#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:51 GMT TreeBASE (cc) 1994-2008 Study reference: Hunter R., & Halanych K. 2008. Evaluating connectivity in the brooding brittle star Astrotoma agassizii across the Drake Passage in the Southern Ocean. Journal of Heredity, 99: 137-148. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2013] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=65; TAXLABELS Astrohamma_tuberculatum_1 Astrohamma_tuberculatum_2 Astrotoma_agassizii_St_1.1 Astrotoma_agassizii_St_1.2 Astrotoma_agassizii_St_1.3 Astrotoma_agassizii_St_1.4 Astrotoma_agassizii_St_1.5 Astrotoma_agassizii_St_1.6 Astrotoma_agassizii_St_1.7 Astrotoma_agassizii_St_1.8 Astrotoma_agassizii_St_14.1 Astrotoma_agassizii_St_14.2 Astrotoma_agassizii_St_14.3 Astrotoma_agassizii_St_14.4 Astrotoma_agassizii_St_3.1 Astrotoma_agassizii_St_3.2 Astrotoma_agassizii_St_3.3 Astrotoma_agassizii_St_3.4 Astrotoma_agassizii_St_4.1 Astrotoma_agassizii_St_4.2 Astrotoma_agassizii_St_4.3 Astrotoma_agassizii_St_4.4 Astrotoma_agassizii_St_4.5 Astrotoma_agassizii_St_4.6 Astrotoma_agassizii_St_47.1 Astrotoma_agassizii_St_5.1 Astrotoma_agassizii_St_5.2 Astrotoma_agassizii_St_5.3 Astrotoma_agassizii_St_5.4 Astrotoma_agassizii_St_5.5 Astrotoma_agassizii_St_5.6 Astrotoma_agassizii_St_5.7 Astrotoma_agassizii_St_5.8 Astrotoma_agassizii_St_7a Astrotoma_agassizii_St_8.1 Astrotoma_agassizii_St_8.2 Astrotoma_agassizii_St_82.1 Astrotoma_agassizii_St_82.2 Astrotoma_agassizii_St_82.3 Astrotoma_agassizii_St_82.4 Astrotoma_agassizii_St_82.5 Astrotoma_agassizii_St_85.3 Astrotoma_agassizii_St_9.1 Astrotoma_agassizii_St_9.2 Astrotoma_agassizii_St_9.3 Astrotoma_agassizii_St_9.4 Astrotoma_agassizii_St_9.5 Astrotoma_agassizii_St_9.6 Astrotoma_agassizii_St_9.7 Astrotoma_agassizii_St_9.8 Astrotoma_agassizii_Sts_1_18 Astrotoma_agassizii_Sts_3_5_8_9 Astrotoma_agassizii_Sts_31_47_82_85 Astrotoma_agassizii_Sts_4_14 Astrotoma_agassizii_Sts_4_5_14 Astrotoma_agassizii_Sts_4_7b_14 Astrotoma_agassizii_Sts_47_78 Astrotoma_agassizii_Sts_47_82 Astrotoma_agassizii_Sts_47_82_85.1 Astrotoma_agassizii_Sts_47_82_85.2 Astrotoma_agassizii_Sts_5_6.1 Astrotoma_agassizii_Sts_5_6.2 Astrotoma_agassizii_Sts_5_7b Astrotoma_agassizii_Sts_8_9 Astrotoma_agassizii_Sts_9_18 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3101] TITLE 'COII + 16S rDNA'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=985; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Astrohamma_tuberculatum_1 CTCATCTCTTATAATGAGAGAGTTTCATCTATTTCACGACTACTCAATGAGATTTATTATATTAATAATTATAATTATAGTATACGGATTAATAATTTTATTAAAAAAAGCCCCAACTCACTGAAAGTTTACGGAAAAGCAACAAATAGAATTATGATGGACTATATCTCCTAGATTTATTTTAATAGCCTTAGCTATCCCCTCAATAAAATTACTATACTTTATGGATGAAGGAAAAAATCCTGATATAACAGTAAAGACAATTGGACATCAATGATACTGAAGTTATGAAATATGAGATAATAAACGAATAGAAATTGATTCTTATATGGTTAACTTAGAAGACATAAAACAAAAAGGGCTACCTCGTCTACTTGAAGTAGATAAACGATTAACAATCCCTTACAAAACAAAAATTCGAATAATAACATCATCCACTGATGTAATACATGCATGATCTTTACCAACCTTAGGATTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCAGTGATT-GAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTATTAATTTTAGGCTAGAATGAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTAATTTTTAACTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTTAGTTATTGATTAG--GAAAAAATTTTTTTTAATAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAAAAAAAATAAAAATTGATTTAAATCTTTAATATATGTAAGACCTAGAATTTTTCTAGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTTCTTTTGAGAGTACATATTGACAAAGGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGTAGCAGTTTCCAAGGGTTGG Astrohamma_tuberculatum_2 CTCATCTCTTATAATGAGAGAGTTTCATCTATTTCACGACTACTCAATGAGATTTATTATATTAATAATTATAATTATAGTATACGGATTAATAATTTTATTAAAAAAAGCCCCAACTCACTGAAAGTTTACGGAAAAGCAACAAATAGAATTATGATGGACTATATCTCCTAGATTTATTTTAATAGCCTTAGCTATCCCCTCAATAAAATTACTATACTTTATGGATGAAGGAAAAAATCCTGATATAACAGTAAAGACAATTGGACATCAATGATACTGAAGTTATGAAATATGAGATAATAAACGAATAGAAATTGATTCTTATATGGTTAACTTAGAAGACATAAAACAAAAAGGGCTACCTCGTCTACTTGAAGTAGATAAACGATTAACAATTCCTTACAAAACAAAAATTCGAATAATAACATCATCCACTGATGTAATACATGCATGATCTTTACCAACCTTAGGATTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCAGTGATT-GAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTATTAATTTTAGGCTAGAATGAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTAATTTTTAACTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTTAGTTATTGATTAG--GAAAAAATTTTTTTTAATAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAAAAAAAATAAAAATTGATTTAAATCTTTAATATATGTAAGACCTAGAATTTTTCTAGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTTCTTTTGAGAGTACATATTGACAAAGGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGTAGCAGTTTCCAAGGGTTGG Astrotoma_agassizii_St_1.1 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_1.2 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAAATATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_1.3 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATAATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTTTACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCCAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATAGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCCACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGATTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGC??????????????????? Astrotoma_agassizii_St_1.4 ??????????ATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAAATATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_1.5 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAAATATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_1.6 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATAATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTTTACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCCAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATAGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCCACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGATTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAAATATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_1.7 ????????TTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATAATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTTTACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCTAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATTACATCATCCACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGATTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_1.8 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TTGAAATTGAATTAAATCT--AAAAGTGTAAATACCCGGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_14.1 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACGCCCTAATAATCCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACCATATCCCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAATCTAGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAGGTAGATAAACGACTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAGTTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_14.2 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACGCCCTAATAATCCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACCATATCCCCAAGATTTATCTTAATTGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAACCTAGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAGGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAGTTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_14.3 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAATATACGCCCTAATAATCCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACCATATCCCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAATCTAGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAGGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAGTTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_14.4 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACGCCCTAATAATCCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACCATATCCCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAATCTAGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAGGTAGATAAACGATTAACTATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAGTTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_3.1 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TTGAAATTGAATTAAATCT--AAAAGTGTAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_3.2 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_3.3 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAGATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_3.4 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAATAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_4.1 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACGCCCTAATAATCCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACCATATCCCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGATATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAATCTAGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAGGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAGTTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_4.2 CTCATCTCTTATAATGAGAGAATTTCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACGCCCTAATAATCCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACCATATCCCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGACATCACAATAAAGACAATTGGGCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAATCTAGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAGTTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_4.3 CTCATCTCTTATAATGAGAGAATTCCGCCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACGCCCTAATAATCCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACCATATCCCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAATCTAGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAGGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAGTTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_4.4 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACGCCCTAATAATCCTTCTTCTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACCATATCCCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGACATCACAATAAAGACAATTGGTCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAATCTAGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAGTTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_4.5 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACGCCCTAATAATCCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACCATATCCCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGACATCACAATAAAGACAATTGGTCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACCAATCTAGAAGACATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACTGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAATTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_4.6 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACGCCCTAATAATCCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACCATATCCCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAATCTAGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAGGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATAATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAGTTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_47.1 CTCATCTCTTATAATGAGAGAATTTCACCAATTCCACGACTATTCAATGAGCTTCATCATACTAATAACTATAATAATAGTATATGCCCTAATAATTCTTCTACTAAAAGCTCCAACTCACTGGAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATCAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGACACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATATATGACTAATCTCGAAGATATTAAACAAAAAGGGCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATTCCCTATAAAACAAAAATCCGAATAATTACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGCCTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTAGAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGAAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAGTAGAAGTTAATTTTTTACCAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TATAAATTGAATTAAATCT--AAAAGTTAAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_5.1 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTATACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCTAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_5.2 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTATACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_5.3 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTATACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGGACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_5.4 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATATACCCTAATAATCCTTATACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_5.5 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTATACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATAACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_5.6 CTCATCTCTCATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTATACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_5.7 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTATACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTTAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_5.8 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTATACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCTAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_7a CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATAATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTTTACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCTAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCCGACATCACAGTAAAGACTATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCCACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGATTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_8.1 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATAATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTTTACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCTAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATTACATCATCCACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGATTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAGTTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_8.2 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATAATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTTTACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCTAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCCACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGATTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_82.1 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACAACTATTCAATGAGCTTCATCATACTAATAACTATAATAATAGTATATGCCCTAATAATTCTTCTACTAAAAGCTCCAACTCACTGGAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATCAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGACACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATATATGACTAATCTCGAAGATATTAAACAAAAAGGGCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATTCCCTATAAAACAAAAATCCGAATAATTACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGTCTAAAGATGGATGCAATAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTAGAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGAAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAGTAGAAGTTAAATTTTTACCAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TATAAATTGAATTAAATCT--AAAAGTTAAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_82.2 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATACTAATAACTATAATAATAGTATATGCCCTAATAATTCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATCAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGACACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATATATGACTAATCTCGAAGATATTAAACAAAAAGGGCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATTCCCTATAAAACAAAAATCCGAATAATTACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGTCTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTAGAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGAAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAGTAGAAGTTAAATTTTTACCAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TATAAATTGAATTAAATCT--AAAAGTTAAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_82.3 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATACTAATAACTATAATAATAGTATATGCCCTAATAATTCTTCTACTAAAAGCTCCAACCCACTGGAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATCAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGACACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATATATGACTAATCTCGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATTCCCTATAAAACAAAAATCCGAATAATTACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGTCTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTAGAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGAAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAGTAGAAGTTAAATTTTTACCAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TATAAATTGAATTAAATCT--AAAAGTTAAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_82.4 TTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATACTAATAACTATAATAATAGTATATGCTCTAATAATTCTTCTACTAAAAGCTCCAACTCACTGGAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATCAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGACACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATATATGACTAATCTCGAAGATATTAAACAAAAAGGGCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATTCCCTATAAAACAAAAATCCGAATAATTACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGTCTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTAGAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGAAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAGTAGAAGTTAAATTTTTACCAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TATAAATTGAATTAAATCT--AAAAGTTAAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_82.5 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATACTAATAACTATAATAATAGTATATGCCCTAATAATTCTTCTACTAAAAGCTCCAACTCACTGGAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATCAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGACACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATATATGACTAATCTCGAAGATATTAAACAAAAAGGGCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATTCCCTATAAAACAAAAATCCGAATAATTACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGCCTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTAGAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGAAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAGTAGAAGTTAAATTTTTACCAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TATAAATTGAATTAAATCT--AAAAGTTTAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_85.3 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATACTAATAACTATAATAATAGTATATGCCCTAATAATTCTTCTACTAAAAGCTCCAACTCACTGGAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATCAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGACACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATATATGACTAATCTCGAAGATATTAAACAAAAAGGGCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATTCCCTATAAAACAAAAATCCGAATAATTACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGTCTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTAGAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGAAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAGTAGAAGTTAAATTTTTACCAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TATAAATTGAATTAAATCT--AAAAGTTAAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_9.1 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TTGAAATTGAATTAAATCT--AAAAGTGTAAATACCCAGGATTATTCTGGAATTAGAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_9.2 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATTATATTAATAACTATAATAATAATATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TTGAAATTGAATTAAATCT--AAAAGTGTAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_9.3 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTTATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGC????ATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTCTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TTGAAATTGAATTAAATCT--AAAAGTGTAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_9.4 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TTGAAATTGAATTAAATCT--AAAAGTGTAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_9.5 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATAATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTTTACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCTAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCCACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGATTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGATGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TTGAAATTGAATTAAATCT--AAAAGTGTAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_9.6 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTTGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TTGAAATTGAATTAAATCT--AAAAGTGTAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_9.7 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTGTAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TTGAAATTGAATTAAATCT--AAAAGTGTAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_St_9.8 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TTGAAATTGAATTAAATCT--AAAAGTGTAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_1_18 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATAATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTTTACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCTAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCCACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGATTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_3_5_8_9 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TTGAAATTGAATTAAATCT--AAAAGTGTAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_31_47_82_85 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATACTAATAACTATAATAATAGTATATGCCCTAATAATTCTTCTACTAAAAGCTCCAACTCACTGGAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATCAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGACACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATATATGACTAATCTCGAAGATATTAAACAAAAAGGGCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATTCCCTATAAAACAAAAATCCGAATAATTACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGTCTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTAGAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGAAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAGTAGAAGTTAAATTTTTACCAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TATAAATTGAATTAAATCT--AAAAGTTAAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_4_14 CTCATCTCTTATAATGAGAGAATTTCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACGCCCTAATAATTCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACCATATCCCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGACATCACAATAAAGACAATTGGTCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAATCTAGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAGTTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_4_5_14 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACGCCCTAATAATCCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACCATATCCCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAATCTAGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAGGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAGTTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTC?????????? Astrotoma_agassizii_Sts_4_7b_14 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACGCCCTAATAATCCTTCTACTAAAAGCTCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGGTGAACCATATCCCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATTAAATTATTATATTTTATGGATGAAGGAAAAAATCCTGACATCACAATAAAGACAATTGGTCACCAATGATACTGAAGATATGAAATATGAGATAAAAAACGAATAGAAATAGATTCATATATGACTAATCTAGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTTATAGAAGTTAAATTTTTATTTAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AGAAGTGTAAGTACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_47_78 TTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATACTAATAACTATAATAATAGTATATGCTCTAATAATTCTTCTACTAAAAGCTCCAACTCACTGGAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATCAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGACACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATATATGACTAATCTCGAAGATATTAAACAAAAAGGGCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATTCCCTATAAAACAAAAATCCGAATAATTACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGTCTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCAGTGATTAGAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGAAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAGTAGAAGTTAAATTTTTACCAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TATAAATTGAATTAAATCT--AAAAGTTAAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_47_82 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATACTAATAACTATAATAATAGTATATGCCCTAATAATTCTTCTACTAAAAGCTCCAACTCACTGGAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATCAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGACACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATATATGACTAATCTCGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATTCCCTATAAAACAAAAATCCGAATAATTACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGTCTAAAGATGGATGCAGTCATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTAGAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGAAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAGTAGAAGTTAAATTTTTACCAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TATAAATTGAATTAAATCT--AAAAGTTAAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_47_82_85.1 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATACTAATAACTATAATAATAGTATATGCCCTAATAATTCTTCTACTAAAAGCTCCAACTCACTGGAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATCAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGACACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATATATGACTAATCTCGAAGATATTAAACAAAAAGGACTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATTCCCTATAAAACAAAAATCCGAATAATTACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGTCTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTAGAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGAAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAGTAGAAGTTAAATTTTTACCAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TATAAATTGAATTAAATCT--AAAAGTTAAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_47_82_85.2 CTCATCTCTTATAATGAGAGAATTCCACCAATTCCACGACTATTCAATGAGCTTCATCATACTAATAACCATAATAATAGTATATGCCCTAATAATTCTTCTACTAAAAGCTCCAACTCACTGGAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATCTTAATAGCATTAGCTATCCCATCAATCAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATTACAGTAAAGACAATTGGACACCAATGATACTGAAGATACGAAATATGAGACAAAAAACGAATAGAAATAGATTCATATATGACTAATCTCGAAGATATTAAACAAAAAGGGCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATTCCCTATAAAACAAAAATCCGAATAATTACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACCTTAGGTCTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATCATCAAAAGGTCCTGCCTGCCCGGTGATTAGAAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGAAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATAAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTAATTAGTAGAAGTTAAATTTTTACCAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TATAAATTGAATTAAATCT--AAAAGTTAAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_5_6.1 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTATACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_5_6.2 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTATACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCTAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTTGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_5_7b CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGCTTCATCATATTAATAACTATAATAATAGTATACACCCTAATAATCCTTATACTAAAAACCCCAACTCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCCGACATCACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAATCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGATAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCGGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTAAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAAATAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_8_9 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTGATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TAGAAATTGAATTAAATCT--AAAAGTATAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACCTATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG Astrotoma_agassizii_Sts_9_18 CTCATCTCTTATAATGAGAGAATTCCACCAATTTCACGACTATTCAATGAGATTCATCATATTAATAACTATAATAATAGTATACACCATAATAATCCTTATACTAAAAACCCCAACCCACTGAAAGTTTACAGAAAAGCAACAAATAGAATTATGATGAACTATATCTCCAAGATTTATATTAATAGCATTAGCTATCCCATCAATTAAATTATTATACTTTATGGATGAAGGAAAAAATCCTGACATAACAGTAAAGACAATTGGTCACCAATGATACTGAAGATACGAAATATGAGATAAAAAACGAATAGAAATAGATTCATACATGACTAACCTCGAAGATATTAAACAAAAAGGCCTCCCACGTCTACTAGAAGTAGACAAACGATTAACAATACCCTATAAAACAAAAATACGAATAATCACATCATCTACCGACGTAATTCACGCATGATCTTTACCCACTTTAGGACTAAAGATGGATGCAGTAATCAAAAACATCGCCTTTGGAAAATTATCAAAAGGTCCTGCCTGCCCGGTGATTT-AAAAATTAAACGGCTGCGGTACTCTGACCGTGCAAAGGTAGCATAATCATTAGCCTGTTAATTTCAGGCTGGCATCAATGGCAAGACGAAGGAAAAGCTGTCTCTTTCTATTATTTTAGAATTTTTCTTTTTGGTGAAGAGACCAAAATATGAAAGTGGGACGAGAAGACCCTATTGAGTTTAAGTTGATTAATAGAATTTTAATTTTTATTGAAAAACTTTGGTTGGGGCAACTGTTTATAAAATTAAACATAATAAAA-TTGAAATTGAATTAAATCT--AAAAGTGTAAATACCCAGGATTATTCTGGAATTAAAAATAATTACCATAGGGATAACAGCGTAATTCTTTTCGAGAGTACATATTGACAAAAGAGTTTGCGACCTCGATGTTGGATCAAGTTTTCCTGGAGGTGCAGCAGTTTCTAAGGGTTGG ; END; BEGIN TREES; TITLE Tb8946; LINK TAXA = Taxa1; TRANSLATE 1 Astrotoma_agassizii_St_7a, 2 Astrotoma_agassizii_Sts_8_9, 3 Astrotoma_agassizii_St_9.1, 4 Astrotoma_agassizii_St_9.2, 5 Astrotoma_agassizii_Sts_3_5_8_9, 6 Astrotoma_agassizii_St_9.3, 7 Astrotoma_agassizii_Sts_9_18, 8 Astrotoma_agassizii_St_9.4, 9 Astrotoma_agassizii_St_9.5, 10 Astrotoma_agassizii_St_9.6, 11 Astrotoma_agassizii_St_9.7, 12 Astrotoma_agassizii_St_9.8, 13 Astrotoma_agassizii_Sts_4_7b_14, 14 Astrotoma_agassizii_St_14.1, 15 Astrotoma_agassizii_Sts_4_5_14, 16 Astrotoma_agassizii_St_14.2, 17 Astrotoma_agassizii_St_14.3, 18 Astrotoma_agassizii_St_14.4, 19 Astrotoma_agassizii_Sts_4_14, 20 Astrotoma_agassizii_Sts_1_18, 21 Astrotoma_agassizii_St_1.1, 22 Astrotoma_agassizii_St_1.2, 23 Astrotoma_agassizii_St_1.3, 24 Astrotoma_agassizii_St_1.4, 25 Astrotoma_agassizii_St_1.5, 26 Astrotoma_agassizii_St_1.6, 27 Astrotoma_agassizii_St_1.7, 28 Astrotoma_agassizii_St_1.8, 29 Astrotoma_agassizii_St_4.1, 30 Astrotoma_agassizii_St_4.2, 31 Astrotoma_agassizii_St_4.3, 32 Astrotoma_agassizii_St_4.4, 33 Astrotoma_agassizii_St_4.5, 34 Astrotoma_agassizii_St_4.6, 35 Astrotoma_agassizii_St_3.1, 36 Astrotoma_agassizii_St_3.2, 37 Astrotoma_agassizii_St_3.3, 38 Astrotoma_agassizii_St_3.4, 39 Astrotoma_agassizii_Sts_5_7b, 40 Astrotoma_agassizii_Sts_5_6.1, 41 Astrotoma_agassizii_St_5.1, 42 Astrotoma_agassizii_St_5.2, 43 Astrotoma_agassizii_St_5.3, 44 Astrotoma_agassizii_St_5.4, 45 Astrotoma_agassizii_St_5.5, 46 Astrotoma_agassizii_St_5.6, 47 Astrotoma_agassizii_Sts_5_6.2, 48 Astrotoma_agassizii_St_5.7, 49 Astrotoma_agassizii_St_5.8, 50 Astrotoma_agassizii_St_8.1, 51 Astrotoma_agassizii_St_8.2, 52 Astrotoma_agassizii_St_47.1, 53 Astrotoma_agassizii_Sts_47_82_85.1, 54 Astrotoma_agassizii_Sts_31_47_82_85, 55 Astrotoma_agassizii_Sts_47_82, 56 Astrotoma_agassizii_Sts_47_82_85.2, 57 Astrotoma_agassizii_Sts_47_78, 58 Astrotoma_agassizii_St_82.1, 59 Astrotoma_agassizii_St_82.2, 60 Astrotoma_agassizii_St_82.3, 61 Astrotoma_agassizii_St_85.3, 62 Astrotoma_agassizii_St_82.4, 63 Astrotoma_agassizii_St_82.5, 64 Astrohamma_tuberculatum_1, 65 Astrohamma_tuberculatum_2; TREE Fig._2 = [&R] (65,64,(((((1,(9,20),(27,50),51),(23,26)),((2,(3,4,5,(6,12),(7,11),8,10,28,35),21,(22,24,25),36,37),38),39,40,(41,(47,49)),42,43,44,45,46,48),((13,(19,30),32,33),(14,15,16,17,18,29,31,34))),(52,(53,55,60),54,56,(57,62),58,59,61,63))); END;