTCTCTTCCGTATCTTGTTCCTTAAGTTGACAAAGGACGTTTTCAAGTACCTCCAGAAGTGTGTAGAGAACAACCAAGACTTCAATGTCCAGATGGCAGTCAAGGCCAGCGTCATCACGAACGGACTCAAGTACTCGCTCGCTACGGGAAATTGGGGTGACCAGAAGAAGGCGGCCTCGGCCAAAGCAGGCGTGTCTCAGGTGCTGAACAGGTACACATATGCTTCAACCTTATCCCATCTTCGTCGTACGAATACCCCAATTGGACGTGACGGGAAATTGGCCAAACCTCGCCAGCTCCATAACACCCACTGGGGCTTGGTGTGCCCTGCCGAGACTCCTGAAGGGCAAGCTTGTGGTTTGGTCAAGAATCTGTCTTTGATGTGCTACGTAAGTGTTGGTAGCGAGAGTACCCCCATCACCGACTTCATGAGCCAGCGAAACATGGATCTCCTCGAAGAGTACGACCCAGTTGTCAATCCTACCGCCACCAAGGTATTTGTCAACGGTGTTTGGGTCGGTGTTCATTCGCAGCCTTCACAGCTAGTGTCGGTTGTACAAGAACTCCGACGTAACGGAACCTTGTCTTACGAGATGAGTCTCGTCCGAGACATTCGAGATCGAGAGTTCAAGATCTTCACAGACGCGGGTCGAGTGATGAGGCCATTGTACATCGTCGAGACCGATTATCGGAAGCCCAACCGAGGTGCCCTTGTTCTAAACAAGGGTCATATCCAAAGGCTGCTTGAAGACACGCAA------ATCGATACATCT------GGTTACAATGACGAAGACGCTCAGACTATGAAGTTCGGCTGGAAAGGGTTGCTTCACGGCGGCGTAGTGGAATATCTCGACGCCGAAGAAGAAGAAACCTCTATGATCATCATGACCCCCGAAGATCTTAATGAGCATCGAGATCTCATGCAAGGCATTCCTGCTCCT------GAGGGT---ATACCTGAGG------ATCGTCACAGACGGATCAAACAGAAGCCGAATCCTTCAGTCAAGACATATACCCATTGCGAGATTCATCCCAGCATGATTCTTGGTATTTGTGCAAGCATTATTTTTCAGGCGG----------------TAGGCCAT---ATTTTTGGCTTATC--ACT-GAGGGGCAAAATG--GATGGTGGGGTTGTGCGAACTTTT-CGCGCTAGCGCTAGGCCACATAT-GGC-ATTCGCCAA--CACCAACCCTATGACGCACATTGCATTTTTACATGATGCTAACGCC-TCTTACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTGACAAGTTAAAGGCCGAGCGCGAGCGTGGTATCACCATCGATATCGCCCTCTGGAAGTTCGAGACCCCGAAGTACTATGTCACCGTCATTGGTATGCTCCCTGGGACGCATCTTGCTTCGCAATGCTAACCT--ACTACAGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGATTGCGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTTCTCGCCTACACCCTCGGTGTGAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGTTTCCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATCGACGTCTCCAGCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACCGGAAAGACCCTCCTCGAGGCCATCGATGCCATCGACACCCCGTCCCGTCCGTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGAGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTACCATCAAGGCCGGTATGGTCGTGACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTTGCTGGTGTG---CCAGGAGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCAAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCCCCGGTCCTCGATTGCCACACTGCCCACAT------------------------------------------------------------------------------------------------------------- 'Pleomassaria siparia CBS_279.74' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCCC--CTTT------GGGGTCCGAGTTGTAATTTGCAGAGGGCGC-TTTGGAGTTGGCTGCAGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGTTGCATGCCTTCGCCGTGTAAAG-CCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCATCCGGG-GTTCT-CCCCG-GTGCACTCTTCTGTGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-AGAAAGACCTGTGTCATGTAGCTGTTCTC--GGGC-AGTGTTATAGGG-CAGGTGGAATGCAACCAGCTCGAACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTT?T?GTTTATTTGATAGTACCT---TACCACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTGTTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACCTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACATGGC-TCTTTAGAGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTAGCGGGTCCGCCTCACCGCGTGCACTTGTCCGGCTGGACCTTTCCTT-CTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGATCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACACAATACTCATTGGGGCTTGGTGTGTCCGGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAATCTCTCGTTGATGTGCTACGTTAGTGTGGGTAGTGAGAGCACCCCCATCACGGATTTCATGAGTCAGCGAAACATGGATCTCCTGGAAGAGTACGACCCAGTCGTGAACCCACACGCTACCAAAGTCTTTGTCAACGGTGTTTGGGTGGGTGTGCATTCAGCACCCACACAACTTGTCAGTGTTGTGCAGGAGCTTAGACGGAATGGAACCTTGTCTTACGAAATGAGTCTGATTCGAGAAATTCGAGACCGGGAGTTCAAGATATTCACGGACGCTGGCCGCGTAATGAGACCGCTGTTCGTTGTTGAGACGAATTATCAAAAACCCAACCGTGGACACCTCGTCCTGCAAAAGGAACACATCAAGAGGTTAGAAGCGGATAATGAT------ATCAACACTACT------GGCATGAACGATGAGGATGCTGCGAACGCAAAGTTCGGTTGGAGGGGTCTCATTCACAGTGGTGTCGTGGAATATCTCGATGCCGAGGAAGAAGAAACCGCCATGATCGTTATGACACCTGAAGATTTGATAGAGTGGCGAGATCTCAAAGCTGGCCGGGCACCCGTG------GAAACA---AACGAGAACG------ACCGACATAGGCGTGTCAAACCGAAGCCTAATCCGTCTATCCATGCATATACTCATTGCGAGATTCACCCTAGTATGATTCTCGGCATTTGCGCCAGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGAATATGATTACTGGTACCTCCCAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGGGAGCACGCTCTACTCGCCTACACCCTTGGTGTCAAGCAGCTTATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGAGCGTTTCAACGAAATCATCAAGGAGACCTCTAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCGTTCGTCCCTATTTCCGGCTTCAACGGTGACAACATGATCGAGCCCTCCACCAACTGCCCCTGGTATAAGGGCTGGGAGAAGGAGACCAAGTCTAAGTCCTCTGGCAAGACCCTCCTTGAAGCCATCGACTCCATTGACCCCCCCACCCGTCCCTCCGACAAGCCCCTCCGTCTCCCGCTCCAGGACGTGTACAAGATCGGTGGTATTGGCACGGTCCCTGTCGGTCGTGTCGAGACCGGTGTTATCAAGGCCGGTATGGTCGTCACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCATCACGAGCAGCTTACTGAGGGCGTT---CCTGGCGACAACGTCGGCTTCAACGTCAAGAACGTCTCAGTGAAGGAAATTCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCACCAAAGGGTGCCGACTCCTTCAATGCCCAAGTCATCGTTCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCTCCAGTCTTGGATTGCCACACCGCCCATATTGCTTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGACCGACGAACTGGCAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCTGCTATCGTCAAGATG 'Roussoella angustior MFLUCC_15_0186' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGAGGAAAAGAAACCAACAGGGATTG--CTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTGAAATCTGGCTC--CTTT------GGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGCGTTGGCCGTGGTCCAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTACGTGGCCGCCGGACTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGTAGTTGCTCACCTGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTGTCACGTATCTTCCCTTCGGGGATGACCTTATAGGG-GAGGCGAAACACGACCAGCCCGGACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGCGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Roussoella chiangraina MFLUCC_10_0556' -------------------ATTACTACCCTTG--ACTTTGAGCACC----TTTTCGTTTCCTCGGCGGGTC-CGC-------CCGCCA-----------------GC-GAGGACCCC---------ATAAA-CTCTTT-GCAGTTGAGCAGTATTTGTCTGAGAAA---CATACCAATAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-AACCCTCAAGCCCAGCTTGGTGTTGGGTGCTTGTCCCGC--CTCCCGCGCGGCGACTCACCTCAAAATCA-GTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCAC----AGTC-GCGCCC--TAGGCCCCGGC-GGATCGGCTCTCCAGAAG-CCCC????????-??????????????????????????????????????????????????????????????????????????????ATTG-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGACGGTTGG-ATAAAGGCCTCTGTCATGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACGGCCAGCCCGAACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCTT--------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCCTTAAATTAACAAAGGACGTTTTCAGATACTTACAGAGGTGTGTGGAGAGCAACCAGGACTTTAATGTTCAGATGGCAGTCAAAGCCAGTGTTATCACGAATGGACTCAAGTACTCTCTCGCGACGGGTAATTGGGGCGACCAGAAGAAAGCCGCATCAGCAAAGGCTGGTGTTTCTCAGGTGCTGAATAGGTACACCTATGCGTCCACCTTATCCCATCTACGCCGTACGAACACCCCGATTGGTCGTGACGGAAAGCTCGCCAAACCTCGCCAACTACACAACACTCATTGGGGGTTGGTCTGCCCTGCCGAGACTCCAGAAGGGCAAGCATGTGGCTTGGTGAAGAATCTCTCATTGATGTGCTACGTAAGCGTTGGCAGCGAGAGCACTCCGATTACCGACTTTATGAGCCAGCGAAACATGGACCTCCTTGAAGAGTATGATCCAGTCGTGAATCCCACCGCCACCAAGGTCTTTGTAAACGGTGTATGGGTTGGTGTTCATTCCCAGCCTTCGCAGCTTGTGTCCGTCGTGCAAGAGCTCCGACGGAACGGAACATTGTCTTACGAAATGAGTTTGGTCCGTGACATTCGTGATCGAGAATTTAAAATCTTCACGGATGCTGGACGAGTCATGCGGCCTCTATACATCGTCGAAACTGATTATCGCAAACCCAATCGTGGCAACCTTGTCTTGAACAAGAGCCATATTTCGAGGCTCCATAACGATACCCAT------GTCGACACTTCG------GGTTTGAGCGACGAAGACGCCCAGTCATTGAAGTTTGGATGGAAAGGGCTTCTACATGGCGGTGTAGTGGAATATCTCGATGCCGAAGAAGAGGAGACATCCATGATCATCATGACACCCGAGGATCTGATCGAGCACCGTGATCTTATGCAAGGCATTCCCGCCCCT------GATGCA---CCTAGCGAAG------ATCGTCATAGGCGCATTAAGCAAAAGCCCAACCCTTCGGTGAGGACATATACTCACTGTGAGATTCATCCTAGTATGATACTTGGTATTTGTGCCAGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGGCCGACTGCGCCATTCTCATCATTGCCGCTGGTACTGGTGAGTTCGAAGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTCGCCTACACCCTCGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGAGCGCTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGCCTCCACCAACTGCCCGTGGTACAAGGGATGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTTGAGGCCATCGATGCCATCGATGCCCCCACCCGTCCTTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTTGAGACTGGTGTGATCAAGGCCGGTATGGTCGTTACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTTCCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCTGTCAAGGAGATTCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGACTCCTTCAACGCCCAGGTCATCGTTCTCAACCACCCCGGACAGGTCGGTGCTGGTTACGCTCCCGTCCTCGACTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTCTTGGAGAAGATTGACCGCCGTACTGGAAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATG 'Roussoella hysterioides CBS_546.94' CCACGGTCTGCG-------TGCTTCACCCTTG--AATTTGAGCACC----GTTTCGTTTCCTCGGCGGGTC-CGC-------CCGCCA-----------------GC-GAGGACCCC---------CAAAA-CGCTTT-GCAGT--AGCAGTTTTTGTCTGAACAAA--CATACCAATAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-CCCCCTCAAGCCCAGCTTGGTGTTGGGTGCTTGTTCCGC--CTCCCGCGCGGCGACTCACCTCAAAATCA-GTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCAC----AGAC-GCGCTC--TGGGTCCGGGC-AGATCGGCTCTCCAGAAG-C-TCCTTCTACC-ACTTTTGACC????????????????????????????????????????????????????????????????????????-???????????????????AGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACGACCAGCCCGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTTGCTGGAGAACCGCATGCCCTTCACTGGGTGTGCTGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCT---------------------------------------------------------TGTGTGGAGAGCAACCAGGACTTCAATGTTCAGATGGCGGTGAAAGCTAGCGTCATCACAAACGGACTTAAGTACTCTCTTGCCACGGGCAATTGGGGTGACCAAAAGAAAGCTGCTTCGGCAAAAGCTGGAGTGTCTCAGGTGCTGAACAGGTACACATATGCCTCCACTCTATCCCATCTACGCCGTACGAATACTCCGATTGGCCGTGATGGAAAGCTTGCCAAACCGCGACAACTACACAATACTCATTGGGGTCTAGTATGTCCTGCAGAGACTCCGGAAGGACAGGCTTGTGGCCTGGTGAAGAATCTGTCGCTGATGTGCTACGTGAGTGTTGGGAGTGAGAGTACCCCAATCACCGACTTTATGAGCCAGCGAAACATGGATCTTCTTGAGGAGTATGATCCAGTCGTTAATCCCACAGCCACTAAGGTCTTCGTTAATGGTGTATGGGTCGGTGTGCACTCTCAACCTTCGCAGCTAGTGTCCGTCGTACAGGAACTCCGCCGAAATGGAACATTGTCTTACGAGATGAGTCTTGTCCGTGACATTCGAGATCGAGAATTCAAGATCTTCACGGATGCCGGCCGAGTCATGCGTCCTTTATACATTGTCGAAACTGATTATCGCAAACCTAATCGCGGCAATCTTGTACTCAACAAAAGCCACATTTCGAGGCTCCTTGAGGATACCGAG------ATCGACACGTCG------GGTTATAATGATGAAGATGCTCAGACCATGAAGTTTGGCTGGAAAGGACTCTTGCACGGTGGCGTAGTGGAATATCTCGACGCCGAAGAGGAGGAGACATCTATGATCATCATGACCCCCGAGGATCTCATCGAGCATCGCGACCTCATGCAAGGCATTGCCGCACCT------GATGCG---CCAAGCGAAG------ATCGTCACAGACGCATCAAACAGAAGCCCAATCCTTCGGTCAGGACATACACTCATTGTGAGATTCACCCTAGCATGATACTTGGTATCTGTGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCTCCAAGGATGGTCAGACTCGTGAGCACGCCCTTCTCGCCTACACCCTCGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTGCCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGCCCTCTTCCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTTCTCGAGGCCATCGATGCCATCGACACCCCCACTCGTCCTTCCGACAAGCCTCTCCGCCTTCCTCTTCAGGATGTCTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTGTTATCAAGTCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTACCGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGACTCCTTCAACGCCCAGGTCATCGTTCTTAACCACCCCGGTCAGGTCGGTGCTGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATCGACCGACGAACTGGAAAGTCTGTTGAGAACAGCCCTAAGTTCATCAAGTCTGGTGATGCTGCTATCGTCAAGATG 'Roussoella intermedia NBRC_106245' -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTTTT-GCCTG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACGGCCAGCCCGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACTCTT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAAATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Roussoella japanensis MAFF_239636' -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACGACCAGCCCGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGCTGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCTCTCTTCCGAATTCTGTTTCTTAAATTGACAAAGGACGTCTTCAGATACCTACAAAGGTGTGTGGAGAGCAACCAGGACTTCAATGTTCAGATGGCGGTGAAAGCTAGCGTCATCACAAACGGACTTAAGTACTCTCTTGCCACGGGCAATTGGGGTGACCAAAAGAAAGCTGCTTCGGCAAAAGCTGGAGTGTCTCAGGTGCTGAACAGGTACACATATGCCTCCACTCTATCCCATCTACGCCGTACGAATACTCCGATTGGCCGTGACGGAAAGCTTGCCAAACCGCGACAACTACACAATACTCATTGGGGTCTAGTATGTCCTGCAGAGACTCCGGAAGGACAGGCTTGTGGCCTGGTGAAGAATCTGTCGCTGATGTGCTACGTGAGTGTTGGGAGTGAGAGTACCCCAATCACCGACTTTATGAGTCAGCGAAACATGGATCTCCTTGAGGAGTATGATCCAGTCGTTAATCCCACAGCCACTAAGGTCTTCGTTAATGGTGTATGGGTCGGTGTGCACTCTCAACCTTCGCAGCTAGTGTCCGTCGTACAGGAACTCCGCCGAAATGGAACATTGTCTTACGAGATGAGTCTTGTCCGTGACATTCGAGACCGAGAATTCAAGATCTTTACAGATGCCGGCCGAGTCATGCGTCCTTTATACATTGTCGAAACTGATTATCGCAAACCTAACCGCGGCAACCTTGTACTCAACAAAAGCCACATTTCGAGGCTCCTTGAGGATACCGAG------ATCGACACGTCG------GGTTATAATGATGAAGATACTCAGACTGCGAAATTTGGCTGGAAAGGACTCTTGCACGGTGGCGTAGTGGAATATCTCGACGCCGAAGAAGAGGAGACATCTATGATCATCATGACCCCCGAGGATCTCATCGAGCATCGCGACCTCATGCAAGGCATTGCCGCACCT------GATGCG---CCAAGCGAAG------ATCGTCACAGGCGCATCAAACAGAAGCCCAATCCTTCGGTTAGGACATACACTCATTGTGAGATTCACCCTAGTATGATACTTGGTATCTGTGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGGCCGATTGCGCTATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGTCAGACTCGTGAGCACGCTCTTCTCGCCTACACCCTCGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCCCGTTTCCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTGCCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGCCCTCTTCCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTTCTCGAGGCCATCGATGCCATCGACACCCCCACTCGTCCTTCCGACAAGCCTCTCCGCCTTCCTCTCCAGGATGTCTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTGTTATCAAGTCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTACCGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAATGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGACTCTTTCAACGCCCAGGTCATCGTTCTTAACCACCCCGGTCAGGTCGGTGCTGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATCGACCGACGAACTGGAAAGTCTGTTGAGAACAGCCCTAAGTTCATCAAGTCTGGTGATGCTGCTATCGTCAAGATG 'Roussoella magnatum MFLUCC_15_0185' --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTACATGGCCGCCGGACTTCGCCGTGTAAAGCCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCTGGG-CTTTT-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTCGG-ATAAAGGCCTCTGTCATGTATCTTCCCTCCGGGGATGACCTTATAGGG-GAGGCGCAACACGGCCAGCCTGAACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGCGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Roussoella mexicana CPC_25355' --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGAAACCAACAGGGATTG-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGTGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCTAGG-CTTTT-GCCTG-GGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTCGGACGGTTGG-ATAAAGGCCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACGACCAGTCTGAACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCTTT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Roussoella neopustulans MFLUCC_11_0609' TCCGGTCCTGCG-------TTTATCACCCTTG--ACTTTGAGCACC------TTTGTTTCCTCGGCGGGTT-CGC-------CCGCCA-----------------GC-GAGGACCCC---------CTAAA-CACTTT-GTAAT--AGCAATATTTGTCTGAAAAA---CATACCAATAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-AACCCTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCCGC--CTCC-GTGCGGCGACTCACCTCAAAATCA-GTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCAC----AGTC-GCGCCC--TAGGCCCCGGC-AGGTCGGCTCTCCAAAAG-C-CCATTTTACC-ACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA???????????????????????????????????????G-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCTGGG-CTCTC-GCCCG-GGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACGGCCAGCCTGAACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCACAGGCTGACTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTCGCCTACACCCTTGGTGTGAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGAGCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTCCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTTGAGGCCATCGATGCCATCGATGCCCCCACCCGTCCCTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTTGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTTCCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGCGCCGACTCCTTCAACGCCCAGGTCATCGTTCTTAACCACCCTGGTCAGGTCGGTGCTGGTTACGCTCCCGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATTGACCGACGAACTGGCAAGTCTGTTGAGAACAGCCCTAAGTTCATC-AGTCTGGTGACGCTGCCATCGTCAAGATG 'Roussoella nitidula MFLUCC_11_0182' TCGGGCGGTGCG-------TTCATCACCCTTG--AATTTTAGTACC-----TTTTGTTTCCTCGGCGGGTT-AGC-------CCGCCA-----------------AC-GAGGACCCA---------ACAAA-CATCTT-GCAGT--AGCAGTTTTTGTCTGAAATT----AAACAAATAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-CATTCCATAGGGCATGCCTGTTCGAGCGTTATTTA-AACCCTCAAGCTCAGCTTGGTGATGGGTGCTTGTCTCGC--CTTC-GCGCGGTGACTCACCTCAAATTCA-GTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCAC----AAAC-GCACTC---AAGTCTAGGT-AGATCGGCTCTCCAAAAG---CCC???????-???????????????????????????????????????????????????????????????????????????GGGATTG-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTC------AGAGTCCGAATTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCTAGG-CTTTC-GCCTG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGTCTCTATCACGTATCTTCCTTC--GGGAAGACCTTATAGGG-GAGACGCAACACGGCCAGCCTGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCTTT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATA-GGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGTTCCGGATTCTGTTCCTCAAATTGACAAAGGACGTCTTCCGATATCTACAAAGATGTGTGGAAAGTAACCAGGACTTCAATGTCCAGATGGCAGTGAAAGCCAGCGTCATCACAAACGGACTCAAGTACTCCCTCGCTACCGGCAATTGGGGCGACCAAAAGAAGGCTGCTTCAGCAAAGGCTGGAGTTTCTCAGGTGTTGAATAGGTATACATACGCCTCCACTCTATCTCATCTGCGCCGCACGAATACGCCGATTGGCCGTGACGGAAAGCTCGCCAAACCGCGACAATTACATAACACTCATTGGGGTCTGGTGTGTCCTGCAGAGACTCCGGAAGGACAAGCCTGTGGTTTGGTGAAAAACTTGTCACTGATGTGCTACGTGAGTGTTGGTAGTGAGAGTACTCCAATCACCGACTTCATGAGCCAACGAAACATGGATCTTCTTGAGGAGTATGATCCAGTGGTCAATCCCACAGCTACCAAGGTCTTCGTCAATGGTGTATGGGTCGGTGTGCATTCCCAACCTTCGCAGCTGGTGTCCGTCGTGCAGGAACTTCGGCGCAATGGAACCTTGTCTTACGAAATGAGTCTTGTCCGGGAAATTCGAGATCGTGAATTCAAGATCTTCACAGACGCAGGTCGTGTCATGCGACCTCTGTTCATTGTCGAAACTGATTATCGCAAACCTAATCGGGGCAACCTTGTCCTGAACAAAAGCCACATTTCGAAGCTGCTTGACGATACCCAG------ATTGACACGTCA------GGTTACAATGATGAAGATGCTCAGGCCATGAAGTTCGGTTGGAAAGGACTCTTGCACGGTGGTGTAGTGGAATATCTCGATGCCGAAGAAGAGGAGACATCTATGATTATCATGACACCCGAGGATCTCATCGAACATCGTGATCTCATGCAGGGCATCCCGGCACCT------GATGCA---CCTAGCGAAG------ATCGGCACAGGCGCATCAAGCAAAAGCCTAATCCTTCAGTGAGGACATATACTCATTGTGAGATTCAGCCTAGTATGATACTTGGTATCTGTGCCAGTATCAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTACTGGTACCTCCCAGGCTGACTGCGCTATTCTTATCATCGCCGCCGGTACTGGTGAGTTTGAGGCTGGTATCTCCAAGGATGGGCAGACCCGTGAGCACGCTCTCCTCGCCTACACCCTCGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACTAAATGGAGCGAGAGCCGTTTCCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTGCCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGCCTCCCCCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACCAAAGCCAAGGCCACTGGCAAGACCCTTCTCGAGGCCATCGACGCCATCGACACCCCCACCCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTACTGAGGGTGTG---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTGAAGGAAATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGACTCCTTCAACGCCCAGGTCATCGTTCTCAACCACCCCGGTCAGGTCGGTGCTGGTTA{CT}{GT}CTCCCGTCCTCGACTGCCACACTGCCCACATCGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGAC{CT}GACCGACGAACT--------------------------------------------------------------- 'Roussoella nitidula MFLUCC_11_0634' TCGGGCGGTGCG-------TTCATCACCCTTG--AATTTTAGTACC-----TTTTGTTTCCTCGGCGGGTT-AGC-------CCGCCA-----------------AC-GAGGACCCA---------ACAAA-CATCTT-GCAGT--AGCAGTTTTTGTCTGAAATT----AAACAAATAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-CATTCCATAGGGCATGCCTGTTCGAGCGTTATTTA-AACCCTCAAGCTCAGCTTGGTGATGGGTGCTTGTCTCGC--CTTC-GCGCGGTGACTCACCTCAAATTCA-GTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCAC----AAAC-GCACTC---AAGTCTAGGT-AGATCGGCTCTCCAAAAG---CCCATTTT-C-CATTTTAACCTCGGATCAGGTAGGGATACCCGCTGAACTTA???????????????????????????????ACAGGGATTG-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTC------AGAGTCCGAATTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCTAGG-CTTTC-GCCTG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGTCTCTATCACGTATCTTCCTTC--GGGAAGACCTTATAGGG-GAGACGCAACACGGCCAGCCTGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCTTT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGTTCCGGATTCTGTTCCTCAAATTGACAAAGGACGTCTTCCGATATCTACAAAGATGTGTGGAAAGTAACCAGGACTTCAATGTCCAGATGGCAGTGAAAGCCAGCGTCATCACAAACGGACTCAAGTACTCCCTCGCTACCGGTAATTGGGGCGACCAAAAGAAGGCTGCTTCAGCAAAGGCTGGAGTTTCTCAGGTGTTGAATAGGTATACATACGCCTCCACTCTATCTCATCTGCGCCGCACGAATACGCCGATTGGCCGTGACGGAAAGCTCGCCAAACCGCGACAATTACATAACACTCATTGGGGTCTGGTGTGTCCTGCAGAGACTCCGGAAGGACAAGCCTGTGGTTTGGTGAAAAACTTGTCACTGATGTGCTACGTGAGTGTTGGTAGTGAGAGTACTCCAATCACCGACTTCATGAGCCAACGAAACATGGATCTTCTTGAGGAGTATGATCCAGTGGTCAATCCCACAGCTACCAAGGTCTTCGTCAATGGTGTATGGGTCGGTGTGCATTCCCAACCTTCGCAGCTGGTGTCCGTCGTGCAGGAACTTCGGCGCAATGGAACCTTGTCTTACGAAATGAGTCTTGTCCGGGAAATTCGAGATCGTGAATTCAAGATCTTCACAGACGCAGGTCGTGTCATGCGACCTCTGTTCATTGTCGAAACTGATTATCGCAAACCTAATCGGGGCAACCTTGTCCTGAACAAAAGCCACATTTCGAAGCTGCTTGACGATACCCAG------ATTGACACGTCA------GGTTACAATGATGAAGATGCTCAGGCCATGAAGTTCGGTTGGAAAGGACTCTTGCACGGTGGTGTAGT-GAATATCTCGATGCCGAAGAAGAGGAGACATCTATGATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGGCTGACTGCGCTATTCTTATCATCGCCGCCGGTACTGGTGAGTTTGAGGCTGGTATCTCCAAGGATGGGCAGACCCGTGAGCACGCTCTCCTCGCCTACACCCTCGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACTAAATGGAGCGAGAGCCGTTTCCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTGCCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGACGCCTCCCCCAACTGCCCATGGTACAAGGGCTGGGAGAAGGAGACCAAAGCCAAGGCCACTGGCAAGACCCTTCTCGAGGCCATCGACGCCATCGACACCCCCACCCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTACTGAGGGTGTG---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTGAAGGAAATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGACTCCTTCAACGCCCAGGTCATCGTTCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCTCCCGTCCTCGACTGCCACACTGCCCACATCGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATTGACCGACGAACTGGCAAGTCTGTCGAGAACAGCCCCAAGTTCATCAAGTCTGGTGACGCTGCTATCGTC-AGATG 'Roussoella pustulans MAFF_239637' -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACGGCCAGCCCGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCT----TCCGAATTCTGTTTCTCAAATTGACAAAGGATGTCTTCAGGTACCTACAAAGGTGTGTGGAGAGCAACCAGGATTTCAACGTGCAGATGGCAGTAAAAGCCAGTGTCATCACGAACGGATTGAAGTACTCCCTCGCTACGGGCAATTGGGGTGATCAGAAGAAAGCTGCTTCGGCAAAAGCTGGAGTTTCGCAGGTGTTGAACAGGTACACATATGCCTCCACTCTGTCCCATCTACGCCGTACAAACACCCCGATTGGTCGTGACGGAAAGCTCGCCAAACCGCGACAACTACACAACACTCATTGGGGTCTGGTGTGCCCTGCAGAGACTCCGGAAGGACAAGCTTGTGGCTTGGTGAAAAACCTGTCACTGATGTGCTACGTGAGTGTCGGTAGTGAGAGTACACCAATTACCGACTTTATGAGCCAGCGAAACATGGATCTTCTTGAGGAGTATGATCCAGTCGTTAATCCTTCGGCCACCAAAGTCTTTGTCAATGGTGTATGGGTCGGTGTGCATTCCCAACCTTCGCAGCTAGTATCTGTCGTACAGGAACTCCGGCGCAATGGAACGTTGTCTTACGAAATGAGTCTTGTCCGTGACATTCGAGATCGGGAGTTCAAGATCTTTACGGATGCAGGCCGAGTCATGCGACCTCTATACATTGTCGAAACTGACTATCGCAAACCTAATCGTGGCAATCTTGTATTGACCAAGAGCCACATTTCGAGGCTCCTTGAAGACACACAG------ATCGACACGTCA------GGTTACAATGATGAAGATGCTCAATCCATGAAGTTTGGTTGGAAAGGACTTTTGCACGGTGGCGTAGTGGAATATCTCGACGCTGAAGAAGAGGAGACATCCATGATCATCATGACACCCGAGGATCTCATCGAGCACCGTGATCTCATGCAAGGCATTCCTGCACCT------GATGCG---CCTAGCGAAG------ATCGTCACAGGCGCATCAAGCAGAAGCCTAACCCTTCGGTCAGGACATACACCCATTGCGAGATTCACCCTAGTATGATACTTGGTATCTGTGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCAGGCTGATTGCGCCATTCTCATCATCGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGACGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTTGGTGTGAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGAGCGAGAGCCGTTTCCAGGAGATCATCAAGGAGACTTCTAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTGCCTTTCGTCCCCATCTCCGGATTCAACGGTGACAACATGATTGACTCTTCCCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGATCAAGACGAAGGTCACTGGTAAGACCCTCCTTGAGGCCATCGATGCCATCGACAACCCTGTCCGTCCCTCCGACAAGCCCCTCCGCCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTGTTATCAAGTCCGGCATGGTCGTCACCTTTGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCATCACGAGCAGCTTGTCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAATGTTGCCGGTGACTCCAAGAACGATCCTCCCAAGGGTGCCGACTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGTCAGGTTGGTGCTGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATTGACCGACGAACTGGCAAGTCTACTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCTGCTATCGTCAAGATG 'Roussoella scabrispora MFLUCC_11_0624' ACCCGGTCTGCG-------TGCTTCACCCTTG--GATTTGAGCACTG---TTTTTGTTTCCTCGGCGGGTC-CGC-------CCGCCA-----------------GC-GAGGACCCT---------TAAAA-CGCTTT-GTAGT--AGCAGTTTTTGTCTGAACAA---TGTACCAACAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-ACTCCTCAAGCCCAGCTTGGTGTTGGGTGCTTGTCCCGC--CCCT-GCGCGGCGACTCACCTTAAAATTA-???????????????-?????---????????????????----????-??????-????????????-??????????????????---??????????-??????????????????????????????????????????????????????????????????????????????????-??TCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT--CTTT------GGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CCCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTCGG-ATAAAGGCCTCTGTCACGTATCATCCCTC--GGGATGACCTTATAGGG-GAGGCGCAACACGGCCAGCCCGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTT---------TGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCTTCCGAATCCTGTTCCTGAAATTGACAAAGGACGTTTTCAGGTACCTACAAAGATGCGTGGAGAGCAATCAGGATTTCAATGTTCAGATGGCCGTAAAAGCTAGCGTCATCACGAACGGACTCAAATACTCCCTTGCTACAGGCAATTGGGGTGACCAAAAGAAAGCTGCTTCGGCAAAAGCTGGAGTGTCTCAAGTGCTGAACAGGTACACATATGCCTCTACCCTATCCCATTTACGCCGTACGAACACTCCGATCGGCCGTGACGGAAAGCTTGCCAAACCGCGACAGTTACACAACACTCACTGGGGTCTGGTGTGTCCCGCAGAGACTCCGGAAGGACAAGCTTGTGGCTTAGTGAAGAATCTGTCATTGATGTGCTATGTGAGTGTTGGCAGTGAAAGTACTCCAATCACCGACTTTATGAGCCAACGAAACATGGATCTTCTAGAGGAGTATGATCCAGTCGTTAATCCCACAGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTCGGTGTGCATTCTCAACCTTCGCAGCTAGTATCCGTCGTACAGGAACTTCGGCGCAATGGAACGTTATCTTACGAAATGAGTCTGGTGCGGGACATTCGAGATCGAGAATTCAAGATATTTACGGATGCAGGCCGAGTCATGCGTCCTCTATATATTGTCGAAACTGATTATCGCAAACCAAACCGTGGGAATCTTGTATTGAACAAAAGCCATATTTCGAGGCTTCTTGAGGATACTCAG------ATCGACACGTCG------GGGTATAATGATGAAGATGCTCAGGCCATGAAGTTTGGTTGGAAAGGACTCTTGCACGGTGGCGTGGTGGAATATCTCGACGCAGAGGAAGAGGAGACATCTATGATCATCATGACCCCCGAGGATCTTATCGAGCATCGCGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCCAGGCTGACTGCGCTATTCTCATCATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGCTCGTTTCCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTGCCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATTGAAGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGCAAGACTCTTCTCGAGGCCATCGATGCCATCGATGCCCCCACCCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGCATGGTCGTCACTTTCGCCCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTACCGAGGGTGTT---CCCGGTGACAATGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCAAGGGTGCCGACTCCTTCAACGCCCAGGTCATCGTTCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCACCTGTCCTCGATTGCCACACTGCCCACATCGCCTGCAAGTTCTCCGAGCTCTTGGAGAAGATTGATCGACGAACTGGAAAGTCTGTTGAGAACAGCCCTAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATG Roussoella_scabrispora_RSC ACCCGGTCTGCG-------TGTTTCACCCTTG--CATTTGAGCACTG---TTTTCGTTTCCTCGGCGGGTC-CGC-------CCGCCA-----------------GC-GAGGACCCC---------CAAAA-CCCTCT-GTAGT--AGCAGTTTTTGTCTGAACAA---TGTACCAACAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-ACTCCTCAAGCCCAGCTTGGTGTTGGGTGCTTGTCCCGC--CCCC-GCGCGGCGACTCACCTCAAAATTA-GTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCAC----AGAC-GCGCCC--TAGGTCCCGGC-GGATCGGCTCTCCAGAAAGCTTGTTTTCACC-ACTCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT--CTTC------GGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CCCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTCGG-ATAAAGGCCTCTGTCACGTATCATCCCTC--GGGATGACCTTATAGGG-GAGGCGCAACACGGCCAGCCCGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTCCAGGCGC----------------TGGCCCAT---ATTCTTGGCTTATC--GCT-GAGGGGCAATTTG-CACTGGTGGGGTTGTGCGAACTTTTTCGCGCTAGCGCTATTCCCGATCC-GGCC-CTCGCCAATCCCCCAACCCTATGACGCACATTTCAATTTTGGACAATGCTGACTGC-CTCCACAGGAAGCCGCCGAGCTCGGCAAAGGTTCCTTCAAGTATGCTTGGGTCCTGGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACGCCCAAGTACTACGTAACTGTTATTACTATTCCTTTCTTTCTCTCTTTTCGATTTTCTTGCTAACCCACCCACTAGATGCTCCCGGTCACCGTGATTTCATCAAGAACATGATTACTGGTACTTCCCAGGCTGACTGCGCCATTCTCATCATCGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCCCTGCTCGCCTACACCCTCGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGCTCGTTTCCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTGCCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATTGAAGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGCAAGACTCTTCTCGAGGCCATCGATGCCATCGATGCCCCCACCCGTCCTTCCGACAAGCCCCTCCGTCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGCATGGTCGTCACTTTCGCCCCCGCTGGTGTGACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTACCGAGGGTGTT---CCCGGTGACAATGTCGGCTTCAACGTCAAGAACGTCTCCGTTAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCAAGGGTGCCGACTCCTTCAACGCCCAGGTCATCGTTCTCAACCACCCCGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- 'Roussoella siamensis MFLUCC_11_0149' CCGCCGCAGGTA-------TTTACCACCCTTG--ACTTTGAGCACC----TTTTTGTTTCCTCGGCAGGTT-CGC-------CTGCCA-----------------GCAGAGGACCCT---------ATAAA-CACTTG-TAGTT--TGCAGTATTTGTCTGAAAAC----ATACCAATAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-AACCCTCAAGCTCAGCTTGGTATTGGGTGCTTGTCCCGC--CTCT-GCGCGGCGACTCACCTCAAAAACA-GTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCAC----AGTC-GCACTC-AACAGTCTTGGC-AGGTCGGCTAACCAAAAG---CTTACTTTTCTTATTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA-TCATA????????????????????GGGGTATTG-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTC------AGAGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGTGTTGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCTAGG-CTCTC-GCCTG-GGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACAACCAGCCTGAACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCTTT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTTTCCGAATTCTATTCCTCAAATTGACGAAGGATGTCTTCAGATACCTACAAAGGTGTGTGGAGAGCAACCAGGATTTCAATGTCCAGATGGCAGTAAAAGCCAGTGTTATCACAAACGGATTGAAGTACTCCCTTGCCACGGGTAATTGGGGTGATCAAAAGAAGGCTGCATCAGCAAAGGCTGGTGTCTCTCAGGTGTTGAACAGGTATACATATGCCTCCACCTTATCCCATTTACGTCGTACGAACACTCCAATCGGTCGTGACGGAAAACTCGCTAAACCACGACAACTACATAACACTCATTGGGGATTGGTCTGTCCCGCCGAGACTCCAGAAGGACAAGCCTGTGGCTTGGTAAAAAATCTCTCGCTCATGTGCTATGTCAGTGTTGGTAGTGAGAGTACACCAATTACCGACTTTATGAGCCAGCGAAACATGGATCTTCTTGAAGAATATGATCCAGTCGTGAATCCAACGGCTACCAAGGTCTTTGTCAATGGAGTATGGGTTGGTGTGCACTCACAACCGTCTCAGCTCGTTTCTGTCGTCCAAGAGCTGCGACGCAACGGAACCTTGTCTTATGAAATGAGTCTTGTCCGCGACATTCGAGATAGAGAATTCAAGATTTTCACAGACGCAGGTCGAGTCATGCGACCTCTTTACATTGTCGAAACCGATTATCGCAAACCCAACCGTGGCAATTTGGTTCTGAATAAGAGCCATATTTCAAGGCTCCTTGCAGATACTGAA------ATCGACACATCG------GGTTATAATGATGAAGATGCTCAAACCTTGAAGTTTGGTTGGAAAGGACTTTTGCATGGTGGCGTAGTCGAATATCTTGACGCTGAAGAAGAGGAGACTTCTATGATCATCATGACACCTGAGGACCTTATCGAGCATCGCGATCTTATGCAAGGAATTCCCGCGCCT------GATGCA---CCTAGCGAAG------ACCGACACAGACGTATCAAGCAAAAGCCCAATCCCTCCGTGAGGACATACACTCATTGCGAAATTCATCCTAGTATGATTCTCGGTATCTGCGCTAGTATCAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCTGATTGCGCCATTCTCAT-ATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTTCTCGCCTACACCCTTGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGATCAAGACCAAGGCCACCGGTAAGACCCTTCTTGAGGCTATCGATGCTATCGAGACCCCCGTCCGTCCTTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTCCCCGTCGGTCGTGTTGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTTCCGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGAGCCGACTCTTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCCGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTTCTTGAGAAGATCGACCGCCGAACTGGAAAGTCTGTTGAGAACAGCCCTAAGTTCATCAAGTCTGGTGACGCTGCTATCGTCAAGATG 'Roussoella sp. CBS_170.96' CCGCCACACGCG-------TTTATCACCCTTG--ACTTTGAGCACC-----TTTCGTTTCCTCGGCGGGTT-CGC-------CCGCCA-----------------GC-GAGGACCCC---------CCAAA-CCCTTT-GTAAT--AGCAATATTTGTCTGAAAAA----CAACCAATAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-ACCCCTCAAGCCTAGCTTGGTATTGGGTGCTTGTCCCGC--CTCTCGCGCGGCGACTCACCTCAAAGTCA-TTGGCAGCCCGCATCTCGCCG---GCCGTGAGCGCAGCAC----AGAC-GCGCTC--TTGGCAACGGT-GGATCGGCTCTCCAAAAG-C-----------TTATTTCAACCACTGACC?????????????????????????????????????????????????????????????????-??????????????????????GGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGTGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCACCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCTGGG-CTCTC-GCCCG-GGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACGACCAGCCTGAACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTTCTCGCCTACACTCTCGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCTGAGGCCCGTTTCCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACCGGAAAGACCCTCCTCGAGGCTATCGATGCCATCGATACCCCCGTCCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGCCGAGGGTGTT---CCCGGTGACAACGTCGGTTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGAAACGTCGCTGGTGACTCCAAGAACGATCCCCCCAAGGGTGCTGACTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCTGGTCAGGTCGGTGCTGGTTACGCTCCCGTCCTCGATTGCCACACTGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTACTGAGAACAGCCCTAAGTTCATCAAGTCTGGTGATGCTGCCATCGTCAAGATG 'Roussoella thailandica MFLUCC_11_0621' --GCGGGGCGTT-------TTTCTCACCCTCG--ACTTTGAGCACC------TTTGTTTCCTCGGCGGGTC-CGC-------CCGCCA-----------------AT-GAGGACCCA---------ACGAA-CCCTTT-GCAGT--AGCAGTTTTTGTCTGAAAAA----TAACCAATAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGG-TATTCCGTAGGGCATGCCTGTTCGAGCGTTATTTA-ACCCCTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCCGC--CTCCTGCGCGGCGACTCACCTCAAATACA-GTGGCAGCCCGCATT-CGCCG---GCCGTGAGCGCAGCAC----AAAC-GCGCCC---AGGTCCTGGC-GGGTCGGCTCTCCAGAAG---CCCATTTTTC-TATGTTAACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGC?????????????????????????????????????G-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCAGG-CTCTC-GCCTG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGTCTCTATCACGTATCTCCCTTC--GGGGAGACCTTATAGGG-GAGACGCAACACGGCCAGCCTGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCTTT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Roussoella verrucispora CBS_125434' -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACGGCCAGCCCGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTA-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGCTGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCTCTCTTCCGAATTCTGTTCCTTAAATTGACAAAGGACGTCTTCAGATACCTACAAAGATGTGTGGAGAGCAACCAGGACTTCAATGTTCAGATGGCCGTGAAAGCTAGCGTCATCACGAACGGACTAAAGTACTCCCTTGCCACGGGCAATTGGGGTGACCAAAAGAAAGCTGCTTCGGCAAAAGCTGGAGTGTCTCAGGTGCTGAACAGGTACACATATGCCTCCACTCTATCCCATCTTCGCCGCACAAACACTCCGATTGGCCGTGACGGAAAGCTTGCCAAACCGCGACAACTACACAATACTCACTGGGGCCTGGTATGTCCTGCAGAGACTCCGGAAGGACAAGCTTGTGGCCTGGTGAAGAATTTGTCACTGATGTGCTACGTGAGTGTTGGGAGTGAGAGTACTCCAATTACCGACTTTATGAGCCAGCGAAACATGGATCTTCTTGAGGAGTATGATCCAGTCGGTAACCCAGCAGCTACGAAGGTCTTCGTTAATGGTGTGTGGGTCGGTGTGCATTCTCAACCTTCGCAGCTAGTGTCCGTCGTACAGGAACTCCGCAGAAATGGAACATTGTCTTACGAGATGAGTCTTGTCCGGGACATTCGAGATCGAGAATTCAAGATCTTTACAGATGCAGGCCGAGTCATGCGCCCTCTATACATTGTCGAAACTGATTATCGCAAACCTAATCGCGGCAACCTGGTACTGAACAAAAGCCACATTTCGAAACTCCTTGAGGATATCGAG------ATCGACACGTCG------GGTTATAATGATGAAGATACTCAGGGTATGAAATTTGGCTGGAAAGGACTCTTGCATGGTGGCGTAGTAGAATATCTCGACGCCGAAGAAGAGGAAACTTCTATGATTATCATGACCCCCGAGGATCTCATCGAACATCGCGACCTCATGCAAGGTATTGCCGCACCT------GATGCG---CCTAGCGAAG------ATCGTCACAGGCGCATCAAACAGAAACCCAATCCTTCGGTCAGGACATACACTCATTGTGAGATTCACCCTAGTATGATTCTTGGTATTTGTGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCGCGACCGATTGCGCCATTCTCATCATCGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGAGGGTCAGACTCGTGAGGACGCCCTTCTCGCCTACACCCTTGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGTCTCGTTTCCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTGCCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGAGCCCTCCCCCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACCAAGGCCAAGTCCTCTGGTAAGACCCTTCTCGAGGCCATCGATGCCATCGACCAACCCACCCGTCCTTCCGACAAGCCTCTCCGCCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTGTTATCAAGTCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTTGTCGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGACTCCTTCAACGCCCAGGTCATCGTTCTTAACCACCCCGGTCAGGTCGGTGCTGGTTACGCACCCGTCCTCGATTGCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATTGACCGGCGAACTGGAAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCAGGTGATGCTGCCATAGTCAAGATG 'Roussoellopsis macrospora MFLUCC_12_0005' CCTCCCGGGTAA-------CCTACCACCCTTT--GTTTATTACACT-------TTGTTGCTTTGGCAGGCC-TGC-------CCTCGGGCTGCTGGCTCCGGCCGGC-GAGCGTCTGCCAGAGGACCTAAA-CTCTGT--TTGT---CTA-TAA-TGTCTGAGTAC----TATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGG-TATTCCGGGGGGCATGCCTGTCCGAGCGTCATTAC-AACCCTCAAGCTCAGCTTGGTGTTGGG------CCCCGC-----CGCCCCGGCG---GGCCCTAAAGTCA-GTGGCGG----TGCC-GTCCG---GCTCCGAGCGTAGTAATTCTTCTC-GCTCTG--GAGGTCCGGTC---GTGTGCTTGCCAGCAACCCCCAATTTTTT-TCAGGTGACCTC???????????????????????????????????????????????GGAAAAGAAACCAACAGGGATTG-CCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--CTTT------GGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGCCGGCCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CGCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTATCACGTACCTTCCTTC--GGGAAGACCTTATAGGG-GAGGCGCAACACGGCCAGCCCGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCCC--------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTT-CTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAAGGCGCCTGAAAAATAGCGACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCTTCCGAATCCTGTTCCTCAAATTGACGAAGGACGTCTTCAGATACCTACAAAGGTGTGTGGAGAGCAACCAGGACTTCAACGTCCAGATGGCCGTAAAAGCTAGCGTCATCACGAACGGACTCAAGTACTCCCTCGCCACGGGCAATTGGGGCGACCAAAAGAAGGCTGCTTCGGCAAAGGCTGGAGTGTCTCAGGTGCTGAATAGGTACACATATGCCTCCACTCTATCCCATCTACGCCGTACGAACACTCCGATTGGGCGTGACGGAAAACTTGCTAAACCGCGACAACTACACAACACTCATTGGGGTCTGGTGTGTCCTGCAGAGACTCCGGAAGGACAAGCCTGTGGTTTGGTGAAGAATCTGTCACTTATGTGTTATGTGAGTGTTGGGAGTGAGAGTACTCCAATCACCGACTTCATGAGCCAGCGAAACATGGATCTCCTTGAGGAGTATGATCCAGTCGTTAATCCCTCAGCCACCAAGGTTTTCGTCAACGGTGTATGGGTCGGCGTGCATTCTCAACCCTCGCAACTAGTGTCCGTCGTACAGGAACTCCGGCGCAATGGAACGTTGTCTTACGAAATGAGTCTAGTCCGTGACATTCGAGATCGAGAATTCAAGATCTTTACGGATGCAGGCCGAGTCATGCGTCCTCTATACATTGTCGAAACTGATTATCGGAAACCTAATCGTGGCAATCTCGTATTAAACAAAAGCCACATCTCGAGGCTCCTTGAGGATAGCGAG------ATTGACACGTCA------GGTTACAATGACGAAGATGCTCAGGCCATGAAGTTTGGTTGGAAAGGACTCTTGCACGGTGGCGTAGT-GAATATCTCGACGCTGAAGAAGAGGAGACGTCTATGATTATCATGACACCCGAGGATCTCATCGAACATCGTGACCTTATGCAAGGCATTCCCGCACCT------GATGCA---CCTAGCGAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGGCTGACTGTGCCATTCTCATCATCGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTTCTCGCCTATACTCTTGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACGACCAAGTGGAGCGAGAGCCGTTTCCAAGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTGCCCTTCGTCCCCATCTCCGGTTTCAACGGCGACAACATGATCGAAGCCTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTTCTTGAGGCCATCGATGCCATTGACAGCCCCACCCGTCCTTCCGACAAGCCTCTCCGCCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGCATGGTCGTCACCTTCGCCCCTGCTGGTGTCACCACTGAAGTCAAGTCGGTCGAAATGCACCACGAGCAGCTTACCGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCTCCCAAGGGCGCCGATTCGTTCAACGCGCAGGTCATCGTCCTTAACCATCCCGGTCAGGTCGGTGCTGGTTACGCACCCGTCCTCGATTGCCACACTGCCCACATCGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATCGACCGACGAACTGGAAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCTGCTATCGTCAAGATG 'Roussoellopsis sp. NBRC_106246' -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------GGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCTGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTGTCATGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGCGCAACACGGCCAGCCCGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCCC--------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATAATAACTTATCGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGAGCCTGAGAGACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Roussoellopsis tosaensis MAFF_239638' -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT--CTTC------GGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCACACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTATCACGTATCTTCCTTC--GGGAAGACCTTATAGGG-GAGGCGCAACACGGCCAGCCCGAACTGAGG-ACCGCGCATTC-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCCC--------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTG-CTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGTGCGCCTGAGAAACGGCGAACACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCTCTCTTCCGAATTCTGTTCCTCAAATTGACAAAGGACGTCTTCAGATACCTACAAAGGTGTGTGGAGAGCAACCAGGACTTCAATGTCCAGATGGCCGTAAAAGCTAGCGTCATCACCAACGGACTCAAGTACTCCCTCGCTACGGGCAATTGGGGCGACCAAAAGAAAGCTGCTTCGGCAAAGGCTGGAGTTTCCCAGGTTCTGAATAGGTACACATACGCCTCCACTCTATCCCATCTACGCCGGACGAACACTCCGATTGGGCGTGACGGAAAGCTTGCTAAGCCACGACAACTACACAACACTCATTGGGGTCTGGTGTGTCCTGCAGAGACTCCGGAAGGACAAGCCTGTGGTTTGGTGAAGAATTTGTCACTGATGTGTTATGTGAGTGTCGGGAGTGAGAGTACTCCAATCACCGACTTTATGAGCCAGCGAAACATGGATCTTCTTGAGGAGTATGATCCAGTCGTTAATCCCTCAGCCACCAAGGTTTTCGTCAACGGTGTATGGGTCGGTGTGCATTCTCAACCTTCGCAGCTGGTGTCCGTCGTACAGGAACTCCGGCGCAATGGGACGTTGTCTTATGAAATGAGTCTTGTCCGTGACATTCGAGATCGAGAATTCAAGATCTTTACGGATGCAGGCCGAGTCATGCGTCCTCTATACATCGTCGAAACTGACTATCGGAAACCTAATCGTGGCAACCTTGTATTAAACAAAAACCACATTTCGAGGCTCCTCCAGGATACCGAG------ATTGACACCTCA------GGCTATAATGACGAAGATGCCCAGGCCATGAAGTTTGGTTGGAAAGGACTCTTGCACGGTGGCGTAGTGGAATATCTCGATGCTGAAGAAGAAGAGACGTCTATGATCATCATGACACCCGAGGATCTCATCGAACACCGTGACCTTATGCAAGGCATTCCCGCACCT------GATGCA---CCTAGCGAAG------ATCGTCACAGGCGCTTCAAACAAAAACCCAATTCTTCGGTCAGGACATACACTCATTGTGAAATTCACCCCAGTATGATACTTGGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGGCTGACTGCGCCATTCTCATCATCGCCGCTGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGTCAGACCCGTGAGCACGCTCTCCTCGCCTATACCCTTGGTGTGAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGAGCCGTTTCCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTGCCCTTCGTCCCTATCTCCGGTTTCAACGGCGACAACATGATCGAAGCCTCCCCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGACCAAGGCCACGGGTAAGACCCTTCTCGAGGCCATCGATGCCATTGACACCCCCACCCGTCCTTCCGACAAGCCCCTCCGCCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGTACGGTCCCCGTCGGTCGTGTCGAGACGGGTGTTATCAAGGCCGGCATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCGGTCGAAATGCACCACGAGCAGCTTACCGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTTGCCGGTGACTCGAAGAACGACCCTCCCAAGGGCGCCGACTCCTTCAATGCCCAGGTCATCGTTCTTAACCACCCCGGTCAGGTCGGTGCTGGTTACGCTCCCGTCCTCGATTGCCACACTGCCCACATCGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATTGACCGACGAACTGGAAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCTGCCATTGTCAAGATG 'Seriascoma didymospora MFLUCC_11_0179' AACCCTCTTCGA-------GATAGAACCCTTG-ACTTTAGAGCACCT---TTTTTGTTTCCTCGGCGGGCT-CGC-------CCGCCA-----------------GC-AGGAACCCCTA-------AACAC-TCTTCT-GTAAT--AGCGGTACCT-TCTGAAATAT--AAAGCAAAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TATTCCTTAGGGCATGCCTGTTCGAGCGTCATTTTAACCCTTCAAGCTCAGCTTGGTGTTGGGCGTCTGTCCCTC--CCCC--CCGGGGGACTCGCCTCAAATGCA-TTGGCAGCCGGAA---CGTTG---GCTTCGAGCGCAGCAG----AAAC-GCGCCC--GGCGCCTGGCGGCCTCCGGCTCTCCAGAAA----GCCTACCCC-CA????????????????????????????????????????????????????????????????????????????????-?????????????????????????????GCTCAAATTTGAAATCTGGCTC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCCCTGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCGGTTGTTCACCCGAG-TCTCTGACCAG-GGGCATTCTTCCGCGGGCAGGCCAGCATCAGTTTGGGCGGCCGG-ACAAAGACCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCGGCCAGCCCGGATTGAGG-CCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA----------------------AATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGTGAGCCCCATGCCCTTCACTGGGTGTGCGGGGGAACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGCAGAAATGCGTGGAAAATAACCAGGATTTCAACATCCAGATGGCTGTCAAAGCTAGCGTCATTACAAACGGCCTCAAATACTCGCTTGCCACAGGGAACTGGGGCGACCAGAAGAAAGCTGCATCGGCTAAAGCCGGCGTTTCTCAGGTGCTGAACCGCTACACCTACGCCTCGACACTGTCCCATCTTCGTCGAACGAATACTCCAGTCGGTCGAGATGGAAAGCTCGCGAAACCGCGGCAGCTACATAACACGCACTGGGGATTGGTCTGTCCCGCCGAAACCCCAGAAGGGCAGGCGTGTGGCCTGGTGAAGAATCTGTCCTTGATGTGCTTTGTCAGTGTTGGCAACGAGAGTACGCCAATCACGGATTATATGACTCAGCGCAACATGGAGCTTTTGGAAGAGTATGATCCTGTGGTCAATCCAACAGCCACTAAGGTCTTCGTGAACGGTGTTTGGGTCGGTGTACACTCGGCACCTTCGCAACTTGTCTCTGTTGTGCAAGAGCTTCGACGTTTCGGAACTCTATCATACGAGATGAGTCTTATTCGAGATATTCGAGATCGAGAGTTTAAGATTTTCACCGATGCTGGTCGAGTCATGAGGCCCTTATTCGTAGTCGAGTCCGATTATCGTAAACCCAACCGGGGAAGTTTGGTGCTGAACAAGGGTCACGTCCAGAAGCTCATCGAGGATCAAGAA------ATCGATACCTCA------GGATACAACGACGAAGACACAGCTCAGATGAAGTTCGGCTGGACAGGTCTCGTCCACAGCGGTGTAGTTGAGTATCTCGACGCTGAAGAAGAGGAGACGGCCATGATTATCATGACACCTGAAGACCTGGACGAGCACCGCAAGCTCATGCAAGGCATTCCCCTCCCC------GAAGGC---ATATCGGCAG------ATCGTCATGTCCGCATTAAGCCCAAACCGAATCCGTCGGTCAAGACCTACACTCACTGCGAGATC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGCTATTCTCATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTTTTGGCCTACACTCTCGGTGTCAAGCAACTCATCGTTGCTATCAACAAGATGGACACCACTAAGTGGAGCGAGGAGCGTTTCTCCGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATTGAGCCATCTTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGTCCAAGTCCACTGGTAAGACCCTCCTTGAGGCCATCGACGCCATCGACACCCCAACCCGTCCCTCCGACAAGCCCCTCCGCCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACAGTTCCTGTCGGTCGTGTCGAGACCGGTGTTATCAAGGCTGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAGCAGCTCGCCGAGGGTGTT---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCACCAAAGGGCTGCGACTCCTTTAACGCCCAGGTCATCGTTCTTAACCACCCTGGTCAGGTCGGTGCCGGTTACGCCCCAGTCTTGGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCTTGGAGAAGATCGACCGACGAACTGGCAAGTCTGTTGAGAACGCTCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATG Teichospora_trabicola_C134 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--CTCC------GGTGCCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGTGTTGGCTGTGGTCCAAGTTCCCTGGAACAGGACGTCGCAGAGGGTGAGAACCCCGTACGTGGCCGCCAGCCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGGAGCCAGACGTGCCCGCGGATGCTCAGCCGGG-GTTTT-CCCCG-GTGCACTCTTCCGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGG-ACAAAAGCCTGCTAAACGTACCTCCCCCC--GGGGAGGACTTATAGGG-TGGGTGGCATACGACCAGCCCGGACTGAGG-ACCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGCAGGTGGGAACCCCT---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTCCGTATCCTTTTCCTCAAATTGACCAAGGATGTTTTCAAATATCTGCAGAAATGCGTAGAGAACAACCAAGAATTCAACGTACAGATGGCGGTCAAAGGTAGTGTTCTTACCAACGGTCTGAAATACTCGCTAGCGACAGGCAACTGGGGCGACCAGAAGAAAGCTGCTTCAGCCAAGGCCGGTGTTTCCCAGGTGCTGAACCGATATACCTATGCATCAACATTGTCCCATTTGCGGCGAACCAACACTCCGGTAGGCCGTGATGGCAAGCTTGCCAAGCCACGACAACTGCACAACACCCACTGGGGTTTGGTGTGTCCTGCGGAGACACCGGAAGGACAAGCTTGTGGGTTGGTCAAAAATTTATCCTTGATGTGCTACGTCAGTGTTGGCACTGAGAGCACACCCATCACCGACTATATGAGCCAACGCCAGATGGAACTCCTCGAGGAGTACGATCCGGTCGTAAACCCGACAGCCATCAAAGTCTTCGTCAACGGCGTCTGGGTTGGTACTCACAACAACCCTACTCAGCTTGTCAACAACGTGCAAGAGCTGCGACGGAACGGAACCCTATCCTACGAGATGAGTTTAATTCGAGACATTCGGGACCGAGAGTTCAAAATCTTCACCGACGCAGGTCGTGTTATGCGGCCGCTATTCGTGGTAGAGAACCGCCTCAACCAGGCCAATGTTGGACAGCTCGTCCTGAACAAGGGCCACGTCCAAAAATTGCTTGATGATAGGGAG------ATTGACACGTCT------GGAATGAGTGACGAAGACGCGGCAAGCGTGAAATTTGGCTGGAGAGGTCTCCTTCACAGCGGTGTCATCGAATATCTCGACGCCGAGGAAGAAGAGACCGCCATGATCGTCATGACACCAGAAGATCTCGAAGAGCATAGGGAGCTTCAACTAGGCGTTGTTGCACCC------ACAGTG---CCTGATGAAG------ACCGACATAGAAGGATCAAGCCGAAGCCGAATCCTTCAGTAAGATTCTATACCCACTGCGAGATCCACCCCAGTATGATCC----------------------CTCCGTAGCGC----------------GCAGCCATTATTTTTTCGGCTTATC--GCT-GAGGGGCAATTTG-TGGTGGTGGGGTTGTGCGAACTTTT-CGCGCTAGCGCTATGCCCAGTTC-GGCCGTTCGCCAA--CCTCAACACCATGACGCACATCCCCACTCC--CCGCTGCTAACGGC-CACTCCAGGAAGCCGCCGAACTTGGCAAGGGTTCCTTCAAGTACGCATGGGTGCTCGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACCCCGAGGTACTATGTAACCGTCATTGGTAAGCTCCACCCTACTTATCTCCAATTCGACTGCTAACCC--GCCCTAGACGCCCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGCGCTATTCTCATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGCCCGTTTCAACGAAATCATCAAGGAGACCTCTTCCTTCATCAAGAAGGTCGGTTACAACCCCAAGCACGTTGCTTTCGTCCCCATCTCTGGTTTCAACGGCGACAACATGATTGATGCCTCTCCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGATCAAGGTCAAGGCCTCTGGCAAGACCCTCCTTGAGGCCATCGATGCTATCGAGCCCCCGTCGCGTCCTACCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTTCCTGTCGGTCGTGTCGAGACTGGTGTTATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTGACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTACTGAGGGTGTC---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGTGACTCCAAGAACGACCCTCCCAAGGGCGCCGAGTCTTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGTCAGGTCGGTGCTG-------------------------------------------------------------------------------------------------------------------------------------------------- 'Tetraplosphaeria sasicola HHUF_27566' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--CCTT------GGGGCCCGAGTTGTAATTTGTAGAGGGCGC-TTTGGCGTTGGCTCCTGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCAGGCCGCCTCCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCAGTTGTTCATCCGGG-CTCCC-GCCCG-GTGCACTCCTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGCCGG-ATAAAGGTCCTGGGAACGTAGCTCTCTCC--GGGGAGTG-TTATAGCCCAGGGCGCAATGCGGCCAGCCCGGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCCC--------CGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTACCAACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-CTCGGGGCTT-CTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Thyridaria acaciae CBS_138873' CCTGCATACATG------CATTACACCCTTTG--ACTTTGAGCACC-----GTACGTTTCCTCGGCAGGTT-CGC-------CTGCCA-----------------GC-GGGGACCCCC--------ATAAA-CTCTTT-GTAGTT-GGCAGTATTTGTCTGAAAAC---AATGATAATAATCACAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGG-TATTCCTTGGGGCATGCCTGTTCGAGCGTCATTTA-AACCCTCAAGCCTAGCTTGGTGTTGGGTGCTTGTCCCCC--C----------GGACTCACCTCAAAGACA-TTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCCC----AGTC-GCGCC?-????????????-??????????????????---??????????-??????????????????????????????????????????????????????????????????????CAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGCAGAGGATGC-TTTGGCGTCGGTCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAG-CTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCGGGCGGTTGG-AAAAAGGCCTCCATCACGTACCACCTCTC--GGGGTGGCCTTATAGGG-GAGGCGCAACACGGCCAGCCTGGACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGCGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Thyridaria_broussonetiae_TB CCCGCACACATG------CATTACACCCTTTG--ACTTTGAGCACC-----GTACGTTTCCTCGGCAGGTT-CGC-------CTGCCA-----------------GT-GGGGACCCT---------ATAAA-CTCTTT-GCAGTT-AGCAGTATTTGTCTGAAAACA--AACCATAATAATCACAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-AACCTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCCCC--C----------GGACTCACCTTAAAGACA-TTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCAC----AGTC-GCGCTC--TAAGCCCTGGC-AGATCGGCTATCCAGAAG---CCCATTCTTC-TTTATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGATGC-TTTGGCGTTGGTCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAG-CTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCGGGCGGTTGG-ATAAAGGCCTCCATCACGTACCACCTTTC--GGGGTGGCCTTATAGGG-GAGGCGCAACACGGCCAGCCTGGACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCTTCCGGATTTTGTTCCTCAAGTTGACAAAGGACGTCTTCAGGTACCTCCAGAAATGTGTGGAGAGCAATCAAGACTTCAACGTCCAGATGGCCGTGAAAGCCAGTGTCATCACGAATGGGCTTAAGTACTCGCTTGCCACGGGTAACTGGGGAGACCAGAAGAAGGCGGCCTCGGCGAAAGCAGGTGTGTCCCAGGTGCTGAACAGGTACACCTATTCCTCAACCTTGTCCCATCTTCGCCGCACGAATACCCCGATCGGCCGTGATGGAAAATTGGCCAAACCGCGACAGCTACACAACACGCATTGGGGTTTGGTGTGTCCTGCCGAGACCCCAGAAGGGCAGGCTTGTGGCTTGGTGAAGAATCTTTCATTGATGTGCTACGTCAGTGTTGGTAGCGAGAGTACCCCCATCACCGATTTCATGAGCCAGCGTAATATGGACCTCCTTGAAGAGTACGACCCGGTTGTCAACCCATCTGCTACCAAGGTGTTTGTTAACGGTGTCTGGGTCGGTGTCCATTCCCAGCCTTCACAGCTTGTGTCGGTCGTGCAGGAGCTTCGGCGCAACGGAACACTGTCCTACGAGATGAGTCTTGTCCGTGACATTCGAGACCGAGAGTTCAAGATCTTCACGGATGCAGGCCGAGTTATGCGCCCCCTATATATTGTGGAAACCGACTATAGGAAACCAAACCGAGGTGCTCTGGTTCTGACCAAAGGCCACATCCAAAAACTTCTTGACGATACACAA------ATTGATACGTCA------GGTTACAACGACGAAGATGCTCAAGCTATGAAGTTTGGCTGGAAAGGACTGCTTCATGGTGGCGTTGTGGAATACCTTGACGCCGAGGAGGAAGAAACTTCTATGATTATCATGACACCCGAGGACCTGAATGAGCATAGGGATCTTATGCAGGGTATCCCAGCACCC------GAGGGC---GTGCCTGAAG------ATCGCCATAGGCGGATCAAGCAAAAGCCGAATCCCTCAGTCAAGACCTATACCCATTGCGAAATCCACCCGAGTATGATCCTTGGCATCTGTGCCAGCATCATTGACGAGGCGC----------------TGGGTCAT----ATTTTGGCCCAGCGCACT-GAGGGGCAATTTGGCCTCGGTGGGGTTGTGCGAACTTTTACGCGCCAGCACTAAGCCCGATCT-GGC-ACTCGCCAA--CGCCTGC-CTATGACGCACACTTCATTTTTGCAATATGCTAACCCA-CCCTCCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTGCTTGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTATGTCACCGTCATTGGTATGTCCCGCTAGGACCCATCTCGATCTTGCCGCTAACCCAACCGCCAGATGCCCCCGGTCACCGTGATTTCATCAAGAACATGATTACTGGTACTTCCCAGGCTGATTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTCGCCTACACTCTCGGTGTCAGGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCCAGGACCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCCCCGAGCCGTCCCTCCGACAAGCCCCTCCGCCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTTGAGGGTGTG---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTTATCGTCCTCAACCACCCCGGTCAGGTCGGTGCCG-------------------------------------------------------------------------------------------------------------------------------------------------- Thyridaria_broussonetiae_TB1 CCCGCACACATG------CATTACACCCTTTG--ACTTTGAGCACC-----GTACGTTTCCTCGGCAGGTT-CGC-------CTGCCA-----------------GT-GGGGACCCT---------ATAAA-CTCTTT-GCAGTT-AGCAGTATTTGTCTGAAAACA--AACCATAATAATCACAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-AACCTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCCCC--C----------GGACTCACCTTAAAGACA-TTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCAC----AGTC-GCGCTC--TAAGCCCTGGC-AGATCGGCTATCCAGAAG---CCCATTCTTC-TTTATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGATGC-TTTGGCGTTGGTCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAG-CTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCGGGCGGTTGG-ATAAAGGCCTCCATCACGTACCACCTTTC--GGGGTGGCCTTATAGGG-GAGGCGCAACACGGCCAGCCTGGACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCAAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATAATAACTTAACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGATTTTTAGGGAAAGATCCCGGAGAGGGCGCCTGAGAAACGGCGGCCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATGCGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGATAGTCGGGGGTGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCTATTGAAGACTAACTACTGCGAAAGCATTCACCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCTCTCTTCCGGATTTTGTTCCTCAAGTTGACAAAGGACGTCTTCAGGTACCTCCAGAAATGTGTGGAGAGCAATCAAGACTTCAACGTCCAGATGGCTGTGAAAGCCAGTGTCATCACGAATGGGCTTAAGTACTCGCTTGCCACGGGTAATTGGGGAGACCAGAAGAAGGCGGCCTCGGCGAAAGCAGGTGTGTCCCAGGTGCTGAACAGGTACACCTATTCCTCAACCTTGTCCCATCTTCGCCGCACGAATACCCCGATCGGCCGTGATGGAAAATTGGCCAAACCGCGACAGCTACACAACACGCATTGGGGTTTGGTGTGTCCTGCCGAGACCCCAGAAGGGCAGGCTTGTGGCTTGGTGAAGAATCTTTCATTGATGTGCTACGTCAGTGTTGGTAGCGAGAGTACCCCCATCACCGATTTCATGAGCCAGCGTAATATGGACCTCCTTGAAGAGTACGACCCGGTTGTCAACCCATCTGCTACCAAGGTGTTTGTTAACGGTGTCTGGGTCGGTGTCCATTCCCAGCCTTCACAGCTTGTGTCGGTCGTGCAGGAGCTTCGGCGCAACGGAACACTGTCCTACGAGATGAGTCTTGTCCGTGACATTCGAGACCGAGAGTTCAAGATCTTCACGGATGCAGGCCGAGTTATGCGCCCCCTATATATTGTGGAAACCGACTATAGGAAACCAAACCGAGGTGCTCTGGTTCTAACCAAAGGCCACATCCAAAAACTTCTTGACGATACACAA------ATTGATACGTCA------GGTTACAACGATGAAGATGCTCAAGCTATGAAGTTTGGCTGGAAAGGACTGCTTCATGGTGGCGTTGTGGAATACCTTGACGCCGAGGAGGAAGAAACTTCTATGATTATCATGACACCCGAGGACCTGAATGAGCATAGGGATCTTATGCAGGGTATCCCAGCACCC------GAGGGC---GTGCCTGAAG------ATCGCCATAGGCGGATCAAGCAAAAGCCAAATCCCTCAGTCAAGACCTATACCCATTGCGAAATCCACCCGAGTATGATCCTTGGCATCTGTGCCAGCATCATTGACGAGGCGC----------------TGGGTCAT----ATTTTGGCCCAGCGCACT-GAGGGGCAATTTGGCCTCGGTGGGGTTGTGCGAACTTTTACGCGCCAGCACTAAGCCCGATCT-GGC-ACTCGCCAA--CGCCTGC-CTATGACGCACACTTCATTTTTGCAATATGCTAACCCA-CCCTCCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTGCTTGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTATGTCACCGTCATTGGTATGTCCCGCTAGGACCCATCTCGATCTTGCCGCTAACCCAACCGCCAGATGCCCCCGGTCACCGTGATTTCATCAAGAACATGATTACTGGTACTTCCCAGGCTGATTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTCGCCTACACTCTCGGTGTCAGGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCCAGGACCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCCCCGAGCCGTCCCTCCGACAAGCCCCTCCGCCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTTGAGGGTGTG---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTTATCGTCCTCAACCACCCCGGTCAGGTCGGTGCCG-------------------------------------------------------------------------------------------------------------------------------------------------- Thyridaria_broussonetiae_TB1a CCCGCACACATG------CATTACACCCTTTG--ACTTTGAGCACC-----GTACGTTTCCTCGGCAGGTT-CGC-------CTGCCA-----------------GT-GGGGACCCT---------ATAAA-CTCTTT-GCAGTT-AGCAGTATTTGTCTGAAAACA--AACCATAATAATCACAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-AACCTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCCCC--C----------GGACTCACCTTAAAGACA-TTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCAC----AGTC-GCGCTC--TAAGCCCTGGC-AGATCGGCTATCCAGAAG---CCCATTCTTC-TTTATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGATGC-TTTGGCGTTGGTCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAG-CTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCGGGCGGTTGG-ATAAAGGCCTCCATCACGTACCACCTTTC--GGGGTGGCCTTATAGGG-GAGGCGCAACACGGCCAGCCTGGACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Thyridaria_broussonetiae_TB2 CCCGCACACATG------CATTACACCCTTTG--ACTTTGAGCACC-----GTACGTTTCCTCGGCAGGTT-CGC-------CTGCCA-----------------GT-GGGGACCCT---------ATAAA-CTCTTT-GCAGTT-AGCAGTATTTGTCTGAAAACA--AACCATAATAATCACAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGG-TATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTA-AACCTTCAAGCTCAGCTTGGTGTTGGGTGCTTGTCCCCC--C----------GGACTCACCTTAAAGACA-TTGGCAGCCCGCATC-CGCCG---GCCGTGAGCGCAGCAC----AGTC-GCGCTC--TAAGCCCTGGC-AGATCGGCTATCCAGAAG---CCCATTCTTC-TTTATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGTCCGAGTTGTAATTTGTAGAGGATGC-TTTGGCGTTGGTCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCGTGTAAAG-CTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGG-CTCTC-GCCCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCGGGCGGTTGG-ATAAAGGCCTCCATCACGTACCACCTTTC--GGGGTGGCCTTATAGGG-GAGGCGCAACACGGCCAGCCTGGACTGAGG-ACCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCTTCCGGATTTTGTTCCTCAAGTTGACAAAGGACGTCTTCAGGTACCTCCAGAAATGTGTGGAGAGCAATCAAGACTTCAACGTCCAGATGGCTGTGAAAGCCAGTGTCATCACGAATGGGCTTAAGTACTCGCTTGCCACGGGTAATTGGGGAGACCAGAAGAAGGCGGCCTCGGCGAAAGCAGGTGTGTCCCAGGTGCTGAACAGGTACACCTATTCCTCAACCTTGTCCCATCTTCGCCGCACGAATACCCCGATCGGCCGTGATGGAAAATTGGCCAAACCGCGACAGCTACACAACACGCATTGGGGTTTGGTGTGTCCTGCCGAGACCCCAGAAGGGCAGGCTTGTGGCTTGGTGAAGAATCTTTCATTGATGTGCTACGTCAGTGTTGGTAGCGAGAGTACCCCCATCACCGATTTCATGAGCCAGCGTAATATGGACCTCCTTGAAGAGTACGACCCGGTTGTCAACCCATCTGCTACCAAGGTGTTTGTTAACGGTGTCTGGGTCGGTGTCCATTCCCAGCCTTCACAGCTTGTGTCGGTCGTGCAGGAGCTTCGGCGCAACGGAACACTGTCCTACGAGATGAGTCTTGTCCGTGACATTCGAGACCGAGAGTTCAAGATCTTCACGGATGCAGGCCGAGTTATGCGCCCCCTATATATTGTGGAAACCGACTATAGGAAACCAAACCGAGGTGCTCTGGTTCTAACCAAAGGCCACATCCAAAAACTTCTTGACGATACACAA------ATTGATACGTCA------GGTTACAACGATGAAGATGCTCAAGCTATGAAGTTTGGCTGGAAAGGACTGCTTCATGGTGGCGTTGTGGAATACCTTGACGCCGAGGAGGAAGAAACTTCTATGATTATCATGACACCCGAGGACCTGAATGAGCATAGGGATCTTATGCAGGGTATCCCAGCACCC------GAGGGC---GTGCCTGAAG------ATCGCCATAGGCGGATCAAGCAAAAGCCAAATCCCTCAGTCAAGACCTATACCCATTGCGAAATCCACCCGAGTATGATCCTTGGCATCTGTGCCAGCATCATTGACGAGGCGC----------------TGGGTCAT----ATTTTGGCCCAGCGCACT-GAGGGGCAATTTGGCCTCGGTGGGGTTGTGCGAACTTTTACGCGCCAGCACTAAGCCCGATCT-GGC-ACTCGCCAA--CGCCTGC-CTATGACGCACACTTCATTTTTGCAATATGCTAACCCA-CCCTCCAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTGCTTGACAAGCTGAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCCCCAAGTACTATGTCACCGTCATTGGTATGTCCCGCTAGGACCCATCTCGATCTTGCCGCTAACCCAACCGCCAGATGCCCCCGGTCACCGTGATTTCATCAAGAACATGATTACTGGTACTTCCCAGGCTGATTGCGCCATTCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTCGCCTACACTCTCGGTGTCAGGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGAGCCAGGACCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTCCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGCCTCCTCCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTCGAGGCCATCGATGCCATCGACCCCCCGAGCCGTCCCTCCGACAAGCCCCTCCGCCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGTTGAGGGTGTG---CCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTCGCTGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTTATCGTCCTCAACCACCCCGGTCAGGTCGGTGCCG-------------------------------------------------------------------------------------------------------------------------------------------------- 'Torula herbarum CBS_111855' -CCCCGAGCCAA-----CACTTTCTACCCTGT--CTTTTCGATACCT---CTACCTCCTCCCCGGC--CCC-CGG------GCCGGGAT-------------------GGCTACTTC---------AAAAG-AACCTTTGCAGTT-TACAGTCAAT-TCAGTACTTT----GTAACAAAATTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGCGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGGTTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTTC-AACCTTCAAGCCTGGCTTGGTGTTGGGCGC-TGTCCCGC--CTCC-GCGCGCGGACTCGCCCCAAATGAA-TTGGCAGTCGCACCC-TCCGA---GCCGCGAGCGCAGCAC---AAGTC-GCGCGGGCGGTACTCTGGGGGGACGGACGCTCCACAAG---ACCCTTTCTC-AGTCTTGACC????????????????????????????????????????????????????????????????????????-????????????????????????????????????TTTGAAATCTGGCTC--CTTT------GGGGTCCGAGTTGTAATTTGCAGAGGGAGCTTTTGGCGTCGGTCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCTTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACGTGCCCGCGGTTGATCATCCAGG-CTCCA-GCCTG-GTGCACTCCTCCGCGGGCAGGCCAGCATCAGTTCGGGCGGTCGG-ATAAAGGCCTCTATCACGTACCACCCCTC--GGGGTGGCCTTATAGGG-GAGGCGCAACACGGCCAGCCCGGACTGAGGTTCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCAGC----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTT---------ACCGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAATCCCCGACTTCGGAAGGGGTGTGTTTATTAGATAAAAAACCAATGCCC-TCCGGGGCTC-CTTGGTGATTCAGAATAACCTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACAGAGAATTAGGGTTCGATTCTGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACTCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGTTGGCTGGTCCGCCTCACCGCGTGTACTGGTCTGACCGGGCCTTTCCTT-CTGGAGAACCTCATGCCCTTCACTGGGTGTGCTGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGACAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGACCAATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCT---------------------------------------------------------------------------------------------------------AGTGTTATCACGAACGGATTGAAGTACTCGCTCGCCACGGGAAACTGGGGTGATCAGAAGAAGGCCGCTTCCGCGAAAGCAGGTGTTTCCCAGGTGTTGAATCGATACACATACGCATCCACGTTGTCCCATCTTCGCCGCACAAACACACCCATTGGTCGTGACGGAAAGCTTGCTAAGCCTCGCCAGCTCCATAACACTCATTGGGGCTTGGTCTGTCCTGCTGAAACCCCCGAAGGACAAGCCTGTGGACTGGTCAAGAATCTTTCATTGATGTGCTACGTCAGTGTTGGTAGCGAAAGCACACCAATCACAGACTTCATGAGCCAGCGAAATATGGATCTTCTTGAAGAATATGACCCTGTGGTCAACCCGACTGCCACCAAGGTTTTTGTGAACGGTGTGTGGGTCGGTGTGCATTCTCAGCCCTCGCAGCTTGTGTCTGTTGTTCAGGAGCTTCGACGGAATGGAACTCTATCCTACGAAATGAGTCTTATTCGAGACATCCGAGATCGTGAGTTCAAAATCTTTACCGATGCAGGACGAGTCATGAGACCCCTCTTCGTGGTGGAAACCGACTACCGGAAGCCCAACCGCGGCAGTCTTGTTCTCAACAAATCACATGTTCAAAGGCTACTTGAAGACAAGGAA------ATTGATACGGCT------GGCTACAATGACGAAGACGCTGCAAGCATGAAGTTCGGATGGCGAGGACTTATCCAGAATGGTGTGGTCGAGTACCTTGATGCTGAAGAAGAGGAGACTGCCATGATCATTATGACCCCAGAAGACTTGGATGAGCATCGTGACCTCATGCAAGGTATCGCTGCACCC------GAAGGG---GCTCGTGCCG------ATCGCTACAAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAACGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGCACGTTCCCTTCGTGCCCATCTCCGGTTTCAACGGTGACAACATGATCGAAGTCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGTCCACTGGTAAGACCCTTCTCGAGGCCATTGATGCCATCGACACCCCCACCCGTCCCACCGACAAGCCTCTCCGCCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTATCATCAAGGCTGGTATGGTCGTGACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAACAGCTCACCGAGGGTGTC---CCAGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCTGAGTCTTTCAACGCTCAGGTCATCGTCCTTAACCACCCCGGTCAGGTTGGTGCTGGTTACGCCCCAGTCCTCGATTGCCACACTGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGATCGACGAACGGGCAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCC--------------- 'Torula herbarum CBS_140066' -CCCGGAGCCAA-----CGCGTTCTACCCTGT--CTTTTTCATACCC---CTACCTCCTCCCCAGC--CCT-CGG------GCTGGGAC-------------------GGCTACTCT---------TTAAA-AACCTT-GCAGTT-TACAGTCAAT-TCAGTTTTTT---TATAACAAAATTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGCGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGGTTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTTC-AACCTTCAAGCCCAGCTTGGTGTTGGGCGT-TGTCCCGC--CTCTTGCGCGCGGACTCGCCCCAAATTGA-TTGGCAGTCGCATCC-ACCGA---GCCGCGAGCGCAGCAC---AAGTC-GCGCGA--GCCGGCGAGGCGGCAAGGACGCTCCACAAGACCCTTTTTTACA-AGTCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTC--CTTC------GGGGTCCGAGTTGTAATTTGCAGAGGGAGCTTTTGGCGTCGGTCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCTTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACGTGCGCGCGGTTGATCATCCAGG-CTCCA-GCCTG-GTGCACTCCTCCGCGCGCAGGCCAGCATCAGTTCGGGCGGTCGG-ATAAAGGCCTCTGTCACGTACCACCCCCC--GGGGTGGCCTTATAGGG-GAGGCGCAACACGGCCAGCCTGGACTGAGGTTCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCAGC----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTT---------ACCGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Torula hollandica CBS_220.69' GCCCGGAGCCGA-----CCCTCTCCACCCTGC--CTTTTTGAAAACC---TCACCTCCTCCCCGGC--CTC-CGC------GCCGGGCT-------------------GGCTTACTT---------GAAAA-AACCTT-GCAGT--TATAGTCTAT-TCAGTTATTT----TAAACAAAATTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGCGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGGTTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTTC-AACCTTCAAGCCTGGCTTGGTGTTGGGCGC-TGTCCCGC--CCCC-GCGCGCGGACTCGCCTCGAATGAA-TTGGCAGTCGCACCC-TCCGA---GCCGCGAGCGCAGCAC---AAGTC-GCGCCC--GCCGGCCCGCTGGGACGGACGCTCCATGAG---ACCCCC-CAC-AGTCTTGACC????????????????????????????????????????????????????????????????????????-???????????????????????????????????????????????????--????------????????????????????????????GCTTTTGGCGTCGGTCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGCCTTCGCCTTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCTAGACGTGCCCGCGGTTGATCATCCAGG-CTCCG-GCCTG-GTGCACTCCTCCGCGGGCAGGCCAGCATCAGTTCGGGCGGTCGG-ATAAAGGCCTCTGTCACGTACCACCCCTC--GGGGTGGCCTTATAGGG-GAGGCGCAACACGGCCAGCCCGGACTGAGGTTCCGCGCATCT-GCTAGGATGCTGGCGTAATAGCAGC----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTC---------ACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATATCCGTGGTAATTCTAGAGCTAATACATGCTAAAATCCCCGACTTCGGAAGGGGTGTGTTTATTAGATAAAAAACCAATGCCC-TCCGGGGCTC-TTTGGTGATTCAGAATAACCTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACAGAGAATTAGGGTTCGATTCTGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACTCGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCTGGTCCGCCTCACCGCGTGTACTGGTCTGGCCGGGCCTTTCCTT-CTGGAGAACCTCATGCCCTTCACTGGGCGTGCTGGGGAACCAGGACTTTTACTTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGAACCGCCGTAATGATTAATAGGGACAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGACCAATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATATTGACTCGCTCGGCACCT---------------------------------------------------------------------------------------------------------AGTGTCATCACCAACGGATTGAAGTATTCGCTCGCCACGGGAAACTGGGGTGATCAGAAAAAGGCAGCGTCCGCGAAGGCGGGAGTCTCACAGGTGCTCAACCGATACACCTATGCATCCACCTTGTCCCATCTTCGCCGCACAAACACACCCATCGGCCGAGATGGAAAGCTCGCGAAGCCTCGCCAGCTACATAACACACATTGGGGCTTGGTCTGCCCTGCCGAAACTCCTGAAGGGCAAGCTTGTGGACTGGTCAAGAACCTGTCCCTGATGTGTTACGTCAGTGTTGGCAGTGAAAGCACGCCTATCACCGATTTCATGAGCCAACGAAATATGGATTTGCTGGAAGAATATGATCCTGTGGTCAATCCCACTGCCACCAAGGTTTTTGTGAACGGCGTATGGGTAGGTGTGCATTCGCAACCTTCCCAGCTTGTTTCCGTTGTCCAGGAGCTTCGACGTAACGGAACTCTATCCTACGAGATGAGTCTTATTCGAGACATCCGAGACCGTGAATTCAAAATCTTTACCGATGCCGGACGTGTAATGAGGCCCCTTTTTGTGGTTGAAACCGACTACCGAAAACCCAACCGTGGCAGCCTTGTTCTCAATAAATCGCACGTCCAGAGGCTACTCGAAGACAAGGAG------ATTGATACGGCC------GGGTATAATGATGAAGATGCTGCAGGCATGAAGTTCGGTTGGCGCGGACTCATTCAAAATGGTGTGGTTGAGTACCTCGACGCCGAGGAAGAAGAAACCGCCATGATTATCATGACTCCTGAAGACTTGGACGAGCATCGCGACCTTATGCAAGGTATTGCTGCACCT------GACGGA---GCCCGGGCTG------ATCGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTGCTCGCCTACACCCTTGGTGTCAAGCAGCTCATCGTCGCTATCAACAAGATGGACACCACCAAGTGGAGCGAGGACCGTTTCCAGGAAATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATCGACGTCTCCACCAACTGCCCCTGGTACAAGGGATGGGAGAAGGAGACCAAGACCAAGTCCACTGGCAAGACCCTTCTCGAGGCCATTGATGCCATCGACACCCCCAGCCGTCCCACCGACAAGCCTCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTTCCCGTCGGTCGTGTCGAGACTGGTATCATCAAGGCTGGTATGGTCGTGACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAAATGCACCACGAACAGCTCACCGAGGGTGTC---CCAGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGTCGTGGTAATGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCCCCAGTCCTCGATTGCCACACTGCCCATATTGCCTGCAAGTTCTCCGAGCTCCTCGAGAAGATCGATCGACGAACGGGCAAGTCCGTTGAGAACTCCCCCAAGTTCATCAAGTCTGGTGATGCCGCCATCGTTAAG--- 'Trematosphaeria pertusa CBS_122368' --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGCAACAGCTCAAATTTGAAATCTGGCCC--TCCTTCTTGGGGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGCGTTGGTGGCGGTCTAAGTTCCTTGGAACAGGCCATCGCAGAGGGTGAGAATCCCGTATGTGGTCGCCCGCCTTCGCCGTGTAAAG-CCCCCTCGACGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGTCTGCGGTTGCTCAGCCGGG-CTCCC-CCCCG-GTGCACTCTTCCGCAGGCAGGCCAGCATCAGTTTGGGCGACTGGTAGAAAGACCTCTGTCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCAGCCAGCCTGGACTGAGGGACCGCGCTTCG-GCGAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTAAACGGAGGTGGGAACCCCTCCTTGCGGGGGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT---------------------------------------------------------------ACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAAGCCCGACTTCGGAAGGGTTGTATTTATTAGATAAAAAACCAAT-----------GCTC-TTTGGTGATTCATAATAACTTCTCAGATCGCACGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTACGGTATTGGCCTACCATGGTTTCAACGGGTAACAGGGAATTAGGGTTCGATTCTGGAGAGCGAGCCTGAGAGACGGCTAGCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACTCAATGCCGACACGGCGAAGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGCACTTGACCGGCCGGGCCTTCTTCT-CTGGAGAACCGCATGCCCTTCACTGTGGTGTGCTGGGGACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGACG-GCAGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATCAATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAA-----------------------------------------------------------------------------------------------------------------------------------------------------GTCAAGGCCAGCATAATCACCAACGGCCTAAAGTACTCTCTCGCCACCGGCAACTGGGGCGACCAGAAGAAGGCTGCCTCTGCGAAAGCAGGCGTCTCCCAGGTGTTGAACCGGTACACCTACGCATCCACTCTGTCCCATCTCCGGCGAACGAACACCCCCGTCGGCCGTGACGGAAAGCTGGCCAAGCCACGGCAGCTCCACAACAGCCACTGGGGCCTGGTTTGCCCTGCCGAGACTCCAGAAGGGCAGGCGTGCGGTCTAGTCAAGAACCTGTCCTTGATGTGTTATGTAAGTGTCGGCAGCGAGAGTACGCCTATTATCGACTTCATGACCCAGCGAAACATGGAACTTCTCGAGGAGTACGACCCGGTCATCAATCCGACTGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTAGGGACACATATGAACCCGCAACAGCTTGTGACGGTTGTGCAAGAGCTCCGACGAAACGGGACGCTCTCGTACGAGATGAGCCTTATTCGGGATATTCGCGACCGAGAGTTCAAAATCTTCACCGATGCTGGACGCGTCATGAGGCCGCTTTTCGTGGTGGAAAATGACGTTCGGAAGCCTAACCGTGGCCACCTTGTGTACGACCGAACTCATCTACAGAAGCTTCTCAATGACTCTACT------GTGGACACATCT------GG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTTCTCGCCTACACTCTCGGTGTCCGACAGATCATCGTCGCTATCAACAAGATGGACACCGCCAAGTGGAGCGAGGACCGTTACAAGGAGATTGTCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAATCCCAAGCACGTCCCCTTCGTCCCAATCTCTGGCTTCTACGGCGACAACATGATTGACTCGTCCGCCAACTGCCCGTGGTACAAGGGCTGGGAGAAGGAGACCAAAACTAAGGTCACCGGCAAGACCCTCCTTGAGGCTATCGACAACATCGACCCCCCGTCCCGTCCTTCCGACAAGCCCCTTCGTCTGCCTCTCCAGGATGTGTACAAGATTGGTGGTATTGGCACTGTCCCTGTCGGCCGTGTCGAGACCGGTATCATCAAGGCTGGTATGGTCGTCACCTTTGCTCCGGCTGGTGTGACCACTGAAGTCAAGTCTGTCGAGATGCACCACGAACAGCTTGTCCAGGGTGTT---CCCGGCGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAGATCCGTCGTGGCAACGTCGCCGGCGACTCCAAGAACGACCCGCCCAAGGGTGCTGAGTCCTTCAACGCCCAGGTCATCGTCCTTAACCACCCCGGCCAGGTTGGTGCTGGTTACGCTCCTGTCCTCGACTGCCACACCGCCCACATCGCCTGCAAGTTCTCCGAGCTTCTCGAGAAGATCGACCGCCGAACTGGCAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGACGCCGCTATCGTCAAGATG Ulospora_bilgramii_CBS_110020 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGCTCAAATTTGAAATCTGGCTC--CCTT-----GGGGGTCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTACGTGGCCGGCGGTCTTCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGG-CTCTT-GCCCG-GTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCAGGCGGTCGG-ATAAAGGCCTTGGGAATGTGGCTCTCTTC--GGGGAGTG-TTATAGCCCAGGGTGCAATGCGGCCAGCTTGGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCCT--------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAGCCGCATGCCCTTCACTGGGTGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCT---------------------------------------------------------------------------------------------------------------ATTACAAACGG?CTCAAGTATTCGTTGGCAACAGGAAATTGGGGAGACCAAAAGAAAGCGGCATCTGCTAAGGCCGGTGTCTCTCAGGTGCTCAACCGTTACACCTACGCTTCTACGCTTTCGCATCTTCGCCGAACGAATACACCGGTTGGCCGTGACGGCAAGCTGGCTAAACCGCGGCAGCTACACAACACCCACTGGGGTCTGGTGTGTCCTGCAGAAACTCCAGAAGGACAGGCTTGTGGCTTAGTCAAAAATCTCTCGTTGATGTGTTACGTCAGTGTCGGTAGTGAGAGTACGCCAATCACCGATTTCATGAGCCAGCGAAATATGGAATTGCTTGAAGAGTACGACCCAATGGTCAACCCAACGGCTACCAAAGTCTTCGTAAACGGCGTATGGGTGGGCGTTCATTCCCAGCCATCCCAGCTGGTGTCTGTCGTGCAAGAGCTCCGACGGAATGGCACGTTGTCCTACGAGATGAGTTTGATCCGTGATATCCGAGACAGGGAATTCAAGATTTTCACAGATGCGGGCCGAGTCATGAGGCCTTTGTTCGTTGTTGAAACGGACTATCGCAAGCCTAACCGTGGAAGCTTAATCCTAGACAAAACCCATATTCAGAAGCTTGAGGATGACCAACAC------ATCGACACATCT------GGTTATAACGATGAGGATACTGCGGCCATGACATTTGGATGGAAAGGTCTTATCCAGAGTGGCGTGGTAGAATACCTCGACGCCGAAGAGGAGGAAACCGCTATGATCGTCATGAGCCCCGAAGATCTTGAAGAACATCGAGATTTGATGCAAGGTCTCCAGCAAATT------GAAGGC---GGCGCCATCG------ATC?ACACAAGCGCATCAAGCCGAAGCCGAATCCCTCTATCAAAACTTATACCCACTGCGAAATTCACCCAAGCATGATTCTTGGCATTTGTGCCAGTATCAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCATTGCCGCTGGTACTGGTGAGTTTGAGGCCGGTATCTCCAAGGATGGTCAGACTCGTGAGCACGCTTTGCTCGCCTACACCCTTGGTGTCAAGCAACTCATTGTTGCCATCAACAAGATGGACACCACCAAGTGGAGCGAGGAGCGTTTCAACGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTCCCTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGACCAAGGCTACTGGCAAGACGCTCCTTGAGGCCATTGACTCCATCGACCCCCCAACCCGTCCTTCTGACAAGCCCCTTCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTCCCTGTCGGTCGTGTCGAGACTGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCGGTCGAGATGCACCACGAGCAGCTTGCTGAGGGTGTT---CCCGGCGACAATGTTGGCTTCAACGTCAAGAACGTTTCCGTGAAGGAAATCCGCCGTGGTAACGTCGCTGGTGACTCCAAGAACGACCCACCAAAGGGTGCCGATTCCTTCAACGCCCAGGTCATTGTCCTCAACCACCCCGGTCAGGTCGGTGCTGGTTACGCCCCAGTCTTGGACTGCCACACTGCCCACATTGCTTGCAAGTTTGCTGAGCTCCTCGAGAAGATTGACCGACGAACTGGCAAGTCTGTTGAGAACAGCCCCAAGTTCATCAAGTCTGGTGATGCTGCCATCGTTAAGATG 'Versicolorisporium triseptatum JCM_14775' AACCCCCGGACA-------AGTGACACCCTTGCACTTTCGAGCACT----CTTCTGTTTCCTCGGCGGGCT-CGC-------CCGCCA-----------------GT-GGGGACCCT---------CAAAACCTATTC-GTAAT--AGCAGTACCC-TCAGAAATAA---AAACAAAAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGG-TATTCCTTAGGGCATGCCTGTTCGAGCGTCATTTAGGAAATTCAAGCACAGCTTGGTGTTGGGCGCCTCGTCCCC--CGTC--CGGGAGGACCCGCCTCAAATGCA-TTGGCAGCCGGTC---CGTTG---GCTTCGAGCGCAGCAG----AATA-GCGCCC--GGCGTCCGACGGCACCTAGCTCTCCAGGAA--GCCACCCCCCC-ATTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA??????????????????????????????????????TG-CCCTAGT-ACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC--TTTC------AGGGCCCGAGTTGTAATTTGTAGAGGGTGC-TTTGGCGTTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCCGGACTCCGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCTAG-CCAACGGCTCG-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCAGGCGGCCGG-ACAAAGACCTCTATCACGTATCTTCCTTC--GGGATGACCTTATAGGG-GAGGTGTAATGCGGCCAGCCTGGATTGAGG-TCCGCGCATCA-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGTTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGAGATTAGGGTTTGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGTGAGCCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTTGACTCGCTCGGCACCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Westerdykella ornata CBS_379.55' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTG-CCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT-CTC-------AGGGTCCGAGTTGTAATTTGCAGAGGGTGC-TTTGGCGATGGCTGTGGTCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGCCAGCCTACGCCGTGTAAAG-CCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTACCAGGG-CTCTT-GCCCT-GGGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCGGGCGGTTGG-ATAAATGCCTTCTGCATGTACCTCTCTTC--GGGGAGGACTTATAGGGGTTGGCGCCATACAGCCAGCCTGGACTGAGG-TCCGCGCATCT-GCTAGGATGCTGGCGTAATGGCTGT----------------------AAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAGCCCGAGCGCGGAATGAAAGTGAACGGAGGTGGGAACCCCT---------CGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAG--------GACAATGGCTCATTAAATCAGTTATCGTTTATTAGATAGTACCT---TACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCC-TTCGGGGCTC-TTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACGCGGGGAGGTAGTGACAATAAATACTGATACAGGGC-TCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTT-CTGGAGAACCCCATGCCCTTCACTGGGCGTGTGGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACGTTAGCATGGAATAATAGAATAGGACGTGCGATCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGAGATG-TTCTCTCTTGACTCGCTCGGCACCTTTGTTCTGGATTCTATTCCTCAAGCTCACAAAAGATGCT-----GGTTCTCCAGAGATGTGTGGAAAACAATCAGGA-GAAAACGGTCAGATGGGTGTGAAGGGCAGCATCATCACCAACGGCCTCAAGTACTCCCTTGCGACTGGAAACTGGGGCGACCAGAAGAAGGCAGCGTCGGCTAAGGCCGGTGTTTCTCAGGTGCTCAACCGATACACGTATGCTTCGACGCTATCGCATCTGCGCCGAACTAATACACCTGTCGGTCGAGATGGCAAACTGGCAAAGCCGCGCCAGCTACACAATACTCACTGGGGCTTGGTCTGTCCTGCCGAGACTCCAGAAGGGCAGGCGTGTGGTCTGGTGAAGAACTTGTCGCTCATGTTCTACGTTTGTGTTGGTAGCGAGAGTACGCCCATCACAGATTTCATGAGCCAGCGGAACATGGAACTTCTTGAGGAGTACGATCCTGTACAGAACCCGACAGCCACCAAGGTGTTCGTAAATGGCGTCTGGGTCGGCGTGCACTCGAACCCTTCTCAGCTGGTGAAGGTCGTCCAGGAGCTACGACGCAATGGCACTCTCTCATATGAGATGAGCTTGATCCGTGATATCCGCGACCGAGAGTTCAAGATTTTCACAGATGCCGGGCGTGTCATGAGACCGCTCTTCGTGGTGGAAACGGACTACGCCAAGCCGAACAGGGGAAGCTTGGTGCTCAATAAGGGTCATATCCAAAAGCTTCTGGAGGACCGAGAT------ATTGATACGTCC------GGTATGAATGATGAGGATACCAATGCGGTCAAATTTGGCTGGAAAGGCCTCATCCACAATGGTGTGGTGGAATATCTGGATGCTGAGGAAGAAGAGACTGCCATGATTATCATGACGCCCGAGGATCTCGACGAACATCGAGAACTGATGCAAGGTATCCCGCCAGCG------GAAACA---TCAGCACCGG------ACCGCCACAAGCGAATCAAGCCCAAACCCAATCCGTCCGTCAAAACATATACGCACTGCGAAATTCACCCCAATATGATTCTTGGTATCTGTGCCAGTATCAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTGCGTA-ACCCTCGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGACCGCTACAACGAGATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTTGGCTACAATCCCAAGCACGTCCCCTTCGTCCCCATCTCCGGCTTCAACGGCGACAACATGATTGAGCCTTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGCAAGACCCTCCTCGAGGCCATCGACGCCATTGATCCCCCTAGCCGTCCCTCCGACAAGCCCCTCCGCCTTCCCCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTCCCCGTCGGTCGTGTCGAGACCGGTACCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGCTGAGGGTGTT---CCCGGTGACAACGTTGGCTTCAACGTGAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGCAACGTTGCTGGTGACAGCAAGAACGACCCCCCCAAGGGTGCTGAGTCCTTCAACGCCCAGGTCATCGTTCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCTCCCGTCCTTGACTGCCACACCGCCCACATTGCTTGCAAGTTCGCCGAGCTCCTTGAGAAGATCGACCGCCGTACCGGTAAGTCGGTCGAGAACTCTCCCAAGTTCATCAAGTCCGGTGATGCCGCCATCGTCAAGATG ; END; BEGIN SETS; CHARSET TEF1 (CHARACTERS = 'Thyridaria combined ITS-LSU-SSU-rpb2-tef1') = 2480-3561; CHARSET lsu (CHARACTERS = 'Thyridaria combined ITS-LSU-SSU-rpb2-tef1') = 1-1484; CHARSET RPB2 (CHARACTERS = 'Thyridaria combined ITS-LSU-SSU-rpb2-tef1') = 3562-4877; CHARSET ssu (CHARACTERS = 'Thyridaria combined ITS-LSU-SSU-rpb2-tef1') = 1485-2479; END; BEGIN TREES; TITLE 'Thyridaria combined ITS-LSU-SSU-rpb2-tef1 RAxML'; LINK TAXA = Taxa2; TRANSLATE 1 'Amniculicola lignicola CBS_123094', 2 'Westerdykella ornata CBS_379.55', 3 'Herpotrichia diffusa CBS_250.62', 4 'Melanomma pulvis pyrius CBS_124080', 5 'Pleomassaria siparia CBS_279.74', 6 'Massariosphaeria phaeospora CBS_611.86', 7 Cyclothyriella_rubronotata_TR3, 8 Cyclothyriella_rubronotata_TR9a, 9 Cyclothyriella_rubronotata_TR9, 10 Cyclothyriella_rubronotata_TR, 11 Cyclothyriella_rubronotata_TR1, 12 'Cyclothyriella rubronotata CBS_419.85', 13 'Alternaria alternata CBS_916.96', 14 'Leptosphaeria doliolum CBS_505.75', 15 'Trematosphaeria pertusa CBS_122368', 16 'Massarina eburnea CBS_473.64', 17 'Karstenula rhodostoma CBS_690.94', 18 'Dendryphion europaeum CPC_22943', 19 'Torula hollandica CBS_220.69', 20 'Torula herbarum CBS_111855', 21 'Torula herbarum CBS_140066', 22 'Roussoella sp. CBS_170.96', 23 'Arthopyrenia salicis CBS_368.94', 24 'Roussoella mexicana CPC_25355', 25 'Roussoella chiangraina MFLUCC_10_0556', 26 'Roussoella angustior MFLUCC_15_0186', 27 'Roussoella magnatum MFLUCC_15_0185', 28 'Roussoella siamensis MFLUCC_11_0149', 29 'Roussoella neopustulans MFLUCC_11_0609', 30 'Roussoella nitidula MFLUCC_11_0634', 31 'Roussoella nitidula MFLUCC_11_0182', 32 'Roussoella thailandica MFLUCC_11_0621', 33 'Roussoellopsis sp. NBRC_106246', 34 'Roussoellopsis tosaensis MAFF_239638', 35 'Roussoellopsis macrospora MFLUCC_12_0005', 36 'Roussoella verrucispora CBS_125434', 37 'Roussoella hysterioides CBS_546.94', 38 'Roussoella japanensis MAFF_239636', 39 'Roussoella scabrispora MFLUCC_11_0624', 40 Roussoella_scabrispora_RSC, 41 'Roussoella pustulans MAFF_239637', 42 'Roussoella intermedia NBRC_106245', 43 'Neoroussoella bambusae MFLUCC_11_0124', 44 Thyridaria_broussonetiae_TB1, 45 Thyridaria_broussonetiae_TB2, 46 Thyridaria_broussonetiae_TB, 47 Thyridaria_broussonetiae_TB1a, 48 'Thyridaria acaciae CBS_138873', 49 'Parathyridaria percutanea CBS_128203', 50 'Parathyridaria percutanea CBS_868.95', 51 Parathyridaria_ramulicola_MRR1, 52 Parathyridaria_ramulicola_MF4, 53 Hobus_wogradensis_TI, 54 Ohleria_modesta_MGC, 55 Ohleria_modesta_OM, 56 'Paradictyoarthrinium tectonicola MFLUCC_13_0465', 57 'Paradictyoarthrinium diffractum MFLUCC_13_0466', 58 'Nigrograna mackinnonii CBS_110022', 59 'Nigrograna mackinnonii CBS_674.75', 60 Nigrograna_mackinnonii_E9303e, 61 Nigrograna_fuscidula_MF9, 62 Nigrograna_fuscidula_MF7, 63 Nigrograna_fuscidula_MF3, 64 Nigrograna_fuscidula_MF1a, 65 Nigrograna_fuscidula_MF1, 66 Nigrograna_fuscidula_MF8, 67 Nigrograna_norvegica_TR8, 68 Nigrograna_mycophila_MF6, 69 Nigrograna_mycophila_TDK, 70 Nigrograna_mycophila_MF5, 71 Nigrograna_obliqua_MF2, 72 Nigrograna_obliqua_KE, 73 Nigrograna_obliqua_MRP, 74 Nigrograna_obliqua_BW4, 75 'Neooccultibambusa chiangraiensis MFLUCC_12_0559', 76 'Seriascoma didymospora MFLUCC_11_0179', 77 'Occultibambusa fusispora MFLUCC_11_0127', 78 'Occultibambusa bambusae MFLUCC_13_0855', 79 'Occultibambusa pustula MFLUCC_11_0502', 80 'Versicolorisporium triseptatum JCM_14775', 81 'Mauritiana rhizophorae BCC_28866', 82 'Lophiostoma macrostomum KT_508', 83 Teichospora_trabicola_C134, 84 'Lophiotrema nucula CBS_627.86', 85 Ulospora_bilgramii_CBS_110020, 86 'Tetraplosphaeria sasicola HHUF_27566', 87 Anteaglonium_parvulum_SMH5223, 88 Massaria_inquinans_M19, 89 Massaria_campestris_M28; TREE Fig._1 = [&U] ((1:0.256284,((2:0.311175,((((5:0.190796,(3:0.209155,4:0.085507):0.052051):0.113861,((6:0.286906,(7:3.0E-6,(8:3.0E-6,(9:3.0E-6,(10:3.0E-6,(11:7.5E-4,12:5.31E-4):3.0E-6):3.0E-6):3.67E-4):3.0E-6):0.182423):0.047149,((13:0.16505,14:0.175774):0.168675,(15:0.325391,(16:0.321257,17:0.277847):0.030409):0.088231):0.062584):0.040295):0.042477,((((18:0.122431,(19:0.075576,(20:0.03124,21:0.08152):0.023604):0.112646):0.142805,(((24:0.064809,(22:0.00258,23:0.02446):3.0E-6):0.10295,(43:0.129631,(((25:0.034558,(26:0.086259,27:0.047851):0.022132):0.042445,(28:0.100422,29:0.028078):0.016428):0.007584,((32:0.045829,(30:3.0E-6,31:9.64E-4):0.052377):0.033562,(((33:0.025364,(34:0.023441,35:0.059018):0.039468):0.015297,((36:0.034152,(37:0.004739,38:0.00697):0.012647):0.019218,(39:0.012539,40:0.00653):0.053712):0.015259):0.005413,(41:3.0E-6,42:0.030439):0.052587):0.010584):0.02527):0.025667):0.01631):0.027535,((48:0.044721,((44:3.0E-6,45:3.0E-6):3.0E-6,(46:0.001944,47:3.0E-6):3.0E-6):0.012905):0.102975,((49:0.001913,50:0.00382):0.095853,(51:3.0E-6,52:3.0E-6):0.088636):0.035263):0.018774):0.074681):0.052404,(53:0.205471,(54:3.0E-6,55:3.0E-6):0.139014):0.027739):0.01008,((56:0.039965,57:0.005948):0.177279,((((58:0.007673,(59:3.0E-6,60:0.001055):0.004544):0.007526,(66:3.0E-6,(61:3.0E-6,(65:6.98E-4,(64:3.0E-6,(62:3.0E-6,63:3.0E-6):3.0E-6):3.0E-6):3.0E-6):3.0E-6):0.018486):0.090685,(67:0.083463,((68:0.004948,(69:0.001808,70:3.0E-6):2.88E-4):0.013662,(71:0.003857,(72:3.71E-4,(73:3.0E-6,74:3.0E-6):7.68E-4):0.001163):0.007423):0.073494):0.019501):0.099118,(75:0.137826,(76:0.124526,(80:0.114257,(77:0.069282,(78:0.013435,79:0.018791):0.122377):0.028054):0.016549):0.008999):0.056827):0.05463):0.005925):0.017327):0.01765,(81:0.263668,(82:0.254811,83:0.277938):0.031444):0.02837):0.017692):0.034747,(84:0.240582,(87:0.180673,(85:0.093661,86:0.132368):0.050066):0.02243):0.041677):0.017573):0.183332,(88:0.024582,89:0.024369):0.183332); END;