#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 12:46 GMT TreeBASE (cc) 1994-2008 Study reference: Meeboon J., & Takamatsu S. 2016. Erysiphe eucalypticola and Phyllactinia lagerstroemiae, two new species of powdery mildews on Eucalyptus and Lagerstroemia from Thailand. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S19906] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=43; TAXLABELS 'Erysiphe abeliicola Ex_Abelia_MUMH4472' 'Erysiphe akebiae Ex_Akebia_MUMH4649' 'Erysiphe alphitoides Ex_Quercus_MUMH2471' 'Erysiphe aquilegiae Ex_Laurus_MUMH2559' 'Erysiphe astragali Ex_Astragalus_MUMH2585' 'Erysiphe berberidicola Ex_Mahonia_MUMH575' 'Erysiphe blasti Ex_Lindera_MUMH4379' 'Erysiphe buhrii Ex_Gypsophila_MUMH787' 'Erysiphe clethrae Ex_Clethra_MUMHs88' 'Erysiphe corylacearum Ex_Cornus_MUMH90' 'Erysiphe corylacearum Ex_Corylus_MUMH199' 'Erysiphe corylopsis Ex_Corylopsis_MUMH4174' 'Erysiphe cruciferarum Ex_Raphanus_MUMH289' 'Erysiphe dieruillae Ex_Weigela_TPU1669' 'Erysiphe epigena Ex_Quercus_MUMH3795' 'Erysiphe eucalypticola Ex_Eucalyptus_MUMH5745' 'Erysiphe eucalypticola Ex_Eucalyptus_MUMH6673' 'Erysiphe euphorbiae Ex_Chamaesyce_MUMH4646' 'Erysiphe friesii var. dahurica Ex_Rhamnus_MUMH4638' 'Erysiphe glycines Ex_Desmodium_MUMH396' 'Erysiphe glycines Ex_Glycine_MUMH1462' 'Erysiphe heraclei Ex_Osmorhiza_MUMH1874' 'Erysiphe huayinensis Ex_Isodon_MUMH2557' 'Erysiphe izuensis Ex_Rhododendron_MUMH4651' 'Erysiphe juglandis Ex_Juglans_MUMH278' 'Erysiphe ligustri Ex_Ligustrum_MUMH2244' 'Erysiphe liriodendri Ex_Liriodendron_MUMH4666' 'Erysiphe lonicerae var. lonicerae Ex_Lonicera_MUMH2481' 'Erysiphe monascogera Ex_Styrax_MUMH3786' 'Erysiphe myoschili Ex_Myoschilos_MUMH1875' 'Erysiphe ornata var. ornata Ex_Betula_MUMH2560' 'Erysiphe palczewskii Ex_Robinia_MUMHs111' 'Erysiphe phyllanthi Ex_Phyllanthus_MUMH99' 'Erysiphe quercicola Ex_Acacia_MUMH3241' 'Erysiphe ribicola Ex_Ribes_BCRU03850' 'Erysiphe russellii Ex_Xanthoxalis_MUMH2593' 'Erysiphe schizandrae Ex_Schisandra_MUMH2582' 'Erysiphe symphoricarpi Ex_Symphoricarpos_MUMH974' 'Erysiphe syringae Ex_Syringa_TPU1549' 'Erysiphe syringae-japonicae Ex_Syringa_MUMH1916' 'Erysiphe trifoliorum Ex_Trifolium_MUMH701' 'Erysiphe viburni-plicati Ex_Viburnum_MUMH794' 'Erysiphe viciae-unijugae Ex_Vicia_MUMH817' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=31; TAXLABELS 'Leveillula cylindrospora Ex_Noaea_AB044352' 'Leveillula duriaei Ex_Salvia_AB044373' 'Leveillula guilanensis Ex_Chondrilla_AB045156' 'Leveillula picridis Ex_Artemisia_AB044384' 'Leveillula saxaouli Ex_Haloxylon_AB044382' 'Leveillula taurica Ex_Impatiens_AB045003' 'Phyllactinia actinidiae Ex_Actinidia_AB080489' 'Phyllactinia actinidiae-latifoliae Ex_Actinidia_MUMH5514' 'Phyllactinia adesmiae Ex_Adesmia_MUMH1938' 'Phyllactinia ampulliformis Ex_Discaria_AB080571' 'Phyllactinia bougainvilleae Ex_Bougainvillea_KC556804' 'Phyllactinia caricicola Ex_Carica_MUMH3722' 'Phyllactinia chubutiana Ex_Lycium_AB243690' 'Phyllactinia durantae Ex_Duranta_MUMH3726' 'Phyllactinia enkianthi Ex_Rhododendron_AB080517' 'Phyllactinia fraxini Ex_Fraxinus_AB080551' 'Phyllactinia fraxini Ex_Wisteria_AB080544' 'Phyllactinia fraxinicola Ex_Fraxinus_AB080493' 'Phyllactinia fraxinicola Ex_Fraxinus_AB080585' 'Phyllactinia juglandis Ex_Juglans__AB080531' 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH3342' 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH3351' 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH5750' 'Phyllactinia leveilluloides Ex_Quercus_HAL2917F' 'Phyllactinia moricola Ex_Morus_MUMH79' 'Phyllactinia obclavata Ex_Tabebuia_MUMH3725' 'Phyllactinia pyri-serotinae Ex_Pyrus_AB080521' 'Phyllactinia salmonii Ex_Paulownia_AB080486' 'Phyllactinia sapii Ex_Sapium_AB080487' 'Pleochaeta polychaeta Ex_Celtis_MUMH3086' 'Pleochaeta shiraiana Ex_Celtis_MUMH1742' ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=36; TAXLABELS 'Leveillula cylindrospora Ex_Noaea_AB080468' 'Leveillula lanuginosa Ex_Daucus_AB042641' 'Leveillula quilanensis Ex_Chondrilla_AB080478' 'Leveillula saxaouli Ex_Haloxylon_AB080469' 'Leveillula taurica Ex_Artemisia_AB080470' 'Leveillula taurica Ex_Impatiens_AB080473' 'Phyllactinia adesmiae Ex_Adesmia_MUMH1938' 'Phyllactinia alni Ex_Alnus_AB080411' 'Phyllactinia angulata Ex_Quercus_MUMH928' 'Phyllactinia betulae Ex_Betula_AB080396' 'Phyllactinia broussonetiae-kaempferi Ex_Broussonetia_AB080382' 'Phyllactinia cassiae-fistulae Ex_Cassia_AB691227' 'Phyllactinia cassiae-fistulae Ex_Cassia_AB691228' 'Phyllactinia chubutiana Ex_Lycium_AB243690' 'Phyllactinia enkianthi Ex_Rhododendron_AB080408' 'Phyllactinia eupteleae Ex_Euptelea_AB080388' 'Phyllactinia fraxini Ex_Fraxinus_AB080451' 'Phyllactinia fraxini Ex_Syringa_AB080436' 'Phyllactinia fraxinicola Ex_Fraxinus_AB080383' 'Phyllactinia guttata Ex_Acer_AB080433' 'Phyllactinia hamamelidis Ex_Hamamelis_AB080410' 'Phyllactinia juglandis Ex_Juglans_AB080422' 'Phyllactinia kakicola Ex_Diospyros_AB080381' 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH3342' 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH3351' 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH5750' 'Phyllactinia leveilluloides Ex_Quercus_HAL2917F' 'Phyllactinia magnoliae Ex_Magnolia_AB080416' 'Phyllactinia moricola Ex_Morus_AB080372' 'Phyllactinia obclavata Ex_Spathodea_MUMH1748' 'Phyllactinia obclavata Ex_Tabebuia_MUMH1876' 'Phyllactinia paliuri Ex_Paliurus_AB080458' 'Phyllactinia pterostyracis Ex_Pterostyrax_AB080403' Phyllactinia_sp._Ex_Rhabdaclema_MUMH3723 'Pleochaeta polychaeta Ex_Celtis_MUMH3086' 'Pleochaeta shiraiana Ex_Celtis_MUMH1742' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M42789] TITLE Phyllactinia_lagerstroemiae_ITS_31_taxa; LINK TAXA = Taxa2; DIMENSIONS NCHAR=765; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Leveillula cylindrospora Ex_Noaea_AB044352' CAGAGCG-TGAAGACCTC-----GGCCC----CTCCGCAGCGCAAGCTGA-TGC-----GAGGGACACATG---CCGGGGTCGACCC--TCCCACCCGTGTCGA--CTCGTCTCCTGTTGCTTTGGCAGGCCGA-----CTGCCT--AGCA--GTCCTCTGG------CTC------TCG-------------------GGC-TGGAG-TGCGCCTGCCAGA--GA--------------CCTACTCAA----------------CTCGTGTTC-T------GGATGAAGTCTGAGC-AA----TCAAGTATACA----A-----ATGAATAAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCTTCGAGCCGA-CTA----GGCTTGGTCTTGGGG-CTCGCCC-GCGT--------------------------------TTGGCGC------------GGCGGCTCTCAAACGCAGTGGCGGTGCCGGTGG-TGCTTTCCGCGTAGT---CA--CAT-TTCTCGCGCGAGGGCAGAATCCGGA-CCCAGCCAGC--AACCACAACGTCCGCAG--CGCT-CTGCGCGGCGACGTTGTACGTTTTTTTCCTCCTC---CGG 'Leveillula duriaei Ex_Salvia_AB044373' CAGAGCG-TGAAGACCTC-----GGCCC----CTCCACAGCGCAAGCTGG-TGC-----GAGGGACACATG---CCGGGGTCGACCC--TCCCACCCGTGTCGA--CTTGTCTCCTGTTGCTTTGGCAGGCCGA-----CTGCCT--AGCG--GTCCTCTGG------CTC------TCG-------------------GGC-TGGAG-TGCGCCTGCCAGA--GA---------------CTATTCAA----------------CTCGTGTTC-T------GGATGAAGTCTGAGC-AA----TAAAGAAAAAA----AAAATAATGAATAAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCGTCGAGCCGA-CTA----GGCTTGGTCTTGGGG-CTCGCCC-GCAT--------------------------------TTGGCGC------------GGCGGCTCTTAAACGCAGTGGCGGTGCCGGTGG-TGCTTTCCGCGTAGT---CA--CAT-TTCTCGCGCGAGGGCAGAATCCGGA-CCCAGCCAGC--AACCACAAAGTCCGCAG--CGCT-CTGCGCGGCGAC--------TTTTGTACTTCTTC---TGG 'Leveillula guilanensis Ex_Chondrilla_AB045156' CAGAGCG-TGAAGACCTC-----GGCCC----CTCCGCAGCGCAAGCTGG-TGC-----GAGGGACACATG---CCGGGGTCGACCC--TCCCACCCGTGTCGA--CTCGTCTCCTGTTGCTTTGGCAGGCCGA-----CCGCCT--GGCG--GTCCTCTGG------CTC------TTG-------------------GGC-TGGAG-TGCGCCTGCCAGA--GA---------------CTATCCAA----------------CTCGTGTTC-T------GGATGAAGTCTGAGC-AA----TCAAGTAAAAA------ATTAAAGAATAAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCGTCGAGCCGC-CTT----GGCTTGGTCTTGGGG-TCCGCCC-GC-G--------------------------------TTGGCGC------------GGCGGCCCTTAAATGCAGTGGCGGTGCCGGTGG-TGCTTTCCGCGTAGT---CA--CAT-TTCTCGCGCGAGGGCAGGATCCGGA-CCCAGCCAGC--AATC---TAGTTCGCGG--CGCT-CTGCGCTGCGAC---------------TTCTCTC---TGG 'Leveillula picridis Ex_Artemisia_AB044384' CAGAGCG-TGAAGACCTC-----GGCCC--CATCCACCAGCGCAAGCGGG-TGC-----GAGGGACACATG---CCGGGGTCGACCC--TCCCACCCGTGTCGACTCCG-TCTCTTGTTGCTTTGGCAGGCCGA-----CCGCCC--AGCG--GTCCTCTGG------CTC------CCG-------------------GGC-TGGAG-CGCGCCTGCCAGA--GA---------------ATATTCAA----------------CTCGTGTTT-T------GGGTGAAGTCTGAGC-AA----TCAAGTAATAC------------GAATAAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATA---ACAACCCCCTCGAGCCGA-CTA----GGCTTGGTCTTGGGG-CCCGCCC-GC-G--------------------------------TTGGCGC------------GGCGGCCCTTAAACCCAGTGGCGGTGCCGGTGG-TGCTTTCCGCGTAGT---CA--CGT-TTCTCGCGCGAGGGCACGATCTGGA-CCCAGCCAGC--AACC---AAGTCCGCGG--CGCT-GTGCGCTGCGAC---------------TTCTCTC---TGG 'Leveillula saxaouli Ex_Haloxylon_AB044382' CAGAGCG-TGAAGACCTC-----GGCCC----CTCCACAGCGCAAGCTGG-CGC-----AAGGGACACATG---CCGGGGTCAACCC--TCCCACCCGTGTCAA--CTCGTCTCCTGTTGCTTTGGCAGGCCGA-----CTGCCT--AGCG--GTCCTCTGG------CTC------TCG-------------------GGC-TGGAG-TGCGCCTGCCAGA--GA---------------CTACTCAA----------------CTCGTGTTT-T------GGATGAAGTCTGAGC-AA----TCAAGTATAAA----A-----ATGAATAAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCTTCGAGCCGA-CTA----GGCTTGGTCTTGGGG-CTCGCCC-GCGT--------------------------------CTGGCGC------------GGCGGCTCTCAAACGCAGTGGCGGTGCCGGTGG-TGCTTTCCGCGTAGT---CA--CAT-TTCTCGCGCGAGAGCAGAATCCAGG-CCCAGCCAGC--AACCACAAAGTCCGCGG--CGCT-CTGCGCGGCGAC---------TTTGTACTTCTTC---TGG 'Leveillula taurica Ex_Impatiens_AB045003' CAGAGCG-TGAAGACCGC-----GGCCC----CTCCGCAGCGCAAGCTGA-TGC-----GAGGGACACATG---CCGGGGTCGACCC--TCCCACCCGTGTCGA--CTCGTCTCCTGTTGCTTTGGCAGGCCGA-----CTGCCT--AGCG--GTCCTCTGG------CTC------TCG-------------------GGC-TGGAG-TGCGCCTGCCAGA--GA---------------CTATTTAA----------------CTCGTGTTT-T------GGATGAAGTCTGAGG-AA----TCAAGTGAACA----AA---AATGAATAAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCGTCGAGCCGA-CTA----GGCTTGGTCTTGGGG-CTCGCCC-GCAT--------------------------------TTAGCGC------------GGCGGCTCTTAAACACAGTGGCGGTGCCGGTGG-TGCTTTCCGCGTAGT---CA--CAT-TTCTCGCGCGAGGGCAGAATCCGGA-CCCAGCCAGCA-AACCACAGTGTCCGCGG--CGTT-CTGCGCAGCGAC---------TCTGTACTTCTTC---TGG 'Phyllactinia actinidiae Ex_Actinidia_AB080489' CAGAGCG-TGAAGACCCCCCCTCGGGCC--CCTCCAGCGGCGCAAGTCGG-TGT-----GAGGGATACATG-CCTCGGGGTCGACCC--TCCCACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCCGG-------------GGCA--ACCCGCTGG------CCC------TTG-------------------GGC-TGGAG-CGTGCCTGCCAGA--GA-----------ATGTATTTTCAAAGTGTTTTGGAACAA-CTCGTGTTA-T------TGGTGAAGTCTGAGCACA------ATGTGGGAA----A----------TTAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCCTCAAGCCGC-TCT----GGCTTGGTCTTGGGG-CTCGCCC-GC-A--------------------------------TCTGCGT------------GGCGTCCCTTAAACCCAGTGGCGGAACCGGTGG-TGCTCTCCGCGTAGT---CA--CG--TTCTCGCGACAGGGTGGCA-CTGGA-TCCAGCCAA---AA-----AGACCCACGG--CGTCTTTGCGCGACGTG------------TCTCTCTCAA---TGG 'Phyllactinia actinidiae-latifoliae Ex_Actinidia_MUMH5514' -------------------------------------CGGCGCAAGTCGG-TGTGA---GAGGGGGGACCATGCCGGGGGTCGACCC--TCCCACCCGTGTCGATTTTTTTCTCCTGTTGCTTTGGCAGGCCGG------GGCCC--AGCG--CCCCGCTGGC-----CGC--------------------------ATGGC-TGGAG-CGTGCCTGCCAGAGGGA-----------AATGTTAGTCAA----------------CTCGTGTAATT------TAATGCAGTCTGAGCAAA-------TGTGAAAA------------TAATAAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCCTCAAGCCGCTTCT----GGCTTGGTCTTGGGG-CTCGCCC-GCAA--------------------------------TCTGCGT------------GGCGTCCCTTAAACGCAGTGGCGGTACCAGCGGTTGCTCTCCGCGCAGT---CA--CGT-TTCTCGCGGCAGGGAGACA-CTGGA-ACCAGCCAA---AACCAAAAGACCCCGCGGACGTCTCGGCGTCACGGA-------------CTCTCTCTA---TGG 'Phyllactinia adesmiae Ex_Adesmia_MUMH1938' CAGAGCG-TGAAGACCTC-----GGCCC----CTCCGCGGCGCAAGCTGA-TGC-----GAGGGATACATG--TCCGGGGTCGACCC--TCCCACCCGTGTCGA--CTCTTTTGCTGTTGCTTTGGCAGGCCGG-----CCGCCTCGCGCG--GTCCTCTGGC-----CCC------TCG-------------------GGC-TGGAG-CGCGCCTGCCAGA--GA-----------ATATTTTGTCAA----------------CTCGTGTTTAT------GAATGAAGTCTGAGT-AATCAAACATATTAGAA----A----------TAAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTATTCCTAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCCTCGAGCCGC-ATA----GGCTTGGTCTTGGGG-CTCGCCC-GC-G--------------------------------TCAGCGT------------GGCGGCCCTTAAATGCAGTGGCGGTGCCGGTGG-TGCTTTCCGCGTAGT---CA--TAT-TTCTCGCGCGAGAGCAGGATCCGGA-CCCAGCCAGC--AA---GCAAGTCCGCGG--CGGT-CTGCGTCGCGAC---------------TTCTCTC---AGG 'Phyllactinia ampulliformis Ex_Discaria_AB080571' ----------------------------------------------------------------------------------GACC----TCCACCCGTGTCGATTGTA-TCTTCTGTTGCTTTGGTAGGCCGG--GGCCCGCCT--AGCGGATCCCGCTGG------CCT------CTGA-----------------TGGC-TGGAG-CGTGCCTGCCAGA--GA-----------AAAC-TTGACAA----------------CTCGTGTGA-T------TGATGAAGTCTGAGCAAA----CCATGTGGGAA----A----------TTAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAA---ACAA-CCCCTCAAGCCGC-TCT----GGCTTGGTCTTGGGG-CGCGCCC-GC-G--------------------------------AGAGCGC------------GGCGGCCCTTAAATCGAGTGGCGGTACCGGTGG-TGCTCTCCGCGTAGT---CA--CGT-TTCTCGCGACAGGACGGCA-CTGGA-ACCAGCCAA---AA--------GACGACG----GA-CGCTGGTGCGTC------TGTCCTAC-TGATCTA---TGG 'Phyllactinia bougainvilleae Ex_Bougainvillea_KC556804' CAGAGCG-TGAAGACCTC-----GGCCC----CTCCACAGCGCAAGCTGGTTGC-----GAGGGGGACATG---CCGGGGTCGACCC--TCCCACCCGTGTCGACCTATTTTTCCTGTTGCTTTGGCAGACCGG-----CCGCCG--CGCG--GTCCTCTGGCGTCCTCTG------TTG-----------------GGGGT-TGGAG-AGCGTCTGCCAGA--GA-----------AATACTTGTTAA----------------CTCGTGTGATT------AAATGCAGTCTGAGG-AA---------TGAAAA----T-----ACGAATACG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTATTCCTAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCTTCAAGCCGCATTT----GGCTTGGTCTTGGGG-CTCGTCC-GCAGGAAGCAACACAAAATCCTCTTTTTTGGGTTCTTCAGCGT------------GGCGGCTCTTAAATGCAGTGGCGGTGCTGGTGA-TGCTTTCCGCGTAGT---CA--CAT-CTTCCGCGCGAAGGCCAGATCCGGCTTCCAGCCAAGCTAAGCAAA------------CGGTTCTGCATCACGCA----GAGCTCGTTCACTCTCAA---TGG 'Phyllactinia caricicola Ex_Carica_MUMH3722' ----------------------------------------------------------------------------------GACCC--TCCCACCCGTGTCGA-CTTGTTGTCTCGTTGCTTTGGCAGGCCGGCCGCCCCATCCCGGGCGG-GCCCTCTGG------CCT------TTG-------------------GCT-GGGAG-CGTGTCTGCCGGA--GA-----------AAAT--TGTTAA----------------CTCGTGTAA-T------TAGTGGGGTTTGAAG-------GGAAGGAA------------CATGAATGCA-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTATTCCTAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCCTCGAGCCGC-TCT----GGCTTGGTCTTGGGG-CTCGCCC-GC-G--------------------------------GTCGCGC------------GGCGTCCCTTAAACTTAGTGGCGGTGCTGGTAG-TGCTCTCCGCGTAGT---CA--CGT-ATCTCGCGATAGGGTGGTG-CCGGA-CCCAGCCAAGCAACCGAGGTGGTCCGATG--GG----AGCGTCGGGCC------CCCCTCGCTTTCTCTA---TGG 'Phyllactinia chubutiana Ex_Lycium_AB243690' CAGAGCG-TGACGACCTCG----GGCCC--TCTCATCCGGTGCAAGCTGG-AGCTTGA-GGGGGGTTCCTG---CCGGGGTCGACCC--TCCCACCCGTGTCGATCTCA-TCTCCTGTTGCTTTGGCAGGCCGG----ACCGCCT--GTCGG-TCCCTCGGGC-----CTT------TTGTGTTGGGGAAGGGA----AGCC-TGAAG-CGTGCCTGCCAGA--GAAGTTGGAAACAACATCTTGACAAA---------------CTCGTGTGA-T------TGGTGAAGTCTGAGG-CA----TCTAATAAAGA----T----AATGAATGAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTATTCCCAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCTCTCGAGCCGA-TCT----GGCTTGGTCTTGGGG-CTCGCCC-GC-G--------------------------------ATAGCGT------------GGCGTCCCTTAAACCCAGTGGCGGTGCTGATAG-TGTTCTCCGCGTAGT---CA--CA--GTCTCGCGGTAGGGCAGTA-CCAGG-CCCAGCCAAG--AATAAAAGGATCCGGCG---ACC-TTCCGCCGCGAC----TCTTTCTCTCTCTCTCTCTAATGG 'Phyllactinia durantae Ex_Duranta_MUMH3726' -----------------------------------------------------------------------------------ACCC--TCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGG-----CCGCCT--GCCG--GTCCTCTGGC-----CCC------TTG------------------TGGCGTAGAG-CGTGTCTGCCAGA--GA----------AAAATTTTGTCAA----------------CTCGTATGA-T------CGGTGAAGTCTGAGG-AATCAAACACATGAA-----------------TAAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGA---ACAA-CCCCTCGAGCCAC-TTT----GGCTTGGTCTTGGGG-CTCGCCC-GC-G--------------------------------GTCGCGT------------GGCGTCCCCTAAAAGCAGTGGCGGTGCCGGTAG-TGCTTTCCGCGTAGT---CA--CGT-ATCTCGCGCGAGGGTGGTG-CCGGA-CCCAGCCAGCAGGAGTCACGACGTCATCG---------TCGGGGCTTCAATCTTTTTTTATTTTTTCTTA---TGG 'Phyllactinia enkianthi Ex_Rhododendron_AB080517' CAGAGCG-TGAAGACCCCCCTCGGGCCC---CTCCAGCGGCGCAAGTCGG-TGT-----GAGGGATACATG-CCTCGGGGTCGACCC--TCCCACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCCGG-------------GGCA--ACCCGCTGG------CCC------TTG-------------------GGC-TGGAG-CGTGCCTGCCAGA--GA-----------ATGTATTTTCAATATGTTTTGGAACAA-CTCGTGTTA-T------TGGTGAAGTCTGAGCACA------ATGTGGGAA----A----------TAAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCCTCAAGCCGC-TCT----GGCTTGGTCTTGGGG-CTCGCCC-GC-A--------------------------------TCTGCGC------------GGCGTCCCTTAAACCCAGTGGCGGAACCGGTGG-TGCTCTCCGCGTAGT---CA--CG--TTCTCGCGACAGGGTGGCA-CTGGA-TCCAGCCAA---AA-----AGACCCACGG--CGTCTTTGCGCGACGTG------------TCTCTCTCAA---TGG 'Phyllactinia fraxini Ex_Fraxinus_AB080551' CAGAGCG-TGAAGACTTC-----GGCCC----CTCCGCGGCGCAAGTCGAGGTT-----GAGGGGAACATG---CCGGGGTCGACCC--TCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGG----GGCGCCTT-GGCG--CTCCGCTGGC-----CCC------CTG-------------------GGC-TGGAG-CGTGCCTGCCAGA--GA-----------AAATGTTGTCAA----------------CTCGTGTGA-T------TGGTGAAGTCTGAGG-AA----TCATGTGGGAA----A----------TTAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCCTCAGGCCGC-TCA----GGCTTGGTCTTGGGG-CTCGCCC-GC-C--------------------------------TTGGCGC------------GGCGGCCCTTAAACACCGTGGCGGTGCTGGTGG-TGCTCTCCGCGTAGT---CA--CG--TTCTCGCGACAGGGCGGCA-CTGGA-CCCAGCCAA---AA--------CCCGACG------CCGGCAAGGTGTC--------AACCCCCCTCTCTA----GG 'Phyllactinia fraxini Ex_Wisteria_AB080544' -----------------------------------------------------------------------------------ACCC--TCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGG----GGCGCCTT-GGCG--CTCCGCTGGC-----CCC------CTG-------------------GGC-TGGAG-CGTGCCTGCCAGA--GA-----------AAATGTTGTCAA----------------CTCGTGTGA-T------TGGTGAAGTCTGAGG-AA----TCATGTGGGAA----A----------TTAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCCTCAGGCCGC-TCA----GGCTTGGTCTTGGGG-CTCGCCC-GC-C--------------------------------TTGGCGC------------GGCGGCCCTTAAACACCGTGGCGGTGCTGGTGG-TGCTCTCCGCGTAGT---CA--CG--TTCTCGCGACAGGGCGGCA-CTGGA-CCCAGCCAA---AA--------CCCGACG------CCGGCAAGGTGTC--------AACCCCCCTCTCTA----GG 'Phyllactinia fraxinicola Ex_Fraxinus_AB080493' CAGAGCG-TGAAGACCTC-----GGCCC----CTCCGCGGCGCAAGTCGAGGTT-----GAGGGGAACATG---CCGGGGTCGACCC--TCCCACCCGTGTCGA-TTTATTCTCCTGTTGCTTTGGCAGGCCGG----GGCGCCCTTGGCA--CTCCGCCGGC-----CCC------TTG-------------------GGC-TGGAG-CGTGCCTGCCAGA--GA-----------AAATGTTGTCAA----------------CTCGTGTGA-T------TGGTGAAGTCTGAGG-AA----TCATGTGGGAA----A----------TTAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCCTCGGGCCGC-TCA----GGCTTGGTCTTGGGG-CTCGCCC-GC-C--------------------------------TTGGCGC------------GGCGGCCCTTAAATACAGTGGCGGTGCCGGTGG-TGCTCTCCGCGTAGT---CA--CG--TTCTCGCGACAGGGCGGCA-CCAGA-CCCAGCCAA---AA--------CCCGACG------CCGGCAAGGTGTC--------AACCCCCCCTTCTA----GG 'Phyllactinia fraxinicola Ex_Fraxinus_AB080585' CAGAGCG-TGAAGACCTC-----GGCCC---CTCCCGCGGCGCAAGTCGA-GGTG----GAGGGGAACATG---CCGGGGTCGACCC--TCCCACCCGTGTCGATTTTATTCTCCTGTTGCTTTGGCAGGCCGG----GGCGCCTT-GGCG--CTCCGCCGGC-----CCC------GTG-------------------GGC-TGGAG-CGTGCCTGCCAGA--GA-----------AAATGTTAGCAA----------------CTCGTGTGA-T------TGGTGAAGTCTGAGG-AA----TCATGTGGGAA----A----------TTAGTTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCCTCAGGCCGC-GCA----GGCTTGGTCTTGGGG-CTCGCCC-GC-C--------------------------------TTGGCGC------------GGCGGCCCTTAAACACAGTGGCGGTGCCGGTGG-TGCTCTCCGCGTAGT---CA--CG--TTCTCGCGACAGGGCGGCA-CCAGA-CCCAGCCAA---AA--------CCCGACG------CCGGCAAGGTGTC---------AACCCCCTCTCTA----GG 'Phyllactinia juglandis Ex_Juglans__AB080531' CAGAGCG-TGAAGACTCC---TCGGCCC---CTCCAGCGGCGCAAGTCGG-TGC-----GAGGGATACATG-CTGCGGGGTCGACCC--TCCCACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCCGG-------------GGTA--ACCCGCTGG------CCC------TTG-------------------GGC-TGGAG-CGTGCCTGCCAGA--GA-----------ATGTATTTTCAATATGTTTTGGAACAA-CTCGTGTTA-T------TGGTGAAGTCTGAGCACA------ATGTGAGAA----A----------TTAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCCTCAAGCCGC-TCT----GGCTTGGTCTTGGGG-CTCGCCC-GC-A--------------------------------GCTGCGC------------GGCGTCCCTTAAACCCAGTGGCGGAACCGGTGG-TGCTCTCCGCGTAGT---CA--CG--TTCTCGCGACAGGGCGGCA-CTGGA-TCCAGCCAA---AA-----AGACCCACGG--CGTC-TTGCGCGACGTG------------TCTCTCTCAA---TGG 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH3342' CCGAGCG-TGAAGGCCCT-----GGCCCCGCATCCTCGACCGCCAGTCGGGGGT-----GAGGGATCCACG---CCAGGGACGACCC--TCCCACCCGTGTCGA-TTTATGAATCTGTTGCTTTGGCAGGCCAG--TGCCCATCT--GGGT--ACGCTCCAG------CGC------GTG-------------------CGC-TGGAGGGGTGCCTGCCAGA--GA------------CCTATTGTCCA----------------CTCGTGTTG-T------CAGTGAAGTCTGAGGAAG------AAGAAATGA---------------ATAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATT---ACAA-CCTCTCAAGCCAGTCTT----GGTTTGGTCTTGGGGACTCGTCTCGCCT--------------------------------CTGGCCG------------GGCGTCCCTTAAAAGCAGTGGCGGTGCCCGTGG-TGCTCTGCGCGTAGT---CA--TG--CTCTCGCGACAGGGTCACT-GGGGA-GCCAGCCAAG--AA---------GCAGTGGGTGGTGCCGCTCTGCGTCGCCTACCCCAACTGTGTGTCGA---TGG 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH3351' CAGAGCGTTGAAGGCCCT-----GGCCCCGCATCCTCGGCCGCAAGTCGGGGGT-----GGGGGATCCACG---CCAGGGTCGACCC--TCCCACCCGTGTCGA-TTTAATTAACTGTTGCTTTGGCAGGCCCG--TGCCCCTCT--GGGG--ACGCTCTCG------CGC------TCAC------------------TGC-TGGAGTTGTGCCTGCCAGA--GA------------ACCATTGTCCA----------------CTCGTGTTG-T------CAGTGAAGTCTGAGGGAA----AGAAGAAATGA----A-----------TAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATT---ACAA-CCTCTCAAGCCTGTGTT----GGTTTGGTCTTGGGGACTCGCCCTGCCT--------------------------------TTGGCTT------------GGCGTCCCTTAAAAGCAGTGGCGGTGCCCGTGG-TGCTCTGCGCGTAGT---CA--TG--CTCTCGCGACAGGG--------GGA-GCCAGCCAAG--AACAAGTGTGGGTGGAG--ACGGTCTCCGTCGCCGC--------CTCCAATGTATCTA---AGG 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH5750' CAGAGCGTTGAAGGCCCT-----GGCCCCGCATCCTCGGCCGCAAGTCGGGGGT-----GGGGGATCCACG---CCAGGGTCGACCC--TCCCACCCGTGTCGA-TTTAATTAACTGTTGCTTTGGCAGGCCCG--TGCCCCTCT--GGGG--ACGCTCTCG------CGC------TCAC------------------TGC-TGGAGTTGTGCCTGCCAGA--GA------------ACCATTGTCCA----------------CTCGTGTTG-T------CAGTGAAGTCTGAGGGAA----AGAAGAAATGA----A-----------TAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATT---ACAA-CCTCTCAAGCCTGTGTT----GGTTTGGTCTTGGGGACTCGCCCTGCCT--------------------------------TTGGCTT------------GGCGTCCCTTAAAAGCAGTGGCGGTGCCCGTGG-TGCTCTGCGCGTAGT---CA--TG--CTCTCGCGACAGGG--------GGA-GCCAGCCAAG--AACAAGTGTGGGTGGAG--ACGGTCTCCGTCGCCGC--------CTCCAATGTATCTA---AGG 'Phyllactinia leveilluloides Ex_Quercus_HAL2917F' CAGAGCG-TGAAGGCCTC-----GGCCC---CTTGTCTGGCGTAAGCTAG-TATG----GGGGGTACCATG---CCGGGGCCAACCC--TCCCACCCGTGTCGATCTCA-TCTCCTGTTGCTTTGGCAGGCCGG-----CCGCCTCCGTCGGTCCCCCCTAT------CCC------GCGATTAGTCGAGGGAGAAGGGCCC-TGCAG-TGTGCCTGCCAGA--GG-----------AAGTCTTGTCAA----------------CTCGTGTAAAG------TGGTGAAGTCTGAGG-AA-------TGAAATAA----A-----CCGAATTAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTATTCCTAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCTCTCGAGCCGC-TCT----GGCTTGGTCTTGGGG-CTCGCCC-GC-G--------------------------------TATGCGC------------GGCGTCTCCTAAACATAGTGGCGGTGCCGGGTGGTGCTCTCCGCGTAGT---CA--CG--ATCTCGCGGCAGGGCAACA-GCGGA-CCTAGCCAACAAAA-----TCGTCCGGCGGA-----CTCCGTCGCGAT---------------CTTTCTCTTATGG 'Phyllactinia moricola Ex_Morus_MUMH79' CTGAGCG-TGAAGACTCTCG---GTCCCCCGCCCCATTGGTGCAAGCCAG-TGC-----GAGGGGGGAGCATGGCCGGAGTCGACCC--TCCCACCCGTGTCGATAAAA-ACGTCTGTTGCTTTGGTAGGCCGG--GGCCCGCCT--GGCGGATCCCGCTGG------CCT------TTG-----------------ATGGC-TGGAG-CGTGCCTGCCAGA--GA------------AAGTTGGACAA----------------CTCGTGTGA-T------TGATGAAGTCTGAGC-AA----CCAAGTGGGAA----A----------TTAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAA---ACAA-CCCCTCAAGTCGC-TCT----GGCTTGGTCTTGGGG-CCCGCCC-GC-G--------------------------------ACAGCGT------------GGCGGCCCTTAAATCTAGTGGCGGTGCCGGTGG-TGCTCTCCGTGTAGT---CA--CG--TTCTCGCGACAGGGCAGCA-CTGGA-CCCAGCCAA---AA----GACAACCTGTG--CGTC----TGTCGCACG---------------CTATCTA---TGG 'Phyllactinia obclavata Ex_Tabebuia_MUMH3725' ----------------------------------------------------------------------------------GACCC--TCCCACCCGTGTCGACCTTT-TCACCTGTTGCTTTGGCAGATCGG-----CCGCCTC-GGCG--GTCCTCTGGCACCTGCTCCGCGGGTAGACCCCGGCGGGGTCGGGCTGGC-TAGAGCCGTGTCTGCCAGAGAAA-----------AGAACTTGTCAA----------------CTCGTGTAACC------ACATGTCGTCTGAAGAAG----CTTCACAGAAG----CAGCATATGAATGAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTATTCCTGGGGGCATGCCTGTTCGAGCGTCATA---ACAACCTCCTCAAGCCCCCTTTGGGGGGCTTGGTTTTGGGG-CTCGCCC-GCGC--------------------------------TCGGCGT------------GGCGGTCCTTAAACACAGTGGCGGTGCCGGGGA-TGCTTTCCGCGTAGT---CG--CATCTTCTCGCGCGAAAGTCGGATCCCGA-CCCAGCCAGGTAAAGCCGCGAGTCGACGG--CCCA-CTACGCCGTCAA----------CTCTGCACTCTA---TGG 'Phyllactinia pyri-serotinae Ex_Pyrus_AB080521' CTGAGCG-TGAAGACTCTCGGG-CCCCC--C-CGCCATGGCGCAAGCCAG-TGCGGCGAGGGGGGCGAATCATGCCGGAGTCGACCC--TCCCACCCGTGTCGATGTTA-TCTCCTGTTGCTTTGGTGGGCCGG--GGGCCGCCT--AGCGGACCCCGCTGGC-----CCT------GCGC-----------------GGGC-TAGAG-CGTGCCTGCCAGA--GA-----------AATC-TTGACAA----------------CTCGTTTAATT------TGAGGAAGTCTGAGC-AAGCCCCCATGGGCGAA----CA---CACAATTTAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAA---ACAA-CCCCTCAAGCCAG-TCT----GGCTTGGTCTTGGGG-TCCGCCC-GC-G--------------------------------GCTGCGC------------GGCGGCCCTTAAAGCCAGTGGCGGTACCGGTAG-TGCTCTCCGCGTAGT---CA--CG--ATCTCGCGGCAGGGTAGCA-CTGGA-TCCAGCCAG---AA--GACGATGACGCCG--CCTT-CGGTGCGGTGTC------TG--------TTTCAA---TGG 'Phyllactinia salmonii Ex_Paulownia_AB080486' CAGAGCG-TGAAGACCCCCCTCGGGCCC---CTCCAGCGGCGCAAGTCGG-TGT-----GAGGGATACATGCCCTCGGGGTCGACCC--TCCCACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCCGG-------------GGCA--ACCCGCTGG------CCC------TTG-------------------GGC-TGGAG-CGTGCCTGCCAGA--GA-----------AAGTATTTTCAATGTGTTTTGGAACAA-CTCGTGTTA-T------TGGTGAAGTCTGAGCACA------ATGTGGGAA----A----------TTAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCCTCAAGCCGC-TCT----GGCTTGGTCTTGGGG-CTCGCCC-GC-A--------------------------------TCTGCGC------------GGCGTCCCTTAAACCCAGTGGCGGAACCGGTGG-TGCTCTCCGCGTAGT---CA--CG--TTCTCGCGACAGGGTGGCA-CTGGA-TCTAGCCAA---AA-----AGACCCACGG--CGTCTTTGCGCGACGTG------------ACTCTCTCAA---TGG 'Phyllactinia sapii Ex_Sapium_AB080487' CAGAGCG-TGAAGACTCC---TCGGCCC---CTGCAGCGGCGCAAGTCGA-TGT-----GAGGGATACATG-CCGCGGGGTCGACCC--TCCCACCCGTGTCGATATTATTCTCCTGTTGCTTTGGCAGGCCGG-------------GGCA--ACCCGCTGG------CCC------TTG-------------------GGC-TGGAG-CGAGCCTGCCAGA--GA-----------ATGTATT-TCAATATGTTTTGGAACAACCTCGTGTTA-T------TGGTGAAGTCTGAGCACA------ATGTGGGAA----A----------TTAG-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCGTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCCTCAAGCCGC-TCT----GGCTTGGTCTTGGGG-CTCGCCC-GC-A--------------------------------GCTGCGC------------GGCGTCCCTTAAACCCAGTGGCGGAACCGGTGG-TGCTCTCCGCGTAGT---CA--CG--TTCTCGCGACAGGGCGGCA-CTGGA-TCCAGCCAA---AA-----AGACCCACGG--CGTC-TTGCGCGACGTG------------TCTCTCTCAA---TGG 'Pleochaeta polychaeta Ex_Celtis_MUMH3086' -TGAGCG-TGAG--------------------ACTTATGCCTTGAATTGGGCAT-----------------------GAGTTGACCCCTCCCCACCCGTGCTGA-TTTATCAAACTGTTGCTTTGGCGGGCCTG--GACAATTTT--------GTTTTCCATCTTGTCCTTCCGGCTTTA------------------CGGC-TGAGA-CGTGTCCGCCAGA--GA---------CGAAAC----CCAA----------------CTCTTATGT-A------TAGTGTTGTCTTAGGCAAAGAAATTTGCGAAAC----AAAAAAAAATGAAAC-TTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACACAA-CCTTTCAAGCCTTGCTTTTGGGCTTCGGTATTGGGG-CGCGCCC-------------------------------------TTGGCTTTTAATGCTTATAGGCGTCCCTTAAAGAGAGTGGCGGTGCCACGGT-TGCTCTACGCGTAGT---AAACAATGTTCTCGCGACAGGGTACCGGCGGGACGTGAGCCAG---AA-----------GGCG--GGTT-TTTCGCTCCCTT---------CACACTTTTTCATCATAGG 'Pleochaeta shiraiana Ex_Celtis_MUMH1742' CTGAGCGTGTGAGATTCT---------------------------------------------GCCACATG---GCGGAGTTGAACTACCTCCACCCGTGCCGATTTTATCTATCTGTTGCTTTGGTGGACCAG----GTCACCT--TGTG---CCCTGCGG------CTT------TTT-----------------TCGGC-TGTAG-TGCGTCCGCCAGA--GA---------CAAAGCCCCCCCAA----------------CTCGTGATTTTATGTAACAGTGTGGTCTAAGGAGA---------AGAAAACTTGAATTTTATAAATATACTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCATA---ACAA-CCCATCAAGCCAC-CAT----GGTTTGGTCTTGGGG-CTCGCCG-------------------------------------ATTTTCT------------GGCGTCCCTTAAATAGAGTGGCAGTGCCGCGGG--GCTCTACGCGTAGTAAGCA--TTTTCTCTCGCGACAGAACACCGTTTGTGGACTGGCCAG---AA--------------------------GTTACATC---------------TTCTCATCACAGT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M42788] TITLE 'Erysiphe eucalypticola ITS+28S 43 taxa'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1362; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Erysiphe abeliicola Ex_Abelia_MUMH4472' CAGAGCGTGAGGCTCA-GTCGC-GGCATCTGCCGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGTGTCG{AG}TGTGC-TGG-CCGCGA-GGAC-ATGCATCG---GC--CGCCCACCGGC--TT--CGGCTGGAGCGCGTCCGCCAGAGA-CCTAACC----AAAACTCATG---TTGTCTTTTGCAGTCTAAGC-TTTATTTATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACACCCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--GTG-CGGCGGCCCTTAAAAACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCA-------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTTC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CCGAGTTTT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGGAACGTAGCTCCTCTCG---GGGAGTGTTATAGCCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTAAACGTAGGTGAGAACCCC-TTC--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe akebiae Ex_Akebia_MUMH4649' CAGAGTGTGAGGCTCA-GTCGT-GGCATCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGCTCCGCAA-GGAC-ATGCGTCG---GC--CGCCCACCGGT--TT--CGGCTGGAGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTTT-GTCGTCTTAGC-TTTAT-TATTGA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG--------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGATCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCC{CT}ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACC-CCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe alphitoides Ex_Quercus_MUMH2471' CAGAGTGTGAGGCTCA-GTCGT-GGCATCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGCTCCGCAA-GGAC-ATGCGTCG---GC--CGCCCACCGGT--TT--CGGCTGGAGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTTT-GTCGTCTTAGC-TTTAT-TATTGA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACC-CCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe aquilegiae Ex_Laurus_MUMH2559' CAGAGCGTGAGGCTCA-GTCGT-GGCGTCAGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTTCGTCGT--CGC-TGC-CCGTAC-GGAC-ATGCGTCG---GC--CGCCCACCGGT--TT--CGACTGGAGCGCGTCCGCCAAAGA-CCTAACC----AAAACTCATG---TTGTCTTT-GTCGTCTCAGC-TTTAT-TATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCCCGTCGCG--TTG-CGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTCG---GGGAGTGTTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe astragali Ex_Astragalus_MUMH2585' CAGAGTGCGAGGCTCA-GTCGT-AGCGTCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGC-CCGCAA-GGAC-ATGCGTCG---GC--CGCCCACCGGT--TT--CGACTGGAGCGCGCCCGCCAAAGA-CCCAATC----AAAACTCATG---TTGTTTAT-GTCGTCTCAGC-TTTAT-TATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACC-TTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTTTGGGGGCGCATCATCGACCGATCCTGATGTCTTCGGA---------------------- 'Erysiphe berberidicola Ex_Mahonia_MUMH575' CAGAGTGCGAGGCTCA-GTCGT-GGCGTCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TATCTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGC-CCACAT-GGAC-ATGCGCCG---GC--CGCCCACCGGTGGTTATCCACTGGAGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTACCTTTGT--GTGGCTGCGGTGTTGGGGCGCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATC-TTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe blasti Ex_Lindera_MUMH4379' CAGAGCGTGAGGCTCA-GTCGT-GGCGTCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGTCGT--CGC-TGC-CCGCAA-GGAC-ATGCGTCG---GC--CGCCCACCGGC--TT--CGGCTGGAGCGCGTCCGCCAAAGA-CCCAACC----CAAACTCATG---TTGTCTTT-GCAGTCTCAGCTTTTAT-TATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCG--AAG-CGGCAGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGGGTGACGAC-AGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCG---------------------------------ACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGCGGGAACGTAGCTCCTCTCG---GGGAGTGTTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCATTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe buhrii Ex_Gypsophila_MUMH787' CAGAGTGCGAGGCTCA-GTCGT-GGCGTCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGG--CGC-TGT-CCGCAG-GGAC-ACGCGTCG---GC--CGCCCACCGGT--TT--CGACTGGAGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTCTGT-GTCGTCTGAGC-ATTATAAATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGCCCGGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACC-TTGAGGTCTCCTCGAGTGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTACGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-CTTTGGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe clethrae Ex_Clethra_MUMHs88' CAGAGTGCGAGGCTCA-GTCGT-GGCGTCTGCTGCG-TGCTGGGCCAACCCTCCCATCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCGTCGT--CGCATGC-CCGTCA-GGACTCTGCGTCG---GC--TGCCCACCGGT--TT--CGGCTGGAGCGCGCCCGCCAAAGA-CCCAACT----AAAACTCATG---TTGTCTTT-GTCGTCTTAGC-TTTAT-TATTGA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCGAGCCGCGTTTGC--GTGGCTGCGGTGTTGGGGCTCGTCGCG--GTG-CGGCGGTCCTTAAAGATAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGAGGCCTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCAGAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCGGCCGATCACC-TCGAGTTCT-CTCGAGTGCACTCGACCGCACACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAAGGTAGCTCCCCTCAACCGGGAGTGTTATAGCCTATGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAGCCTC-GTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe corylacearum Ex_Cornus_MUMH90' CAGAGCGTGAGGCTCA-GTCGT-GGCATTTGCCGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGCTGCGCCGA--CGC-TGT-CCGCAAGGAAAGATGCGTCG---GTCGCCCCCGCCGGC--TT--CGGCTGGAGCGCGTCCGCCAAAGA-CCCAACCAAAAAAAACTCATG---TTATCATT-GCAGTCTAAGTCTTTAT-TATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACA-CCCCCTCCAGCTGCCTTTGC--GTGGCTGCGGTGTTGGGGCACGTCGCG--GTG-CGACGGCCCTGAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGACGGTTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACC-CAGAGTTTC-TTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe corylacearum Ex_Corylus_MUMH199' CAGAGCGTGAGGCTCA-CTCGT-GGCATCTGCCGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGTTGTGTCGT--CGC-TGC-CCGCAA-GGAC-ATGCGTTG---GC--CACCCACCGGC--TT--CGGCTGGAGCGCGTCCGCCAAAGA-CCTAACC----AAAACTCATG---TTGTTTTT-GCAGTCTAAGC-TTTAT-TATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCG--GTG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-CTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CTGAGTTTT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe corylopsis Ex_Corylopsis_MUMH4174' CAGAGCGTGAGGCTCA-GTCGT-GGCTTCTACCGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTGCGTCGT--CGC-TGC-CTTCAA-GGAC-AGGTGACG---GC--CGCCCACCGGC--TT--CGGCTGGAGCGCGTCCGCCAAAGA-CCCAAAC----AAAACTCATG---TTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACAACCCCCTCCAGCTGCCTCTGT--GTGGTTGCGGTGTTGGGGCACGTCGCG--ATG-CGGCGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGAGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCAGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACC-GTGAGTTCT-CTCTCGTGCACTCGTCAGCGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCG---GAGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCTT-CATTGGAGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe cruciferarum Ex_Raphanus_MUMH289' CAGAGTGCGAGGCTCA-GTCGT-GGCGTCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGC-CCGCATGGGAC-ATGCGTCG---GC--CGCCCACCGGT--TTCACGACTGGAGCGCGTCCGCCAAAGA-CCCAACC---AAAAACTCATG---TTGTCTGT-GTCGTCTCAGC-TTTAT-TATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTATGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACC-TTGCGTTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe dieruillae Ex_Weigela_TPU1669' CAGAGTGTGAGGCTCAGGGCGT-AGCATCTGCTGCG-TGCTGGGCCAATCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTACGCCGT--CGC-TGG-CCGCAA-GGAC-ATGCGTAGGCTGC--CGCCCACTGGC--TT--CGGCTGGAGCGCGCCCGCCAAAGA-CCTAACC----AAAACTCATG---TTGTCTTT-GTAGTCTCAGT-TATAT-TATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGGATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTACCTTTGA--GTGGCTGCGGTGTTGGGGCACGTCGCG--GTG-CGGCGGCTCTAAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGCAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTCGGGTTCGGCTTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCACAGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CCGAGTTTT-CTCTGGTGCACTCGACAGCGGACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGTTCCCTTCG---GGGCGTGTTATAGCCTACGGTGTCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCGTTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGA------------------ 'Erysiphe epigena Ex_Quercus_MUMH3795' CAGAGTGTGAGGCCCA-GTCGT-GGCATCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGC-CCGCAA-GGAC-ATGCGTCG---GC--CGCCCACCGGC--TT--CGGCTGGAGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTATTTTT-GTCGTCTCAGC-TTTAT-TATTGA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCCCGTCGCG--TTG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CCGAGTTCT-CTCAGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe eucalypticola Ex_Eucalyptus_MUMH5745' CAGAGCGTGAGGCCTA-GTCGT-AGCATTCGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATTTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGC-CCGCAA-GGAC-ATGCGTTG---GC--CGCCCACCGGT--TT--CGGCTGGAGCGCGTCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTTT-GTCGTCTCAGC-TTTAT-TATTGA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--AAG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGAGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCTGATCACC-CCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGAT------------------------------- 'Erysiphe eucalypticola Ex_Eucalyptus_MUMH6673' CAGAGCGTGAGGCCTA-GTCGT-AGCATTCGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATTTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGC-CCGCAA-GGAC-ATGCGTTG---GC--CGCCCACCGGT--TT--CGGCTGGAGCGCGTCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTTT-GTCGTCTCAGC-TTTAT-TATTGA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--AAG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGAGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCTGATCACC-CCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGAT------------------------------- 'Erysiphe euphorbiae Ex_Chamaesyce_MUMH4646' CAGAGCGTGAGGCTCA-GTCGT-GGCGTCAGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTACGTCGT--CGC-TGC-CCGTAC-GGAC-ATGCGTCG---GC--CGCCCACCGGT--TT--CGACTGGAGCGCGTCCGCCAAAGA-CCTAACC----AAAACTCATG---TTGTCTTT-GTCGTCTCAGC-TTTAT-TATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCCCGTCGCG--TTG-CGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCT{CT}AGTAACGGC{GT}AGTGA{AT}GCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTCG---GGGAGTGTTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe friesii var. dahurica Ex_Rhamnus_MUMH4638' CAGAGTGCGAGGCTCA-GTCGT-GGCGTCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGT-CCGCAT-GGAC-ATGCGTCG---GC--CGCCCACCGGT--TT--CGACTGGAGCGCGCCCGCCAAAGA-CCCAACC---AAAAACTCATG---TTGTTTGT-GTCGTCTTAGT-TTGAT-AATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ACG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACC-TTGAGTTCTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe glycines Ex_Desmodium_MUMH396' CAGAGCGTGAGGCTCA-GTCGCTGGCATCTGCCACG-TGCTGGGCCGACCCTCCCACCCGTGTCGATTTTATAGATTGTTGCTTTGGCGGGCCGGGAC-CGTCCA--CGT-CGT-TCACAG-TGAC-GTGTGCGA---GC--TGCCCACCGGC--TT--TGGCTGGAGCGTGTCCGCCAAAGA-CCCAACC---CAAAACTCTTATATTTGTCATG-GTAGTCTAAGT-AAAAG-TATAT-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCGAGCTACCGTTGT--GTGGCTGTGGTGTTGGGGCTCGCCGCGTCTCG-CGGTGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGATTCTCGCGACAGAGTGACGAC-GATGATCAGCC-----------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGTTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTTGATCATC-TAGAGTTTT-CTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTTG---GGGAGTGTTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAACCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCC-TTT--GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATG-------------------- 'Erysiphe glycines Ex_Glycine_MUMH1462' CAGAGCGTGAGGCTCA-GTCGC-GGCGTCTGCCATG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTATTGATTGTTGCTTTGGCGGGCCGGGAC-CGTCCA--CGT-CGC-TCGCAG-TGAC-GTGTGCGA---AC--TGCCCACCGGC--TT--TGGCTGGAGCGTGCCCGCCAAAGA-CCCATCC---CCAAACTCATA---TTGTCCT--GCAGTCTAAGT-GATAT-TATAT-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCGAGCTACAATTGT--GTGGCTGTGGTGTTGGGGCTCGCCGCGCCTCG-CGGTGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTACTTTTGATTCTCGCGACAGAGTGACGAC-GAAGATCAGCC-----------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGCAGATTCAGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGTTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTTGATCATC-CAGGGTTTT-CTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCG---GGGAGTGTTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe heraclei Ex_Osmorhiza_MUMH1874' CAGAGTGCGAGGCTCA-GTCGT-GGCGTCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCGTCGT--CGC-TGT-CCGCCT-GGAC-ATGCGTCG---GC--CGCCCACCGGT--TT--CGACTGGAGCGCGCCCGCCAAAGA-CCCAACC---AAAAACTCATG---TTGTCTGT-GTCGTCTTAGC-TTTATAAATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCC-------------------------------------------------------------------------------------AACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGACGCTGCCGATCACC-TTGAGGTCTCCTCGAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-CTTTGGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe huayinensis Ex_Isodon_MUMH2557' CAGAGCGCGAGGCTCA-GTCGT-AGCATGTGCTGCG-CGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGCTGCGTCGA--CGC-TGC-CCGTAC-GGAC-AGGCGTCG---GCC-CGCCCACTGGCTATT--CGGCTGGAGCGCGTTCGCCAAAGA-CCCAACC---ACAAACTCATG---TTGTCTTTTGTCGTCTAAGG-TATA--TATTTAATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAAACACCCCCCTCGAGCTACCTTTGTTGGTGGCTGTGGTGTTGGGGCACGTCGCG--GAG-CGGCGGCCCTTAAAGACAGTGGCGGTCTCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGCT-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTGCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCCACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-TCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTGCCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCGGT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGA---------------------- 'Erysiphe izuensis Ex_Rhododendron_MUMH4651' CAGAG{CT}GCGAGGCTCA-GTCGT-GGCGTCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCGTGTTGCTTTGGCGGGCCGGGCTGCGTCGT--CGC-TGC-CCGCAA-GGAC-CTGTGTCG---GCCGCGCCCACTGGT--TT--TGACTGGAGCGCGCCCGCCAAAGA-CCCAATC--CAAAAACTCATG---TTGTCTGT-GTCGTCTTAGC-TTTAT-TATTGA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACACCCCCCTCCAGCCGCCGTTGT--GTGGCTGCGGTGTTGGGGCGCGTCGCG--GTG-CGGCGGCCCTTAAAAACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGACCGGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCG--------------------------------AACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-GTGAGTTCT-CTCGCGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-GTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe juglandis Ex_Juglans_MUMH278' CAGAGCGTGAGGTTCA-GTCGT-GGCATCTGCCGTG-TCCTGAGCCGACCCTCCCACCCGTGTCGACTTTATATCATGTTGCTTTGGCGGGCCGGGTTATGTCCA--GGT-CGC-CCGTAA-GGGT-GCGTATGG---GC--AGCCCACCGGC--TT--CGGCTGGAGCGTGTCCGCCAGAGA-CCTATCC-----AAACTCATG---TTGTCTTT-GCAGTCTAAGG-TTTAT-TATGT-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACA-CCCCCTCGAGCCATC-TAGT--GTGGTTACGGTGTTGGGGCTCGTCGGG--TTTCCGGCGGCCCTTAAAGACAGTGGCGGTCCTGACGTGGGCTCTACGCGCAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-CTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCATC-CTGAGTTCT-CTCTGGTGCACTCGACAGCGGACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTTG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TAT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe ligustri Ex_Ligustrum_MUMH2244' CAGAGTGTGAGGCTCA-GTCGT-GGCATCTGCCGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGTTGCGTCGT--CGC-TGC-CCGCAA-GGAC-ATGCGTCG---CC--CGCCCACCGGC--TT--CGGCTGGAGCGCGTCCGCCAAAGA-CCCAACC---AAAAACTCATG---TTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCG--GTG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGACGTGGACTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCC------------------------------------------------------------------------------------------CGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-CTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CTGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGGAACGTAGCTCCTCTTG---GGGAGTGTTATAGCCTACGGTGTCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe liriodendri Ex_Liriodendron_MUMH4666' CAGAGTGCGAGGCTCA-GTCGT-GGCATCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TGTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGC--CGC-TGCTCCGCAA-GGAC-ATGCGTCG---GC--CGCCCACCGGT--TTT-CGGCTGGAGCGTGCCCGCCAAAGACCCCAATC----AAAACTCATG---TTGTTTTT-GTCGTCTCAGC-TTTAT-TATTGA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACACCCCCCTCCAGCTACCTTTGT--GTGGCTGCGGCGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCC------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCAAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGATCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe lonicerae var. lonicerae Ex_Lonicera_MUMH2481' CAGAGCGTGAGGCTCA-GTCGT-GGCGTCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGTTGCGTCGT--CGC-TGC-CCGCAA-GGAC-AGCCGTCG---GC--CTCCCACCGGT--TT--CGACTGGAGCGCGTCCGCCAAAGA-CCCAATC----AAAACTCATG---TTGTCTTT-GTCGTCTCAGC-TTTAT-TATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTACCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CCGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTTGGATGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCATCTGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe monascogera Ex_Styrax_MUMH3786' CAGAGTGTGAGGCTCA-GTCGT-GGCATCTGCCGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGCTCCGCAA-GGAC-ATGCGTCG---GC--CGCCCACCGGT--TT--CGGCTGGGGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTTT-GTCGTCTCAGC-TTTAT-TATTGA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAG---------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-TCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCTCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCAGACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe myoschili Ex_Myoschilos_MUMH1875' CAGAGTGCGAGGCTCA-GGCGT-GGCATGTGCTGCGTTACTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTCGCGTCGT--CGC-TGC-CCGTAC-GGAC-ACGCGTCG---GC--CGCCCACTGGT--TT--CGACTGGAGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTTT-GTCGTCTCAGC-TTTAT-TATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA-------------------------------------GAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-TTGAGTTCTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGATAAAGGCCGTAGGAATGTGGCTCCCTTCG---GGGAGTGTTATAGCCTATGGTGCCCTGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-CTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe ornata var. ornata Ex_Betula_MUMH2560' CAGAGCGTGAGGCTCA-GTCGT-GGCATCTGCCGCG-TACTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGTCGCGTCGT--CGC-TGT-CTGCAA-GGAC-ATGCGTTG---GC--CGCCCACCGGC--TT--CGGCTGGAGCGCGCCCGCCAAAGA-CCAAACC----AAAACTCATG---TTGTCTTT-GCAGTCTAAGC-TTTAT-TACTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCGTCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCG--GAG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGGGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTCGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CCGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTCG---GGGAGTGTTATAGTCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe palczewskii Ex_Robinia_MUMHs111' CAGAGTGCGAGGCTCA-GTCGT-AGCGTCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGT-TCGCAA-GGAC-ATGCGTCG---GC--CGCCCACCGGT--TTT-TCACTGGAGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCC---------------------------------------------------------------------------------------CGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACC-TTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCG---GGGAGTGTTATAGCCTAGGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe phyllanthi Ex_Phyllanthus_MUMH99' CAGAGTGCGAGGCTCA-GTCGT-GGCGTCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTCGCGTTGT--CGC-TGT-CCGCAT-GGAC-ATGCGGCG---CC--CGCCCACCGGT--TT--CGACTGGAGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACACCCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTATCAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCACTGCCGATCACC-TTGAGTTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCCAAACCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe quercicola Ex_Acacia_MUMH3241' CAGAGCGTGAGGCTCA-GTCGT-GGCATCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGCCCCGCAA-GGAC-AAGCGTCG---GC--CGCCCACCGGT--TT--CGGCTGGAGCGCGCCCGCCAAAGA-CCCCATC----AAAACTCATG---TTGTTTAT-GTCGTCTTAGC-TTTAT-TATTGA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTG--ATA-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-TTGAGTTTT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCGC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe ribicola Ex_Ribes_BCRU03850' CAGAGTGCGAGGCTCA-GTCGT-GGCGTCTGCTGCG-TGCTGGGTCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--TGC-TGC-CCTAAC-GGGC-ATGCGTCG---GC--CGCCCACCGGT--TT--CGACTGGAGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTTT-GTCGTCTCAGC-TTTAT-TATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCGTTGT--GTGGCTGTGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTGGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCTCCTCTGAGCTCGTCTCGAGTGTACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGA-GTCTT-GGAGG-------------------- 'Erysiphe russellii Ex_Xanthoxalis_MUMH2593' CAGAGTGCGAGGCTCA-GTCGT-GGCATCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGC-CTACAT-GGAC-ATGCGTCG---GC--CGCCCACCGGT--TTT-CAACTGGAGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTGT-GTCGTCTCAGC-TATAT-TATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGGCGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACC-TTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCG---GGGAGTGTTATAGCCTATGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGG----------------------- 'Erysiphe schizandrae Ex_Schisandra_MUMH2582' CAGAGTGTGAGGCTCA-GTCGT-GGCATCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATTTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGC-CCGCAA-GGAC-ATGCGTCG---GC--CGCCCACCGGT--TT--CGGCTGGAGCGCGCCCGCCAAAGA-CCCAACC----TAAACTCATG---TTGTTTGT-GTCGTCTCAGC-TTTAT-TATTGA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGTTTCTCGCGACAGGGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCATC-TCGAGTTTT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe symphoricarpi Ex_Symphoricarpos_MUMH974' CAGAGCGTGAGGCTCA-GTCGT-GGCGTCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATTTTGTTGCTTTGGCGGGCCGGGTTACGTCGT--CGC-TGT-CCGCAA-GGAC-AGACGTCG---GC--CTCCCACCGGT--TT--CGACTGGAGCGCGTCCGCCAAAGA-CCCAATC----AAAACTCATG---TTGTCTTT-GCAGTCTCAGC-TTTAT-TATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTACCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CCGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTTGGATGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCG---GGGAGTGTTATAGCCTATGGTGCCATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe syringae Ex_Syringa_TPU1549' CAGAGTGCGAGGCTCA-GTCGT-AGCATCTGCTGCG-TGCTGGGCCAACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGC-CCACAC-GGAC-AAGCGTCG---GC--CGCCCACCGGT--TT--CGACTGGAGCGCGTCCGCCAAAGA-CCCAACC----AAAACTCATG---TTTTTTTTCGTCGTCTCAGC-TTTAT-TATTGA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGGGTGACGAC-GGCGGCTTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CCGAGTTCT-CTCGGGTGCACTCGACCGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTCCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGAT----------------- 'Erysiphe syringae-japonicae Ex_Syringa_MUMH1916' CAGAGTGTGAGGCTCA-GTCGT-GGCATCTGCCGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGTTGCGTCGT--CGC-TGC-CCGCAA-GGAC-ATGCGTCG---GC--CGCCCACCGGC--TT--CGGCTGGAGCGCGTCCGCCAAAGA-CCCAACC---AAAAACTCATG---TTGTCTTT-GCAGTCTAAGC-TTTAT-TATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCG--GTG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGACGTGGACTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCC-----------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-CTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACC-CTGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe trifoliorum Ex_Trifolium_MUMH701' CAGAGTGCGAGGCTCA-GTCGC-GGCGTCGGCCGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGT-TCGCAA-GGAC-GTGCGTCG---GC--CGCCCACCGGT--TTA-GAACTGGAGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTGT-GTCGTCTCAGC-TTTAT-TATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCC-----------------------------------------------------------------------------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACC-TTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe viburni-plicati Ex_Viburnum_MUMH794' CAGAGCGTGAGGCTCA-GTCGG-GGCACCTGCCGCG-CGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTGTGTCGT--CGC-TGT-CCGCCA-GGAG-TAGCGTCG---GC--CGCCCGCCGGC--TT--CGGCTGGAGCGCGTCCGCCAAAGA-CCCAACC--AAAAAACTCATG---TTGTCATT-GCAGTCTAAGC-TTTAT-TATTG-----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCG--GTG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAA-GGTGGCCTGCCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCGTTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGCTGCCGATCACC-CCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGGAACGTAGCTCCCCTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TCT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe viciae-unijugae Ex_Vicia_MUMH817' CAGAGTGCGAGGCTCA-GTCGT-GGCATCTGCTGCG-TGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGT--CGC-TGT-CCGCAT-GGAC-CTGCGTCGGCCGC--CGCCCACCGGT--TT--CGACTGGAGCGCGCCCGCCAAAGA-CCCAACC----AAAACTCATG---TTGTTTGT-GTCGTCTCAGC-TTTAT-AATGAA----AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAT-AACA-CCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCG--ATG-CGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAA-CTTGCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCC----------------------------------------------------------------------------------------------------GGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACC-TTGAGTTCTGCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCG---GGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M42790] TITLE Phyllactinia_lagerstroemiae_28S_36_taxa; LINK TAXA = Taxa3; DIMENSIONS NCHAR=603; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Leveillula cylindrospora Ex_Noaea_AB080468' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATACGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCC 'Leveillula lanuginosa Ex_Daucus_AB042641' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCC 'Leveillula quilanensis Ex_Chondrilla_AB080478' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGACGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCC 'Leveillula saxaouli Ex_Haloxylon_AB080469' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCC 'Leveillula taurica Ex_Artemisia_AB080470' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGCGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTCCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGCAATGAAAGTGAACGTAGGTGAGAACCC 'Leveillula taurica Ex_Impatiens_AB080473' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGAAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGACGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia adesmiae Ex_Adesmia_MUMH1938' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTGGCTCCCTTC--GGGGGGTGTTATAGCCTGCGACGCAATACCGCCAACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGCAA------------------------- 'Phyllactinia alni Ex_Alnus_AB080411' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-TAT-CGACGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia angulata Ex_Quercus_MUMH928' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCACGCGGCTCAGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGG-GGC-GCACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGTGTCGTTGATCATCCAACG-TTCTCGT-TGGTGCACTCGGCGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCTTTTC--GGGGAGTGTTATAGCCCGCGGCGTAATACCGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATGCGCGAAATGAAAGTGAACATAGGTGAGAACCC 'Phyllactinia betulae Ex_Betula_AB080396' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTT-CGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia broussonetiae-kaempferi Ex_Broussonetia_AB080382' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCAG-TGTCCGGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAGACACTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC--GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTTGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTG-AAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia cassiae-fistulae Ex_Cassia_AB691227' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTTCGGGCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-TGATACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGTGTCGCTGATCATCCGAAG-TTTTCTT-TGGTGCACTCGACGA-CACACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTCGTAGGAACGTGGCTTCCCTC--GGGGAGTGTTATAGCCTGCGGCGCAATACTGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCTATGCGAGTGTTTGGGTGTG-AAACCCATACGCGAAATGAAAGTGAACGTAGGTGAGACCCC 'Phyllactinia cassiae-fistulae Ex_Cassia_AB691228' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTTCGGGCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-TGATACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGTGTCGCTGATCATCCGAAG-TTTTCTT-TGGTGCACTCGACGA-CACACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTCGTAGGAACGTGGCTTCCCTC--GGGGAGTGTTATAGCCTGCGGCGCAATACTGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCTATGCGAGTGTTTGGGTGTG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGACCCC 'Phyllactinia chubutiana Ex_Lycium_AB243690' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-ACACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGTTGATCATCCAACG-TTTTCGT-TGGTGCACTCGACGA-CGCGCAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCTTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCAAGTGTTTGGGTGCA-AAACCCATGCGCGGAATGAAAGTGAACGC------------ 'Phyllactinia enkianthi Ex_Rhododendron_AB080408' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTT-CGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCGCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia eupteleae Ex_Euptelea_AB080388' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TGT-CGGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAGACTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC--GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia fraxini Ex_Fraxinus_AB080451' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGT-GGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-CGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTC--GGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia fraxini Ex_Syringa_AB080436' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGT-GGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-CGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTC--GGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia fraxinicola Ex_Fraxinus_AB080383' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGT-GGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-CGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGCAGGAACGTAGCTCTTTTC--GGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia guttata Ex_Acer_AB080433' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGT-GGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-CGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTGGGAACGTAGCTCTCTTC--GGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia hamamelidis Ex_Hamamelis_AB080410' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTT-CGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia juglandis Ex_Juglans_AB080422' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-CGT-CGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACTGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia kakicola Ex_Diospyros_AB080381' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTT-CGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCATCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH3342' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTTTGGTCCGGCCTAAGTTCCGTGGAACCGGACGTCAGAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-CAACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCATCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCGCCTACCCCGACCGAGGACCGCGCTTTGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCCCTGCGAGTGTTTGGGTG-------------------------------------------- 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH3351' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-CAACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCATCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTAGGAACGTAGCTCCTTAC--GGGGAGTGTTATAGCCTGCGGCGCAATACCGCCTACCCCGACCGAGGACCGCGCTTTGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGAGAAACCCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH5750' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-CAACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCATCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTAGGAACGTAGCTCCTTAC--GGGGAGTGTTATAGCCTGCGGCGCAATACCGCCTACCCCGACCGAGGACCGCGCTTTGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGAGAAACCCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia leveilluloides Ex_Quercus_HAL2917F' AGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCACGCGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGTATCGTTGATCATCCAACG-TTCTCGT-TGGTGCACTCGGCGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCCGCGGCGCAATACTGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATGCGCGAAATGAAAGTGAACATAGGTGAGAACCC 'Phyllactinia magnoliae Ex_Magnolia_AB080416' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTT-CGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia moricola Ex_Morus_AB080372' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCAG-TGT-CGGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG---CTCTT-TGGTGCACTTGACGA-CGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC--GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTG-AAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia obclavata Ex_Spathodea_MUMH1748' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGCGGTCCGGTCTAAGTTCCTTGGAATAGGACGTCGTAGAGGGTGAGAACCCCGTGTGCGGCCGG-GAC-GCACGGCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCCGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGAGGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGATCGTAGGAATGTAGCTCCTTTC--GGGGAGTGTTATAGCCTACGGTGCAATACCGCCTACGCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCTATGCGAGTGTTTGGGTGCA-AAACCCATCCGCGCAATGAAAGTGAACGCAGGTGAGAACCC 'Phyllactinia obclavata Ex_Tabebuia_MUMH1876' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGATGTGCGGTCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAGCCCCGTGTGCGGCCGG-GAC-GCACGTCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCCGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGAGGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGATCGTAGGAATGTAGCTCCTTTC--GGGGAGTGTTATAGCCTACGGTGCAATACCGCCTACGCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCTATGCGAGTGTTTGGGTGCA-AAACCCATCCGCGCAATGAAAGTGAACGCAGGTGAGAACCC 'Phyllactinia paliuri Ex_Paliurus_AB080458' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TGT-CGGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAGACTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia pterostyracis Ex_Pterostyrax_AB080403' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TGT-CGGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCTAAAGACTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC--GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCC Phyllactinia_sp._Ex_Rhabdaclema_MUMH3723 AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GAC-GCACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCGGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTAGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATGTCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCC----------------------------------- 'Pleochaeta polychaeta Ex_Celtis_MUMH3086' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGAAGC-CTGTACCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTTGGGCGTTGGTGATCATCCTGAG-TTTTCTCATGGTGCACTCGGCGA-CGCACAGGCCAGCATCGGTTTGGGTGGTTGGAAAAAGGTCTTGGGAACGTAGCTCTTCTTCGGGGGAGTGTTATAGCCCGGGATGCAATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Pleochaeta shiraiana Ex_Celtis_MUMH1742' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTAGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-TGC-CTGTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTTGGTGATCATCCGGAG-TTTTCTC-TGGTGCACTCGGCAA-TGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTAGGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCCTGGGCGCAATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCC ; END; BEGIN TREES; TITLE Phyllactinia_lagerstroemiae_28S_36_taxa; LINK TAXA = Taxa3; TRANSLATE 1 'Phyllactinia kakicola Ex_Diospyros_AB080381', 2 'Phyllactinia hamamelidis Ex_Hamamelis_AB080410', 3 'Phyllactinia enkianthi Ex_Rhododendron_AB080408', 4 'Phyllactinia magnoliae Ex_Magnolia_AB080416', 5 'Phyllactinia alni Ex_Alnus_AB080411', 6 'Phyllactinia betulae Ex_Betula_AB080396', 7 'Phyllactinia paliuri Ex_Paliurus_AB080458', 8 'Phyllactinia juglandis Ex_Juglans_AB080422', 9 'Phyllactinia eupteleae Ex_Euptelea_AB080388', 10 'Phyllactinia pterostyracis Ex_Pterostyrax_AB080403', 11 'Phyllactinia broussonetiae-kaempferi Ex_Broussonetia_AB080382', 12 'Phyllactinia moricola Ex_Morus_AB080372', 13 'Phyllactinia fraxini Ex_Fraxinus_AB080451', 14 'Phyllactinia fraxini Ex_Syringa_AB080436', 15 'Phyllactinia guttata Ex_Acer_AB080433', 16 'Phyllactinia fraxinicola Ex_Fraxinus_AB080383', 17 'Leveillula taurica Ex_Artemisia_AB080470', 18 'Leveillula quilanensis Ex_Chondrilla_AB080478', 19 'Leveillula saxaouli Ex_Haloxylon_AB080469', 20 'Leveillula lanuginosa Ex_Daucus_AB042641', 21 'Leveillula cylindrospora Ex_Noaea_AB080468', 22 'Leveillula taurica Ex_Impatiens_AB080473', 23 'Phyllactinia angulata Ex_Quercus_MUMH928', 24 'Phyllactinia leveilluloides Ex_Quercus_HAL2917F', 25 'Phyllactinia adesmiae Ex_Adesmia_MUMH1938', 26 'Phyllactinia cassiae-fistulae Ex_Cassia_AB691227', 27 'Phyllactinia cassiae-fistulae Ex_Cassia_AB691228', 28 'Phyllactinia obclavata Ex_Tabebuia_MUMH1876', 29 'Phyllactinia obclavata Ex_Spathodea_MUMH1748', 30 Phyllactinia_sp._Ex_Rhabdaclema_MUMH3723, 31 'Phyllactinia chubutiana Ex_Lycium_AB243690', 32 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH3351', 33 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH5750', 34 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH3342', 35 'Pleochaeta shiraiana Ex_Celtis_MUMH1742', 36 'Pleochaeta polychaeta Ex_Celtis_MUMH3086'; TREE 'PAUP_12' = [&R] ((35:0.020408,36:0.022796):0.033925,((26:0.001802,27:0.0):0.037451,(((15:0.005492,16:0.001803,(13:0.0,14:0.0):0.001807):0.012556,((7:0.001956,(9:0.0018,10:0.0018,(11:0.002396,12:0.003707):0.004888):0.001667):0.018935,(8:0.003282,(6:0.0,(1:0.003603,2:0.0,3:0.001804,4:0.0,5:0.005465):0.001794):0.004044):0.01768):0.005587):0.008928,((34:0.018389,(32:0.0,33:0.0):0.004463):0.020394,(30:0.011713,((31:0.019985,(23:0.00711,24:0.005906):0.015104):0.010205,((28:0.004166,29:0.003282):0.036618,(17:0.002046,(21:0.003629,(18:0.003649,20:0.0,(22:0.001821,(19:0.001814,25:0.011636):0.001826):0.001805):0.0):0.003435):0.00771):0.004336):0.005707):0.008176):0.001051):0.001708):0.033925); END; BEGIN TREES; TITLE Phyllactinia_lagerstroemiae_ITS_31_taxa; LINK TAXA = Taxa2; TRANSLATE 1 'Phyllactinia pyri-serotinae Ex_Pyrus_AB080521', 2 'Phyllactinia actinidiae-latifoliae Ex_Actinidia_MUMH5514', 3 'Phyllactinia moricola Ex_Morus_MUMH79', 4 'Phyllactinia ampulliformis Ex_Discaria_AB080571', 5 'Phyllactinia fraxinicola Ex_Fraxinus_AB080493', 6 'Phyllactinia fraxinicola Ex_Fraxinus_AB080585', 7 'Phyllactinia enkianthi Ex_Rhododendron_AB080517', 8 'Phyllactinia juglandis Ex_Juglans__AB080531', 9 'Phyllactinia actinidiae Ex_Actinidia_AB080489', 10 'Phyllactinia salmonii Ex_Paulownia_AB080486', 11 'Phyllactinia sapii Ex_Sapium_AB080487', 12 'Phyllactinia fraxini Ex_Wisteria_AB080544', 13 'Phyllactinia fraxini Ex_Fraxinus_AB080551', 14 'Phyllactinia leveilluloides Ex_Quercus_HAL2917F', 15 'Phyllactinia chubutiana Ex_Lycium_AB243690', 16 'Phyllactinia caricicola Ex_Carica_MUMH3722', 17 'Phyllactinia obclavata Ex_Tabebuia_MUMH3725', 18 'Phyllactinia durantae Ex_Duranta_MUMH3726', 19 'Leveillula cylindrospora Ex_Noaea_AB044352', 20 'Leveillula saxaouli Ex_Haloxylon_AB044382', 21 'Leveillula picridis Ex_Artemisia_AB044384', 22 'Leveillula taurica Ex_Impatiens_AB045003', 23 'Leveillula guilanensis Ex_Chondrilla_AB045156', 24 'Leveillula duriaei Ex_Salvia_AB044373', 25 'Phyllactinia adesmiae Ex_Adesmia_MUMH1938', 26 'Phyllactinia bougainvilleae Ex_Bougainvillea_KC556804', 27 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH3351', 28 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH5750', 29 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_MUMH3342', 30 'Pleochaeta polychaeta Ex_Celtis_MUMH3086', 31 'Pleochaeta shiraiana Ex_Celtis_MUMH1742'; TREE 'PAUP_12' = [&R] ((30:0.439811,31:0.360191):0.095542,((29:0.112046,(27:0.0,28:0.0):0.06609):0.204791,(16:0.207093,((18:0.151593,((17:0.24768,26:0.132787):0.04846,(25:0.051465,(21:0.062408,(23:0.029768,((19:0.026171,20:0.022116):0.01187,(22:0.032847,24:0.011761):0.0):0.033477):0.00424):0.057733):0.041266):0.061918):0.045956,((14:0.177083,15:0.140229):0.067887,((6:0.01602,(5:0.016408,(12:0.0,13:0.0):0.016337):0.005323):0.077479,((2:0.100464,(3:0.085581,(1:0.169723,4:0.058149):0.005833):0.100046):0.023653,(9:0.005393,((7:0.00265,10:0.00874):0.005317,(8:0.009172,11:0.00943):0.009803):0.004817):0.080177):0.02196):0.045838):0.009559):0.01807):0.101711):0.095542); END; BEGIN TREES; TITLE 'Erysiphe eucalypticola ITS+28S 43 taxa'; LINK TAXA = Taxa1; TRANSLATE 1 'Erysiphe eucalypticola Ex_Eucalyptus_MUMH6673', 2 'Erysiphe eucalypticola Ex_Eucalyptus_MUMH5745', 3 'Erysiphe trifoliorum Ex_Trifolium_MUMH701', 4 'Erysiphe palczewskii Ex_Robinia_MUMHs111', 5 'Erysiphe russellii Ex_Xanthoxalis_MUMH2593', 6 'Erysiphe berberidicola Ex_Mahonia_MUMH575', 7 'Erysiphe cruciferarum Ex_Raphanus_MUMH289', 8 'Erysiphe astragali Ex_Astragalus_MUMH2585', 9 'Erysiphe friesii var. dahurica Ex_Rhamnus_MUMH4638', 10 'Erysiphe heraclei Ex_Osmorhiza_MUMH1874', 11 'Erysiphe buhrii Ex_Gypsophila_MUMH787', 12 'Erysiphe viciae-unijugae Ex_Vicia_MUMH817', 13 'Erysiphe phyllanthi Ex_Phyllanthus_MUMH99', 14 'Erysiphe ribicola Ex_Ribes_BCRU03850', 15 'Erysiphe myoschili Ex_Myoschilos_MUMH1875', 16 'Erysiphe monascogera Ex_Styrax_MUMH3786', 17 'Erysiphe schizandrae Ex_Schisandra_MUMH2582', 18 'Erysiphe akebiae Ex_Akebia_MUMH4649', 19 'Erysiphe alphitoides Ex_Quercus_MUMH2471', 20 'Erysiphe epigena Ex_Quercus_MUMH3795', 21 'Erysiphe quercicola Ex_Acacia_MUMH3241', 22 'Erysiphe syringae Ex_Syringa_TPU1549', 23 'Erysiphe liriodendri Ex_Liriodendron_MUMH4666', 24 'Erysiphe izuensis Ex_Rhododendron_MUMH4651', 25 'Erysiphe clethrae Ex_Clethra_MUMHs88', 26 'Erysiphe euphorbiae Ex_Chamaesyce_MUMH4646', 27 'Erysiphe aquilegiae Ex_Laurus_MUMH2559', 28 'Erysiphe symphoricarpi Ex_Symphoricarpos_MUMH974', 29 'Erysiphe lonicerae var. lonicerae Ex_Lonicera_MUMH2481', 30 'Erysiphe blasti Ex_Lindera_MUMH4379', 31 'Erysiphe huayinensis Ex_Isodon_MUMH2557', 32 'Erysiphe dieruillae Ex_Weigela_TPU1669', 33 'Erysiphe syringae-japonicae Ex_Syringa_MUMH1916', 34 'Erysiphe corylacearum Ex_Corylus_MUMH199', 35 'Erysiphe ornata var. ornata Ex_Betula_MUMH2560', 36 'Erysiphe ligustri Ex_Ligustrum_MUMH2244', 37 'Erysiphe corylopsis Ex_Corylopsis_MUMH4174', 38 'Erysiphe corylacearum Ex_Cornus_MUMH90', 39 'Erysiphe viburni-plicati Ex_Viburnum_MUMH794', 40 'Erysiphe abeliicola Ex_Abelia_MUMH4472', 41 'Erysiphe juglandis Ex_Juglans_MUMH278', 42 'Erysiphe glycines Ex_Desmodium_MUMH396', 43 'Erysiphe glycines Ex_Glycine_MUMH1462'; TREE 'PAUP_101' = [&R] ((42:0.009386,43:0.017768):0.031531,(41:0.03901,(40:0.015961,(34:0.004434,((33:8.08E-4,36:0.004544):0.003816,(37:0.034882,(35:0.013825,((38:0.028222,39:0.017882):0.003125,((31:0.03614,32:0.031484):0.004134,((28:0.006571,29:0.003768):0.011746,((30:0.010541,(26:0.0,27:8.74E-4):0.015555):0.006743,((24:0.016658,25:0.028324):0.006097,(20:0.009303,((1:0.0,2:0.0):0.012704,((18:8.76E-4,19:0.0):0.001759,(17:0.006323,(16:0.003693,21:0.013824):0.002595):8.45E-4):0.001801,(23:0.00832,(22:0.013336,(15:0.015607,(14:0.013031,((13:0.007302,(12:0.004463,(9:0.006508,(10:0.004209,11:0.008417):0.00529):0.001467):0.00115):8.25E-4,(8:0.004623,(7:0.008122,((3:0.005572,4:0.003849):0.004181,(5:0.005722,6:0.007633):7.53E-4):0.00101):0.002759):0.00232):0.003852):0.002744):0.007205):0.001758):9.43E-4):0.001724):0.004081):0.008385):0.0):0.004323):0.003497):0.001759):2.96E-4):0.003873):0.00273):0.003498):0.018298):0.031531); END;