#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 4:57 GMT TreeBASE (cc) 1994-2008 Study reference: Cruz R.H., Baseia I.G., & Hosaka K. 2016. Rediscovery of Cyathus badius, an ‘extinct’ species from the Bonin Islands, Japan. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S19947] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=22; TAXLABELS 'Crucibulum laeve RH-20151011-7 LSU' 'Cyathus africanus DAOM200370 LSU (DQ463330)' 'Cyathus annulatus DAOM200366 (DQ463332 LSU)' 'Cyathus badius (LSU)' 'Cyathus gansuensis (LSU)' 'Cyathus griseocarpus DAOM200396 LSU (DQ463324)' 'Cyathus guandishanensis (LSU)' 'Cyathus helenae DAOM200384 LSU (DQ463334)' 'Cyathus jiayuguanensis (LSU)' 'Cyathus lignilantanae (LSU)' 'Cyathus magnomuralis UFRN-Fungos1817 LSU' 'Cyathus olla f. anglicus BPI727225 (DQ463326) ' Cyathus_olla_f._lanatus 'Cyathus olla f. olla BPI727227 LSU (DQ463327)' 'Cyathus pallidus SWFC21160 LSU (DQ463336)' 'Cyathus parvocinereus (LSU)' 'Cyathus renweii SWFC21406 LSU (DQ463333)' 'Cyathus setosus DAOM200815 LSU (DQ463331)' 'Cyathus stercoreus (LSU)' 'Cyathus subglobisporus BBH18348 (EF613554)' 'Cystoderma amianthinum (LSU)' 'Nidula sp KH-JPN15-582 LSU' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=23; TAXLABELS Crucibulum_laeve Cyathus_africanus Cyathus_annulatus Cyathus_badius Cyathus_berkeleyanus Cyathus_colensoi Cyathus_crassimurus Cyathus_gansuensis Cyathus_hookeri Cyathus_hortensis Cyathus_jiayuguanensis Cyathus_lignilantanae Cyathus_magnomuralis Cyathus_olla Cyathus_olla_f._brodiensis Cyathus_pallidus Cyathus_parvocinereus Cyathus_renweii Cyathus_setosus Cyathus_stercoreus Cyathus_subglobisporus Cystoderma_amianthinum Nidula_sp ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=17; TAXLABELS 'Crucibulum laeve RH-20151011-7' Cyathus_africanus_DAOM200370 Cyathus_annulatus_DAOM200366 'Cyathus badius KH-JPN15-1321' Cyathus_gansuensis_strain69 Cyathus_jiayuguanensis_SWFC20846 'Cyathus lignilantanae MA-Fungi87327' 'Cyathus magnomuralis UFRN-Fungos1817' Cyathus_olla_f._olla_BPI727227 Cyathus_pallidus_SWFC21160 'Cyathus parvocinereus UFRN-Fungos1814' Cyathus_renweii_SWFC201406 Cyathus_setosus_DAOM200815 Cyathus_stercoreus_SWFC21386 Cyathus_subglobisporus_BBH18348 Cystoderma_amianthinum_HO124693 'Nidula sp KH-JPN15-582' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M38416] TITLE Cyathus_ITS_combined; LINK TAXA = Taxa2; DIMENSIONS NCHAR=816; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Crucibulum_laeve ?????????????????????????????CTGAT-TTGCTGTTG--CTGACTCT-GAG-GAGTA-TGTGCACGC--TT-----A-------TCATCT-TTA-TA---T----TTCCACCT---GTGCACCTTTTGTAGAC-TT-GGATTAT--AATATATA----TTTC-TCGAGGTAACACTCGGATAATGG-----GG-TTTGCA-G-TTGTGAAAACTTC---TGTT--C-TCCT-T----ATATATATTA-ATATCCA---GTCTATGTTAATT--AT-ATACACCATT-AGT--ATGTTTA---T-AGAATGT---TGTTATTAGGGTTTCAAAT--CCTTTTAATTAA--ATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-C--ACTT-CTTCTTTTAT-TAGTT-GAAGCT-GG-----A-TT-GGATGT-GGGGGTTT--GCCGGC-TT-ATTCTT-TT-ATTAGTCAGCTCTCCTT-AAATGCATTAGCA-G--AACCTT-ATGTTG-A-TCAGC----TATTG-GTGTGATAATTATCTACGCCATTGGTT-GTG-----AAG-CAAGCTATATAT-------------------GGGGTTCAGCTTCTAAAATTTA-TTATGTCTG-CAAGG-ACAAATTATA---TGAC---AA??????? Cyathus_africanus ?????????????????????????????CTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCCGA-C-G-GA-GG-GGTTCATTTTTTATTA-CCTTCTTTTCCACCT---GTGAACT-TTTGTAGATGTT-GAAG-ATCGCTTCTCAAG-CAATTCGTAAG-AATTGATT-GGT--TTGGA-----G-TTTGCGGGCGT-CATTAAGTTGA--TGTCGGCTTTCTCTGTTG--G--TCTT-------CA-C-GTCTAT-T---TTACAT-ATAC-TC-TT-ATTTCA-GTTTA------GAAGGAC-ATG--ATT-GGGCTTTT-AT-GCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ATTT-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGTGTT-GGATGT-GGGGGTT---GCGGGCTTTCATTTA-GTTGA--AGTCGGCTCTCCT-GAAATGCATTAGC--GGAAACCTTT--GTTGGA-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GCGCG--AAAG-CA--CTTGGG-TTCAATTTCGAAC----C--GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACATTTGACCTCAAATCAGGT Cyathus_annulatus ?????????????????????????????CTGACGCTGATG-----GTCAAA-----CATA----TGTGCTCGCCG--CCATGA-GA-GGTTCATTTTTTATTAACC--CTTTTCCACCT---GTGAACT-ATTGTAGATGTT-GGAG-ATCATTCCTC-AGGC--------AGCAAT-GCTT-GGT--TTGGA-----G-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGCTTTCTCTG----CGA-TCGA-------CAAT-GTCTAT-T----TACAT-ATAC-CC-TTGATTAAA-GTTAA-----AGAAGGAC-TTG--ATT-GGGCTTTC-AT-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTATC---TTT-ATTGA--T---AGTG------CGTGTT-GGATGT-GGGGGTT---GCGGGC-TTCATTCA-GTTGA--AGTCGGCTCCTCT-GAAATGCATTAGC--GGGAATCTTT--GTTGAA-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GTA-GTTC-GG-CA--CTTGGG-TTTGG---C-AACAAGCC--GGGATTCTGCTTCTAATCGTCCATTCACTTGGACAA--TACT--TTGACATTTGACCTCAAATCAGGT Cyathus_badius ????????????????AGAGTGG--AGG-TTGATGCTGATG-----GTCAAA-----CATA----TGTGCTCGCC--TC-------------CATTTTTTATATT-CACC-TTTCCACCT---GTGAACC-ATTGTAGATGTT-GAAG-GTCAATTCTCAAG-C--TTC-------ATTGCTT-GGT--TTGG-----CG-TTTGCGGGCTT-CATTCAGTTGAA--GTCATC--TCTC-GCTGTCGAA-CTT-------CAAT-GTCTAT-T----TACAT-ATAC-CC-TTGATAAAA-GTTAA---T--GAAGGAC-TTG--ATT-GGGCTTC--AC-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTA-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGCGTT-GGATGTGGGGGGTT---GCGGGC-TTCATTTA-GTTGA--GGTCGGCTCCTCT-GAAATGCATTAGC--GGGAATCTTT--GTTGTG-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCCTTAGGAA-GTG-GCT---GACA--CTAGGGCTT-GGT--CAATCA{AG}{CG}CC--GGGGTTCTGCTTCTAATGGTCCATTCACTTGGACAA--TACT?????????????????????????? Cyathus_berkeleyanus ?????????????????????????????TTGATGCTGGTGTTTCTCTTAACGGAGAGACA-TATTGTGCTC-ATCAACTG-AAGGGGGGTTCATTTTTTATTA---TA-TTTTCCACCT---GTGAACT-ATTGTAGATGTT-GGAG-ATCACCTCTCAAG-CAA---GTAA----TTGCTT-GGTC--TGGA---GAG-TTTGCGGGCTT-CATTAAGTTGAA--GTCGGC--TCTCT-CTGTCGA-TCTT-------CAAT-GTCTAT-T---TTACAT-ATAC-TCAAATA--AAA-GTT-A---T-AGAAGGAA-TTG--ATT-GGGCTT--AAT-GCCTATAAATCAAATATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTC--ATTT-C--ATTT-GT-TAATTC-AAGTG-AGATGCATGTT-GGATGT-GGGGGTT---GCGGGCATTCATT-AAGTTGA--AGTCGGCTCTCCT-GAAATATATTAGC-TGGG-ACCTTT--GTTGGA-CT-GCTTTCCATA--GTGTGATAATTATCTACGC-TTAGGA--G-GCTTTGAAGACA---TA----TT-GGTTTTTAATTAAACCAGAGGTTCTGCTTCTAATAGTCCATTGACTTGGACAA-TTA-TTA-TGACATTTGACCTCAAATCACGT Cyathus_colensoi ?????????????????????????????CTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCCGA-C-G-GA-GG-GGTTCATTTTTTATTA-CCTTCTTTTCCACCT---GTGAACT-TTTGTAGATGTT-GAAG-ATCGCCTCTCAAG-CAATTCGTAAG-AATTGATT-GGT--TTGGA-----G-TTTGCGGGCGT-CATTAAGTTGA--TGTCGGCTTTCTCTGTTG--G--TCTT-------CA-C-GTCTAT-T---TTACAT-ATAC-CC-TT-ATTTCA-GTTTA------GAAGGAC-ATG--ATT-GGGCTTTT-AT-GCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ATTT-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGTGTT-GGATGT-GGGGGTTT--GCGGGCTTTCATTCA-GTTGA-AAGTCGGCTCTCCT-GAAATGCATTAGC--GGAAACCTTT--GTTGGA-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GCGCG--AAAG-CA--CTTGGG-TTCAATTTCGAAC----C--GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACATT-GACCTCAAATCAGGT Cyathus_crassimurus ?????????????????????????????CTGACGCTGATG-----GTAAAA-----CATA----TGTGCTCGCCG--CCATGA-GGGGGTTCATTTTTTATTAACCTTCTTTTCCACCT---GTGCACT-CTTGTAGATATT-GAAGGGTCATCTCTC-AGGC--------AGCAAT-GCTT-GGT--TTGGA-----G-TTTGCGGGCTT-CATTTATTTGAA--ATCGGCTTTCTCTG-T--CGA-CCTTT------CA---GT--ATCTATTTTACAT-ATAC-CC-TTGAAATAA-GTT-A---T-AGAAGGAC-TTG--ATT-GGGC-TCTAAT-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTA-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGTGTT-GGATGT-GGGGGTTTT-GCGGGC-TTCATTCA-GTTGA--AGTCGGCTCTCCT-GAAATGCATTAGCGTG--AATCTTT--GTTGAA-CCCGCTT-CTATTAGGTGTGATAATTATCTACGCCTTTG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cyathus_gansuensis ?????????????????????????????TTGATGCTGGTGTTTCTCT-AACCGGGAGACA-TATTGTGCTCGCC-TGC--TGATGGGGGTTCATTTTTTGTTAA-CTTCTTTTCCACCT---GTGCACT-ATTGTAGTTGTT-GTTG-ATCGTCTCTCAAG-C---------GCAA--GCTT-GGTC--TGGA-----GTTTTGCGGGTTT-CATTAAGTTGAA--GTCGGCTTTCTCTGTT---GA-TCTT-------CA---G-C-ATCTAT-TTACAT-ATAC-TCGAT-AT--AA-GTTTA------GAAGGTC-TTG--AT-AGGGCTTT--AT-GCCTATAAATCAATTATACAACTTTTATTGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTC--ATTT-C--ATTT-GTTTA--TCAAAGTG-AAATGCATGTT-GGATGT-GGGGGTT---GCGGGCTTTCATTCAA-TTGA--AGTCGGCTCTCCT-GAAATGCATTAGC-TGG-AACCTTT--GTTGGA-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GT--GACAAAGACA---TTTCA-TACACTTGTGTAT-------GGGGTTCTGCTCCTAATCGTCCATTCACTTGGACAATTTACT--TTGACATTTGACCTCAAATCAGGT Cyathus_hookeri ?????????????????????????????CTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCCGA-C-G-GA-GG-GGTTCATTTTTTATTA-CCTTCTTTTCCACCT---GTGAACT-TTTGTAGATGTT-GAAG-ATCGCCTCTCAAG-CAATTCGTAAG-AATTGATT-GGT--TTGGA-----G-TTTGCGGGCGT-CATTAAGTTGA--TGTC{AC}GCTTTCTCTGTTG--G--TCTT-------CA-C-GTCTAT-T---TTACAT-ATAC-CC-TT-ATTTCA-GTTTA------GAAGGAC-ATG--ATT-GGGCTTTT-AT-GCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ATTT-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGTGTT-GGATGT-GGGGGTT---GCGGGCTTTCATTCA-GTTGA--AGTCGGCTCTCCT-GAAATGCATTAGC--GGAAACCTTT--GTTGGA-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GCGCG--AAAG-CA--CTTGGG-TTCAATTTTGAAC----C--GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACATTTGACCTCAAATCAGGT Cyathus_hortensis CATTATTGAATTAATA-GT-TGGTAGTG-CTGATGCTGGTG-----GTCAAA-----CACA----TGTGCTCGCTCTGCC---A--------C-TT-ATTATTA--C--C-TTTCCACCT---GTGAACT-ATTGTAGATGTT-GAAG-GTCACCTCTCAAG-C--TTC-------ATTGCTT-GGTC--TGG-----CG-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGC--TCTC-GCTG-CGAA-CTT-------CAAT-GTCTATCT---CTACAT-ATAC-CCATT-ATTAAAAGT--A--TC-AGAAGGAC-TTG--ATT-GGGCTTC--ATTGCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGC{GT}CCTTGCGCTCTTTGGTATTCCGAAGA{AG}CATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTA-C--ATTT-GTTTA-TTC-AAGTGTAAGTGCGTGTT-GGATGT-GGGGGTT---GCGGGC-TTCATTCA-GTTGA--AGTCGGCTCCCCT-GAAATGCATTAGCA-G-AAATCTTT--GTTGTG-CT-GCTT-CTATTGGGTGTGATAATTATCTACTCC-TAGGAA-GTG-GCT---GACA--CTA???????????????????????????????????????????????????????????????????????????????????????????? Cyathus_jiayuguanensis ?????????????????????????????CTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCCGA-C-G-GA-GG-GGTTCATTTTTTATTA-CCTTCTTTTCCACCT---GTGAACT-TTTGTAGATGTT-GAAG-ATCGCCTCTCAAG-CAATTCGTAAG-AATTGATT-GGT--TTGGA-----G-TTTGCGGGCGT-CATTAAGTTGA--TGTCGGCTTTCTCTGTTG--G--TCTT-------CA-C-GTCTAT-T---TTACAT-ATAC-CC-TT-ATTTCA-GTTTA------GAAGGAC-ATG--ATT-GGGCTTTT-AT-GCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ATTT-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGTGTT-GGATGT-GGGGGTTT--GCGGGCTTTTATTCA-GTTGA-AAGTCGGCTCTCCT-GAAATGCATTAGC--GGAAACCTTT--GTTGGA-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GCGCG--AAAG-CA--CTTGGG-TTCAATTTCGAAC----C--GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACATTTGACCTCAAATCAGGT Cyathus_lignilantanae ?????????????????????????????????????????????????????????CACA----TGTGCTCGCTCTGCC---A--------C-TT-ATTATTA--C--C-TTTCCACCT---GTGAACT-ATTGTAGATGTT-GAAG-GTCACCTCTCAAG-C--TTC-------ATTGCTT-GGTC--TGG-----GG-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGC--TCTC-GCTG-CGAA-CTT-------CAAT-GTCTATCT---TTACAT-AT{AT}C-CCCTT-ATTAAAAGT--A--TC-AGAAGGAC-TTG--ATT-GGGCTTC--ATTGCCTATAAATCAATTATACAACTTTCA--GCAACGGATTTTTTGGCTCTTGCATCGATGAAGAACGCAACGAAATGCGATAAGTAATGGGAATTGCAGAATTCAGTGAATCAT{CT}GAATCTTTGAACGCCCCCTGCGCTTTTTGGTATTCCGAAGAACATGCCTGGTTGAGTGTCCTTAAATTCTCCACCC--CCTA-C--CTTT-GTTTA-TTC-AAGTG-AAGTGCGTGTT-GGAAGGGGGGGG-T---GCGGGC-TTCCTTCA-GGTGA--AGTTGGCTCCCCT-GAAATGCCTTAGCA-G-AAATTTTT--GGTGGG-CT-GCTT-CTATTGGGTGTGATA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cyathus_magnomuralis ????????????????????????????GCTGATGCTGGTG-----GTCAAA-----CACA----TGTGCTCGCTCTGCC---A--------C-TT-ATTATTA--C--C-TTTCCACCT---GTGAACT-ATTGTAGATGTT-GAAG-GTCACCTCTCAAG-C--TTC-------ATTGCTT-GGTC--TGG-----CG-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGC--TCTC-GCTG-CGAA-CTT-------CAAT-GTCTATCT---CTACAT-ATAC-CCATT-ATTAAAAGT--A--TC-AGAAGGAC-TTG--ATT-GGGCTTC--ATTGCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--AC{CT}A-C--ATTT-GTTTA-TTC-AAGTG-AAGTGCGTGTT-GGATGT-GGGGGTT---GCGGGC-TTCATTCA-GTTGA--AGTCGGCTCCCCT-GAAATGCATTAGCA-G-AAATCTTT--GTTGTG-CT-GCTT-CTATTGGGTGTGATAATTATCTACTCC-TAGGAA-GTG-GCT---GACA--CTAGGACTT-GGT--CAAACAAGTC--GGGGTTTTGCTTCTAATAGTCCATTCACTTGGACAA--TACTTATTGACATTTGACCTCAAATCAGGT Cyathus_olla ??????????????????????????????TGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCCGA-C--GGA-GG-GGTTCATTTTTTATTA-CCTTCTTTTCCACCT---GTGAACT-TTTGTAGATGTT-GAAG-ATCGCCTCTCAAG-CAATTCGTAAG-AATTGATT-GGT--TTGGA-----G-TTTGCGGGCGT-CATTAAGTTGA--TGTCAGCTTTCTCTGTTG--G--TCTT-------CA-C-GTCTAT-T---TTACAT-ATAC-CC-TT-ATTTCA-GTTTA------GAAGGAC-ATG--ATT-GGGCTTTT-AT-GCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ATTT-C--ATTT-GTTTA--TC-AAGTG-AAGTGTGTGTT-GGATGT-GGGGGTT---GCGGGCTTTCATTCA-GTTGA--AGTCGGCTCTCCT-GAAATGCATTAGC--GGAAACCTTT--GTTGGA-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GCGCG--AAAG-CA--CTTGGG-TTCAATTTTGAAC----C--GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACATTTGACCTCAAATCAGGT Cyathus_olla_f._brodiensis ?????????????????????????????CTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCCGA-C-G-GA-GG-GGTTCATTTTTTATTA-CCTTCTTTTCCACCT---GTGAACT-TTTGTAGATGTT-GAAG-ATCGCCTCTCAAG-CAATTCGTAAG-AATTGATT-GGT--TTGGA-----G-TTTGCGGGCGT-CATTAAGTTGA--TGTCAGCTTTCTCTGTTG--G--TCTT-------CA-C-GTCTAT-T---TTACAT-ATAC-CC-TT-ATTTCA-GTTTA------GAAGGAC-ATG--ATT-GGGCTTTT-AT-GCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ATTT-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGTGTT-GGATGT-GGGGGTTT--GCGGGCTTTCATTCA-GTTGA-AAGTCGGCTCTCCT-GAAATGCATTAGC--GGAAACCTTT--GTTGGA-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GCGCG--AAAG-CA--CTTGGG-TTCAATTTCGAAC----C--GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACATT-GACCTCAAATCAGGT Cyathus_pallidus ?????????????????????????????TTGATGCTGGTGTTTCTCTC----GAGACACA----TGTGCTCGCC-AGC--TGATGGGGGTTCATTTTTTATTA--CTTT-TTTCCACCT---GTGCACT-ATTGTAGATGTT-GGAG-ATCGTATCTCAAG-C-----GTAA------GCTT-GGTC--TGGA-----G-TTTGCGGGCTT-CATTAAGTTGAA--GTCGGCATTCTCTGTT---GA-TCTT-------CA-C-GTCTAT-T--TTTACAT-ATAC-TC-TT-AAT-AA-GTTTA------GAAGGAC-TTG--ATT-GGGCTTTTAAT-GCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTC--ATTT-C--ATTT-GTTTA--TC-AAGTG-AAATGCATGTT-GGATGT-GGGGGTTT--GCGGGCATTCATT-AAGTTGA--AGTCGGCTCTCCT-GAAATACATTAGC--GGGAA-CTT-ATGTTGGA-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GT--G-TG-AGACAG--TAACA-TAC--TTTATTGTGTAT----GGGTTCTGCTTCTAATCGTCCATTCACTTGGACAA-TTACT-CTTGACATTTGACCTCAAATCAGGT Cyathus_parvocinereus CATTATTGAATTAATAAGAGTGG--AGG-TTGATGCTGATG-----GTCAAA-----CATA----TGTGCTCGCC--TC-------------CATT-TTTATATT-CACC-TTTCCACCT---GTGAACC-ATTGTAGATGTT-GAAG-GTCAATTCTCAAG-C--TTC-------ATTGCTT-GGT--TTGG-----CG-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGC--TCTC-GCTGTCGAA-CTT-------CAAT-GTCTAT-T----TACAT-ATAC-CC-TTGATAAAA-GTTAA---T--GAAGGTC-TTG--ATT-GGGCTTC--AC-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTA-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGCGTT-GGACGT-GGGGGTT---GCGGGC-TTCATTTA-GTTGA--GGTCGGCTCCTCT-GAAATGCATTAGC--GGGAATCTTT--GTTGTG-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GTG-GCT---GACA--CTAGGGCTT-GGT--CAAACAAGC---GGGGTTCTGCTTCTAATGGTCCATTCACTTGGACAA--TACT--TTGACATTTGACCTCAAATCA??? Cyathus_renweii ?????????????????????????????CTGACGCTGATG-----GTCAAA-----CATA----TGTGCTCGCCG--CCATGA-GG-GGTTCATTTTTTATTAACCTTT---TCCACCT---GTGAACT-ATTGTAGATGTT-GGAG-ATCATTCCTCAAG-C-----------AAT-GCTT-GGT--TTGGA-----G-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGCTTTCTCTG----CGA-TCGA-------CAAT-ATCTAT-T----TACATTATAC-CC-TTGATTAAA-GTAAA------GAAGGAC-TTG--ATT-GGGCTTTTAAT-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTATC---TTT-ATTGA--T---AGTG------CGCGTT-GGATGT-GGGGGTT---GCGGGC-TTCATTCA-GTTGA--AGTCGGCTCCTCT-GAAATACATTAGC--GGGAATCTTT--GTTGAA-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GTA-GCTC-AG-CA--CTTGGG-TTTGG---C-AACAAA-CC-GGGATTCTGCTTCTAATCGTCC-----CTTGGACAA-TTACT--TTGACATT-GACCTCAAATCAGGT Cyathus_setosus ?????????????????????????????CTGATGCTGATG-----GTAAAA-----CATA----TGTGCTCGCCG--CCATGA-GG-GGTTCATTTTTTATTATTCTTCTTTTCCACCT---GTGCACT-CTTGTAGATATT-GGAG-GTCATCTCTC-AGGC--------AGCAAT-GCTT-GGTG--TCGA-----G-TTTGCTGGCTT-CATTTATTTGAA--GTCGGCTTTCTCTG-T--CGA-CCTT-------CA---GT--ATCTATTTTACAT-ATAC-CC-TTGAAATAA-GTT-A---T-AGAAGGAC-TTG--ATT-GGGC-TCTAAT-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTA-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGTGTT-GGATGT-GGGGGTTTTTGCGGGCTTTCATTCA-GTTGA--AGTCGGCTCTCCT-GAAATGCATTAGCGTG--AATCTTT--GTTGAA-TC-GCTT-CTATTAGGTGTGATAATTATCTACGCCTTTGAAAAGGG-GTTC-AG-CA--CTTGGG-TTTGG---C-AACAAACCAAA-GGTTCTGCTTCTAA???????????????????????????????????????????????????? Cyathus_stercoreus ?????????????????????????????CTGATGCTGGTG-----GTCAAA-----CACA----TGTGCTCGCTCTGCC---A--------C-T{CT}-ATTAA----CA---TTTCCACCT---GTGAACT-ATTGTAGATGTT-GAAG-GTCACCTCTCAAG-C-TTTC---AGCAAT-GA-TATG-C-TTGGTCTGGCG-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGC--TCTC-GCTG-CGAA-CTT-------CAAC-ATCTATCC---TTACAT-ATAC-CCATTAACAAAAAGT-AA---CAAGAAGGAC-TTG--ATT-GGGCTTC--ATTGCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTT-C--ATTTTGTTTA-TTC-AAGTG-AAGTGCGTGTT-GGATGT-GGGGGTT---GCGGGC-TTCATTCA-GTTGA--AGTCGGCTCCCCT-GAAATGCATTAGCA-G-GAATCTTT--GTTGTG-CT-GCTT-CTATTGGGTGTGATAATTATCTACGC-TTAGGAA-GTG-GCT---GACA--CTAGGACTT-GGT--CAAACAAGTC--GGGGTTCCGCTTCTAATAGTCCATTCACTTGGACAA--TACTACTTGACATTTGACCTCAAATCAGGT Cyathus_subglobisporus ?????????????????????????????TTGATGCTGATG-----GTAAAA-----CATA----TGTGCTCGCCG--CCATGA-GG-GGTTCATTTTTTATTAACCTTC-TTTCCACCT---GTGCACT-TTTGTAGATGTT-GAAG-ATGATCTCTCAAG-C--------AGCAAT-GCTT-GGT--TTGGA-----G-TTTGCGGGCTT-CATTAAATTGAA--GTCGGCCTTCTCTGTT---GA-TCTT-------CAATTGTCTAT-T---TTACAT-ATAC-CC-TTGAATGAA-GTT-A---T-AGAAGGTG-TTG--ATTCGGGCTTT-AAT-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTT-T--ATTT-GTTTA--TC-AAGTA-GAGTGCGTGTT-GGATGT-GGGGGTT---GCGGGC-TTCATTCA-GTTGA--AGTCGGCTCCTCT-GAAAAGCATTAGC--GGGAATCTTT--GTTGGA-CC-GCTT-CTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GTA-GTTC-AG-CA--CTTGGG-TTTGG---C-AACAAACC--GGGGTTC????????????????????????????????????????????????????????????? Cystoderma_amianthinum CATTATTGAAT-AA-A-CT-TGGTAGAGGTTGTTGCTG--GTT---CTTAGG----AG-CAA----GTGCACGCC-TT------------TCCATCT-TCACT----TC----TCCACCT---GTGCACCTTTTGTAGTCTTTTGAAATTAGAGAGCAGTTACTCGGGGGAACTCGGATAGAGGATCTGCTGTGCGCAAGCCA-GC---TTTC------CTTGTATTGT---CTTT--------CAAT-TTTTAAAGGTCTAC--GTTT-TTC---AT--AT---ACCCC----AA---ATGT--ATGTTAAGAATGT-AATC---AATGGGCTTT--ATTGCCTATAAAACAA--ATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCTTGTTTGAGTGTCATTAAATTCTCAACCCTTTCAAA-GTTTTT-ATCAACTTTGAAGTAGGGCTTGGATTTGGG-TGTTGCCGGCTTTT-----CAAT------AGT----CGG----CTCTCCTTAAAA-GCATTAGCG-G--AA-CTTTTTGT--AAGCCGTCTAC--ATA--GTGTGATAATTATCTACGCTATTGATGT-TGCTT--ACG-CTAA-TATA-AT--AAGAGTTCAGCTT-CTAATAGTCCATCTACTTGGACAATAT-CAATATTCGTATTGA-TGACC---ATTTGACCTCAAATCAAGT Nidula_sp ????????????????????TGGTCGCG-CTGATGCTG--GCT---CTTCGG----GG-CA----TGTGCTCG---TGC----A-------CCATCT-TTAAT---CTC----TCCACCTTTTGTGCACCTTTTGTAGAC-TT-GGA-TACC---T-T-TCGAGCCAAA-TCTCGG-----TT--T-----GG-CCTCGG-TTTG-AGGATTG------CT-G---TGTTAACG-CCAGTCTTTC-----CTTACATTTCCAA--GTCTATGT---TTACAT---AC-CC-T--ATA--ATGAAAAACCT-AGAATGTCTATGT-----GGGCCTTT-GT-GCCTATAAA-GAAAAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-C--TCAAAAGCTTTC-AT-TAGCTCGA-G-A--G-GC----TT-GGATGT-GGGGGTT---GCAGGCTTT--TT---GTT-A--GGTCTGCTCCTCTT-AAATGCATTAGCGTG--AACCTTT--GTGGAA--CAGC----TATTG-GTGTGATAATTATCTACGCCTTTGGTTTGTG-----AAG-CA-G-T----GTTCA----GCTT-----CTAACGGTCCT???????????????????????????????????????????????????????????? ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M38418] TITLE 'Cyathus ITS-LSU combined'; LINK TAXA = Taxa3; DIMENSIONS NCHAR=1643; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Crucibulum laeve RH-20151011-7' ?????????????????????????????CTGAT-TTGCTGTTG--CTGACTCT-GAG-GAGTA-TGTGCACGC--TT-----A-------TCATCT-TTA-TA---T----TTCCACCT---GTGCACCTTTTGTAGAC-TT-GGATTAT--AATATATA----TTTC-TCGAGGTAACACTCGGATAATGG-----GG-TTTGCA-G-TTGTGAAAACTTC---TGTT--C-TCCT-T----ATATATATTA-ATATCCA---GTCTATGTTAATT--AT-ATACACCATT-AGT--ATGTTTA---T-AGAATGT---TGTTATTAGGGTTTCAAAT--CCTTTTAATTAA--ATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-C--ACTT-CTTCTTTTAT-TAGTT-GAAGCT-GG-----A-TTGGATGT-GGGGGTTT--GCCGGC-TT-ATTCTT-TT-ATTAGTCAGCTCTCCTTAAATGCATTAGCA-G--AACCTT-ATGTTG-A-TCAGC---TATTG-GTGTGATAATTATCTACGCCATTGGTT-GTG-----AAG-CAAGCTATATAT-------------------GGGGTTCAGCTTCTAAAATTTA-TTATGTCTG-CAAGG-ACAAATTATA---TGAC---AA????????????????????????????????????AATCTGG-TAGTCT-TATGGCTGCCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAAAGGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGGCTTTGTGGTACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTTAGTCACGTTGGCT-GGAAATCAACC---CT-TT-----GGGTGTACTTTCT-AGTTGACGGGTCAGCATCAATTTTAA---TTGTTGGATAAAGGCTT--AGGGAATGTGGCATCTTCGGATGTGTTATAGCCCT-GAGTT-GTATACAACAGTTGGGATTGAGGAACTCAGCACGCCGA--------------------------AAGGCCGGGTATTTTTA-CCACGTTCGTGCTTAGGATGCTGGCATAATAGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACCCGGATGCGTAATGAAAGTGAAAGTTGAGAACCCTGTCGTGGGGTGCATCGACGCCCGGACTTGATGTTTACTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cyathus_africanus_DAOM200370 ?????????????????????????????CTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCCGA-C-G-GA-GG-GGTTCATTTTTTATTA-CCTTCTTTTCCACCT---GTGAACT-TTTGTAGATGTT-GAAG-ATCGCTTCTCAAG-CAATTCGTAAG-AATTGATT-GGT--TTGGA-----G-TTTGCGGGCGT-CATTAAGTTGA--TGTCGGCTTTCTCTGTTG--G--TCTT-------CA-C-GTCTAT-T---TTACAT-ATAC-TC-TT-ATTTCA-GTTTA------GAAGGAC-ATG--ATT-GGGCTTTT-AT-GCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ATTT-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGTGTTGGATGT-GGGGGTT---GCGGGCTTTCATTTA-GTTGA--AGTCGGCTCTCCTGAAATGCATTAGC--GGAAACCTTT--GTTGGA-CC-GCTTCTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GCGCG--AAAG-CA--CTTGGG-TTCAATTTCGAAC----C--GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACATTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAGAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGT--------------------------AAGGTTGGGTCTTCGGA-CTACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cyathus_annulatus_DAOM200366 ?????????????????????????????CTGACGCTGATG-----GTCAAA-----CATA----TGTGCTCGCCG--CCATGA-GA-GGTTCATTTTTTATTAACC--CTTTTCCACCT---GTGAACT-ATTGTAGATGTT-GGAG-ATCATTCCTC-AGGC--------AGCAAT-GCTT-GGT--TTGGA-----G-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGCTTTCTCTG----CGA-TCGA-------CAAT-GTCTAT-T----TACAT-ATAC-CC-TTGATTAAA-GTTAA-----AGAAGGAC-TTG--ATT-GGGCTTTC-AT-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTATC---TTT-ATTGA--T---AGTG------CGTGTTGGATGT-GGGGGTT---GCGGGC-TTCATTCA-GTTGA--AGTCGGCTCCTCTGAAATGCATTAGC--GGGAATCTTT--GTTGAA-CC-GCTTCTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GTA-GTTC-GG-CA--CTTGGG-TTTGG---C-AACAAGCC--GGGATTCTGCTTCTAATCGTCCATTCACTTGGACAA--TACT--TTGACATTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-?-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAGAAAGGCTT--AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGT--------------------------AAGGTTGGGTC-TCTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGTAAACTCGAGCGCACAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus badius KH-JPN15-1321' ????????????????AGAGTGG--AGG-TTGATGCTGATG-----GTCAAA-----CATA----TGTGCTCGCC--TC-------------CATTTTTTATATT-CACC-TTTCCACCT---GTGAACC-ATTGTAGATGTT-GAAG-GTCAATTCTCAAG-C--TTC-------ATTGCTT-GGT--TTGG-----CG-TTTGCGGGCTT-CATTCAGTTGAA--GTCATC--TCTC-GCTGTCGAA-CTT-------CAAT-GTCTAT-T----TACAT-ATAC-CC-TTGATAAAA-GTTAA---T--GAAGGAC-TTG--ATT-GGGCTTC--AC-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTA-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGCGTTGGATGTGGGGGGTT---GCGGGC-TTCATTTA-GTTGA--GGTCGGCTCCTCTGAAATGCATTAGC--GGGAATCTTT--GTTGTG-CC-GCTTCTATTGGGTGTGATAATTATCTACGCCTTAGGAA-GTG-GCT---GACA--CTAGGGCTT-GGT--CAATCA{AG}{CG}CC--GGGGTTCTGCTTCTAATGGTCCATTCACTTGGACAA--TACT???????????????????????????????????????????????????????AATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTGCTTTTTTGCTGGGCGTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGATCT--AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCT-GGGTT-GTATACAGTGATTGGGATTGAGGAACGCAGCACGCCGC--------------------------AAGGTTGGGT-TTC-GA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cyathus_gansuensis_strain69 ?????????????????????????????TTGATGCTGGTGTTTCTCT-AACCGGGAGACA-TATTGTGCTCGCC-TGC--TGATGGGGGTTCATTTTTTGTTAA-CTTCTTTTCCACCT---GTGCACT-ATTGTAGTTGTT-GTTG-ATCGTCTCTCAAG-C---------GCAA--GCTT-GGTC--TGGA-----GTTTTGCGGGTTT-CATTAAGTTGAA--GTCGGCTTTCTCTGTT---GA-TCTT-------CA---G-C-ATCTAT-TTACAT-ATAC-TCGAT-AT--AA-GTTTA------GAAGGTC-TTG--AT-AGGGCTTT--AT-GCCTATAAATCAATTATACAACTTTTATTGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTC--ATTT-C--ATTT-GTTTA--TCAAAGTG-AAATGCATGTTGGATGT-GGGGGTT---GCGGGCTTTCATTCAA-TTGA--AGTCGGCTCTCCTGAAATGCATTAGC-TGG-AACCTTT--GTTGGA-CC-GCTTCTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GT--GACAAAGACA---TTTCA-TACACTTGTGTAT-------GGGGTTCTGCTCCTAATCGTCCATTCACTTGGACAATTTACT--TTGACATTTGACCTCAAATCAGGT????????????????????????????????????????????????????????????????????????????????????GTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGTGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGAT-GCGAACAAGTACCGTGAGGGAAAGATGAATAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCT-GGGAATCAACCTTACTCTTTTGTAGGGCTTATGTTCT-AGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAGGGCCT--AGGGAATGTGGCACCTTCGGGTGTGTTATAG-CCTTGGG-TCGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGTGTCGGCTCTCCTGAAATGCATTAGCTAAGGTTGGGT-TTC-GA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGTGTGGTAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCAGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cyathus_jiayuguanensis_SWFC20846 ?????????????????????????????CTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCCGA-C-G-GA-GG-GGTTCATTTTTTATTA-CCTTCTTTTCCACCT---GTGAACT-TTTGTAGATGTT-GAAG-ATCGCCTCTCAAG-CAATTCGTAAG-AATTGATT-GGT--TTGGA-----G-TTTGCGGGCGT-CATTAAGTTGA--TGTCGGCTTTCTCTGTTG--G--TCTT-------CA-C-GTCTAT-T---TTACAT-ATAC-CC-TT-ATTTCA-GTTTA------GAAGGAC-ATG--ATT-GGGCTTTT-AT-GCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ATTT-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGTGTTGGATGT-GGGGGTTT--GCGGGCTTTTATTCA-GTTGA-AAGTCGGCTCTCCTGAAATGCATTAGC--GGAAACCTTT--GTTGGA-CC-GCTTCTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GCGCG--AAAG-CA--CTTGGG-TTCAATTTCGAAC----C--GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACATTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGA--------------------------AAGGTTGGGTCTTTTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus lignilantanae MA-Fungi87327' ?????????????????????????????????????????????????????????CACA----TGTGCTCGCTCTGCC---A--------C-TT-ATTATTA--C--C-TTTCCACCT---GTGAACT-ATTGTAGATGTT-GAAG-GTCACCTCTCAAG-C--TTC-------ATTGCTT-GGTC--TGG-----GG-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGC--TCTC-GCTG-CGAA-CTT-------CAAT-GTCTATCT---TTACAT-AT{AT}C-CCCTT-ATTAAAAGT--A--TC-AGAAGGAC-TTG--ATT-GGGCTTC--ATTGCCTATAAATCAATTATACAACTTTCA--GCAACGGATTTTTTGGCTCTTGCATCGATGAAGAACGCAACGAAATGCGATAAGTAATGGGAATTGCAGAATTCAGTGAATCAT{CT}GAATCTTTGAACGCCCCCTGCGCTTTTTGGTATTCCGAAGAACATGCCTGGTTGAGTGTCCTTAAATTCTCCACCC--CCTA-C--CTTT-GTTTA-TTC-AAGTG-AAGTGCGTGTTGGAAGGGGGGGG-T---GCGGGC-TTCCTTCA-GGTGA--AGTTGGCTCCCCTGAAATGCCTTAGCA-G-AAATTTTT--GGTGGG-CT-GCTTCTATTGGGTGTGATA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TCTGG-TGGTCC-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTGCTCTTTTGCAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGACCATTGGAG---AAAGGC-TC-AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCT-GGGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGC--------------------------AAGGTTGGGT-TTC-GA-CCACACCCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus magnomuralis UFRN-Fungos1817' ????????????????????????????GCTGATGCTGGTG-----GTCAAA-----CACA----TGTGCTCGCTCTGCC---A--------C-TT-ATTATTA--C--C-TTTCCACCT---GTGAACT-ATTGTAGATGTT-GAAG-GTCACCTCTCAAG-C--TTC-------ATTGCTT-GGTC--TGG-----CG-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGC--TCTC-GCTG-CGAA-CTT-------CAAT-GTCTATCT---CTACAT-ATAC-CCATT-ATTAAAAGT--A--TC-AGAAGGAC-TTG--ATT-GGGCTTC--ATTGCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--AC{CT}A-C--ATTT-GTTTA-TTC-AAGTG-AAGTGCGTGTTGGATGT-GGGGGTT---GCGGGC-TTCATTCA-GTTGA--AGTCGGCTCCCCTGAAATGCATTAGCA-G-AAATCTTT--GTTGTG-CT-GCTTCTATTGGGTGTGATAATTATCTACTCC-TAGGAA-GTG-GCT---GACA--CTAGGACTT-GGT--CAAACAAGTC--GGGGTTTTGCTTCTAATAGTCCATTCACTTGGACAA--TACTTATTGACATTTGACCTCAAATCAGGT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTGCTCTTTTGCAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGACCATTGGAG---AAAGGC-TC-AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCT-GGGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGC--------------------------AAGGTTGGGT-TTC-GA-CCACACCCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT?????????????????????? Cyathus_olla_f._olla_BPI727227 ??????????????????????????????TGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCCGA-C--GGA-GG-GGTTCATTTTTTATTA-CCTTCTTTTCCACCT---GTGAACT-TTTGTAGATGTT-GAAG-ATCGCCTCTCAAG-CAATTCGTAAG-AATTGATT-GGT--TTGGA-----G-TTTGCGGGCGT-CATTAAGTTGA--TGTCAGCTTTCTCTGTTG--G--TCTT-------CA-C-GTCTAT-T---TTACAT-ATAC-CC-TT-ATTTCA-GTTTA------GAAGGAC-ATG--ATT-GGGCTTTT-AT-GCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ATTT-C--ATTT-GTTTA--TC-AAGTG-AAGTGTGTGTTGGATGT-GGGGGTT---GCGGGCTTTCATTCA-GTTGA--AGTCGGCTCTCCTGAAATGCATTAGC--GGAAACCTTT--GTTGGA-CC-GCTTCTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GCGCG--AAAG-CA--CTTGGG-TTCAATTTTGAAC----C--GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACATTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGA--------------------------AAGGTTGGGTCTTTTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cyathus_pallidus_SWFC21160 ?????????????????????????????TTGATGCTGGTGTTTCTCTC----GAGACACA----TGTGCTCGCC-AGC--TGATGGGGGTTCATTTTTTATTA--CTTT-TTTCCACCT---GTGCACT-ATTGTAGATGTT-GGAG-ATCGTATCTCAAG-C-----GTAA------GCTT-GGTC--TGGA-----G-TTTGCGGGCTT-CATTAAGTTGAA--GTCGGCATTCTCTGTT---GA-TCTT-------CA-C-GTCTAT-T--TTTACAT-ATAC-TC-TT-AAT-AA-GTTTA------GAAGGAC-TTG--ATT-GGGCTTTTAAT-GCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTC--ATTT-C--ATTT-GTTTA--TC-AAGTG-AAATGCATGTTGGATGT-GGGGGTTT--GCGGGCATTCATT-AAGTTGA--AGTCGGCTCTCCTGAAATACATTAGC--GGGAA-CTT-ATGTTGGA-CC-GCTTCTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GT--G-TG-AGACAG--TAACA-TAC--TTTATTGTGTAT----GGGTTCTGCTTCTAATCGTCCATTCACTTGGACAA-TTACT-CTTGACATTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTACTTTCT-AGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAGGGCCT--AGGGAATGTGGCACCTTCGGGTGTGTTATAG-CCTT-GGGTCGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGA--------------------------AAGGTTGGGTC-TTTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus parvocinereus UFRN-Fungos1814' CATTATTGAATTAATAAGAGTGG--AGG-TTGATGCTGATG-----GTCAAA-----CATA----TGTGCTCGCC--TC-------------CATT-TTTATATT-CACC-TTTCCACCT---GTGAACC-ATTGTAGATGTT-GAAG-GTCAATTCTCAAG-C--TTC-------ATTGCTT-GGT--TTGG-----CG-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGC--TCTC-GCTGTCGAA-CTT-------CAAT-GTCTAT-T----TACAT-ATAC-CC-TTGATAAAA-GTTAA---T--GAAGGTC-TTG--ATT-GGGCTTC--AC-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTA-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGCGTTGGACGT-GGGGGTT---GCGGGC-TTCATTTA-GTTGA--GGTCGGCTCCTCTGAAATGCATTAGC--GGGAATCTTT--GTTGTG-CC-GCTTCTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GTG-GCT---GACA--CTAGGGCTT-GGT--CAAACAAGC---GGGGTTCTGCTTCTAATGGTCCATTCACTTGGACAA--TACT--TTGACATTTGACCTCAAATCA??????????????????????????????????TCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTGCT-TTTTGCAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCCT--AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCT-GGGTT-GTATACAGTGATTGGGATTGAGGAACGCAGCACGCCGC--------------------------AAGGTTGGGT-TTC-GA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cyathus_renweii_SWFC201406 ?????????????????????????????CTGACGCTGATG-----GTCAAA-----CATA----TGTGCTCGCCG--CCATGA-GG-GGTTCATTTTTTATTAACCTTT---TCCACCT---GTGAACT-ATTGTAGATGTT-GGAG-ATCATTCCTCAAG-C-----------AAT-GCTT-GGT--TTGGA-----G-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGCTTTCTCTG----CGA-TCGA-------CAAT-ATCTAT-T----TACATTATAC-CC-TTGATTAAA-GTAAA------GAAGGAC-TTG--ATT-GGGCTTTTAAT-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTATC---TTT-ATTGA--T---AGTG------CGCGTTGGATGT-GGGGGTT---GCGGGC-TTCATTCA-GTTGA--AGTCGGCTCCTCTGAAATACATTAGC--GGGAATCTTT--GTTGAA-CC-GCTTCTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GTA-GCTC-AG-CA--CTTGGG-TTTGG---C-AACAAA-CC-GGGATTCTGCTTCTAATCGTCC-----CTTGGACAA-TTACT--TTGACATT-GACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-?-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAGAAAGGCTT--AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGT--------------------------AAGGTTGGGTC-TCTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGTAAACTCGAGCGCACAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cyathus_setosus_DAOM200815 ?????????????????????????????CTGATGCTGATG-----GTAAAA-----CATA----TGTGCTCGCCG--CCATGA-GG-GGTTCATTTTTTATTATTCTTCTTTTCCACCT---GTGCACT-CTTGTAGATATT-GGAG-GTCATCTCTC-AGGC--------AGCAAT-GCTT-GGTG--TCGA-----G-TTTGCTGGCTT-CATTTATTTGAA--GTCGGCTTTCTCTG-T--CGA-CCTT-------CA---GT--ATCTATTTTACAT-ATAC-CC-TTGAAATAA-GTT-A---T-AGAAGGAC-TTG--ATT-GGGC-TCTAAT-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTA-C--ATTT-GTTTA--TC-AAGTG-AAGTGCGTGTTGGATGT-GGGGGTTTTTGCGGGCTTTCATTCA-GTTGA--AGTCGGCTCTCCTGAAATGCATTAGCGTG--AATCTTT--GTTGAA-TC-GCTTCTATTAGGTGTGATAATTATCTACGCCTTTGAAAAGGG-GTTC-AG-CA--CTTGGG-TTTGG---C-AACAAACCAAA-GGTTCTGCTTCTAA????????????????????????????????????????????????????CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTA-GG-TCGTATACAGTGATTGGGATTGAGGAACGCAGCACGCCGA--------------------------AAGGTTGGGT-TTC-GA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCATAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cyathus_stercoreus_SWFC21386 ?????????????????????????????CTGATGCTGGTG-----GTCAAA-----CACA----TGTGCTCGCTCTGCC---A--------C-T{CT}-ATTAA----CA---TTTCCACCT---GTGAACT-ATTGTAGATGTT-GAAG-GTCACCTCTCAAG-C-TTTC---AGCAAT-GA-TATG-C-TTGGTCTGGCG-TTTGCGGGCTT-CATTCAGTTGAA--GTCGGC--TCTC-GCTG-CGAA-CTT-------CAAC-ATCTATCC---TTACAT-ATAC-CCATTAACAAAAAGT-AA---CAAGAAGGAC-TTG--ATT-GGGCTTC--ATTGCCTATAAATCAATTATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTT-C--ATTTTGTTTA-TTC-AAGTG-AAGTGCGTGTTGGATGT-GGGGGTT---GCGGGC-TTCATTCA-GTTGA--AGTCGGCTCCCCTGAAATGCATTAGCA-G-GAATCTTT--GTTGTG-CT-GCTTCTATTGGGTGTGATAATTATCTACGC-TTAGGAA-GTG-GCT---GACA--CTAGGACTT-GGT--CAAACAAGTC--GGGGTTCCGCTTCTAATAGTCCATTCACTTGGACAA--TACTACTTGACATTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGCCT-T-CAGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTGCTCTTTTGCAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGACCATTGGAG---AAAGGCTT--GGGGAATGTGGCACCTTCGGGTGTGTTATAGACCCA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGC--------------------------AAGGTAGGGT-TTC-GA-CCACACCCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cyathus_subglobisporus_BBH18348 ?????????????????????????????TTGATGCTGATG-----GTAAAA-----CATA----TGTGCTCGCCG--CCATGA-GG-GGTTCATTTTTTATTAACCTTC-TTTCCACCT---GTGCACT-TTTGTAGATGTT-GAAG-ATGATCTCTCAAG-C--------AGCAAT-GCTT-GGT--TTGGA-----G-TTTGCGGGCTT-CATTAAATTGAA--GTCGGCCTTCTCTGTT---GA-TCTT-------CAATTGTCTAT-T---TTACAT-ATAC-CC-TTGAATGAA-GTT-A---T-AGAAGGTG-TTG--ATTCGGGCTTT-AAT-GCCTATAAATCAATAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCC--ACTT-T--ATTT-GTTTA--TC-AAGTA-GAGTGCGTGTTGGATGT-GGGGGTT---GCGGGC-TTCATTCA-GTTGA--AGTCGGCTCCTCTGAAAAGCATTAGC--GGGAATCTTT--GTTGGA-CC-GCTTCTATTGGGTGTGATAATTATCTACGCC-TAGGAA-GTA-GTTC-AG-CA--CTTGGG-TTTGG---C-AACAAACC--GGGGTTC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAAGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCT-GGG-TCGTATACAGTGATTGGGATTGAGGAACGCAGCACGCCGT--------------------------AAGGTTGGGT-TTC-GA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCATAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cystoderma_amianthinum_HO124693 CATTATTGAAT-AA-A-CT-TGGTAGAGGTTGTTGCTG--GTT---CTTAGG----AG-CAA----GTGCACGCC-TT------------TCCATCT-TCACT----TC----TCCACCT---GTGCACCTTTTGTAGTCTTTTGAAATTAGAGAGCAGTTACTCGGGGGAACTCGGATAGAGGATCTGCTGTGCGCAAGCCA-GC---TTTC------CTTGTATTGT---CTTT--------CAAT-TTTTAAAGGTCTAC--GTTT-TTC---AT--AT---ACCCC----AA---ATGT--ATGTTAAGAATGT-AATC---AATGGGCTTT--ATTGCCTATAAAACAA--ATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCTTGTTTGAGTGTCATTAAATTCTCAACCCTTTCAAA-GTTTTT-ATCAACTTTGAAGTAGGGCTTGGATTTGGGTGTTGCCGGCTTTT-----CAAT------AGT----CGG----CTCTCCTTAAAAGCATTAGCG-G--AA-CTTTTTGT--AAGCCGTCTAC-ATA--GTGTGATAATTATCTACGCTATTGATGT-TGCTT--ACG-CTAA-TATA-AT--AAGAGTTCAGCTT-CTAATAGTCCATCTACTTGGACAATAT-CAATATTCGTATTGA-TGACC---ATTTGACCTCAAATCAAGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGA-TAGTCC-TA-GGCTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGACCAGGGA-TCAACCTTGCTCTT--GCTGGGTGTACTTTCT-GGTTAACGGGTCAACATCAATTTTGA---TTGTTGGAAAAAGA--TCAAGGGAATGTAGCATCTTCGGATGTGTTATAG-CCTTTGGTT-GTATACAACAGTTGGGATTGAGGAACTCAGCACGCCGA--------------------------AAGGCCGGGT-TTTTAA-CCACGTTCGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCGGGGAGCATCGACGCCCGGACCAGAAATTTATGGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Nidula sp KH-JPN15-582' ????????????????????TGGTCGCG-CTGATGCTG--GCT---CTTCGG----GG-CA----TGTGCTCG---TGC----A-------CCATCT-TTAAT---CTC----TCCACCTTTTGTGCACCTTTTGTAGAC-TT-GGA-TACC---T-T-TCGAGCCAAA-TCTCGG-----TT--T-----GG-CCTCGG-TTTG-AGGATTG------CT-G---TGTTAACG-CCAGTCTTTC-----CTTACATTTCCAA--GTCTATGT---TTACAT---AC-CC-T--ATA--ATGAAAAACCT-AGAATGTCTATGT-----GGGCCTTT-GT-GCCTATAAA-GAAAAATACAACTTTCA--GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTATCAAC-C--TCAAAAGCTTTC-AT-TAGCTCGA-G-A--G-GC----TTGGATGT-GGGGGTT---GCAGGCTTT--TT---GTT-A--GGTCTGCTCCTCTTAAATGCATTAGCGTG--AACCTTT--GTGGAA--CAGC---TATTG-GTGTGATAATTATCTACGCCTTTGGTTTGTG-----AAG-CA-G-T----GTTCA----GCTT-----CTAACGGTCCT???????????????????????????????????????????????????????????????????????????AAGCTCAAATTTAAAATCTGGCT-GTCTATATGGCAGTCCGAGTTGTAATCTAGAGAAGTGCTACCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGGCTATGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGCTGGCCAGGGA-TCAACCTCGCTCTTTTGTGAGGCGCACTTTCT-GGTCGGTGGGTCAGCATCAGTTTTGG---TTGCTGGATAAAGGCCTT--GGGAATGTGGCATCTTCGGATGTGTTATAGCCCTT-GGTT-GGATACAGTGGCTGGGATTGAGGAACTCAGCACGCCGC--------------------------AAGGCCGGG-CTTTT-AGCCACGTACGTGCTTGGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACCCGAGTGCGCAATGAAAGTGAAAGTTGAGATCCCTGTCGTGGGGAGCATCGACGCCCGGACCTGAGGCTTGCTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M38417] TITLE Cyathus_LSU_combined; LINK TAXA = Taxa1; DIMENSIONS NCHAR=830; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] 'Crucibulum laeve RH-20151011-7 LSU' ?????????????????????????????AATCTGG-TAGTCT-TATGGCTGCCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAAAGGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGGCTTTGTGGTACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTTAGTCACGTTGGCT-GGAAATCAACC---CT-TT-----GGGTGTACTTTCT-AGTTGACGGGTCAGCATCAATTTTAA---TTGTTGGATAAAGGCTT--AGGGAATGTGGCATCTTCGGATGTGTTATAGCCCT-GAGTT-GTATACAACAGTTGGGATTGAGGAACTCAGCACGCCGA--------------------------AAGGCCGGGTATTTTTA-CCACGTTCGTGCTTAGGATGCTGGCATAATAGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACCCGGATGCGTAATGAAAGTGAAAGTTGAGAACCCTGTCGTGGGGTGCATCGACGCCCGGACTTGATGTTTACTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus africanus DAOM200370 LSU (DQ463330)' CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAGAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGT--------------------------AAGGTTGGGTCTTCGGA-CTACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus annulatus DAOM200366 (DQ463332 LSU)' CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-?-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAGAAAGGCTT--AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGT--------------------------AAGGTTGGGTC-TCTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGTAAACTCGAGCGCACAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus badius (LSU)' ?????????????????????????????AATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTGCTTTTTTGCTGGGCGTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGATCT--AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCT-GGGTT-GTATACAGTGATTGGGATTGAGGAACGCAGCACGCCGC--------------------------AAGGTTGGGT-TTC-GA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus gansuensis (LSU)' ????????????????????????????????????????????????????????????????????????????????????GTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGTGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGAT-GCGAACAAGTACCGTGAGGGAAAGATGAATAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCT-GGGAATCAACCTTACTCTTTTGTAGGGCTTATGTTCT-AGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAGGGCCT--AGGGAATGTGGCACCTTCGGGTGTGTTATAG-CCTTGGG-TCGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGTGTCGGCTCTCCTGAAATGCATTAGCTAAGGTTGGGT-TTC-GA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGTGTGGTAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCAGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus griseocarpus DAOM200396 LSU (DQ463324)' ???????????????????????ATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGA--------------------------AAGGTTGGGTCTTTTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus guandishanensis (LSU)' CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGA--------------------------AAGGTTGGGTCTTTTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus helenae DAOM200384 LSU (DQ463334)' CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-C-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAGAAAGGCTT--AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGT--------------------------AAGGTTGGGTC-TCTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGTAAACTCGAGCGCACAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus jiayuguanensis (LSU)' CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGA--------------------------AAGGTTGGGTCTTTTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus lignilantanae (LSU)' ???????????????????????????????TCTGG-TGGTCC-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTGCTCTTTTGCAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGACCATTGGAG---AAAGGC-TC-AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCT-GGGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGC--------------------------AAGGTTGGGT-TTC-GA-CCACACCCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus magnomuralis UFRN-Fungos1817 LSU' ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTGCTCTTTTGCAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGACCATTGGAG---AAAGGC-TC-AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCT-GGGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGC--------------------------AAGGTTGGGT-TTC-GA-CCACACCCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAAT?????????????????????? 'Cyathus olla f. anglicus BPI727225 (DQ463326) ' CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGA--------------------------AAGGTTGGGTCTTTTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cyathus_olla_f._lanatus CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAAGAA-TCAACCTTACTCTTTTGTGGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAGTTTTGA---TTGCTGG-AAAAGGTCTCAAGG-AATGTGGCACCTTCGGGTGTGTTATAG-CCTTGGG-TCATATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGT--------------------------AAGGTTGGGT-TTC-GA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATTTCTGTCATGGAAAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus olla f. olla BPI727227 LSU (DQ463327)' CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGA--------------------------AAGGTTGGGTCTTTTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus pallidus SWFC21160 LSU (DQ463336)' CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTACTTTCT-AGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAGGGCCT--AGGGAATGTGGCACCTTCGGGTGTGTTATAG-CCTT-GGGTCGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGA--------------------------AAGGTTGGGTC-TTTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus parvocinereus (LSU)' ???????????????????????????????TCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTGCT-TTTTGCAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCCT--AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCT-GGGTT-GTATACAGTGATTGGGATTGAGGAACGCAGCACGCCGC--------------------------AAGGTTGGGT-TTC-GA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus renweii SWFC21406 LSU (DQ463333)' CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-?-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAGAAAGGCTT--AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCTA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGT--------------------------AAGGTTGGGTC-TCTGA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGTAAACTCGAGCGCACAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus setosus DAOM200815 LSU (DQ463331)' CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTA-GG-TCGTATACAGTGATTGGGATTGAGGAACGCAGCACGCCGA--------------------------AAGGTTGGGT-TTC-GA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCATAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus stercoreus (LSU)' CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGCCT-T-CAGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTGCTCTTTTGCAGGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGACCATTGGAG---AAAGGCTT--GGGGAATGTGGCACCTTCGGGTGTGTTATAGACCCA-GGTT-GTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGC--------------------------AAGGTAGGGT-TTC-GA-CCACACCCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus subglobisporus BBH18348 (EF613554)' ???????????????????????????????????????????????????????????????????????????????CCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAA-TCAACCTTACTCTTTTGTAAGGCTTAC-TTCTTAGTTGACGGGCCAACATCAATTTTGA---TTGCTGGAAAAAGGCTT--AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCT-GGG-TCGTATACAGTGATTGGGATTGAGGAACGCAGCACGCCGT--------------------------AAGGTTGGGT-TTC-GA-CCACACTCGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCATAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cystoderma amianthinum (LSU)' CGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGA-TAGTCC-TA-GGCTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGACCAGGGA-TCAACCTTGCTCTT--GCTGGGTGTACTTTCT-GGTTAACGGGTCAACATCAATTTTGA---TTGTTGGAAAAAGA--TCAAGGGAATGTAGCATCTTCGGATGTGTTATAG-CCTTTGGTT-GTATACAACAGTTGGGATTGAGGAACTCAGCACGCCGA--------------------------AAGGCCGGGT-TTTTAA-CCACGTTCGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCGGGGAGCATCGACGCCCGGACCAGAAATTTATGGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Nidula sp KH-JPN15-582 LSU' ???????????????AAGCTCAAATTTAAAATCTGGCT-GTCTATATGGCAGTCCGAGTTGTAATCTAGAGAAGTGCTACCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGGCTATGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGCTGGCCAGGGA-TCAACCTCGCTCTTTTGTGAGGCGCACTTTCT-GGTCGGTGGGTCAGCATCAGTTTTGG---TTGCTGGATAAAGGCCTT--GGGAATGTGGCATCTTCGGATGTGTTATAGCCCTT-GGTT-GGATACAGTGGCTGGGATTGAGGAACTCAGCACGCCGC--------------------------AAGGCCGGG-CTTTT-AGCCACGTACGTGCTTGGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACCCGAGTGCGCAATGAAAGTGAAAGTTGAGATCCCTGTCGTGGGGAGCATCGACGCCCGGACCTGAGGCTTGCTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC ; END; BEGIN TREES; TITLE Cyathus_ITS_Bayesian_analysis; LINK TAXA = Taxa2; TRANSLATE 1 Cystoderma_amianthinum, 2 Nidula_sp, 3 Crucibulum_laeve, 4 Cyathus_hookeri, 5 Cyathus_olla_f._brodiensis, 6 Cyathus_jiayuguanensis, 7 Cyathus_colensoi, 8 Cyathus_africanus, 9 Cyathus_olla, 10 Cyathus_annulatus, 11 Cyathus_gansuensis, 12 Cyathus_setosus, 13 Cyathus_subglobisporus, 14 Cyathus_crassimurus, 15 Cyathus_stercoreus, 16 Cyathus_renweii, 17 Cyathus_berkeleyanus, 18 Cyathus_pallidus, 19 Cyathus_magnomuralis, 20 Cyathus_lignilantanae, 21 Cyathus_hortensis, 22 Cyathus_parvocinereus, 23 Cyathus_badius; TREE Tree_ITS = [&R] (1:0.1604605,(2:0.0845061,(3:0.09896759,(17:0.05748526,18:0.01287684,(11:0.03106433,((6:0.002573591,7:0.00107413,8:0.005694975,(5:0.001141961,(4:0.00108942,9:0.002781516):0.002756408):0.002739494):0.02458348,(13:0.03114391,((10:0.007679887,16:0.01148955):0.0199513,((12:0.01496921,14:0.00530963):0.0305832,((22:0.004184288,23:0.006290526):0.02761987,(15:0.02067154,(20:0.06598941,(19:0.001514238,21:0.003276011):0.004928295):0.007196125):0.02359552):0.01980142):0.0076873):0.007537269):0.02355905):0.03593129):0.01390628):0.2453346):0.09134667):0.1604605); END; BEGIN TREES; TITLE Cyathus_LSU_Bayesian_analysis; LINK TAXA = Taxa1; TRANSLATE 1 'Cystoderma amianthinum (LSU)', 2 'Crucibulum laeve RH-20151011-7 LSU', 3 'Nidula sp KH-JPN15-582 LSU', 4 'Cyathus badius (LSU)', 5 'Cyathus africanus DAOM200370 LSU (DQ463330)', 6 'Cyathus annulatus DAOM200366 (DQ463332 LSU)', 7 'Cyathus gansuensis (LSU)', 8 'Cyathus griseocarpus DAOM200396 LSU (DQ463324)', 9 'Cyathus guandishanensis (LSU)', 10 'Cyathus helenae DAOM200384 LSU (DQ463334)', 11 'Cyathus jiayuguanensis (LSU)', 12 Cyathus_olla_f._lanatus, 13 'Cyathus lignilantanae (LSU)', 14 'Cyathus stercoreus (LSU)', 15 'Cyathus olla f. anglicus BPI727225 (DQ463326) ', 16 'Cyathus olla f. olla BPI727227 LSU (DQ463327)', 17 'Cyathus pallidus SWFC21160 LSU (DQ463336)', 18 'Cyathus parvocinereus (LSU)', 19 'Cyathus renweii SWFC21406 LSU (DQ463333)', 20 'Cyathus setosus DAOM200815 LSU (DQ463331)', 21 'Cyathus subglobisporus BBH18348 (EF613554)', 22 'Cyathus magnomuralis UFRN-Fungos1817 LSU'; TREE LSU_tree = [&R] (1:0.014778175,(2:0.02978759,(3:0.03677179,((7:0.01382639,12:0.008679468):0.002781826,(17:0.006804037,8:7.843721E-4,9:7.663079E-4,11:7.70775E-4,15:7.798399E-4,16:7.811324E-4,5:0.004772033,21:0.002840261,20:0.00415899,(6:7.844095E-4,10:9.392741E-4,19:7.753598E-4):0.004413044,((4:0.006241027,18:8.198115E-4):0.002668937,(13:0.001542082,14:0.01169889,22:8.928862E-4):0.00465146):0.004967634):0.003437261):0.044545):0.01469792):0.014778175); END; BEGIN TREES; TITLE 'Cyathus ITS-LSU Bayesian analysis'; LINK TAXA = Taxa3; TRANSLATE 1 Cystoderma_amianthinum_HO124693, 2 'Crucibulum laeve RH-20151011-7', 3 'Nidula sp KH-JPN15-582', 4 Cyathus_africanus_DAOM200370, 5 Cyathus_annulatus_DAOM200366, 6 'Cyathus badius KH-JPN15-1321', 7 Cyathus_gansuensis_strain69, 8 Cyathus_jiayuguanensis_SWFC20846, 9 'Cyathus lignilantanae MA-Fungi87327', 10 'Cyathus magnomuralis UFRN-Fungos1817', 11 Cyathus_olla_f._olla_BPI727227, 12 Cyathus_pallidus_SWFC21160, 13 'Cyathus parvocinereus UFRN-Fungos1814', 14 Cyathus_renweii_SWFC201406, 15 Cyathus_setosus_DAOM200815, 16 Cyathus_stercoreus_SWFC21386, 17 Cyathus_subglobisporus_BBH18348; TREE 'ITS-LSU tree' = [&R] (1:0.08560805,(3:0.08153151,(2:0.07969827,((7:0.02586699,12:0.01045957):0.01111544,((4:0.006044351,(8:0.001257974,11:0.0028634):0.001160972):0.01309438,(15:0.02199401,(17:0.01487173,((5:0.003419682,14:0.005441286):0.01007355,((6:0.006409448,13:0.001945787):0.01301059,(16:0.01695661,(9:0.02763839,10:0.002717204):0.002661123):0.01414743):0.01385296):0.00881001):0.004833385):0.0109478):0.01366994):0.1523061):0.0260376):0.08560805); END;