#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on June 04, 2020; 12:27 GMT TreeBASE (cc) 1994-2008 Study reference: Kuo L., Ebihara A., Kato M., Rouhan G., Ranker T., & Wang C. 2017. Morphological characterization of infra-generic lineages in Deparia (Athyriaceae; Polypodiales). Cladistics, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S20277] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=72; TAXLABELS Athyrium_atkinsonii Athyrium_filixfemina Athyrium_niponicum Athyrium_otophorum Athyrium_skinneri Cornopteris_opaca Deparia_acrostichoides Deparia_acuta Deparia_aff._glabrata Deparia_aff._jiulungensis Deparia_auriculata Deparia_biserialis Deparia_bonincola Deparia_boryana Deparia_cataracticola Deparia_concinna Deparia_confluens Deparia_conilii Deparia_coreana Deparia_dickasonii Deparia_dimorphophylla Deparia_dolosa Deparia_edentula Deparia_emeiensis Deparia_erecta Deparia_fenzliana Deparia_formosana Deparia_forsythiimajoris Deparia_glabrata Deparia_gordonii Deparia_hainanensis Deparia_henryi Deparia_heterophlebia Deparia_japonica Deparia_jiulungensis Deparia_kaalaana Deparia_kiusiana Deparia_lancea Deparia_lobatocreneta Deparia_longipes Deparia_macdonellii Deparia_marginalis Deparia_medogensis Deparia_minamitanii Deparia_okuboana Deparia_omeiensis Deparia_otomasui Deparia_parvisora Deparia_petersenii_deflexa Deparia_petersenii_petersenii_var._petersenii Deparia_petersenii_petersenii_var._yakusimensis Deparia_prolifera Deparia_pseudoconilii Deparia_pterorachis Deparia_pycnosora Deparia_sichuanensis Deparia_sp. Deparia_subfluvialis Deparia_tenuifolia Deparia_timetensis Deparia_tomitaroana Deparia_unifurcata Deparia_viridifrons Deparia_wilsonii Deparia_yunnanensis Diplazium_bombonasae Diplazium_dilatatum Diplazium_proliferum Diplazium_squamigerum Diplazium_wichurae Matteuccia_struthiopteris Woodwardia_japonica ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M43118] TITLE 'Deparia trnL-L-F + rps16-matK IGS + matK + rbcL'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=4318; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Athyrium_atkinsonii -----------------------------------------------TTTATTTTTAAAC------TTC-AGCTTCTT-GCCTAGTCA-AACC----GTTGATCTCGCCTTCGTCGACCTGTTTAACACAATAT------CGCTTCCAGTAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCACGTATATTAAAAGCCTGAATGGCTCACCTGCAAAGTGTTTC-------------------------------GGAAAGACCAA-AAAAATAAA------ATTGAAGTGGCTTCCGTATTTT--------------GCTTCCGA--------ACAAATTGTGTGAATCCGAACAACCTGAAATGGGTTAA------------------TTGAAGTGTCTCGTTGGGGATAGAGGGAGTCGAACCCTCACGGTC----GAAACCAACGGATTTTCGTTCTACTGCAACTTGCGCCGCTACTCCTTATCTTATTAAGTGTGTAGAATGGGACTCTACCTCCATTCACG-----AAAGTGTCATTTTCT-GCTACCGGCTCGCTTGTTGAATAATTTTCATCGGAATGGAGTGGGATCCCGCA-----ACAGGTAAGAGAAGAATATGCGGACTGGCA-ATAGTAGAAGGAGTCTACTTAGTGTTGCATTACCAAG------TACGAACAGAATTTCGTGAATGAATGCTGGGC--------CCAAACCGAGGGGTCCGCGTCC-----------GAATAA---GA-AAAGAATTAAAATTTTATTTCCTTACCAGGTTTCAGT------CTTATACTTCTACATATTATCCCATGCAGTTAACCACGCAAAAAAGTTAGATATTCAGTTATTTCGAGAACTAG------------------------------------------------------------------------------------------------AAATCAAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTCCTTTCAGGTGCTTTTGTATTACCCCTCTCTTCTACTTATACTCTACATCTATGCCGTATTTGGCATTCCCTTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAAAGAAGTGATATCGGACATATCTTCACGGATGTGATGAAAAATTGGAAGGGGAAGGGAAAACGCAGGTAGTTCAAGCCAATGACATGATTACTACCGGGA--------CAAA-TTTTATATCC--AACCCGGTGTTGGGTT-----AGGGGTTGACCGCCGATTTCACGCCACAAATTTGATATAACTCCCC-ACGATCCTTCCCGAAAG-----ATGATTGCAGCTCGGTACTTTATCGAGGATCAAGTCGGAAAATGTTTTACTTGGGTCGATGCTTCCTCGACAAAACCCAAATTAGTAAGTATTTACTACATCAGCAAGTATTTACTAA----------------------------------------------------------TTCGGGTTTCACGTTGTCCGATGAAAAAGGTGATTCAGCTCTTTCGACCACGGTGGTTAAACATTCGCAGCTTTTTCTTC------TCATTTTATTCATACAATGAAAATAGAATTATTCATACAATGAAAATAGAATTATTAATACATTGAATCTTTTGAATAAAATTCATTATGAAAAATAATGCTTGGGAGTTACTGTGACGAAGACAACTTCTGGATCCCTTCCTAAATTTGATGTATTACAGAAAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTACTTCTCTTCCCATTCAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTAGATAGACGAGACA------------TCGGTTTGGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCAATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTTATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCATGTACTTCTACAAACAATATGTCTAATTTTGGGGATACCTCTTTCGTGTCGGTTAGCTGCTGAAACAAATAACAACTCGAAAATTTCACAGTCTATCCATTCAATATTTTTATTTCTGGAAGATAGATTACCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCACAGAATCTTCATCTAGAAACTCCGGTTCGCTTGTTTCGCCGACGAATTGGGGATGTGACATTTCCACATCTATTAAGGGTAGTTTTTCACACGTACAAAACTTTGTTTGGAAAATCTATTCAGTTTCGGTCTTGGAAACAAAGAGAACGGAGAAGTATTGACATGCTACTCCGAAATTTTTACACTTACGAAATCGATTCGATATTGCTAGTTTCATGGACACGAATGTATGAGTCAAACCCGAGATATTTTGTATCTCCCGATCGGAATAACATGACCAGAAAGAAGATACGTGTTTCTGAATATAATTCTCGATCAGACGCGACAAGCATCGACCGCTGTCTCACTCGAAGTTTGTGCATCCACCTTGGGAGATGTAGAAACAAATCTCTCATAGCTTTTCGTGGAACTCAATATTTCGCAAAAAAATGGATTTATTACCTCTCGATATTTCTCAGATCTCATTTTCATTATCCAATTGAATTTACCCAAATACGTATCAGTTTGTTATCCGCCAGCTGCGTCTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAGAAACGTCCAGGTCGAAACCACAATGGATTATTACAACAGT------CTTTTGAGTGGAGAGAGAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAAAAAGAGAAGTTCTGCGATAGTACTGGACATCCAGTTAGTAAATTAGCCTGGACTGTATTAACAGATGATGAGATTTTGAACAGGTTTGTAAAAATTTGGAATACTTTTTCCCTGTACCACAGCGCTTCAATAAATCGAGATGGATTGCGTAGATCGAGATATATATC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAGCCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAACTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCCTACGCTTGGAAGACCTCCGAATTCCCCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGCATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAGGGGCATTACCTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGGGAGTTGGGTGCACCAATAGTCATGCATGACTACTTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAATGGACTGCTTCTTCATATTCACCGTGCGATGCATGCCGTGATCGATAGACAACGAAATCACGGTATACATTTCCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGACTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTAGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Athyrium_filixfemina TCGGCC-GATTCATTTACGGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTCTT-GCCTAGTCA-AACC----GTTGATCTCGCCTTCGTCGACCTGTTTAACACAATAT------CGCTTCCAGTAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCACGTATATTAAAAGCCTGAATGGCTCACCTGCAAAGTGTTTC-------------------------------GGAAAGACCAAAGAAAATAAA------ATTGAAGTGGCTTCCGTATTTT--------------GCTTCCGA--------ACAAATTGTGTGAATCCGAACAATCTGAAATGGGTTAA------------------TTGAAGTGTCTCGTTGGGGATAGAGGGAGTCGAACCCTCACGGTC----GAAACCAACGGATTTTCGTTCTACTGCAACTTGCGCCGCTATTCCTTATCTCATCAAGTGTGTAGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTCT-GCTACCGGCTCGCTTGTTGAATAATTTTCATCGGAATGGAGTGGGATCCCGCA-----ACAGGTAAGAGAAGAATATGCAGACTGGCG-GTAGTAGAAGGAGTCTACTTAGTGTTGCATTACCAAG------TACGAACAGAATTTCGTGAATGAATGCTGGGC--------CCAAACCGAGGGGTCCGCGTCC-----------GAATAA---GA-AAAGAATTAAAATTTTATTTCCTTACCAGGTTTCAGT------CTTATACTTCTACATCTTATCTCATGCAGTTAACCACGCAAAAAAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGTCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAAT-CATCCGAA-----------AAATCAAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTCTTTTCAGGTGCTTTTGTATTACCCCTCTCTTCTACTTATACTCTACATCTATGCCGTATTTGGCATTCCCTTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAAAGAAGTGATATCGGACATATCTTCACGGGTGTGATGAAAAATTGGAAGGGGAAGGGAAGACGCAAGTAGTTCAAGCCAATGACATGATTACTACCGGGA--------CAAA-TTTTATATCC--AACCCGGTGTTGGGTT-----AGGGGTTGACCGCCGATTTCACGCCACAAATTTGATCTAACCCCCC-ACGATCCTTCCCAAAAG-----ATGATTGCAGCTCGGCACTTTATCGAGGATCAAGTCGGGAAATGTTTTACTTGAGTCGATGCTTCCTCGACAAAACCCAAATTAGTAAGTATTTACTACATCAGCAAGTATTTACTAA----------------------------------------------------------TTCGGGTTTCACGTTGTCCGATGAAACAGGTGATTCAGCTCTTTCGACCACGGTGGTTAAACATTCGCAGCTTTTTCTTC------TCATTTTATTCATACAATGAAAATATAACTATTAATACATTGAA-----------------------TCTTTTGAATAAAATTCATTATGAAAAGTAATGCTTGGGAGTTACTGTGACGAAGACAACTTCTGGATCCCTTCCTAAATTTGACGTATTACAGAAAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTACTTCTCCTCCCATTCAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTAGATAGACGAGACG------------TCGGTTTGGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCAATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTTATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCATGTACTTCTACAAACAATATGTCTAATTTTGGGGATACCTCTTTCGTGTCGGTTAGCTGCTGAAACAAATAACAACTCGAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTTGGAAGATAGATTACCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCACAGAATCTTCATCTAGAAACTCCGGTTCGCTTGTTTCGCCGACGAATTGGGGATGTGACATTTCCACATCTATTAAGGGTAGTTTTTCACACATACAAAACTTTGTGTGGAAAATCTATTCAGTTTCGGTCTTGGAAACAAAGAGAACGGAGAAGTATTGACATGCTACTCCGAAATTTTTACACTTACGAAATCGATTCGATATTGCTAGTTTTATGGACACGAATGCATGAGTCAAACCCAAGATATTTTGTATCTCCCGATCGGAATAACATGACCAGAAAGAAGATACGTGTTTCTGAATATAATTCTCGATCAGACGCGATAAGCATCGACCGCTGTCTCACTCGAAGTTTGTGCATCCACCTTGGGAGATGTAGAAACAAATCTCTCATAGCTTTTCGTGGAACTCAATATTTCGCAAAAAAATGGATTTATTACCTTTCGATATTTCTCAGATCTCATTTTCATTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGCGTCTTATTCTTAGGTTACATCTCAGCTATTCAGCCAGTCTCGGGAAACGTCCAGGTCGAAACCACAGTGGATTCTTACGGCAGT------CTTTTGGGTGGAGAAGGAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAAAAAGAGAAGTTCTGCGATAGTACTGGACATCCAGTTAGTAAATTAGCCCGGACTGTATTAACAGATGATGAGATTTTGAACAGGTTTGTAAAAATTTGGAATACTTTTTCCTCGTACCACAGCGCTTCAATAAATCGAGATGGATTGCGTAGATCGAGATATATATCGCTGGTGTCAAAGATTACCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAGCCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCCTACGCTTGGAAGACCTCCGAATTCCCCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGCATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATTAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAGGGGCATTACCTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGGGAGTTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAATGGACTGCTTCTTCATATTCACCGTGCGATGCATGCCGTGATCGATAGACAACGAAATCACGGTATACATTTCCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTCGGCAAACTAGAAGGGGAACGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGACTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Athyrium_niponicum -----------------------------------------------TATATTTTTCAAC------TCC-AGCTTTTT-GCCTAGTCA-AACC----GTTGATCTCGCCTTCATCGATCTGTTTGATACAATAT------CGCTTCCAGTAAA-T------AAAGTCTGGA--GGGGGAAGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAAGCCTGAATGGCTCACCTGCGAAGTGTTTC-------------------------------GGAAAGACCAAAGAAAAGGAA------ATTGAAGCGGTTTCCGTATTTT--------------GCTTCCGAACAAATTGACAAATTGTGTGAATCCGAGCAACCTGAAATGGGTTAATTAAAGTTTATGGGTTAATTAAAGTTTCTCGTTGGGGATAGAGGGAGTCGAACCCTCACGGTC----GAAACCAACGGATTTTCGTTCTACTGCAACTTGCGCCGCTATTTCTTACTTCATCAAGTGTGTAGAATGGGACTCTACCTCCATTCACG-----AAAGTATCACTTTTT-GCTACTGGCTCGCTTGTTGAGTAATTTTCATTGGAATGGAGTGGGATCCCGCAACAGGACAGGTAAGAGAGGAATATGCAGACTGGCA-ATAGTAGAAGGGGTCTACTTAGTATTGCATTATCAAG------TACGAACAGAATTTCGTGAATGAATGCTGGGC--------CCAAACCGAGGGGTCCGCGTCC-----------GACTAA--AAT-AAAAAATGAAAATTTCATTTCTTTACCAAGTTTCAGT------CTCATACTTCTACACCTTATCCCATGCAGTTAACCACGCAAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATCTGAATAATACAAGA-AAATCAAAATTTAGGAGAATCTAATGGGCCCAGCTTACAGCTCTTTTCAGGTGCTTTTGTACTACCCCTCTTTTTTACTTATACTCTACATCTATGCCGTATTTGGCATTCCCTTAAGAAGTAGATTATTTCGTAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAAAGAGGTGATATCGGACACATATTTACGGGTGTGATTAAAAAGTGGAGGAGGAAGGGAAGACGCAGGTAGTTCAAGCCAATGACATGATTACCGCCGGGA--------CAAACTTTTTTATTC--AACCCAATGTTGGGTT-----AGGGATTGGCCGCCGATTTCATGCCATAAGTTTGATCTAACTCCCC-ACGATCCTTCCCAAAAT-----ATGATTGCAGCTCGGCACTTTATCGAGGATCAAGTCGGGAAATGTTTTATTTGGGTGGATGTTTACTCGACAAAACCCGAATTAGTAAGTATTTACTACATTAGTAAGTATTTACTAT----------------------------------------------------------TTTGGGTTTCACGTTGTCCGATGAAACAGGTGATTCAGTTCTTTCAACTACAGTAGTTAAACATTTGCAGCTTTTTTTT-------CTATTTTATTCATACAATGGAAATATAACTATTAATACATTGAA-----------------------TCTTTCGGATGAAATTCATTATGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTCTGGATCCCCTCCTAATTTTGATGTATTACAGAAAAGCGAAGGGCTTAGCGCTATTCGAGATTGTTTCCCATATCTACTTCTTTTCCCATTCAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTAGATAGACGAGACG------------TCGATTTAGTATTCGGGGCGTGTAGTGCAGCAGCAGCAAAGCGTTCAATTGATAGTGTGCGTTACCAAGATTATTCGGAGATTTTCTATTCGGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATATCCATGTACTCCTACAAACAATATGTCTAATTTCGGGGATACCTCTTTCGTGTCGGTTAGCTGCTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCGATATTTTTATTTCTGGAAGATAGATTACCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCACGGAATCTTCATCTAGAAACTCCGGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGACATTTCCACATCTATTAAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGGAAATCTATTCAGTTTCGGTCTTGGAAACGAAGAGAACGGAGAAGTATTGACATGCTACTCCGAAATTTTTACACCTACGAAATTGATTCGATATTGCTAGTTTTATGGACACAAATGCATGAGTCAAACCCAAGATATTTTGTATTTACCGATCGAAATAACGTGACTAGAAAGAAAATACGTGTTTCTGAATCTAATTCTCGATCAGACGCGATAAGCATCGACCGCTGTCTCACTCGAAGTTTGTGCATCCACTTTGGGAGATGTAGAAACAAATCTCTCATAGCTTTCCGTGGAACTCAATATTTTGCAAAGAAATGGATTTATTACCTTTTGATATTTCTTAGATCTCATTTTCATTATCCAATTGAATTTAACCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCCTGGGTTACATCTCAGCAATTAAGCCAGTCTCGAAAAACGTCCAGGTCGAAACCGCAGTGGATTCCTGCAGCAGT------ATTTTGGGTGGAGAAGGAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAAGAGAAGTTCCGCGATAGTACTGGACATCCAGTTAGTAAATTAGCCCGGACTGTATTAGCAGATGATGAGATTTTGAACAGGTTTGTGAAAATTTGGAATACTTTTTCCTTGTACCACAGCGCCTCAGTAAATCGGGATGGATTGCGTAGATCGAGATATATATCGCTGGTGTCAAAGATTATCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAGCCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTTTACGCGCCCTACGCTTGGAAGACCTCCGAATTCCCCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGCATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAACTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAGGGGCATTACCTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGGGAGTTGGGTGCACCAATAGTCATGCATGACTATCTGACCGGAGGGTTTACCGCAAATACAAGCTTAGCTTTTTACTGCCGAGACAATGGACTGCTTCTTCATATTCACCGTGCGATGCATGCCGTGATCGATAGACAACGAAATCACGGTATACATTTCCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAACGGGAAGTCACTTTAGGTTTCGTCGATTTACTTCGTGACGACTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCCCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Athyrium_otophorum -----------------------------------AAATCACTGAATTTTATTTTTCAAC------TCC-AGCTTCTT-GCCTAGTCA-AACC----GTTGATCTCGCCTTCGTCGACCTGTTTGACACAGTAT------CGCTTCCAGTAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCACGTATATTAAAAGCCTGAATGGCTCACCTGCAAAGTGTTTC-------------------------------GGAGAGACCGAAGAAGATAAA------ATTGAAGTGGCTTCCGTATTTT--------------GCTTCCGA--------ACAAATTGTGTGAATCCGAACAACCTGAAATGGGTTAA------------------TTGAAGTGTCTCGTTGGGGATAGAGGGAGTCGAACCCTCACGGTC----GAAACCAACGGATTTTCGTTCTACTGCAACTTGCGCCGCTACTTCTTATCTCATTAAGTGTGTAGAATGGGACTCTACCTCCATTCGCG-----AAAGTATCATTTTCT-GCTACCGGCTCGCTTGCTGAATAATTTCCATTGGAATGGAGTGGGATCCTGCA-----ACAGGTAAGAGGAGAATATGCGGACTGGCA-ATAGTAGAAGGAGTCTACTTAGTGTTGCATTACCAAG------TACGAACAGAATTTCGTGAATGAATGCTGGGC--------CCAAACCGAGGGGTCCGCGTCC-----------AAATAA---GA-AAAGAATTAAAACTTTATTCCCTTACCGGGTTTCAGTCTTATACTTATACTTCCACATCTTATTCCATGCAGTTAACCACGCAAAAAAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATCTGAATAATACAAGA-AAATCAAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTCCTTTCAGGTGCTTTTGTATTACCCCTCTCTTCTACTTATACTCCACATCTATGCCGTATTTGGCATTCCCTCAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAAAGAAGTGATATCGGACATATCTTCACGGATGTGATGAAAAATTGGAAGAGGAAGGGAAGACGCAGGTAGTTCAAGCCAATGACATGATTACTACCGGGA--------CAAATTTTTATATCC--GACCCAGTGTTGGGTT-----AGGGGTTGACCGCCGATTTCACGCCACAAATTTGATCCAACTCCCC-ACGATTCTTCCCAAAAG-----ATGATTGCAGCTCGGTACTTTATCGAGGATCAAGTCGGGAAATGTTTTACTTGGGTCGATGCTTCCTCGACAAAACCCAAATTAGTAAGTATTTGCTACATTAGCAAGTATTTACTAA----------------------------------------------------------TTCGGGTTTCACGTTGTCCGATGAAACAGGTGATTCAGCTCTTTCGACCACGGTGGTTAAACATTCACAGCTTTTTCTTC------TCATTTTATTCATACAATGATAATATAATTACTAATACATTGAT-----------------------TCCTTCGAATAAAATTCATTATGAAAAGTAATGCCTGGGAGTTACTGTGACGAAGACAACTTCTGGATCCCTTCCTAAATTTGATGTATTACAGAAAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTACTTCTCCTCCTACTCAGAGATAATTTCTATTCAGTCGCTTGTAGGCGTTGTTTAGATAGACGAGACA------------TCGGTTTGGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCAATTGATAGTGTGCGTCACCAAGATTATTCAGAGATTTTTTATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCATGTACTTCTACAAACAATATGTCTAGTTTTGGGGATACCTCTTTCGTGTCGGTTAGCTGCTGAAACAAATAACAACTCGAAAATTTCACAGTCTATCCATTCAATATTTTTATTTCTGGAAGATAGATTACCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCACAGAATCTTCATCTAGAAACTCCGGTTCGCTTGTTTCGCCGACGAATTAGGGATGTGACATTTCCACATATATTAAGGGTAGTTTTTCACACGTACAAAACTTTGTGTGGAAAATCTATTCAGATTCGGTCTTGGAAACAAAGAGAACCCAGAAGTATTGACACGCTACTCCGAAATTTTTACACTTACGAAATCGATTTGATATTGCTAGTTTTATGGAAACGAATGCATGAATCAAACCCGAGATATTTCGTATCTCCCGATCGGAATAACATGACCAGAAAGAAGATACGTGTTTCTGAATATAATTCTCGATCAGACGCGATAAGCGGCGACCGCTGTATCACTCGAAGTTTGTGCATCCACCTTGGAAGATGTAGAAACAAAAATCTCATAGCTTTTCGTGGAACTCAATATTTCGCAAAAAAATGGATTTATTACCTCTCGATATTTCTCAGATCTCATTTTCATTATTCAATTGAATTTACCCAAATACGTATCAATTTGTTACCCGCCAGCTGCGTCTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGGGAAACGTCCAGGTCGAAACCACAATGGATTCTTACGGCAGT------CTTTTGGGTGGAGAGGGAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAAAAAGAGAAGTTCTGCGATAGTACTGGACATCCAGTTAGTAAATTAGCCCGGACTGTATTAACAGATGATGAGATTTTGAACAGGTTTGTAAAAATTTGGAATACTTTTTCCTTGTACCACAGCGCCTCAATAAATCGAGATGGATTGCGTAGATCGAGATATATATCGCTGGTGTCAAAGATTATCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAGCCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTTTACGCGCCCTACGCTTGGAAGACCTCCGAATTCCCCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGCATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAACTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAGGGGCATTACCTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGGGAGTTGGGTGCACCAATAGTCATGCATGACTATCTGACCGGAGGGTTTACCGCAAATACAAGCTTAGCTTTTTACTGCCGAGACAATGGACTGCTTCTTCATATTCACCGTGCGATGCATGCCGTGATCGATAGACAACGAAATCACGGTATACATTTCCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAACGGGAAGTCACTTTAGGTTTCGTCGATTTACTTCGTGACGACTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCCCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Athyrium_skinneri TCGGCCCGATTCATTTACGGATAAAACTCACCTATAAATCAGTGAAGTATATTTTTCAAC------TCC-AGCTTTTT-GCCTAGTCA-AACC----GTGGATCTCGCCTTTATCAACCTGTTTAATACAATAT------TGCTTCCAGTAAA-T------AAAGTCTGGA--------GGGGGGGGGGGCTCGATTGAGCCATTCATGTATATGAAAAGCTTGAATGGCTCACCTGCAAAGTGTTTT-------------------------------GGAAAGACCGAAGAAAAAAA-------AGTGAAGTGGCTTCCGTATTTT--------------GCTTCCGA--------ACAAATTGTGTGAATCCGAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCGTTGGGGATAGAGGGAGTCGAACCCTCACGGTC----GAAACCAACGGATTTTCGTTCTACTGCAACTTGCGCCGCTACTCCTTATTCTATTAAGTGTGTAGAATGGGACTCTACCTCCATTCACG-----AAATTATCATTTTTT-GTTACCGGCTCGCTTGCTGAATAATTTTCATCGGAATAGAGTGGGATCCCGCA-----ACAGGTAAGAGAAAAATATGTGGACTGGCA-GTAGTAGAAGGAGTCTAATTAGTGTCGCATCACCAGG------TACGAACATAATTTTGTGAATGAATGCTGGGC--------CCAAACCGAGGGGTCCGCGTCC-----------GAATAA---AA-AAAGAATTGAAATTTCATTTCCTTACCAGGTTTCAGT------CTTATACTTCTACATCTTATCCTATGCAGTTAACCACGCGAAACAGTTAGATTTTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATCTGAATAATACAAGA-AAATCAAAATTTAGGAGAATCTAATGGGCCCAGCTTACAGCTCTTTTCAGGTGCTTTTGTACTACCCCTCTTTTTTACTTATACTCTACATCTATGCCGTATTTGGCATTCCCTTAAGAAGTAGATTATTTCGTAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAAAGAGGTGATATCGGACACATATTTACGGGTGTGATTAAAAAGTGGAGGAGGAAGGGAAGACGCAGGTAGTTCAAGCCAATGACATGATTACCGCCGGGA--------CAAACTTTTTTATTC--AACCCAATGTTGGGTT-----AGGGATTGGCCGCCGATTTCATGCCATAAGTTTGATCTAACTCCCC-ACGATCCTTCCCAAAAT-----ATGATTGCAGCTCGGCACTTTATCGAGGATCAAGTCGGGAAATGTTTTATTTGGGTGGATGTTTACTCGACAAAACCCGAATTAGTAAGTATTTACTACATTAGTAAGTATTTACTAT----------------------------------------------------------TTTGGGTTTCACGTTGTCCGATGAAACAGGTGATTCAGTTCTTTCAACTACAGTAGTTAAACATTTGCAGCTTTTTTTT-------CTATTTTATTCATACAATGGAAATATAACTATTAATACATTGAA-----------------------TCTTTCGGATGAAATTCATTATGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGAGAGCTTCTGGATTCCCCCCTAAATTTGATGTATTACAGAAAATCGAAGGGCTTAGCGCTAATCAAGGTTGTTTCCCATATCTACTTCTTTTCTTATTCAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTATTTAGATAGACGAAACA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCAATTGATAGTGTGCGTCACCAAGATTATTCAGAGATTTTTTATTCAGAATTTGTCTGAAAATGAAGCAGTCGACTTGACATAGATCTATATCTCCATGTACTCCTACAAACAATATGTCTAATTCTGGGGATACCTCTTTTGTGTCGGTTAGCTGCTGAAACAAATGACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTCTGGAAGATAGATTACCAAAATCTAGCCACGTTTTAGAGATAGATATGTCACAGAATCTTCATCTAGAAACTCCGGTTCGCTTGTTTCGTCGACGAATTAAGGATGTGACATTTCCACATCTATTAAGGATAGTTTTTCACACGTACAAAATTTTGTGTGGAAAATCTATTCAGTTTCGGTCTTGGAAACAAAAAGAACGGAGAAGTGTTGATATGCTACTCCGAAATTTTTACACTTACGAAATTGATTTGACATTGCTAGTTTTATGGACACGAATGCAGGAGTCAAA---AAGATATTTTGTATCTCCCGATCGGACTAACATGGCTAGAAAGAAAATATGTGTTTCTGAATATAAATCTCGATCAGACGCGATAAGCATCGACCGCTGTCTCACTCGAAGTTTGTGCATCCACTTCGGGAGATGTAAAAACAAATCTCTCATAGCTTTCCGTGGAACTCAATATTTCGCAAAAAAATGGAATTATTACCTTCTGATACTTCTCAGATCTCATTTTCATTACCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTTGAAAAACGTCCAGGTCGAAACCGCAGTGGATTCCTACAGCAGC------ATTCTGAGTGGGGAGGTAATTTATCACAGGATTCCAATTTTGTTACTAGTTAAACTTTTGGAAAAAGAGAAGTTCTGCGATAGTACCGGACATCCAGTTAGTAAATTAGCCTGGACTGTATTAACAGATGATGAGATTTTGAACAGGTTTATAAAAATTTGGAATACTTTTTCCTTGTACCACAGCGCTTCAATAAATCGAGATGGATTGCGTAGATCGAGATATATATCGCTGGTGTCAAAGATTACCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTCCGAATGACCCCACAGCCCGGAGTACCGGCTGAGGAAGCTGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCATATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAACATGTTAACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCCTACGCCTGGAAGACCTTCGAATCCCCCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGCATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAGGGGCATTACCTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAGTTGGGTGCACCAATAGTCATGCATGATTATCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGTCGAGACAATGGACTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTCACCTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Cornopteris_opaca TCGGCC-GATTCATTTACGGATGAAACTCAACTAGAAATCAGTGAAGTATATTCTTCAAC------TCC-AGCTTTTT-GCCTAGCCA-AACC----GTCGATCTCGCTTCCATCGACCTGTTTAATACGATAT------CGCTTCCAGTAAA-T------AAAGTCTGGA--------GGGGGAGGGAGCTCGATTGAGCCATTCATGTATATTAAAAGCCTGAATGGCTCACCTGCAAAGTGTTTT-------------------------------GGAAAGACCAAAGAAAAGAAA------ATTGAAATGGCTTCCGTATTTT--------------GCTTCCGA--------ACAAATTGCGTGAATCCGAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCGTTGGGGATAGAGGGAGTCGAACCCTCACGGTC----GAAACCAACGGATTTTCGTTCTACTGCAACTTGCGCCGCCATTTATTATTTCATTAAGTGTGTAGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTCT-GTTACCGGCTCGCTTGTCAAATAATTTTCATCGGAATAGGGTGGGATCCCACA-----ACGGGTAAGAGAAGAATATGCGGACTGGCA-ATAGTAGAAGGAGTCTACTTAGTGTTGCATTACCAAG------TACGAACAGAATTTCGTGAATGAATGCTGGGC--------CCAAACCGAGGGGTCCGCGTCC-----------GAATAG---GA-AAAGAATTAAAATTTTCTTTCCTTACCAGGTTTCAGT------CTCATACTTCTCCATCTTATCCCATGCAGTTAACCACGCGAAACAATTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGTTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCCTATTGCCCGAAATTCATCTGAATAATACAAGA-AAATCAAATTTTAGGAGAATCTAATGGGCCCAGCTTACATCTCTTTTCAGATGCTTCTGTATTACCCCTCTCTTTTACTTATACTCTACATCTATGCCGTATTTGGCATTCCTTTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAAAGAAGTGATATCGGACATATCTTCACGGGTGTGATGAGAAATTGGAAGAGGAAGGGGAGACGCGGGTAGTTCAAGCCAATGACATGATTACTACCGGGA--------CAAACTTTTCCATCC--AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCATGCCATAAATTTGGTCTAACTCCCC-ACGATCCTTCCCAAAAG-----ATGATTGCAGCTCGGCACTTTT------ATCAAGTCGGGAAATGTTTTACTTAGCTCGATGCTTCCTGGACAAAACCCGAATTGGCAAGTATTTACTACATCAGTAAGTATTTACTAA----------------------------------------------------------TTCGAGTTTCACGTCGTCCGATGAAACAGGTGATTCAGCTCTTTCGACCACAGTGGTTAAACATTTGCAGCTTTTTTTTTT-----TCATTTTATTCATACAATGAAAATATAACTACTAATACATTGAA-----------------------TCTCTCGGATAAAATTCATTATGAAAAGTAATGCCTGGGAGTTACTGCGATGAAGACAACTTCTGGATCCCTTCCTAAATTTGATGTATCACAGAAAAGCGAAGGGCTTAGCGCTAATCAAGATTGTTTCCCATATCTACTTCTCCTCCTACTCAGAGATAATTTCCATTCAGTCGCCTGTAAGCGTTGCTTAGATAGACGAGACG------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACGAAGCGTTCAATTGATAGTGTGCGTTACCAAGATTATTCGGAGATTTTTTATTCGGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCATGTACTTCTACAAACAATATGTCTAATTTTGGGGATACCTCTTTTGTGTCGGTTAGCTGCTGAAACAAATAACAACTCGAAAATTTCACAATCTATTCATTCAATATTTTTATTTATGGAAGATAGATTACCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCACAGAATCTTCATCTAGAAACTCCGGTTCGCTTGTTTCGCCGACGAATTAGGGATGTGACATTTCCACATTTATTAAGGATAGTTTTTCACACGTACAAAACTTTGTGTGGAAAATCTATTCAGTTTCGATCTTGGAAACAAAAAGAACGGAAAAGTATTGACACGCTACTTCGAAATTTCTACACCTACGAAACTGATTCGATATTGCTAGTTTTATGGACACGAATGCATGAGTCAAACCCAAGATATTTTGTATCTCCCGATCGGAATAACATGACTAGAAAGAAAATACGTGTTTCTGAATATAACTCTCGATCAGACGCGATAAGCATCGACCGCTGTCTCACTCGAAGTTTGTGCATCCACTTTGGGAGATATAGAAACAAATCTCTCACAGCTTTTCGTGGAACTCAATATTTCGCAAAAAAATGGATTTATTACGTTTTGATATTTCTCAGATCTCATTTTCACTATCCAATTGAATTTACCCGGATACGTATCAATTCGTTATCCACCAGCTGTGTCTTATTCTTGGGTTACATTTCAGCTATTCAGTCAGTCTCGAGAAACGTCCAGGTCGAAACCGCAGTGGATTCTCACAGCAGT------CTTTTGGGTGGAGAAAGAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGAAGAAAGAAAAGTTCTGCGATAGTACTGGACATCCAGTTAGTAAATTAGCTTGGACTGTATTAACAGATGATGAGATTTTGAACAGGTTTGTAAAAATTTGGAATACTTTTTCCCTGTACCACAGCGCCTCAATAAATCGAGATGGATTGCGTAGATCGAGATATATATC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACTCCGCAGCCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCTGTCGCTGGAGAGGAAAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATCCGTTCACCTCCATTGTAGGTAATGTTTTCGGGTTTAAGGCTCTACGCGCCCTACGCTTGGAAGACCTTCGAATCCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGCATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTATCTGCTAAAAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAAGCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAGTTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTCACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAATGGACTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGACGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGACTATATTGAGAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCAGGTGTACTCCCTGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCCCTAACCGAAATCTTCGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAG Deparia_acrostichoides ----------------ATAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCCTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGAGGGGGGGGGGGGGAGGGGGCTCGACTGAGCCATTCATGTATATTAAAATGCCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAAGACCAAGTCGAAAAAGGA----ATTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATTCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCAGACTAGCC-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC---------CAAAACGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTTAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAGACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTCGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCTTCCCTCCTACTTATAATCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGACATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAAAGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTTCCAAAAG-----ATGGTTGCAGCTCTGCGCCTCATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCATGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTCTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCCTGTAGGCGTTGTTTGGATAGACGAGGCG------------TCGGTTTAGTATTCGGGTCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATTTCCACGTACTTCTACAATCAATATGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTTGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTCTTCACACGTACAAAACTTCGTGTGGAAAATTTAATAAACTTGGGTCTCGTAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAAGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTATCGATCAAACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTACTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATAAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAAAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACGAAAGATACCGATATCTTAGCAGCCTTCCGCATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTACCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTAGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_acuta TCGGCC-GACTCATTTAGAGATAAAACTCAACTATAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTTTTTC-------------------------------GGAAAGACCAAGTCGAAAAAGGA----AGTGAAGTGGTTTCCGTATTTC--------------GTTTACGA--------GCAAATTGTGTGAATTCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTATCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAGTAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCAGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC---------CAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTAAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAGACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTCGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTCTGTATTACCCCTCCCTCCTACTTATACTCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAGCGTTGGGTT-----AGGGGTTGATCGCCGATTTCACAACATAAATTTGGTCCAACTCCCC-ACAACCTTTCCCAAAAG-----ATGGTTGCAGCTCTGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTGCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGGGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCCTGTAGGCATTGTTTGGATAGACGAGGCG------------TCGGTTTAGTATTCGGGTCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACATCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTTATTTTTGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTCTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAACTTCGGTCTCAGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAAGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTCCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTACTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAACCAGTCTCAAAAAATGTTCGGGTTGAAACTGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAAGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGCATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATCTGTTCACCTCCATTGTAGGTAACGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACTAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGATTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_aff._glabrata TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CCCCTCCGGCAAA-T------AAAGTCTGTA--------GGGGGGGGGGGCTCGATTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTATTTC-------------------------------GGAAAGACCAAGTAGAAAAA----------GAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ATAGGTAAGGGAAGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAGACTAAGTACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTCATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGATTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTTACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAGTTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTCAGTAGTTACTAC---------------------------------------------------------CCCCGAGTTTCACGCCGTCCGATGAAACAAGTGACTCAGCTTCTTCGGCTGCAATGGTTAAGCAGCTGCAGTTTTTTTTTTC-----CTATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATACTTGGGAGTTACTGCGATGAAAACAACTTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTCTTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGACTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTTTAATTTTGGGGATACCTCCTCTGCGCCGGTTATCTGCTCAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTTGGAAGACAGGTTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCTAGTTCGCTTGTTTCGCCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTCTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAGAGAACGTAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAAGACGTGTTTCTGGATATAGTTTCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAAAACCAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATATCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC---------AAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTTCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_aff._jiulungensis TCGGCT-GACTCATTTAGAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCATGTATATTAAAATGCCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAAGACCAAGTCGAAAAAGGA----ATTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATTCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCTCGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCAGACTAGCA-CTAGTGGAAGGAATCTACTTTGTGTTACATTACTAGG------TACGAACATAATTTCGTGAATGAGTGCTGGCC---------CAAAACGAAAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAGACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTCGAATAATACAAGA-AAATTGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAGAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAAAGTTGGGTC-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTTCCAAAAG-----ATGGTTGCAGCTCTGCGCCTTATCGAGGATCGAGTCGGTAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAGGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCATGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTCCGGACCCCTTCCTAAATTTGATGTATCACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTACATCTTCTCCTACTTAGAGATAATTTTTATTCAGTCGCCTGTAGGCGTTGTTTGGATAGACGAGGCG------------TCGGTTTAGTATTCGGGTCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAGGCGATATGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTCATTTTCGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTCTTCACACGTACAAAACTTCGTGTGGAAAATTTAATAAACTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAAGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTACTACCTCTCGATACCTCTCAGATGTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATAAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC------------------------------TACACCCCCGAATACAAAACCAAAGATACCGATATCTTAGCAGCCTTCCGCATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTACCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTAGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_auriculata TCGGCC-GACTCATTTAGAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTTTTTC-------------------------------GGAAAGACCAAGTCGAAAAAGGA----AGTGAAGTGGTTTCCGTATTTC--------------GTTTACGA--------GCAAATTGTGTGAATTCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTATCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCAGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC---------CAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAATAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAGACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTCTGTATTACCCCTCCCTCCTACTTATACTCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAGCGTTGGGTT-----AGGGGTTGATCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAG-----ATGGTTGCAGCTCTGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTGCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTCGGATGAAATTCATTACGAGAAGTAATGCTTGGGGGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCCTGTAGGCGTTGTTTGGATAGACGAGGCG------------TCGGTTTAGTATTCGGGTCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACATCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCAAAGTCTATTCATTCAATATCTTTATTTTTGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTATTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAACTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAAGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGTAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTCCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTACTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCAAAAAATGTTCGGGTTGAGACTGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAAGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAAGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGCATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATCTGTTCACCTCCATTGTAGGTAACGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGATTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_biserialis TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AGTC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCCGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTTGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAGGTATCATTTCTT-GCCACCAGCTCGCTTGCTTAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTATATCTATGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTGACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCCC-AATCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGATCTAACTCCCC-ACAATCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGA--------ATAT-----------GGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------ATATTTCATTCATATAATGAAAATAAAGCTACTACTACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATTTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGAGAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACAAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTCTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATATGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTATTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATTTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAATAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGACTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_bonincola TCGGCC-GACTCATTCACAGATAAAACTCAACTAGAAATCGGTGAAGTTTCTTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATTGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTTTTTC-------------------------------GGAAATACCAAGTAGAAAAAAGA----GTTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACGTCACGGAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTACACATCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTGCCCCTCCCTCCTACTTATACTCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTAAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTGTTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------CTATTTTATTCATATAATGAAAATATAGCTACTAATATATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTTGGATCCCTTCCTAAATTTGATGTATTACGGGGAAACGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTAGATAGACGAAGCG------------TCGGTTTAGTATTTGGGGCGTGTAGTGTAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGCTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATACGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTCATTTTTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTATGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAATTACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCCCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACGTCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAACAGT------ATTTTGGGTGGGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCCTGGAGAAGGAAAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCTGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAAGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_boryana TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTGTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CCCCTCCGGCAAA-T------AAAGTCTGTA---------GGGGGGGGGGCTCGATTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTATTTC-------------------------------GGAAAGACCAAGTAGAAAAAGAA----ATTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ATAGGTAAGGGAAGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAGACTAAGTACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTCATGGGCCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGATTACTGGTTTTCCATCAAAACCTCCTTTGAGAGGGGTGATATCGGACATATCTTTACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAATGTTGGGTT-----AGGGGTTGACCACCGATTTCACAATATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTCAGTAGTTACTAC---------------------------------------------------------CCCCGAGTTTCACGCCGTCCGATGAAACAAGTGACTCAGCTTCTTCGGCTGCAATGGTTAAGCAGCTGCAGTTTTTTTTTTT-----CTATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATACTTGGGAGTTACTGCGATGAAAACAACTTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTCTTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGACTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTTTAATTTTGGGGATACCTCCTCTGCGCCGGTTATCTGCTCAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTTGGAAGACAGGTTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCTAGTTCGCTTGTTTCGCCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACGGAGAGAACGTAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAAGACGTGTTTCTGGATATAGTTTCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAGAACCAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTTCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACGGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTTCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_cataracticola TCGGCC-GACTCATTCACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACAAACCGTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTTCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAGTAGAAAAAAGA----GTTGA-----------TATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACTTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAGTGGGACTCTACCTCCATTCACG-----GAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATTGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATAAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCAAATTAGCAAGTGTTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------CTATTTTATTCATATAATGAAAATATAGCTACTAATACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAACGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTTTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTAGATAGACGAGGCA------------TCGGTTTAGTATTTGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTTATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATACGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTCATTTTTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTATGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACAGAGAAGTATTGATACGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAATTACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACTCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAACAGT------ATTTTGGGTGGGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGA----------------CAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_concinna TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----ATTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------TGCCTTCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAGTAGAAAAAAGA----GTTGAAGCGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACTTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATCATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCAAACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGGGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATAATCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGATTATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTCACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTCCCCCCC--AACCC----TTGGGTT-----AGGGGTTGACCGCTGATTTCACAACATAAATTTGGTTTAACTTCCC-ACAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGTGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGAATGCTTCCCCGACAGAAACCTAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTACATTGGTAAGTATTTACTAC--------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATCGAA-----------------------TATTTTGAATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGAATCCTTTCCTAAATTTGATGTATTGCGGGGAAGCGAAGGGCTTAGCGCTAATCAAGATTGTTTCCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAAAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTCTACACTTACGAGGTTGATTTGATCTTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATTCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATCGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAGAAATGTTCGGGTTGAAACTGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGGGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCCTGGAAAAGGATAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTTGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTACTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_confluens TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AGTC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCCGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTTGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAGGTATCATTTCTT-GCCACCAGCTCGCTTGCTTAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTATATCTATGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTGACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCCC-AATCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGATCTAACTCCCC-ACAATCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGA--------ATAT-----------GGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTTT-----ATATTTCATTCATATAATGAAAATAAAGCTACTACTACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATTTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGAGAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACAAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATATGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTATTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATTTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAATAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGACTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_conilii TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCCGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAAGTATCATTTCTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTCTAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTATATCTATGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTGACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATAATTACTATCGGGA--------CAAACTTTTCCCCCC--AATCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAG-----CTGATTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGAAATAT-----------GGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------CTATTTCATTCATATAATGAAAATATAGCTACTACTACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACAAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTATTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGTTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAACAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGATATTTTGAACAGGTTTCTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_coreana TCGGCC-GACTCATTTACAGATAAAACTTAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCGAAGTATTTC-------------------------------GGAAAGACCAAGTAGAAAAAGAA----GTTGAAGTGCTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAATCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ACAGGTAAGGGAAGAATATGCGGACTAGCC-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCAAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGACGACTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTAATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTTACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCCC-AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAA-----------TTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTAGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CCCCGGGTTTCACGCCGTCCGATGATACAAGTGACTCATCTTCTTCGGCTGCAGTGGTTAAGCAGCTGCAGTTTTTTTTT-------CTATTTCATTCATATAATGAAAATATAGCTACTAATATATGGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTATTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAGGGGCTTAGCGTTAATCGAGATTGTTTCCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTTGCTTGTAGGCGTTGTTTGGATAGACGAGGCT------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTTTAATTTTGGGGATACCTCCTCTGCGCCGGTTATCTGCTCAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCTAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAGAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAATAAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAAGACGTGTTTCTGGATATAGTTTTCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAGCAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC------------------------------TACACCCCCCAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTCATCGGCCCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_dickasonii TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----ATTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------TGCCTTCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAGTAGAAAAAAGA----GTTGAAGCGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACTTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATCATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCAAACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGGGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATAATCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGATTATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTCACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTCCCCCCC--AACCC----TTGGGTT-----AGGGGTTGACCGCTGATTTCACAACATAAATTTGGTTTAACTTCCC-ACAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGTGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGAATGCTTCCCCGACAGAAACCTAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTACATTGGTAAGTATTTACTAC--------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATCGAA-----------------------TATTTTGAATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGAATCCTTTCCTAAATTTGATGTATTGCGGGGAAGCGAAGGGCTTAGCGCTAATCAAGATTGTTTCCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAAAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTCTACACTTACGAGGTTGATTTGATCTTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATTCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATCGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAGAAATGTTCGGGTTGAAACTGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGGGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCCTGGAAAAGGATAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC-----------AGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTTGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTACTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_dimorphophylla TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTT--GCCCAGTCA-AGTC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCCGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTTGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAGGTATCATTTCTT-GCCACCAGCTCGCTTGCTTAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTATATCTATGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTGACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCCC-AATCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGATCTAACTCCCC-ACAATCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGA--------ATAT-----------GGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTTT-----ATATTTCATTCATATAATGAAAATAAAGCTACTACTACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATTTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGAGAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACAAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATATGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTATTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATTTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAATAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGACTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_dolosa TCGGCC-GACTCATTTAGAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTTTTTC-------------------------------GGAAAGACCAAGTCGAAAAAGGA----AGTGAAGTGGTTTCCGTATTTC--------------GTTTACGA--------GCAAATTGTGTGAATTCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTATCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCAGACTAGCA-GTAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC---------CAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAGACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTCGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTGTCGGGA--------CAAACTTTTCCCCCC--AACCCAGCGTTGGGTT-----AGGGGTTGATCGCCGATTTCACAACATAAATTTGGTCCAACTCCCC-ACAACCTTTCCCAAAAG-----ATGGTTGCAGCTCTGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTGCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTCGGATGAAATTCATTACGAGAAGTAATGCTTGGGGGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAAGGCTTAGCGCTAATCAAGATTGTTTTCCATATCTACATCTTCTACTATTTAGAGATAATTTTTATTCAGTCGCCTGTAGGCGTTGTTTGGATAGACGAGGCG------------TCGGTTTAGTATTCGGGTCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACATCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTTATTTTTGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTCTTCACACGTACCAAACTTCGTGTGGAAAATTTACTAAACTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAAGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTCCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTACTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCAAAAAATGTTCGGGTTGAAACTGCAGCGGATTCCTACAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAAGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGCATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTACCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATCTGTTCACCTCCATTGTAGGTAACGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGATTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_edentula TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CCCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCTTGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTATTTC-------------------------------GGAAAGACCAAGTAGAAAAAGAA----ATTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCAAAACAACCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ATAGGTAAGGAAAGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAAAATTGAAATTTTGATTCTTTACCAGGTCGCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCAAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTCATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTTATATCGGACATATCTTTACGAGTGTAATGAAAAATTGGAACAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAATTTTTCCCCCC--AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAATTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGTAAATATTTCATTTAGGTGGATGTTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTAGTTACTAC---------------------------------------------------------CCCCGGGTTTCATGCCGTCCGATGAAACAAGTGACTCAGCTTCTTCGGCTGCAATGGTTAAGCAGCTGCAGTTTTTTTTT-------CTATTTCATTCATAGAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAAACAACCTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTACTTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGACTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTTTAATTTTGGGGATACCTCCTCTGCGCCAGTTATCTGCTCAAATAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTTATTTTCGGAAGACAAATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGCCGACGAATTAGGGATGTGCCACTTTCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAGAGAACGTAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAAGACATGTTTCTGGATATAGTTTCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAGAACCAAATCTCTCATAGGTTTTCATGGAACTCAATATTTTGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTTCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_emeiensis TCGGCC-GACTCATTTAGAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCCTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTTTTTC-------------------------------GGAAAGACCAAGTCGAAAAAGGA----AGTAAAGTGGTTTCCGTATTTC--------------GTTTACGA--------GCAAATTGTGTGAATTCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTATCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAAGTATTATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCAGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC---------CAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAGACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTCGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGACTATTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAGCGTTGGGTT-----AGGGGTTGATCGCCGATTTCACAACATAAATTTGGTCCAACTCCCC-ACAAACTTTCCCAAAAG-----ATGGTTGCAGCTCTGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTGCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGGGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTACATCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCCTGTAGGCGTTGTTTGGATAGACGAGGCG------------TCGGTTTAGTATTCGGGTCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACATCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTTATTTTTGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTCTTCACACGTACAAAACTTCCTGTGGAAAATTTACTAAACTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAAGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTCCCGATCCGACGCAATAAGCATCGGCCGCCGTCTCACTCAAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTACTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCAAAAAATGTTCGGGTTGAAACTGCAGCGGATTCCTGCAACAGT------ATTTTGGATGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAAAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAAGTTTGTAGAAATTTGGAATACTTTCTCCTTGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGCATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATCTGTTCACCTCCATTGTAGGTAACGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCATGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGATTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_erecta TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----ATTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTTTAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAAGACCAAGTAGAAAAAGGA----ATTGAAGTGGTTTCTGTATTTC--------------GCTTACGA--------GCA-------TGAACCCAAACAACCTGAAATGCGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCTACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCGGACTAGCA-ATATTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGAAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAATTTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCGGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAAAGTTGGGTT-----AGGGGTTGACCTCCGATTTAAGAACATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAAAAACCAAATTAGCCAGTATTTACTACATTGGTAAGTATTTACCAC---------------------------------------------------------CTTCGAGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------ATATTTCATTCATATAATGAAAATATAGCTATTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAATTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGAAAGCGAAGGACTTAGCGCTAATCGAGATTGTTTCCCATATTTAATTCTTTTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCGGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCGCTTCCACATCTATCGAGGATAGTTTTTCATACGTACAAAACTTCGTGTGGAAAATTTACAAAGCTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATTTCCCGATCAGAATAACGTGACTAGAAAAAAAATATGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACCTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTAAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCTTACAACAGT------ATTTTGGGTGGGGAAGAAATTCATCCCAGGATTCCAATTTTGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCAATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGATATTTTGAACAGGTTTGTAGAAATTTGGAATATCTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGATTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGCGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGCGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTTGCGTTAGAAG Deparia_fenzliana TCGGCC-GACTCATTCACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAGTAGAAAAAAGA----GTTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAGTGGGACTCTACCTCCATTCACG-----GAAGTATCATTTTTT-GCCACTGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAAGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCC----TTGGGTT-----AGGG-TTGACCGCCGATTTCACAACATAAATATGGTCTAACTCCCC-ACAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCAAATTAGCAAGTGTTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------CTATTTTATTCATATAATGAAAATATAGCTACTAATACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCTCTTCCTAAATTTGATGTATTACGGGGAAACGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTATTTAGATAGACGAGGCA------------TCGGTTTAGTATTTGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATACGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTCATTTTTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTATGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACAGAGAAGTATTGATACGCTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAAGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAATTACGTGTTTCTGGATATAGTTCCCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAACAGT------ATTTTGGGTGGGGAAGAAATTCATCCCAGGATTCCAATTTTGCTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGCTGAGATTTTGAACAGGTTCGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAACCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCTCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGATGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_formosana TCGGCC-GACTCATTTACAGCTAAAACTCAACTAAAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAA------------GTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAAGACCAAGTCGAAAAAGGA----ATTGAAGTGGTTCCCGTATTTC--------------GCTTACGA--------GCA-------TGAACCCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTATTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTAAATAATTTTCATTGGAACAGGGTGGGATCTCACA-----GCAGGTCAGAGAGGAATATGCGGACTAGCA-TTAGTGGAAGGAATCTACTTTGTGTTACATT-----G------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAAC-GTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGTCCGGAATTCATTCGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACCTACTTAGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAATTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAAAGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAATTTTGGTCTAACTCCCC-ACAACCTCTCCCAAAAG-----ATGACTGCAGCTCCGCACCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGTTTCCTTGACAAAAACCGAATTAGCAAGTATTTACTACATTGGTAAGTATGTACCAC---------------------------------------------------------CTTCGAGTTTCACGCTGTCCGATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGAGGAAGCGAAGGTCTTAGCGCTAATCGAGATTGTTTCCCATATCTAAGTCTTTTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGCGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATACCTCTACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACGTATTCTGTGCCGGTTATTTGCTAAAACAAATAACAACTCAAAAATTTCAAAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAAATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAGTTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACGAAACTTCGTGTGTAAAATTTAAAAAGCTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTTGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATTTCCCGATCAGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATTAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCTAAAAAATGGATTTATTACCTCTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCTTACAACAGT------CTTTTGGGTGCGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCAATAGTACTGGACACCCGGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGATATTTTGAACAAGTTTGCAGAAATTTGGAATACTTTTTCCTCGTATTACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGATTGACCTACTACACCCCCGAATATAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCTGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTCCGAATCCCTCCTGCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGCGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGCTCGATAGACAACGAAATCACGGTATACACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTTGCGTTAGAAG Deparia_forsythiimajoris TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CCCCTCCGGCAAA-T------AAAGTCTGTA--------GGGGGGGGGGGCTCGATTGAGCCATTCATGTATATTAAAATTCCGAATGGCTCACTTGCAAAGTATTTT-------------------------------GGAAAGACCAAGTAGAAAAAGAA----ATTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGTTTGCTGAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ATAGGTAAGGGAAGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAGACTAAGTACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTCATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCTGTATTTTGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGATTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTTATATCGGACATATCTTTACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTCAGTAGTTACTAC---------------------------------------------------------CCCCGAGTTTCACGCCGTCCGATGAAACAAGTGACTCAGCTTCTTCGGCTGCAATGGTTAAGCAGCTGCAGTTTTTTTTTT------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATACTTGGGAGTTACTGCGATGAAAACAACTTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAAGGGTTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTCTTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGACTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTTTAATTTTGGGGATACCTCCTCTACGCCGGTTATCTGCTCAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTTGGAAGACAGGTTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCTAGTTCGCTTGTTTCGCCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAGAGAACGTAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAAGACGTGTTTCTAGATATAGTTTCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAGAACCAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCTAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGATATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCATACGCTTGGAAGACCTTCGAATCCCTCCTTCTTATTCTAAAACTTTCCTCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTTTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_glabrata ----------------ACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CCCCTCCGGCAAA-T------AAAGTCTGTA--------GGGGGGGGGGGCTCGATTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTATTTC-------------------------------GGAAAGACCAAGTAGAAAAA----------GAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ATAGGTAAGGGAAGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAGACTAAGTACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTCATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGATTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTTACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAGTTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTCAGTAGTTACTAC---------------------------------------------------------CCCCGAGTTTCACGCCGTCCGATGAAACAAGTGACTCAGCTTCTTCGGCTGCAATGGTTAAGCAGCTGCAGTTTTTTTTTTC-----CTATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATACTTGGGAGTTACTGCGATGAAAACAACTTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTCTTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGACTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTTTAATTTTGGGGATACCTCCTCTGCGCCGGTTATCTGCTCAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTTGGAAGACAGGTTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCTAGTTCGCTTGTTTCGCCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTCTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAGAGAACGTAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAAGACGTGTTTCTGGATATAGTTTCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAAAACCAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATATCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGAT--------------------------------------ACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTTCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_gordonii TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTATTTC-------------------------------GGAAAGACCAAGTAGGAAAAGAA----ATTGAAGCGGTTTCCGTATTTC--------------GTTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCCCGCTTGCTGAATAATTTTCATTGGGACAGAGTGGGATCCCACA-----GTAGGTAAGGGAAGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAAGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGATTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Deparia_hainanensis TCGGCC-GACTCATTTACAGCTAAAACTCAACTAAAAATCGGTGAAGTTTATTTT-CAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-G------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAAGACCAAGTCGAAAAAGGA----ATTGAAGTGGTTCCCGTATTTC--------------GCTTACGA--------GCA-------TGAACCCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTATTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTAAATAATTTTCATTGGAACAGGGTGGGATCTCACA-----GCAGGTCAGAGAGGAATATGCGGACTAGCA-TTAGTGGAAGGAATCTACTTTGTGTTACATT-----G------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAAC-GTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGTCCGGAATTCATTCGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACCTACTTAGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAATTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAAAGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAATTTTGGTCTAACTCCCC-ACAACCTCTCCCAAAAG-----ATGACTGCAGCTCCGCACCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGTTTCCTTGACAAAAACCGAATTAGCAAGTATTTACTACATTGGTAAGTATGTACCAC---------------------------------------------------------CTTCGAGTTTCACGCTGTCCGATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGAGGAAGCGAAGGTCTTAGCGCTAATCGAGATTGTTTCCCATATCTAAGTCTTTTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGCGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATACCTCTACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACGTATTCTGTGCCGGTTATTTGCTAAAACAAATAACAACTCAAAAATTTCAAAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAAATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAGTTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACGAAACTTCGTGTGTAAAATTTAAAAAGCTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTTGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATTTCCCGATCAGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATTAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCTAAAAAATGGATTTATTACCTCTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCTTACAACAGT------CTTTTGGGTGCGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCAATAGTACTGGACACCCGGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGATATTTTGAACAAGTTTGCAGAAATTTGGAATACTTTTTCCTCGTATTACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGATTGACCTACTACACCCCCGAATATAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCTGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATCTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTCCGAATCCCTCCTGCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGCGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGCTCGATAGACAACGAAATCACGGTATACACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTTGCGTTAGAAG Deparia_henryi TCGGCC-GACTCATTTACAGATAAAACTTAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTATTTC-------------------------------GGAAAGACCAAGTAGAAAAAGAA----GTTGAAGTGCTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAATCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ACAGGTAAGGGAAGAATATGCGGACTAGCC-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCAAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGACGACTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTAATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTTACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCCC-AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAA-----------TTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTAGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CCCCGGGTTTCACGCCGTCCGATGATACAAGTGACTCATCTTCTTCGGCTGCAGTGGTTAAGCAGCTGCAGTTTTTTTTT-------CTATTTCATTCATATAATGAAAATATAGCTACTAATATATGGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTATTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAGGGGCTTAGCGTTAATCGAGATTGTTTCCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTTGCTTGTAGGCGTTGTTTGGATAGACGAGGCT------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTTTAATTTTGGGGATACCTCCTCTGCGCCGGTTATCTGCTCAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCTAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAGAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGAAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAAGACGTGTTTCTGGATATAGTTTTCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAGCAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCCAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTCATCGGCCCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_heterophlebia TCGGCC-GACTCATTTGCAGCTAAAACTCAACTAAAAATCGGTGAAGTTTATTTTACAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTGATACAATAC------CGCCTCCAGCAAA-G-CAAAGAAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAAGACCAAGTCGAAGAAGGA----ATTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCA-------TGAACCCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTATTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTAAATAATTTTCATTGGAACAGGGTGGGATCTCACA-----GCAGGTAAGAGAGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATT-----G------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAAC-GTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGTCCGAAATTTATTCGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATAAAAACCTCCTTAGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAATTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAAAGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAATTTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAG-----ATGACTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGTTTCCTCGACAAAAACCGGACTAGCAAGTATTTACTACATTGGTAAGTATTTACCGC---------------------------------------------------------CTCCGAGTTTCACGCTGTCCGATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAAGTCTTTTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGCGCAGCAGCAACAAAGCGTTTGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATACCTCTACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACGTCTTCTGTGCCGGTTATTTGCTAAAACAAATAACAACTCAAAAATTTCAAAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAAATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTCTCGAGGATAGTTTTTCACACGTACGAAACTTCGTGTGTAAAATTTACAAAGCTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATTTCCCGATCAGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATTAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGAAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTCTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCTTACAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCAATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGATATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATTATAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGATTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATCTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTCCGAATCCCTCCTGCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGCGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGCTCGATAGACAACGAAATCACGGTATACACCTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTTGCGTTAGAAG Deparia_japonica TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AGTC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCCGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTTGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAGGTATCATTTCTT-GCCACCAGCTCGCTTGCTTAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAATTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTATATCTATGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTGACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCCC-AATCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGATCTAACTCCCC-AAAATCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGA--------ATAT-----------GGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTTT-----ATATTTCATTCATATAATGAAAATAAAGCTACTACTACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATTTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGAGAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACAAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCTGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATATGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTCTTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATTTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAATAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGACTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_jiulungensis TCGGCC-GACTCATTTAGAGATAAAACTCAACTATAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTTTTTC-------------------------------GGAAAGACCAAGTCGAAAAAGGA----AGTGAAGTGGTTTCCGTATTTC--------------GTTTACGA--------GCAAATTGTGTGAATTCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTATCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAGTAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCAGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC---------CAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTAAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAGACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTCGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTCTGTATTACCCCTCCCTCCTACTTATACTCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAGCGTTGGGTT-----AGGGGTTGATCGCCGATTTCACAACATAAATTTGGTCCAACTCCCC-ACAACCTTTCCCAAAAG-----ATGGTTGCAGCTCTGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTGCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGGGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCCTGTAGGCATTGTTTGGATAGACGAGGCG------------TCGGTTTAGTATTCGGGTCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACATCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTCATTTTTGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTCTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAACTTCGGTCTCAGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAAGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTCCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTACTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAACCAGTCTCAAAAAATGTTCGGGTTGAAACTGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAAGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCTTCAACAAATCGAGATG-------------------------------------------------------TACACCCCCGAATACAAGACCAAAGAAACCGATATCTTAGCAGCCTTCCGCATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATCTGTTCACCTCCATTGTAGGTAACGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACG{AT}AAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTTGTAGCAGAA{GT}CTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACTAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGATTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_kaalaana TCGGCC-GACTCATTCACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACAAACCGTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTTCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGGATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAGTAGAAAAAAGA----GTTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACTTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAGTGGGACTCTACCTCCATTCACG-----GAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATTGCCCGAAATTCATTTGAATAATACAAGAAAAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATAAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------TAAACTTTTCCCCCC--AACCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ATAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCAAATTAGCAAGTGTTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------CTATTTTATTCATATAATGAAAATATAGCTACTAATACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAACGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTAGATAGACGAGGCA------------TCGGTTTAGTATTTGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTTATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATACGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTCATTTTTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTATGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACAGAGAAGTATTGATACGTTACTCCGAAATTTTTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAATTACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACTCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGGGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTAAACACCCAGTTGCTAAATTAGCTTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTTGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_kiusiana TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAAGTATCATTTCTT-GCCACCAGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTATATCTATGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTGACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AATCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGA--------ATAT-----------GGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------CTATTTCATTCATATAATGAAAATATAGATACTACTACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACAAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAAAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTATTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAACAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_lancea TCGGCC-GACTCATTCACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGGGGGGGCTCGATTGAGCCATTCGTGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAGTAGAAAAAAGA----GTTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATT-------GTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAAGTATTATTTCTT-GCCACCGGCTCGCTTGCTGAATAATTTTCACTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGTAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTACTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAATATCCTTCGAGAGGGGTGATATCAGACATATCTTTACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGAGA--------CAAACTTTTCCCCCC--AACAC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTGTTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------CTATTTTATTCATATAATGAAAATATAGCTACTAATATATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCTCTTCTTAAATTTGATGTATTACGGGGAAACGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAATCGCTTGTAAGCGTTGTTTAGATAGACCAGGCA------------TTGGTTTAGTGTTTGGGGCGTGTAGTGTAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATTTCCACGTACTTTTACAAGCAATACGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTCTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTATGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAAAAGTATTGATACGCTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAATTACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGGGGAAGAAATTCATCCCAGGATTCCGATTTCGCTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAATTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTATTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGCATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_lobatocreneta ----------------ACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AGTC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCCGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTTGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAGGTATCATTTCTT-GCCACCAGCTCGCTTGCTTAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTATATCTATGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTGACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCCC-AATCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGATCTAACTCCCC-ACAATCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGA--------ATAT-----------GGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTTT-----ATATTTCATTCATATAATGAAAATAAAGCTACTACTACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATTTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGAGAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACAAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATATGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTATTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATTTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAATAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGACTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTTGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_longipes TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AGTC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTTGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAGGTATCATTTCTT-GCCACCAGCTCGCTTGCTTAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTATATCTATGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTGACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AATCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGATCTAACTCCCC-ACAATCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGA--------ATAT-----------GGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------CTATTTCATTCATATAATGAAAATAAAGCTACTACTACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGAGAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACAAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATATGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTATTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAATAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_macdonellii TCGGCC-GACTCATTTAGAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTTTTTC-------------------------------GTAAAGACCAAGTCGAAAAAGGA----AGTGAAGTGGTTTCCGTATTTC--------------GTTTACGA--------GCAAATTGTGTGAATTCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTATCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCAGACTAGCC-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC---------CAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTTATGCAGTTAACCACGCGAGACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTCGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAGCGTTGGGTT-----AGGGGTTGATCGCCGATTTCACAACATAAATTTGGTCCAACTCCCC-ACAACCTTTCCCAAAAG-----ATGGTTGCAGCTCTGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTGCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTTT-----ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGGGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCCTGTAGGCGTTGTTTGGATAGACGAGGCG------------TCGGTTTAGTATTCGGGTCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTTCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACATCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTTATTTTTGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTCTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAACTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAAGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTCCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTACTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCAAAAAATGTTCGGGTTGAAACTGCAGCGGATTCCTACAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAAGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGCATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAACCTGTTCACCTCCATTGTAGGTAACGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGATTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_marginalis TCGGCC-GACTCATTCACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACAAACCGTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTTCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGGATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAGTAGAAAAAAGA----GTTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACTTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAGTGGGACTCTACCTCCATTCACG-----GAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATTGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATAAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------TAAACTTTTCCCCCC--AACCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ATAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCAAATTAGCAAGTGTTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------CTATTTTATTCATATAATGAAAATATAGCTACTAATACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAACGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTAGATAGACGAGGCA------------TCGGTTTAGTATTTGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTTATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATACGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTCATTTTTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTATGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACAGAGAAGTATTGATACGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAATTACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACTCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGGGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCTTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTT?CAAGGGCCGATGCTACGACATTGAACCCGTTGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_medogensis TCGGCC-GACTCATTTAGAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTTTTTC-------------------------------GGAAAGACCAAGTCGAAAAAGGA----AGTGAAGTGGTTTCCGTATTTC--------------GTTTACGA--------GCAAATTGTGTGAATTCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTATCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCAGACTAGCC-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC---------CAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTTATGCAGTTAACCACGCGAGACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTCGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAGCGTTGGGTT-----AGGGGTTGATCGCCGATTTCACAACATAAATTTGGTCCAACTCCCC-ACAACCTTTCCCAAAAG-----ATGGTTGCAGCTCTGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTGCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTTT-----ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGGGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCCTGTAGGCGTTGTTTGGATAGACGAGGCG------------TCGGTTTAGTATTCGGGTCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACATCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTTATTTTTGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTCTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAACTTCGGTCTCGGAGACAGAAAAAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAAGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTCCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTACTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCAAAAAATGTTCGGGTTGAAACTGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAAGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC---------AAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGCATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTACCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATCTGTTCACCTCCATTGTAGGTAACGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGATTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_minamitanii TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----ATTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------TGCCTTCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAGTAGAAAAAAGA----GTTGAAGCGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACTTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATCATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCAAACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGGGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATAATCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGATTATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTCACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTCCCCCCC--AACCC----TTGGGTT-----AGGGGTTGACCGCTGATTTCACAACATAAATTTGGTTTAACTTCCC-ACAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGTGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGAATGCTTCCCCGACAGAAACCTAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTACATTGGTAAGTATTTACTAC--------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATCGAA-----------------------TATTTTGAATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGAATCCTTTCCTAAATTTGATGTATTGCGGGGAAGCGAAGGGCTTAGCGCTAATCAAGATTGTTTCCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAAAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTCTACACTTACGAGGTTGATTTGATCTTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATTCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATCGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAGAAATGTTCGGGTTGAAACTGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGGGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCCTGGAAAAGGATAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTTGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTACTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACCTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_okuboana TCGGCC-GACTCATTTACAGATAAAACTTAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTATTTC-------------------------------GGAAAGACCAAGTAGAAAAAGAA----GTTGAAGTGCTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAATCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ACAGGTAAGGGAAGAATATGCGGACTAGCC-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCAAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGACGACTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTAATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTTACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCCC-AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAA-----------TTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTAGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CCCCGGGTTTCACGCCGTCCGATGATACAAGTGACTCATCTTCTTCGGCTGCAGTGGTTAAGCAGCTGCAGTTTTTTTTT-------CTATTTCATTCATATAATGAAAATATAGCTACTAATATATGGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTATTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAGGGGCTTAGCGTTAATCGAGATTGTTTCCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTTGCTTGTAGGCGTTGTTTGGATAGACGAGGCT------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTTTAATTTTGGGGATACCTCCTCTGCGCCGGTTATCTGCTCAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCTAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAGAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGAAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAAGACGTGTTTCTGGATATAGTTTTCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAGCAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC------------------------------TACACCCCCCAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTCATCGGCCCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_omeiensis TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----ATTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------TGCCTTCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAGTAGAAAAAAGA----GTTGAAGCGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACTTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATCATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCAAACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGGGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATAATCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGATTATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTCACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTCCCCCCCCCAACCC----TTGGGTT-----AGGGGTTGACCGCTGATTTCACAACATAAATTTGGTTTAACTTCCC-ACAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGTGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGAATGCTTCCCCGACAGAAACCTAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTACATTGGTAAGTATTTACTAC--------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATCGAA-----------------------TATTTTGAATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGAATCCTTTCCTAAATTTGATGTATTGCGGGGAAGCGAAGGGCTTAGCGCTAATCAAGATTGTTTCCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAAAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTCTACACTTACGAGGTTGATTTGATCTTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATCGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAGAAATGTTCGGGTTGAAACTGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGGGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCCTGGAAAAGGATAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTTGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTACTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_otomasui TCGGCC-GACTCATTCACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATTGATCTGCTTAATACAATAC------CACCTCCAGCAAA-T------AAAGTCTGGG--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------AGAAATACCAAGTAGAAAAAAGA----GTTGAGTTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCCGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCTGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTTAATAATTTTCATTGGAAAAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTACACATCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTATACCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTTCCCCCC-AACCC----TTGGGTTAGGTTAGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGATATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTGTTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCGCGCTGTCCAATGAAACAGGTGACTCAGCCTCTTTGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------CTATTTTATTCATATAATGAAAATATAGCTACTAATATATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCTCTTTTTAAATTTGATGTATTACGGGGAAACGAAGGGGTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAATCGCTTGTAAGCGTTGTTTAGATAGACCAGGCA------------TTGGTTTAGTGTTTGGGGCGTGTAGTGTAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATTTCCACGTACTTTTACAAGCAATACGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTCTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTATGGAAAATTTACTAAGCTTCGATTTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGCCAAACCCAAGGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAATTACGTGTTTCTGGATATAGTTCTCGACCAGATGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAGTATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTCAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACGTCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAACAGT------ATTTTGGGTGGGGAAGAAATTCATCCCAGGATTCCAATTTCGATACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGA--------------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCTGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTTGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAAGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACATGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTAGGACATCCTTGGGGAAATGCACCCGGTGCGGTCGCCAACCGAGTCGCATTAGAAG Deparia_parvisora TCGGCC-GACTCATTTACTGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGATTGATACAATAC------CCCCTCCGGCAAA-T------AAAGTCTGTA-----------GGGGGGGGCTCGATTGAGCCATTCATGTATATTAAAATTCCGAATGGCTCACTTGCAAAGTATTTT-------------------------------GGAAAGACCAAGTAGAAAAAGAA----ATTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ATAGGTAAGGGAAGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAGACTAAGTACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTCATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCTGTATTTTGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGATTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTTATATCGGACATATCTTTACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTCAGTAGTTACTAC---------------------------------------------------------CCCCGAGTTTCACGCCGTCCGATGAAACAAGTGACTCAGCTTCTTCGGCTGCAATGGTTAAGCAGCTGCAGTTTTTTTTTT------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATACTTGGGAGTTACTGCGATGAAAACAACTTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAAGGGTTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTCTTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGACTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTTTAATTTTGGGGATACCTCCTCTACGCCGGTTATCTGCTCAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTTGGAAGACAGGTTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCTAGTTCGCTTGTTTCGCCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAGAGAACGTAGAAGTATTGATACGCTGCTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAAGACGTGTTTCTAGATATAGTTTCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAGAACCAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCTAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGATATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC--------CAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCATACGCTTGGAAGACCTTCGAATCCCTCCTTCTTATTCTAAAACTTTCCTCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTTTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_petersenii_deflexa TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AGTC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTTGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAGGTATCATTTCTT-GCCACCAGCTCGCTTGCTTAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCAAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTATATCTATGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTGACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AATCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGATCTAACTCCCC-ACAATCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGA--------ATAT-----------GGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------CTATTTCATTCATATAATGAAAATAAAGCTACTACTACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGAGAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACAAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGACATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATATGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTATTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAATAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_petersenii_petersenii_var._petersenii TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AGTC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCCGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTTGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAGGTATCATTTCTT-GCCACCAGCTCGCTTGCTTAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTATATCTATGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTGACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCCC-AATCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGATCTAACTCCCC-ACAATCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGA--------ATAT-----------GGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATTGGTAAGTATTTACCAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTTT-----ATATTTCATTCATATAATGAAAATAAAGCTACTACTACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATTTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGAGAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACAAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATATGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTATTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATTTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAATAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGACTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_petersenii_petersenii_var._yakusimensis TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AGTC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCCGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTTGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAGGTATCATTTCTT-GCCACCAGCTCGCTTGCTTAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTATATCTATGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTGACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGAA--------CAAACTTTTCCCCCCC-AATCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGATCTAACTCCCC-ACAATCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGA--------ATAT-----------GGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTTT-----ATATTTCATTCATATAATGAAAATAAAGCTACTACTACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATTTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGAGAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACAAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATATGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTATTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATTTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAATAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGACTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_prolifera TCGGCC-GACTCATTCACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACAAACCGTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTTCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGGATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTT-------------------------------GGAAATACCAAGTAGAAAAAAGA----GTTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACTTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAGTGGGACTCTACCTCCATTCACG-----GAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATTGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATAAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------TAAACTTTTCCCCCC--AACCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ATAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCAAATTAGCAAGTGTTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------CTATTTTATTCATATAATGAAAATATAGCTACTAATACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAACGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTAGATAGACGAGGCA------------TCGGTTTAGTATTTGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTTATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATACGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTCATTTTTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTATGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACAGAGAAGTATTGATACGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAATTACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACTCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGGGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCTTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGAT-------------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTTGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_pseudoconilii TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AGTC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCCGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTTGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAGGTATCATTTCTT-GCCACCAGCTCGCTTGCTTAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTATATCTATGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTGACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCCC-AATCC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGATCTAACTCCCC-ACAATCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGA--------ATAT-----------GGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTTTTTT--ATATTTCATTCATATAATGAAAATAAAGCTACTACTACATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATTTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGAGAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACAAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTATTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAACAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_pterorachis TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTGATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTATTTT-------------------------------GGAAAGACCAAGTAGAAAAAGGA----ATTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTAAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ACAGGTAAGGGAAGAATACGCGGACTAGCA-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAGG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACACAAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTCTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTTACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTTCCC-ACAACCTTTCCCAAAAG-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAAAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CCCCGGGTTTCACGCTGTCCGATGAAACAGGTGACTCAGCTTCTTCGGTTGCAGTGGTTAAGCAGCTGCAGTTTTTTTTTT------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTACTTCTTCTCCTATTTAAAGATAATTTTTATTCAGTCGCTTGTAAGCGTCGTTTGGATAGACGAGGCT------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTTCACGTACTTCTACAAGCAATATGTTTAATTTTGGGGATACCTCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCAAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAGAGAATGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAATAAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAAATTAATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGACATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACATGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTACTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTTTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_pycnosora TCGGCT-GACTCATTTAGAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCATGTATATTAAAATGCCGAATGGCTCACTTGCAAAGTGTTTCGGAAAGACCAAGTCGAAAAAGGAATTGAATCGGAAAGACCAAGTCGAAAAAGGA----ATTGAAGTGGTTTCCGTATTTT--------------GCTTACGA--------GCAAATTGTGTGAATTCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCAGACTAGGA-CTAGTGGAAGGAATCTACTTTGTGTTACATTACTAGG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC---------CAAAACGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGATTTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAGACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCCCATCGCCCGAAATTCATTCGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTATTTATACTCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATCAAAACCTCCTTCGAGAGGAGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAAAGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTTCCAAAAG-----ATGGTTGCAGCTCTGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCATGCTGTCCAATGAAACAGGTGATTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGCTTTTTTT--------ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAGGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATCACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTACTTCTTCTCCCACTTAGAGATAATTTTTATTCAGTCGCCTGTAGGCGTTGTTTGGATAGACGAGGCG------------TCGGTTTAGTATTCGGGTCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTGCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTTTACAAGCGATATGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTCATTTTCGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTCTTCACACGTACAAAACTTCGTGTGGAAAATTTAATAAACTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAAGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTACTACCTCTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATAAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTACTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCGGCGGATTCCTACAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACGGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC---------AAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACGAAAGATACCGATATCTTAGCAGCCTTCCGCATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTACCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTAGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTTGCATTAGAAG Deparia_sichuanensis TCGGCC-GACTCATTTAGAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTTTTTC-------------------------------GGAAAGACCAAGTCGAAAAAGGA----AGTGAAGTGGTTTCCGTATTTC--------------GTTTACGA--------GCAAATTGTGTGAATTCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTATCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCAGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC---------CAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAATAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAGACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTCTGTATTACCCCTCCCTCCTACTTATACTCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAGCGTTGGGTT-----AGGGGTTGATCGCCGATTTCACAACATAAATTTGGTCCAACTCCCC-ACAACCTTTCCCAAAAG-----ATGGTTGCAGCTCTGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTGCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTTT-----ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTCGGATGAAATTCATTACGAGAAGTAATGCTTGGGGGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCCTGTAGGCGTTGTTTGGATAGACGAGGCG------------TCGGTTTAGTATTCGGGTCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACATCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCAAAGTCTATTCATTCAATATCTTTATTTTTGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTATTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAACTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAAGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGTAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTCCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTACTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCAAAAAATGTTCGGGTTGAGACTGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAAGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAAGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGCATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATCTGTTCACCTCCATTGTAGGTAACGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGATTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_sp. TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CCCCTCCGGCAAA-T------AAAGTCTGTA-------GGGGGGGGGGGGCTCGATTGAGCCATTCATGTATATTAAAATTCCGAATGGCTCACTTGCAAAGTATTTT-------------------------------GGAAAGACCAAGTAGAAAAAGAA----ATTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ATAGGTAAGGGAAGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAGACTAAGTACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCAAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTCATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGATTACTGGTTTTCCAACAAAACCTCCTTCGAGAGGGGTTATATCGGACATATCTTTACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTCAGTAGTTACTAC---------------------------------------------------------CCCCGAGTTTCACGCCGTCCGATGAAACAAGTGACTCAGCTTCTTCGGCTGCAATGGTTAAGCAGCTGCAGTTTTTTTTTT------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATACTTGGGAGTTACTGCGATGAAAACAACTTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAAGGGTTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTCTTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGACTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTTTAATTTTGGGGATACCTCCTCTACGCCGGTTATCTGCTCAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTTGGAAGACAGGTTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCTAGTTCGCTTGTTTCGCCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAGAGAACGTAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAAGACGTGTTTCTAGATATAGTTTCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAGAACCAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCTAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGATATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC---------AAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCATACGCTTGGAAGACCTTCGAATCCCTCCTTCTTATTCTAAAACTTTCCTCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTTTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_subfluvialis ----------------ACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CCCCTCCAGCAAA-T------AAAGTCTGAA--------GGGGGAGGGGGCTCGATTGAGCCATTCTTGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTATTTC-------------------------------GGAAAGACCAAGTAGAAAAAGAA----ATTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCAAAACAACCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGTCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ATAGGTAAGGAAAGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAAAATTGAAATTTTGATTCTTTACCAGGTCGCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTCATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTTATATCGGACATATCTTTACGAGTGTAATGAAAAATTGGAACAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAATTTTCCCCCCC--AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAATTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGTAAATATTTCATTTAGGTGGATGTTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATCGGTAAGTAGTTACTAC---------------------------------------------------------TCCCGGGTTTCATGCCGTCCGATGAAACAAGTGACTCAGCTTCTTCGGCTGCAATGGTTAAGCAGCTGCAGTTTTTTTTT-------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAAACAACCTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAAAGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGCTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGACTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACCTCCTCTGCGCCAGTTATCTGCTCAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTTATTTTCGGAAGACAAATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCTAGTTCGCTTGTTTCGCCGACGAATTAGGGATGTGCCACTTTCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAGAGAACGTAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAAGACGTGTTTCTGGATATAGTTTCCGATCAGACGCAATAAGCGTCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAGAACCAAATCTCTCATAGGTTTTCATGGAACTCAATATTTTGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGACGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTTCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAGGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_tenuifolia TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AGTC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTTGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAGGTATCATTTCTT-GCCACCAGCTCGCTTGCTTAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAACTTGTTCACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_timetensis TCGGCC-GACTCATTTACAGATCAAACTCAACTATAAATCGGTGAAGCTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AGTC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAAAAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAATAGAAAAAAGA----GTTGAAGTGGTTTTCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTTAAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTCACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAGGTATCATTTCTT-GCCACCAGCTCGCTTGCTTAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTTTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGCCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCCACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGAAGACAACTTTCGGATCCCTTCCTGAATTTGATATATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACAAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTG{AG}AAATGAAGCAGTCGACTTGACATAGATTTCTATCTCCACGTGCTTCTACGAGCAATACGTCTAATTCTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATGAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAGAAGTTTTGATATGTTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGTATTTTGTATTTCCCGATCGGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTTATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTACAATAGT------ATTTTGGATGGGGAAGAAATTCATCCCAGGATTCCAATTTCGTTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTAAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCCTCAACAAATCGAGATGGATTGCGTAGATTGAGATATATACC---------AAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTTACCTCCATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATATTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_tomitaroana TCGGCC-GACTCATTCACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAATCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATACAATAC-CGCCTCCAGCAAA-T------AAAGTCTGGA-------GGGGGGGGGGGGCTCGATTGAGCCATTCGTGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAATACCAAGTAGAAAAAAGA----GTTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATT-------GTGCGTGGAATGGGACTCTACCTCCATTCACG-----GAAGTATTATTTCTT-GCCACCGGCTCGCTTGCTGAATAATTTTCACTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGGGTAATATGCGGACTAGCA-ATAGTGAAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GATTGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTATAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACATCCTTCGAGAGGGGTGATATCGGACATATCTTTACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGAGA--------CAAACTTTTCCCCCC--AACAC----TTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAG-----ATGATTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTGTTTACTACATTGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTCCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------CTATTTTATTCATATAATGAAAATATAGCTACTAATATATCGAA-----------------------TCTTTTGGATGAAATTCATTACGAGAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTTCGGATCTCTTCTTAAATTTGATGTATTACGGGGAAACGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAATTCTTCTCTTATTTAGAGATAATTTTTATTCAATCGCTTGTAAGCGTTGTTTAGATAGACCAGGCA------------TTGGTTTAGTGTTTGGGGCGTGTAGTGTAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATTTCCACGTACTTTTACAAGCAATACGTCTAATTTTGGGGATACGTCTTCTGCGCCGGTTATCTACTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTCTGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTATGGAAAATTTACTAAGCTTCGATCTCGGAGACAGAAAGAACGGAAAAGTATTGATACGCTACTCCGAAATTTCTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATCTCCCGATCGGAATAACGTGACTAGAAAAAAATTACGTGTTTCTGGATATAGTTCTCGATCAGACGCAATAAGCATCGACCGCCGCCTTACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGGGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCCTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAATTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCTTCAACAAATCGAG----------------------------GCTGGTGTCAAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTATTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGCATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGATGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_unifurcata TCGGCC-GACTCATTTACAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTATTTC-------------------------------GGAAAGACCAAGTAGGAAAAGAA----ATTGAAGCGGTTTCCGTATTTC--------------GTTTACGA--------GCAAATTGTGTGAATCCAAACAACCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCCCGCTTGCTGAATAATTTTCATTGGGACAGAGTGGGATCCCACA-----GTAGGTAAGGGAAGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAAGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGATTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTCATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCTGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCATTACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAAATTTGGCCTAACTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTAGGTGGATGCTTCCCCGACAGAAACCAAATTAGCAAGTATTTACTACATCGGTAAGTAGTTACTAC---------------------------------------------------------CCCCGGGTTTCACGCCGTCCGATGAAACAAGTGACTCAGCTTCTTCGGCTGCAATGGTTAAGCAGCTGCAGTTTTTTTTTT------ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAAACAACTTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTACCTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAGGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAATAAAGCGTTCGATTGATAGTGTGCGTTACCAAGACTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTTTACAAGCAATATGTTTAATTTTGGGGATACCTCCTCTGCGCCGGTTATCTGCTCAAACAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTCATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCTAGTTCGCTTGTTTCGCCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACGGAGAGAACGTAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGTAATTTTGTATCCCCCGATCAGAATAACGCGACTAGAAAGAAAAGACGTGTTTCTGGATATAGTTTCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAGAACCAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTAGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACAACCAGCGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_viridifrons TCGGCC-GACTCATTTACAGATAAAACTTAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCCCAGCTTTTTTGCCCAGTCAAAACC----GGTGATCTCGCCTTTATCGATCTGCTTGATACAATAC------CGCCTCCAGCAAAAT------AAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTATTTC-------------------------------GGAAAGACCAAGTAGAAAAAGAA----GTTGAAGTGCTTTCCGTATTTC--------------GCTTACGA--------GCAAATTGTGTGAATCCAAACAATCTGAGATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGACTCGAACCCTCACGGTCTTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGGACGGAGTGGGATCCCACA-----ACAGGTAAGGGAAGAATATGCGGACTAGCC-ATAGTGGAAGGAATCTACTTCGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCGGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCAAAACAGTTAGATATTCAGTTATTTCGAGAACTAGTGACTAACAGACGACTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTAATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCTCTCCTACTTATACTCTACATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATCTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTTACGAGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCGGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCCC-AACCCAATGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAA-----------TTCCCC-ACAACCTTTCCCAAAAT-----ATGGTTGCAGCTCGGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTAGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CCCCGGGTTTCACGCCGTCCGATGATACAAGTGACTCATCTTCTTCGGCTGCAGTGGTTAAGCAGCTGCAGTTTTTTTTT-------CTATTTCATTCATATAATGAAAATATAGCTACTAATATATGGAA-----------------------TCTTTTAGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTATTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATCATGGGGAAGCGAGGGGCTTAGCGTTAATCGAGATTGTTTCCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTTGCTTGTAGGCGTTGTTTGGATAGACGAGGCT------------TCGGTTTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTTTAATTTTGGGGATACCTCCTCTGCGCCGGTTATCTGCTCAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATCTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCTAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTTTTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAGCTTCGGTCTCGGAGACAGAGAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGACATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGAAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAAGACGTGTTTCTGGATATAGTTTTCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAAAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTTATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGTGGATTCCTGCAACAGT------ATTTCGGGTGAGGAAGAATTTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCGATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAGCAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC------------------------------TACACCCCCCAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTCTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_wilsonii TCGGCC-GACTCATTTAGAGATAAAACTCAACTAGAAATCGGTGAAGTTTATTTTTCAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTAATACAATAC------CGCCTCCAGCAAA-T------AAAGTCTGGA--------GGGGGAGGGGGCTCGACTGAGCCATTCATGTATATTAAAATCCCGAATGGCTCACTTGCAAAGTTTTTC-------------------------------GGAAAGACCAAGTCGAAAAAGGA----AGTGAAGTGGTTTCCGTATTTC--------------GTTTACGA--------GCAAATTGTGTGAATTCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTACTTATCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTGAATAATTTTCATTGGAACAGAGTGGGATCCCACA-----GCAGGTAAGAGAAGAATATGCAGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATTACTAAG------TACGAACAGAATTTCGTGAATGAGTGCTGGCC---------CAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAATAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAGACAGTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTATTTCCAGGTGCTTCTGTATTACCCCTCCCTCCTACTTATACTCTATATCTACGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATCAAAACCTCCTTCGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAGCGTTGGGTT-----AGGGGTTGATCGCCGATTTCACAACATAAATTTGGTCCAACTCCCC-ACAACCTTTCCCAAAAG-----ATGGTTGCAGCTCTGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGCTTCCCCGACAGAAACCGAATTAGCAAGTATTTACTACATCGGTAAGTATTTACTAC---------------------------------------------------------CTCCGGGTTTCACGCTGTGCAATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTTT------ATATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTCGGATGAAATTCATTACGAGAAGTAATGCTTGGGGGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTTCCATATCTACTTCTTCTCCTATTTAGAGATAATTTTTATTCAGTCGCCTGTAGGCGTTGTTTGGATAGACGAGGCG------------TCGGTTTAGTATTCGGGTCGTGTAGTGCAGCAGCAACAAAGCGTTCGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTCCACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACATCTTCTGCGCCGGTTATCTGCTGAAACAAATAACAACTCAAAAATTTCAAAGTCTATTCATTCAATATCTTTATTTTTGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTATCGAGGATAGTTATTCACACGTACAAAACTTCGTGTGGAAAATTTACTAAACTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAAGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGTAATTTTGTATCTCCCGATCAGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGGATATAGTTCCCGATCAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTCGGGAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTACTACCTTTCGATACCTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCAAAAAATGTTCGGGTTGAGACTGCAGCGGATTCCTGCAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAAGAGAAGTTCTGCGATAGTACTGGACACCCAGTTGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGAGATTTTGAACAAGTTTGTAGAAATTTGGAATACTTTTTCCTTGTATCACAGCGCTTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACC---------AAAGATTACCGACTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGCATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATCTGTTCACCTCCATTGTAGGTAACGTTTTCGGATTTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCTAAAACTTTTATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGATTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Deparia_yunnanensis TCGGCC-GACTCATTTGCAGCTAAAACTCAACTAAAAATCGGTGAAGTTTATTTTACAAC------TCC-AGCTTTTT-GCCCAGTCA-AACC----GTTGATCCCGCCTTTATCGATCTGCTTGATACAATAC------CGCCTCCAGCAAA-G-CAAAGAAAGTCTGGA--------GGGGGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAATACCGAATGGCTCACTTGCAAAGTGTTTC-------------------------------GGAAAGACCAAGTCGAAGAAGGA----ATTGAAGTGGTTTCCGTATTTC--------------GCTTACGA--------GCA-------TGAACCCAAACAACCTGAAATGGGTTAA------------------TTAAAGCGTCTCATTGGGGATAGAGGGACTCGAACCCTCACGGTCCTGTGAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCCGCTATTTCTCATTTTACCAAGTGCGTGGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTTTT-GCCACCGGCTCGCTTGCTAAATAATTTTCATTGGAACAGGGTGGGATCTCACA-----GCAGGTAAGAGAGGAATATGCGGACTAGCA-ATAGTGGAAGGAATCTACTTTGTGTTACATT-----G------TACGAACAGAATTTCGTGAATGAGTGCTGGCC--------CCAAACCGAGAGGTCCGCGTCC-----------GAATGA---AG-AAAGAATTGAAATTTTGATTCTTTACCAGGTCTCAGT------ATTATACTTCTACATATTACCTCATGCAGTTAACCACGCGAAAC-GTTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGCACCTATCTT--GCCTCATCGTCCGAAATTTATTCGAATAATACAAGA-AAATCGAATTTTAGGAGAATCTAATGGGTCCAGCTTACAGCTATTTCCAGGTGCTTTTGTATTACCCCTCCCTCCTACTTATACTCTATATCTATGCCGTATTTGGCATTCCCCTAAGAAGTAGAATATTTCGGAGAGACTATTGGTTTTCCATAAAAACCTCCTTAGAGAGGGGTGATATCGGACATATCTTCACGGGTGTAATGAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAATTCAAGCCAGTGCCATGATTACTATCGGGA--------CAAACTTTTCCCCCC--AACCCAAAGTTGGGTT-----AGGGGTTGACCGCCGATTTCACAACATAATTTTGGTCTAACTCCCC-ACAACCTTTCCCAAAAG-----ATGACTGCAGCTCCGCGCCTTATCGAGGATCGAGTCGGGAAATATTTCATTTGGGTGGATGTTTCCTCGACAAAAACCGGACTAGCAAGTATTTACTACATTGGTAAGTATTTACCGC---------------------------------------------------------CTCCGAGTTTCACGCTGTCCGATGAAACAGGTGACTCAGCTTCTTCGGCTGCAGTGGTTAAACAGCTGCAGTTTTTTTTT-------CTATTTCATTCATATAATGAAAATATAGCTACTAATACATTGAA-----------------------TCTTTTGGATGAAATTCATTACGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTCCGGATCCCTTCCTAAATTTGATGTATTACGGGGAAGCGAAGGGCTTAGCGCTAATCGAGATTGTTTCCCATATCTAAGTCTTTTCCTATTTAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACGAGGCA------------TCGGTTTAGTATTCGGGGCGTGTAGCGCAGCAGCAACAAAGCGTTTGATTGATAGTGTGCGTTACCAAGATTATTCAGAGATTTTTCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATACCTCTACGTACTTCTACAAGCAATATGTCTAATTTTGGGGATACGTCTTCTGTGCCGGTTATTTGCTAAAACAAATAACAACTCAAAAATTTCAAAGTCTATTCATTCAATATTTTTATTTTCGGAAGACAGATTGCCAAAATCTAGCCACGTTTTAGAAATAGAGATGTCCCAGAATCTTCATCTAGAAACTCCAGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGCCACTTCCACATCTCTCGAGGATAGTTTTTCACACGTACGAAACTTCGTGTGTAAAATTTACAAAGCTTCGGTCTCGGAGACAGAAAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTTTACACTTACGAGGTTGATTCGATATTGCTAGTTTTATGGACACGAATGCATAAGTCAAACCCAAGGAATTTTGTATTTCCCGATCAGAATAACGTGACTAGAAAAAAAATACGTGTTTCTGGATATAGTTCTCGATTAGACGCAATAAGCATCGGCCGCCGTCTCACTCGAAGTTTGTGCATCCATTTTGGAAGATGTAGAAACAAATCTCTCATAGGTTTTCATGGAACTCAATATTTCGCGAAAAAATGGATTTATTACCTCTCGATACTTCTCAGATCTCACTTTCACTATCCAATTGAATTTACCCAAATACGTATCAATTTGTCATCCGCCAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAATGTTCGGGTTGAAACCGCAGCGGATTCTTACAACAGT------ATTTTGGGTGAGGAAGAAATTCATCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAGAAGGAGAAGTTCTGCAATAGTACTGGACACCCAGTGGCTAAATTAGCCTGGGCTGTATTAGCAGATGGTGATATTTTGAACAGGTTTGTAGAAATTTGGAATACTTTTTCCTCGTATTATAGCGCCTCAACAAATCGAGATGGATTGCGTAGATCGAGATATATACCGCTGGTGTCAAAGATTACCGATTGACCTACTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAAGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAATCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGGGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTCTGGATCTAAGGCTCTACGCGCCTTACGCTTGGAAGACCTCCGAATCCCTCCTGCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAGAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGCGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAATTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGCCGAGACAACGGACTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGCTCGATAGACAACGAAATCACGGTATACACCTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGGGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACGCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTTGCGTTAGAAG Diplazium_bombonasae TCGGCC-GATTCATTTACGGATAAAAATCAACTGAAAATCGGTGAAGTATATTTATCAAC------TCC-AGCTTCTT-GTCTAGTCA-AACC----GTTGATCTCGCCTTTAGCGATCTGTTTCATAAAATAT------CACTTTCAGCAAA-T------AAAGTCTGGA--------GGTAGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAAGCCTGAATGGCTCACTTGCAAAGCGTTTC-------------------------------GGAGAGGCCGAA--GAAAAAGAA----GTTGAAGTAGTTTCCGTATTTT--------------GCTTCCGA--------ACAATTTGTGTGAATCCGGACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCATTGGGGATAGAGGGAATCGAACCCTCACGGTC----GAAACCAACGGATTTTCGTTCTACTGCAACTTGCGCTGCTACTTCCTACTTCATCAAGTGCGTAGAATGGGACTCTATCTCCATTCACG-----AAAGTATCATTTCCT-GCCACTGGCTCGCTTGCTTAATAATTTTCATTCGAATAGAGTGGGATCCAGCA-----ACAGGTAAGAGAAGAATATGCGGACCGGCA-ATACTAGAGAGGGTCTACTTAGTCCTGCATTACCAAG------TACAAACATAATTT-GTGAATGAATGCTGGGT--------CCAACCTGAGAGGTCCCCGTCCTTTCCCTATTCAAATGG---AG-AAAGAAATAAAATTTTATTTCTTCACCAGGTTTCAGT------CTTATACTTCTACATCTTATCCCATGCAGTTAACCACGCGAAACATTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGTACCTATATT--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCAAATTTTAGGAGAATATAATGGGCCCAGCTTACAGCTCCTCTCAGGTGCTTCTGTATTACCCTTCCCTTCTACTTATACTCTATATCTACGCCGTATTTGGCATTCCCTTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAAATAAGTGATATCGGACATATCTTAATGGGTGCGATGAACAAATGGAAGAGGAAGGGAAGACGCAGGTAGCTCAAGCCGGTGACATGATTACTACCGGGA--------CAAACCCCTTCCTCC--AATTCGATGTTGGGTT-----AGGGGTTGACCGTCGATTTCACACCATAGATTTGTTCTAACCCGCC-AAGATCTTTCTCAAAAG-----ATGGTTGCAGCTCGGTACTTTATCGAGAATCAAGTCGGGAAATATTTTACTTTGGCGGATGCTTCCTTGACAAAACCCGAATT-------------------AGCAAGTATTTACTAA----------------------------------------------------------TTTGGGTTTCGCGTCGTCTGGTGAAACAGGTGATTCATCTCTTTCGACTGCGGTGGCTAAACAATTGTAGCTTCTTCTT-------CTACTTCACTCATACAGCGAAAATATAACTACTAATACATCGAA-----------------------TCCTTTGGATAAAATTCGTTATGAAAAGTAATGCTTGGGAGTTACTACGATGAAGACAATTTCTGGATCCCTTCCCAAAATTGATGCATTACGGAAAAGCGAGGGGCTTGTCGCTAATCAAGACTGTTTCCCATATCTACTTCTTCTCCTACTAAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTTTTTAGGTAGGCGAGACA------------TTGGTCTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCAACTGATAGTGTGCGTTACCAAGATTATTCGGAGATTTTTTATTCAAAATTTGTTTGAAAATAAAGCAGTCGACTTGACATAGATTTATATTTCCACGTACTTCTACAAACAATATGTCTAATTCTGGGGATACCTCTTCTGTGCCGGTTAGCTGCTGAAACAAATAACAACTCGAAAATTTCGCAGTCTATTCATTCAATATTTCTATTTTTGGAAGATAGATTACCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCACAGAATCTTCATCTAGAAACTCCGGTTCGCTTGTGTCGTCGACGAATTAGGGATGTGACATTTCTACACCTACTAAGGATAGTTTTTCACACGTACAAAACTTTGTGTGGAAAATCTATTAAGTCTCGGTCTTGGAAACAAAAAGGACAAAGAGGTATTGATACGCCACTGCGAAATTTTTACACCTATGAAATTGATTCGGTATTGCTAGTTTTATGGACACGAATGTATGAGTCAAACCTAAGATATTCTGTATCTCCCGATCGAAATAACATGATTAGAAAGAAAATATGTGTTTCTGAGTATAATTCTCGGTCAGACGCAATAAGCATCGACCGTTGTCTCACTCGAAGTTTGTGCATCCATTTTGGGAGATGTAAAAACAAATCTCTCATAGCTTTTCATGGAACTCAATATTTTGTAAAGAGATGGATTTATTATCTTTTGATATTTCTTAGATCTCACTTTCACTATCCAGTTGAATTTACCCAAATACGTATCAATTTGTTACCCGCCAGCTGTGTTTTATTCTTGGGTTACATTTCAGCTATTCACCCAGTCTCGAAAAATGCCCAGGTTGAAACCACAGTGGGTTGTTGCAGTAGT------ATTTTGAGTGGGGAAAGAATTCTCCCCAGGATTCCAATTTCGCTACTAGTTAAACTCTTGGAAAAAGAGAAGTTCCGCGATAGTACTGGACATCCAGTTAGTAAATCAGCCCGGACTGTATTAGCAGATGATGATATTTTGAATAGGTTTGTAAAAATTTGGAATACTTTCTCCCTGTACCACAGCGCCTCAATAAATCGAGATGGATTGCGTAGATCGAGATATATATC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACGGTATGGACAGACGGGTTGACCAGTCTCGACCGTTACAAGGGCCGATGCTATGACATTGAACCCGTCGCTGGGGAAGAGAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTCGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCCCTACGCTTGGAAGACCTTCGAATCCCCCCCTCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCCAAAAATTATGGTAGAGCCGTCTA?GAATGCCTTCGTGGTGGACTTGATTTTACAAAGGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGATTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATTAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGGGCTGTTTTTGCTAGGGAGTTGGGTGCACCAATAGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTAC?GCCGAGACAATGGACTGCTTCTTCACATTCACCGCGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGCGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTA?TCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGAC??TGTCTTACAGTTCGGCGGAGGAACCTTGGGACATCCTTGGGGAAACGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAG Diplazium_dilatatum TCGGCC-GATTCATTTACGGATAAAAATCAATTGGAAATCGGTGAAGTATATTTATCAAC------TCC-AGCTTTTT-GCTGAGTCA-AACC----GCTGATCTCGCCTTTGTCGATCTGTTTAATAAAATAT------TGCTTTCAGTAAA-T------AAAATCTGGA--------GGGAGAGGGGACTCGATTGAGCCATTCATGTATATTAAAAGCCTGAATGGCTCACTTGCAAAGCGTTTC-------------------------------GGAAAGACCGGAT-GAAGAAGAA----ATTGAAGTAGTTTCCGTATTTT--------------TCTTCCGAACAAATA-ACAAATTGTGTGAATCCGAACAACCCGAAATCGGTTAA------------------TTAAAGTGTTTCGTTGGGGATAGAGGGAATCGAACCCTCACGGTC----GAAACCAACGGATTTTCGTTCTACTGCAACTTGCGCCGCTACTTCTTACTTCATCAAGTGCATAGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTCTT-GCCACTGGCTCGCTTGCTGAATAATTTCCATTCGAATGGAGTGGGATCCCACA-----ACAGGTAAGAGAAGAATATGCGGATCGGCA-ATAGTAGAGGGGATCTACTTAGTGCTACATTACCAAG------CATGAACAGAATTTTGTGAATGAATGCTGGGC--------CCAAGCCGAGGGGTCCGCGTCC-----------AAATGG---AG-AGAGAAATAATATTTTACTTCTTCACCAGATTTCAGT------CTTATACTTCTACATCTTATCCCATGCAGTTAACCGCGCAAAACAGTTAGATATTCAATTATTTTGAGAACTAGTGACTAACAGA---CTGCCCGTTGGAATGGCCCCCGTCGAGTCTCTGTACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCAAATTTTAGGAGAATCTAATGGGCCCAGCTTACAGCTCTTTCCAGGTGCTTTTGTATTACCCTTCCCTTCTACTTATACTCTACATCTACGCCGTATTTGGCATTCCCTTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAAATAAGCGATATCGGACATATCTTTATGGGTGCAATGAAAAATTGGAGGAGGAAGGGGAGACGCAGGTAGCTTAAGCCAGTGACATGATTACTACCGGGA--------CAAACTTCCTTCTCC--AATTCGATGTTGGGTT-----AGGGGTTGACCATCGATTTCACATCAGAGATTTTTTCTAACCTCCC-ACGATCTTTCTCAAAAG-----ATGGTTGCAGCTCGGTACTTCGTCGAGGATCAAGTCAGGAAATATTTTACTTGAATGGATGCTTCCTCGACAAAACCCGAATT-------------------AGTAAGTATTTACTAA----------------------------------------------------------TTCGGGTTTCACGTTGTCCGGTGAAACAGATGATTCATCTCTCCCGACTACAGTGGCTAAACAATTGTAGCTTTCTCTT-------CCATTTCACTCATACAATGAAAATATAACTATTAATACATCGAA-----------------------TCTTTTGGATAAAATTCGTTATGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGATAACTTCTGGATCCTTTCCTAAATTGGATGCATCACAGAAAATCGAAGGGCTTAGCGCTAGTCAAGACTGTTTCCTATATCTAATTCTCCTCCCATCCAGAGATAATTTCTATTCAGTCGCTTGTAAGCGTTGCTTAGATAGACAAGGCA------------TCGGTCTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCAACTGATAGTGTGCGTTACCAAGATTATTCGGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTGACATAGATTTATATCTACATGTACTTCTACAAACGATATGTCTAATTTTGGGGATACCTCTTTTGTGTTGGTTAGCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTTGGAAGATAGATTACCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCACAGAATCTTCATCTGGAAACTCCGGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGACATTTCTACACCTACTAAGGATAGTTTTTTACACGTACAAAACTTTGTGTGGAAAATCTACTCAGTCTCGGTCTTGGAAACGAAAAGGACAGAGAAGTATTGATACGCTACTCCGAAATTTCTACACTTACGAAATTGATTCGACATTGCTAGTTTTACGGACACGAATGCATGAGTCAAACCCAAGATATTCTGTATCTCCCGATCGAAATAACGTAACTAGGAAGAAAATACGTGTTTCTGAGTATAATTTTCGGTCAGACGCAATAAGCATCGACCGCTGTCTCACTCGAAGTTTGTGTATTCACTTTGGGAGATGTAAAAACAAATCTCTCATAGCTTTTCATGGAACTCAATATTTTGCAAAGAAATGGATTTATTATCTTTCGATATTTCTTAGATCTCACTTTCACTATCCAATTGAATTTATCCAAATACGTATCAATTTGTTACCCGCCAGCTGTGTTTTATTTCTGGGTTACATCTCAGCTATTCATCCAGTCTCGAAAAAAGTCCAGGTTGAAACCACAGTGGATTTTTGCAGCAGT------ATTTCAGGTGGGGAGATAATTCACCCCAGGATTCCAATTTCGCTATTAGTTAAACTCTTGGAAAAAGAGAAGTTCCGCGATGGTACTGGACATCCAGTTAGTAAATCAGCCCGGACTGTATTAACAGATGATGAGATTTTGGATAGGTTTGTAAAAATTTGGAATACTTTCTCTTCGTACCACAGTGCTTCAATAAATCGAGATGGATTGCGTAGATCGAGATATATATC------------------------------TACACCCCCGAATACAAGACCAAAGATACTGACATCTTAGCAGCCTTTCGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGGGAGGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTCGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCCCTACGCTTGGAAGACCTTCGAATCCCCCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGAGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCCAAAAATTATGGTAGAGCCGTCTATGAATGCCTTCGCGGTGGACTTGATTTTACAAAGGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGATTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGAGAGTTGGGTGCACCAATAGTCATGCATGACTATCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTCACTGCCGAGACAATGGACTGCTTCTCCACATCCACCGCGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTAGCCAAAGCATTACGCATGTCCGGCGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Diplazium_proliferum TCGGCC-GATTCATTTACGAATAAAAATCAACTGGAAATCGGTGAAGTATATTTATCAAC------TCC-AGCTTTTT-GCTGAGTCA-AATC----GTTGATCTCGCCTTTATCGATCTGTTTAATAAAATAT------TGCTTTCAGTAGA-T------AAAGTCTGTA--------GGGAGAGGAGTCTCGATTGAGCCATTCATGTATATTAAA---CTGAATGGCTCACTTACAAGGCGTTTT-------------------------------GAAAAGATCGAATCAA-----------GAAGAAGTAGTTTTCGTATTTT--------------GTTTCTGAAGAAAGA-ACAAATTGTGTGAATCCGAACAACCCGAAATCGGTTAA------------------TTGAAGTGTCTCGTTGGGGATAGAGGGAATCGAACCCTCACGGTC----GAAACCAACGGATTTTCGTTCTACTGCAACTTGCGCTGCTACTTGCTATTTCATCAAGTGCGTAGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTCTT-GCCACTGGCTCGCTTGCTAAATAATTTTCATTTGAATGGAGTGGGATTCCACA-----AGAGGTAAGAGAAGAATATGCGGACCGGCA-ATAGTAGAGGGGATCTAGTTAGTGCTACATTACCAAG------TATGAACAGAATTTTGTGAATGAATGCTGGGA--------CCAAACTGAAGGGTCCGCGTCC-----------AAATGG---AG-ACAGAAATAATATTTTATTTCTTTACCAGGTTTCAGT------CTTATACTTATACATCTCACCCCATGCAGTTAACCACGCGAAACAGTTAGATATTCAGTTATTTTCAGAACTAGTGACTAACAGA---TTGCCCGTTGGAATGGCCCCCGTCGAGTCTCTGTACCTATCTCTCGCCTCATCGCCCAAATTTCATTTGAATAATACAAGA-AAATTAAATTTTAGGAGAATCTAATGGGTCCAGCTTACAGCTCTTTCCAGGTGCTTTTGTATTACCCTTCCCTTCTACTTATACTCTACATCTATGCCGTTTTTGGCATTCCCTTAAAAAGTAGACTATTTCGGAGAGACTACTGGTTTTCTATCAAAACCTCCTTCGAAATAAGCGATATCGGACATATCTTTATGGGTGCGATGAAAAATTGGAGGAGGAAGGGGAGACGCAGGTAGCTCAAGCCAGTGACATGATTACTATCGGGAACTTTTCCCCCCCCCTTCCCGCC--AAGTCGATGTTGGGTT-----AGGGGTTGACCGTTGATTTCACATCAGAGATTTTGTCTAACCTCTC-ACGATCTCTCTCAAAAG-----ATGGTTGCAGCTCGGTACTTCGTCGAGGATCAAGTCAAGAAATATGTTATTTGGGTGGATGCTTCCTCGACAAAACCCGAATT-------------------AGTAAGTATTTACTAA----------------------------------------------------------TTCGGGTTTCACGTTGTCTGGTAAAACAGATGATTCATTTTTCCTTACTACAGTGGCTAAACAATTGTAGCTTCTTCTT-------TCACTTCACTCATACAATGAAAATATAACTATTAATACATCGAA-----------------------TCTTTTGAATAAAATTCGTTATGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTCTGGATCCTTTCCCAAATTGGATGCATTACAGAAAATCGAAGGGCTTAGCGCTAGTCAAGACTGTTTCCTATATCTAATTCTTCTCCCACCCAGAGATAATTTTTATTCAATCGCTTGTAAGCGTTGCTTAGATAGACAAGACA------------TCGGTCTAGTATTCGGGGCGTGTAGTGCAGTAGCAACAAAGCGTTCAACTGATAGTGTGCGTTACCAAGATTATTCGGAGATTTTCCATTCAGAATTTGTTTGAAAATGAAGCAGTCAACTTAACATAGATTTATATCTACATGTACTTTTACAAACGATATGTCTAATTTTGGGGATACCTTTTTTGTGTCAGTTAGCTGCTGAAACAAATAACAACTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTTTGGAAGATAGATTACCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCACGGAATCTTCATCTGGAAACTCCGGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGACATTTTTACATCTACTGAGGATAGTTTTTTACACGTACAAAACTTTGTGTGGAAAATCTACCCAGTCTCGGTCTTGGAAACCAAAAGCACATAGAAGTATTGATAATCTACTTCGAAATTTATACACTTACGAAATTGATTCGATATTGCTAGTTTTACGGATACGAATGCATGAGTCAAACCCAAGATATTCTGTATCTCCCGATCGAAATAACGTGACTAGGAAGAAAGTACGTGTTTCTGAGTATAATTTTCGGTCAGACGCAATAAGCATCGACCGCTGCCTCACTCGAAGTTTGTGTATTCACTTTGGGAGATGTAAAAACAAATTTTTCATAGCTTTTCATGGAACTCAATATTTTGCAAAGAAATGGATTTATTATCTTTTGATATTTCTTAGATCTCACTTTCACTATCAAATTCAATTTACCCAAATACGTGTCAACTTGTTACCCGCCAGCTGTGTTTTATTCCTGGGTTACATTTCAGCTATTCAGCCAGTCTCGAAAAAAGTTCAGATTGAAACCACAGTGGATTGTTGCAGCAGT------ATTTCAGGTCGGGAAATAATTCACCCCAGGATTCCAATTTCGCGACTAGTTAAACTCTTGGAAAAAGAGAAGTTCCGCGATGGGACTGGACATCCAGTTAGTAAATCAGCCCGGACTGTATTAACAGATGATGAGATTTTAAATAGATTTGTAAAAATTTGGAATACTTTCTCTTCGTATCACAGTGCTTCAATAAATCGAGATGGATTGCGTAGATCGAGATATATATC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGACATCTTAGCAGCCTTCCGAATGACCCCACAACCTGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGACGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAGGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTTGAAGAAGGTTCTGTCACCAATTCGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCCCTACGCTTGGAAGACCTTCGAATCCCCCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCCAAAAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACAAAGGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGATTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAAAGAGCTGTTTTTGCTAGGGAGTTGGGTGCACCAATAGTCATGCATGACTATCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGTCGAGACAATGGACTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGTGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGGGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Diplazium_squamigerum TCGGCC-GATTCATTTACGGATAAAAATCAACTGGAAATCGGTGAAGTATATTTATCAAC------TCC-AGCTTTTT-GCCTAGTCA-AACC----ATTGATCTCGTCTTTATCGATCTGTTTAATACAATAT------CGCTTTCAGTAAA-T------AAAGTCTCGA--------GGGAGAAGGGGCTCGATTGAGCCATTCATGTATATTAAAAGCCTGAATGGCTCACCTGCAAAGCGTTTC-------------------------------GGAAAGACCGACCGGAGAAAGAG-AAAATTGAAGTAGCTTCCGTATTTT--------------TCTTCCGA--------ACAAATTGTGTGAATCCGAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGAATCGAACCCTCACGGTC----GAAACCAACGGATTTTCGTTCTACTGCAACTTGCGCCGCTACTTCCTACTTCATCAAGTGCGTAGAATGGGACTCTACCTTCATTCGCG-----AAAGTATCACTTCTT-GCCACTGACTCGCTTGCCGAATAATTTCCATTCGAATGGAGTGGGATCCCACA-----ACAGGTAAGAGAAGAATATGCAGACCGGCACATAGTAGAGAGGGTCTACTTAGTGCTGCATTACCAAG------TACGAACATAATTTCGCGAATGAATGCTGGGC--------CCAAACCGAGGGGTCCGCGTCC-----------AAATGA---AT-AAAGAAATAAAATTTCATTTCTTTACCAGGTTTCAGT------CTTATACTTCTACATCTTACCCCATGCAGTTAACCACACAAAACAGTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGTACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATGATACAAGA-AAATCAAATTTTAGGAGGATCTAATGGGCCCAGCTTATAGCTCTTTCCAGGTGCTTCTTTATTACCCTTCCCTTCTATTTATACTCTACATCTATGCCGTATTTGGCATTCCCTTAAGAGGTAGAATATTTCGGAGAGACTACTGGTTTCCCATCAAAACCTCCTTCGAAATAAGTGATATCGGACATATCTCCATGGGTGCGATGAAAAATTGGAGGAGGAAGGGAAGACGCAGGTAGCTCAAGCCAGTGACATGATTACTACCGGGA--------CAAACTTCTTTCTCC--AACTCGATGTTGGGTT-----AGGGGTTGACCGTCAATTTCACATCAGAGATTTGTTCTAACCCCCC-ACAATCTTTCCCAAGAGAAGAGATGGTTGCAGCTCGGTATTTCATTGAGGATCAAGTCGGGAAATATTTTACTTTGGTGGATGCTTCCTCGACAAAACCCGAATT-------------------AGCAGGTATCTACTAA----------------------------------------------------------TTCGGGTTTCACGTTGTCCGGTGAAACAGGTGATTCATCTTTTTCGACTACAGTGGTTAAACAATTGTAGCTTTTTTTT-------TCATTTCACTCATACAATGAAAGTATAACTATTAATACATCGAA-----------------------TCTTTTGGATAAAATTCGTTACGAAAAGTAATGCTTGGGAGTTACTGCGACGAAGACAACTTCTGGATCCCCCCCCAAACTCGATGCATTACAGAAAAGCGAAGGGCTTAGCGCTAATCAAGACTGTTTCCCATATCTACTTCTTTTCCCACTCAGAGATAATTTTCATTCAGTCGCTTGTAAGCGTTGTTTAGATAAACGAGACA------------TCGGTCTAGTATCCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCAACTGATAGTGTGCGTTACCAAGATTATTCGGAGATTTTCTATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTAACATAGATTTATATCTCCACGTACTTCTACAAACAATATGTCTAATTTTAGGGATACCTCTTTTGTGCCGGTTAGCTGCTGAAACAAATAACAACTCAAAAATTTCGCAGTCTATTCATTCAATATTTTTATTTTTGGAAGATAGATTGCCAAAATCTAGCCACGTTTTAGAGATAGAGATGTCACGGAATCTTCATCTAGAAACTCCGGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGACATTTCTACACCTACTAAGGATAGTTTTTCACACGTACAAAACTTTGTGTGGGAAATCTATTCAGTCTCGGTCTTGGAAACGAAAAGGACAGAGAAGTATTGATACGCTACTCCGAAATTTTTACACCTACGAAATTGATTCGATATTGCTAGTTTTATGGACGCGAATGCATGAGTCAAACCCAAGATATTCTGTATCTCCCGATCGAAATAACATGACTAGGAAGAAGATACGTGTTTCTGAGTATAATTCTCGGTCAGACGAAATAAGCATCGACCGTTGTCTTATTCGAAGTTTGTGCATCCACTTTGGGAGATGTAAAAACAAATCTCTCATAGCTTTTCATGGAACTCAATATTTTGCAAAGAAATGGATTTATTACCTTTTGATATTTCTTAGATCTCATTTTCATTATCCAATTGAATTTACCCAGATACGTATCAATTTGTTACCCGCCAGCTGTGTTTTATTCCTGGGTTACATCTCAGCTATTCAGCCAGTCTCGAAAAACGTCCAGGTTGAAACCACAGTGGATTCTTGCAGCAGT------ATTTCGGGTGGGGAAAGAATTCACCCCAGGATTCCAATTTCGCCACTAGTTAAACTCTCGGAAAAAGAGAAGTTCCGCGATAGTACTGGACATCCAGTTAGTAAATCAGCCCGGACTGTATTAACAGATGATGAAATTTTGAATAGGTTTGTAAAAATTTGGAATACTTTCTCCTTGTACCACGGCGCTTCAATAAATCGAGATGGATTGCGTAGATCGAGATATATATC------------------------------TACACCCCCGAATACAAGACCAAAGATACCGACATCTTAGCAGCCTTCCGAATGACCCCACAACCTGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGACGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAGGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTTGAAGAAGGTTCTGTCACCAATTCGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCCCTACGCTTGGAAGACCTTCGAATCCCCCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCCAAAAATTATGGTAGAGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACAAAGGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGATTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAAAGAGCTGTTTTTGCTAGGGAGTTGGGTGCACCAATAGTCATGCATGACTATCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGTCGAGACAATGGACTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGTGACGATTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTTGGGGACGACTCTGTCTTACAGTTCGGTGGGGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAG Diplazium_wichurae -----------------------------------------------------TATCAAC------TCC-AGCTTTTT-GTCTAGTCA-ACCC----GCTGATCTCGCCTTTATCGATCTATTTAATACAATAT------TGCTTTCAGCAAA-T------AAAGTCTCGA--------GGGAGAGGGGGCTCGATTGAGCCATTCATGTATATTAAAAGCCTGAATGGCTCACTTGCGAAGCGTTTC-------------------------------GGAAAGACCGAGTAAAAAAAA------ATTGAAGTAATTTACGTATTTT--------------GCTTCCGA--------ACAAATTGTGTGAATCCGAACAACCTGAAATGGGTTAA------------------TTAAAATGTCTCGTTGGGGATAGAGGGAATCGAACCCTCACGGCC----GAAACCAACGGATTTTCGTTCTACTGCAACTTGCGCTGCTACTTCCTACTTCATTGGGTGCGTAGAATGGGACTCTACCTCCATTCACG-----AAAGTATCATTTCCT-GCCACTGGCTCGCTTGCTGAATAATTTCCATTCAAATAGAGTGGGATCCCACA-----ACAGGTAAGAGAAGAATATGCGGACCGACA-ATAGTAGAAGGGGTCTACTTAGTGCTGGATTACCAAG------TACGAACATAATTTCGTGAATGAATGCTGGGTCCAAACGTCCAAACCGAGGGGTCCGCGTTC-----------AAATGA---AA-AAGGAAATAAAATTTTATTTCTTCACCAGGTTTCAGT------CTTATACTTCTATATCTTACCCCATGCAGTTAACCACGCGAAACATTTAGATATTCAGTTATTTTGAGAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGTACCTATCTC--GCCTCATCGCCCGAAATTCATTTGAATAATACAAGA-AAATCAAATTTTAGGAGAATATAATGGGCCCAGCTTACAGCTATTTTCAGGTGCTTTTGTATTACCCTTCCCTTCTACTTATACTCTATATCTACGCCGTATTTGGTATTCCCTTAAGAAGTAGAATATTTCGGAGAGACTACTGGTTTTCCATCAAAACCTCCTTCGAAATAAGTGATATCGGACATATCTTCATGAGTGCAATGAGAAATTGGAAGAGGAAGGGAAGACGCAGGTAGCTCAAGCCGTTGACATGATTACTACCGGGA--------CAAACTCCTTCCTCC--AACTCGATTTTGGGTT-----AGAGATTGACTGTCTATTTCACACCATAGATTTTTTCTAACCCTCCCACGCTCTTCCTCAAAAG-----ATGGTTGCGGCTCGGTACTTTATTGAGGATCAAGTCGGGAGATATTTCACTTTGGCGGATGTTTCCTCGACAAAACCCGAATT-------------------AGCAAGTATTTACTAA----------------------------------------------------------TTCGGGTTTCGCGTTGTCCAGTAAAACAGGTGATTCATCTCTTCCGGTTACAGTGGTTAAACAATTGTAGCTTCTTCTT-------CTACTTCACTCATACAACGAAAATATAAATATTAATACATCGAA-----------------------TCCTTTGGATAAAATTCGTTATGAAAAGTAATGCTTGGGAGTTACTGCGATGAAGACAACTTCTGGATCCCTTCTCAAAATTGATGCATTACAGAAAAGCGAAGGGCTTAGCGCTAATCAAGACTGTTTCCTATATCTACTTCTTTTCTTATTCAGAGATAATTTTTATTCAGTCGCTTGTAAGCGTTTTTTAGATAGACGAGACA------------TCGGTCTAGTATTCGGGGCGTGTAGTGCAGCAGCAACAAAGCGTTCAACTGATAGTGTGCGTTACCAAGATTATTCGGAGATTTTTTATTCAGAATTTGTTTGAAAATGAAGCAGTCGACTTAACATAGATTTCTATCTCCATGTACTTCTACGAACAATATGTCTAATTCTAGGGATACCTATTCTGTGCCAGTTAGCCGCTGAAACAAATAACAACTCGAAAATTTCGCAGTCTATTCATTCAATATTTTTATTTCTGGAAGATAGATTACCAAAATCTAGCTACGTTTTAGAGATAGAGATGTCACGGAATCTTCATCTAGAAACTCCGGTTCGCTTGTTTCGTCGACGAATTAGGGATGTGACATTTCTACACCTACTAAGGATAGTTTTTTACACGTACAAAACTTCGTGTGGAAAATCTACTCAGTTTCGGTCTTGGAAACGAAAAGAACGAAAAAGTATTGATACGCTACTCCGAAATTTTTACACCTACGAAATTGATTCGGTATTGCTAGTTTTATGGACACGAATGCATGAGTTAAACCTAAGATATTCTGTATCTCCCGATCGAAATAACATGACTAGGAAGAAAATATGTGTTTCTGAGTATAATTCTCGGTCAGACACAATAAGCCTCGACCGTTGTCTCACTCGAAATTTGTGTATCCACTTTGGGAGATGTAAAAACAAATCTCTCATAGCTTTTCGTGGAACTCAATATTTTGCAAAAAGATGGATTTATTATCTTTTGATATTTCTTAGATCTCACTTTCATTATCCAATTGAATTTACTCAAATACGTATCTATTTGTTACCCGCTAGCTGTGTTTTATTCTTGGGTTACATCTCAGCTATTCACCCAGTCTTGAAAAACGTCCAGATTGAAACCACAGTGGATTCTTGCAGCAGT------ATTTCGAGTGGGGAAATAATTCACCCCAGGATTCCAATTTCGCTATTAGTTAAACTCTTGGAAAAAGAGAAGTTCCGCGATAGTACTGGACATCCAGTTAGTAAATCAGCCCGGACTGTATTAGCAGATGATGAGATTTTGAATAGGTTTGTGAAAATTTGGAATACTTTCTCCTTGTACCACAGCGCCTCAATAAATCGAGATGGATTGCGTAGATCGAGATATATATC------------------------------TACACCCCCGAATACAAGACCAAAGAGACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCTGGAGTACCAGCTGAGGAAGCCGGAGCTGCCGTAGCTGCGGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGACGGGTTGACCAGTCTCGACCGTTACAAGGGCCGATGCTACGACATAGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTCGTTCACCTCCATTGTAGGTAATGTTTCCGGATTTAAGGCTCTACGCGCCCTACGCTTGGAAGACCTTAGAATCCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCCAAAAATTATGGTAGAGCCGTCTATGAATGTCTTCGTGGTGGACTTGATTTTACAAAGGATGATGAAAACGTAAATTCTCAGCCATTCATGCGTTGGAGAGATCGATTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAGATGTTGAAGAGAGCTGTTTTTGCTAGGGAGTTGGGTGCACCAATAGTCATGCATGACTATCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACCGTCGAGACAATGGACTGCTTCTTCATATTCACCGCGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCTGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGACTATATCGAGAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCCGCTCTAACTGAAATCTTTGGGGACGATTCTGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCGTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTAGCATTAGAAG Matteuccia_struthiopteris TCGGCC-TACTCATTTACGAGTAAAACTCAACTAGAAATCGGTGAATTATATCTTTAAATGTAAAATCC-AGCTTCTT-GCCTAGTCA-AACC----GTTGATCTCGCCTTTATCGATCTGTTTAATACAATAC------CACTTCCAGTATA-G------AAAATCTGGA-------AGAGGGAGGGGGCTCGATCGAGCCATTCATGTATATTAAAAGCCTGAATGGCTCACCTGCGAAGTGTCTT-------------------------------GGAAGGACTGAATAAAAAGAAAAAAAAATTGAAGTGGTTTCCATATTTTACTTTTTTACCCC-GCTTCCAA--------ACAAATTATGCGAATCCAAACAACCTGAAATGGGTTAA------------------CTGAAGCGTCTCGTTGGGGATAGAGGGATTCGAACCCTCACGGTC----GAAACCAACGGATTTTCGTTCCACCGCAACTTGCGCTGCTACTTATTATTTCATTAGGTGCGTGGAATAGGACTCTACCTCCATTCACG-----AAAGTATCACTTTTCGGTTACCGGCTCGCTTGTTGAGTAATTTTCGTCGGAATAGAGTGGGATCCTGCA-----ACGGGTAATAGAAGGATATGCGGACTGGCA-ATAGTAGAAGGAGTCTACCCAGTGTCGCATCACTAAG------TACGAATAGAATTTTGTCAACGGACGCTGGTC--------CCAAACCAAGGGGTCCGCATCT-----------AAACGGGAGAATAAAAATTTAAAATTTTATTTCTATACTAGGTCTCAGT------CTTATACTTCTGCGTCTTATCCCATGCAATTAACCACACAAAACAATTAGATATTCAGTTATTTCGAGAACTAGTAACTAACAGA---CTGCTCGTTAGAATGGCCCCCGTCGAGTCTCTGCACCTATCTC--GCCTCGTCGCCCAAAATTCATTTGAGTGATACAAGA-AAATCGAATTATAGGAGAATCTAATGGGCCCAGCTTATAGCTATCTTCAGATGCTTTTGTATTATCCTTCTCTTTTACTTATACTCTACATCTATGCCGTATTTGGCATTCCCTTAAGAAGTAGAATATCTCGAAGGGACTACTGGTTTTCCATCAAAACCTCTTTCGAAAGAAGTGATATCGGACATATATTTATGGGTGTGATGAAAAATTGGAAGAGGAGGGGGGGACGCAGGTAGTTCAAGCCAATGACGTGACTATTGCCGGGA--------CATAAGTTTCCCCCC--AACTCGATGTTGGGTT-----GGGGGTTGACCGCCGATTCCATTCCGGAATTTTGGTCTAACTCCCC-ACGACCCTCCCAAAAAG-----ATGGTTGCAGCTCGGCACTTTATCGGGGATCGAGTTAGTAAAAATCTTATCCGGGTGGATGCTTTCTCGGCAAGAAACTAATAAGTAAGTATTTGCTGCATAGATAAATATTTGCCATATTAGTAAATATTTGCCATATTGGTAAGTATTTACTATATTGGTAAGTATTTACTAGCTTCGGGTTTCACATTGTCCGATGGGACAGGTGGTTCAGCTTATCTGACTACCGTGACTAG----TTGTAGTTTATTCCAC------CCACCTCATTTGCATAACAAAAATAAAACTACTAACCTATCGAA-----------------------TCTTTAGGATAAAATTCATTATGAAAAATAATGCTTGGGAGTTATTGCGATGAAGACAACTTCTGGATCCCTCCCCAAACTTGATGCATTACAGAAAAGTGAGGGGCTTAGCGTTAATCAAGGTTGTTTCCCATATCTACTTCTTCTCCTATCTAGAGATAATTTCTATTCAGTCGCTTGTAAGCGTTGTTTGGATAGACGAAGCG------------TCAGTTTGGCATTCGGGGCGTGTAGTGCAGCAGCAGCAAAGCGTTCAATTGATAGTGTGCGTTATCAAGATTATTCAGAGATTTTTTATTCAGAATCTGTTTGAAAATGAAGCAGTCGACTTAACGTAGATTTATATCTCCAGGTACTTCTACAAACAATATGTCTAATTTTGGAGATGCCTCTTTTGTGCCGGTTAGCTGCTGAAGCAAATAACAATTCAAAAATTTCACAGTCTATTCATTCAATATTTTTATTTGCAGAAGACAGATTACCAAAATCTAGTCACGTTTTAGAAATAGAGATGTCACAGAATCTTCATCTAGAAACTCTAGTTCGTCTGTTTCGTCGACAAATTAGGGATGTGCCATTTCTACATCTGTTAAGGATAGTTTTTCACACGTACAAAACTTTGTGTGGAAAATTTATTCAGTTTCAGTCTTGGAGACAGGGAGAACGGAGAAGTATTGATACGCTACTCCGAAATTTCTACACGTACGAAATTGATTCGGCATTGCTAGCTTTATGGACACGAATGCATAAGTCAAACCCAAGATATTTAGTATCTCCCGATCGGAATAACGTGACTAGAAAGAAAATACGTGTTTCTGACTATAGTTCCCAATCAGATGCAATAAGCATTGGCCGCTGTCTCATTCGAAGTTTGTGCATTCACTTTGGGAGATGCAAAAACAAATCTCTCATAGCTTTTCATGGAACTCAATATTTCGCAAAGAAATGGATTTATTGCATTTCGATACTTCTTCGATCTTATTTTCATTATCCAATTGAATTTACCCAGATACGTATCAACTTGTTATCCGTCAGTTGTGTTTCATTCTTGGGTTACATTTCAGCTATTCAGCCAGTCTCGAGAAACGTCCGGGTCGAAACCACAGTGGATTTTTGCATTAGC------ATCTCGGGCGGAAGAAGAAGTCATCCCAGGATTCCAATTTTGCTACCAGTTAAAATCTTGGAAAGGGAGAAGTTCCGCGATAGTACCGGACATCCAGTTAGTAAATCAGCCTGGGCTGTATTAGCAGATGATGAGATTTTGAACAGGTTTGTTAAAATTTGGAATGCTTTTTTCTCGTACCACAG---------------------------------------------------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGGGTACCTGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCTATTGTAGGTAACGTTTTCGGATTTAAGGCTCTACGCGCTCTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGGTGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTTACAAAAGATGATGAAAACGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTTGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACTGGCGAAATCAAGGGGCATTACCTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTTGCTAGGGAGTTGGGTGCACCAATCGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTCGAGACAATGGACTGCTTCTTCATATCCACCGTGCCATGCATGCTGTTATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCTAAAGCATTGCGCATGTCCGGCGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTATGGCACATGCCCGCCCTAACCGAAATCTTTGGGGACGACTCCGTCTTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAACGCACCCGGTGCAGTAGCTAACCGAGTCGCATTAGAAG Woodwardia_japonica GGGAGGTATATTTTCAAGGGA-------GGTATATTTTCAAGAGAGGTATATTTTCAAAC------CCC-AGCTTTTT-GCCTAGTCGAACCC-----TTGATCTCGCCTTTCTCGATCTGTTTGGTGCAACAG------AATTTCCAGCATA-T------AAAGTCTGGG-------------AGGGGGCTCGATTGAGCCATTCATGTATATCAAAAGTCTGAATGGCTCACTTGCGAA--------------------------------------GGAAAGACCAAATAGAGGAAGAATAG-GTTGAAGTGGTTTTCGTATTTT--------------GCTTCCGA--------ACAAATCATGTGAATCCAAACAACCTGAAATGGGTTAA------------------TTAAAGTGTCTCGTTGGGGATAGAGGGAGTCGAACCCTCACGGTC----GAAACCAACGGATTTTCGTTCCACTGCAACTTGCGCTGCCATTCATCATTTTATTAAGTGCGTAGAATGGGACTCTACCTCCATTCACG-----AAAGTATCGCTTCTCCGCTACCGGCCCGATTGCTGAATAACTTCCATTGGAATAATGCGGGATCCCACA-----ACAGGTAAGATAAGAATATGCGGACTAGCA-ATAGTAGAAGGAGTCTACTCAGTTTTGTATTACTAGA-----------ACAGAATTTCGCGAATGAATGCTGGCC--------CCAAACCGAGGGTTCCGCATCC-----------AACTAGGGAAA-GAAGAAGTGAAACTTTATCTCTTTACCAAGTCTCATT------CTTATGCTTCTACATCTTATCCCATGCGGTTAACCACATTAAACGGTTAGATATTCAGTTATTTCAAAAACTAGTAACTAACAGA---CTGCTCGTTGGAATGGCCCCCGTCGAGTCTCTGTACCTATCTC--GCCTCGTCGCCCGAAATTCAATTGAGTAATACAAGA-AAATCAAATTTTAGGAGAATCTAATGGGCCCAGTTTACAGCAATTTTCAGGTGCTTCTGTATTACCCCTCTCTTTTACTTATACTCTACATCTATGCCATATTTGGCATTCCCTTAAGAAGTAGAATATCTCGGAGGGACTACTGGTTTTCCATCAAAACCTCCTTCGGAAGAAGTGATATCGGACATATCTTCATGGGTGTTATTAAAAATTGGAAGAGGAGGGGGAGACGCAGGTAGTTCACACCAATGACATGATTACCACCGGGA--------CAAATATTTTTTTCC--AATTTAACGTTGGGTT-----AGGGATTGAACACCGATTTCACATCATAAATTTGGTCTAACTCCTC-ACAACCTTTTTCAAAAG-----ATGGTTGGAGCTCGGTATTTTATTCAGGATCAAATCAAAAAAGATTTTGTCTGAGTGGATGCTTCCCCGACAAGAACCAAATAAGTAAGTATTTACTAC----------------------------------------------------------------------------CTTTGGGTTTCACATTGTCCGATGAAACAGGTGATTCAACTTCTTTG-CCACCGTGGTTAAACAATTGCAGCTC-CTCCTC------CTATTTTATTCGTATAGCGAAAATAGAACTATTAATACATCGAA-----------------------TCTTTCGGAGAAATTTCATTACGGAAAGTAACGCTTGGGAGTTACTGCGATGAAGACAACTTCTGGACCTCTTCCTAAAATTGATGTATTAAAGAACAGCGAAGGACTTAGCATTAATCGAGATCGTTTCCCATATCTATTTCTTTTCTTATTTAGAGATAATTTCTATTCAGTTGCTTGTAAGCGTTGTTTAGATAGACGAAGCA------------TCAATTTAGTTCTTGGGGCGTGTAGCGCAGCAGCAACAAAGCGTTCAATTGATAGTGTGCGTTACCAGGATTATTCAGAGATTTTCTATTCAGAATTTGTTTGAAGATGAAGCAGTCGACTTAGCATAGATTTATATCTGCATGTACTTCTACAAACAGTATGTCTAATTTTGGGGGTACCTCTTTTGTGTCGGTTAGCCGCTGAAACAAATAACAACTCAAAAATTTCGCAGTCTATTCATTCAATATTTTTATTTTTGGAAGATAGATTGCCAAAATCTAGTCACGTTTTAGAGCTGGAGATGTCACAGAATCTTCACCTAGAAACTCTGGTTCGCCTGCTTCGTCGACAAATTAGGGATGTGCCATTTCTACATCTATTGAGGATAGTTTTTCACACGTACAAAACTTTGTGTGGAGAATTTACTCAGCTCCGATCTTGGAAGCAAGAAGGGCGAAGAAGTATTGATATGCTACTCCAAAATTTTTACACATACGAAATTGATTCAATACCGTTAGCTTCATGGACACGAATGCATAAGTCGAACCCAATATATTTTGTATCTACCGATCAAAATAACATGACTAGGAAGAAAATACGTGTTTCTGAATATAGCTCCCAATCAGACGCGATGAACATCGACCACTGCCTTACCCGAATTCTGTGCATTCACTTCGCAAGATTTAGAAACAAATCTATCATAGCTTCTCATGGAACTCAATATTTCGCGAAAAAATGGAGTTATTACATTTCGATATTTTACCGATCTCACTTTCACTATCCAATTGACTTTACTCAAATACGTATCAATTTATTATCCGCCAGCTGTGTTTTATTCTTGGGTTATATTTCAGTTATTCAGCCAGTCTCAAAAAACGTCTGGGTCGAAACCGCAGTGGATCCTTGCAACAGCAACAGTATTTCAGGCGGAAAAGAAATTCATCCCAGGGTTCCAATTTTATTATTAGTCAAACTCTTGGAGAAAGAGAAGTTTTGCGATGGTGCCGGACATCCAGTTAGTAAATTAGCTTGGACTGTATTAACAGATGATGATATTTTGAACAGGTTTTCAATAATTTGGAATACCTTTTCCTCGTATCACAG---------------------------------------------------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCGGCCTTCCGCATGACCCCGCAACCCGGGGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACAGGTACGTGGACCACTGTCTGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAGGATAACCAGTATATTGCATATGTAGCTTATCCTTTGGATCTATTTGAAGAAGGTTCTGTCACCAATTTGTTCACTTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCCCTACGCTTGGAAGATCTTCGAATCCCTCCTGCCTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAAGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTTTTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGGGCCGTCTATGAATGCCTTCGTGGTGGACTTGATTTTACAAAAGATGATGAAAATGTAAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAAGCCCAGGCTGAAACGGGCGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTTGCTAGGGAGTTGGGTGCACCAATAGTCATGCATGACTACTTGACCGGAGGATTTACCGCAAATACCAGCTTAGCTTTTCACCGCCGAGACAATGGACTGCTTCTTCATATCCACCGTGCGATGCATGCTGTTATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGCAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAAGGTGAACGAGAAGTCACTTTGGGTTTCGTCGATTTACTTCGCGACGATTATATCGAAAAAGATCGTAGCCGCGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCTGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCCGCCCTAACCGAAATCTTTGGGGACGATTCTGTTTTACAGTTCGGTGGGGGAACCTTGGGACATCCTTGGGGAAACGCACCCGGTGCGGTAGCCAACCGAGTCGCGTTGGAAG ; END; BEGIN SETS; CHARSET rps16matK (CHARACTERS = 'Deparia trnL-L-F + rps16-matK IGS + matK + rbcL') = 1004-3084; CHARSET rbcL (CHARACTERS = 'Deparia trnL-L-F + rps16-matK IGS + matK + rbcL') = 3085-4318; CHARSET trnLF (CHARACTERS = 'Deparia trnL-L-F + rps16-matK IGS + matK + rbcL') = 1-1003; END; BEGIN TREES; TITLE 'Deparia 4-pDNA bestREP1'; LINK TAXA = Taxa1; TRANSLATE 1 Woodwardia_japonica, 2 Matteuccia_struthiopteris, 3 Athyrium_atkinsonii, 4 Athyrium_otophorum, 5 Athyrium_filixfemina, 6 Cornopteris_opaca, 7 Athyrium_niponicum, 8 Athyrium_skinneri, 9 Diplazium_wichurae, 10 Diplazium_proliferum, 11 Diplazium_squamigerum, 12 Diplazium_bombonasae, 13 Diplazium_dilatatum, 14 Deparia_petersenii_petersenii_var._petersenii, 15 Deparia_petersenii_petersenii_var._yakusimensis, 16 Deparia_japonica, 17 Deparia_confluens, 18 Deparia_biserialis, 19 Deparia_dimorphophylla, 20 Deparia_lobatocreneta, 21 Deparia_petersenii_deflexa, 22 Deparia_longipes, 23 Deparia_tenuifolia, 24 Deparia_pseudoconilii, 25 Deparia_timetensis, 26 Deparia_kiusiana, 27 Deparia_conilii, 28 Deparia_lancea, 29 Deparia_tomitaroana, 30 Deparia_otomasui, 31 Deparia_bonincola, 32 Deparia_fenzliana, 33 Deparia_cataracticola, 34 Deparia_marginalis, 35 Deparia_prolifera, 36 Deparia_kaalaana, 37 Deparia_minamitanii, 38 Deparia_dickasonii, 39 Deparia_concinna, 40 Deparia_omeiensis, 41 Deparia_heterophlebia, 42 Deparia_yunnanensis, 43 Deparia_hainanensis, 44 Deparia_formosana, 45 Deparia_erecta, 46 Deparia_acrostichoides, 47 Deparia_aff._jiulungensis, 48 Deparia_pycnosora, 49 Deparia_dolosa, 50 Deparia_macdonellii, 51 Deparia_jiulungensis, 52 Deparia_acuta, 53 Deparia_medogensis, 54 Deparia_auriculata, 55 Deparia_sichuanensis, 56 Deparia_wilsonii, 57 Deparia_emeiensis, 58 Deparia_pterorachis, 59 Deparia_okuboana, 60 Deparia_henryi, 61 Deparia_viridifrons, 62 Deparia_coreana, 63 Deparia_unifurcata, 64 Deparia_gordonii, 65 Deparia_edentula, 66 Deparia_subfluvialis, 67 Deparia_aff._glabrata, 68 Deparia_glabrata, 69 Deparia_boryana, 70 Deparia_sp., 71 Deparia_forsythiimajoris, 72 Deparia_parvisora; TREE bestREP1 = [&R] ((((9:36.314499,12:36.314499):11.813685,(11:44.800546,(10:28.475298,13:28.475298):16.325248):3.327638):29.172474,((7:37.95165,8:37.95165):17.237696,(6:48.350521,(5:22.358737,(3:19.165381,4:19.165381):3.193356):25.991784):6.838825):22.111312):6.019342,((58:18.845286,((61:0.263074,(59:0.263074,(60:0.263074,62:0.263074):1.0E-8):1.0E-8):11.814895,((63:1.0E-8,64:1.0E-8):8.863364,((65:3.214196,66:3.214196):4.923441,(67:3.241208,(69:3.241208,(68:3.241208,(70:0.935475,(71:0.357669,72:0.357669):0.577806):2.305733):1.0E-8):1.0E-8):4.896429):0.725727):3.214605):6.767317):8.834714,(((46:8.211672,(47:5.503383,48:5.503383):2.708288):3.957945,(49:3.359978,((51:0.47403,52:0.47403):2.885948,((57:3.359978,(50:1.290758,53:1.290758):2.069219):1.0E-8,(54:0.319858,(55:0.319858,56:0.319858):1.0E-8):3.04012):1.0E-8):1.0E-8):8.80964):10.593245,((45:15.156369,((41:0.461746,42:0.461746):5.761408,(43:1.0E-8,44:1.0E-8):6.223155):8.933214):4.939306,((40:1.0E-8,(37:1.0E-8,(38:1.0E-8,39:1.0E-8):1.0E-8):1.0E-8):13.148582,(((31:8.567937,(30:6.792081,(28:1.601333,29:1.601333):5.190747):1.775857):0.552241,(32:7.099545,(33:1.844146,(35:0.24351,(34:0.24351,36:0.24351):1.0E-8):1.600636):5.255399):2.020633):3.390712,(27:3.963227,(26:2.909405,(25:1.795473,(23:1.174893,((21:0.408428,22:0.408428):0.766465,(16:0.403942,(19:0.403942,(15:0.403942,(17:0.122772,(24:0.122772,(20:0.122772,(14:0.122772,18:0.122772):1.0E-8):1.0E-8):1.0E-8):0.281171):1.0E-8):1.0E-8):0.770951):1.0E-8):0.62058):1.113932):1.053821):8.547664):0.637691):6.947093):2.667187):4.917138):55.64); END; BEGIN TREES; TITLE 'Deparia 4-pDNA rep9BEST'; LINK TAXA = Taxa1; TRANSLATE 1 Woodwardia_japonica, 2 Matteuccia_struthiopteris, 3 Athyrium_atkinsonii, 4 Athyrium_otophorum, 5 Athyrium_filixfemina, 6 Cornopteris_opaca, 7 Athyrium_niponicum, 8 Athyrium_skinneri, 9 Diplazium_wichurae, 10 Diplazium_proliferum, 11 Diplazium_squamigerum, 12 Diplazium_bombonasae, 13 Diplazium_dilatatum, 14 Deparia_petersenii_petersenii_var._petersenii, 15 Deparia_petersenii_petersenii_var._yakusimensis, 16 Deparia_japonica, 17 Deparia_confluens, 18 Deparia_biserialis, 19 Deparia_dimorphophylla, 20 Deparia_lobatocreneta, 21 Deparia_petersenii_deflexa, 22 Deparia_longipes, 23 Deparia_tenuifolia, 24 Deparia_pseudoconilii, 25 Deparia_timetensis, 26 Deparia_kiusiana, 27 Deparia_conilii, 28 Deparia_lancea, 29 Deparia_tomitaroana, 30 Deparia_otomasui, 31 Deparia_bonincola, 32 Deparia_fenzliana, 33 Deparia_cataracticola, 34 Deparia_marginalis, 35 Deparia_prolifera, 36 Deparia_kaalaana, 37 Deparia_minamitanii, 38 Deparia_dickasonii, 39 Deparia_concinna, 40 Deparia_omeiensis, 41 Deparia_heterophlebia, 42 Deparia_yunnanensis, 43 Deparia_hainanensis, 44 Deparia_formosana, 45 Deparia_erecta, 46 Deparia_acrostichoides, 47 Deparia_aff._jiulungensis, 48 Deparia_pycnosora, 49 Deparia_dolosa, 50 Deparia_macdonellii, 51 Deparia_jiulungensis, 52 Deparia_acuta, 53 Deparia_medogensis, 54 Deparia_auriculata, 55 Deparia_sichuanensis, 56 Deparia_wilsonii, 57 Deparia_emeiensis, 58 Deparia_pterorachis, 59 Deparia_okuboana, 60 Deparia_henryi, 61 Deparia_viridifrons, 62 Deparia_coreana, 63 Deparia_unifurcata, 64 Deparia_gordonii, 65 Deparia_edentula, 66 Deparia_subfluvialis, 67 Deparia_aff._glabrata, 68 Deparia_glabrata, 69 Deparia_boryana, 70 Deparia_sp., 71 Deparia_forsythiimajoris, 72 Deparia_parvisora; TREE rep9BEST = [&R] (1:0.10469253,2:0.08224536,((((9:0.03205956,12:0.0307058):0.01089353,(11:0.02249207,(10:0.03511082,13:0.01852182):0.01797784):0.00296265):0.02920981,((7:0.02362133,8:0.02910085):0.01160601,(6:0.03427639,(5:0.00602745,(3:0.00957602,4:0.02004376):0.00265097):0.0126428):0.00357003):0.01099703):0.01065834,((58:0.00674928,((61:2.5605E-4,(59:1.0E-8,(60:1.0E-8,62:5.1252E-4):1.0E-8):2.5486E-4):0.0057447,((63:1.0E-8,64:1.0E-8):0.00762037,((65:0.0025581,66:0.00309656):0.00497462,(67:0.00127891,(69:0.00230464,(68:0.00228851,(70:5.0645E-4,(71:2.5267E-4,72:7.6337E-4):5.0848E-4):0.0030541):1.0E-8):2.2587E-4):0.00329019):5.3923E-4):0.00374738):0.00551562):0.00428719,(((46:0.00538694,(47:0.00394736,48:0.00435422):0.00218128):0.00275965,(49:0.00283359,((51:7.7091E-4,52:1.0E-8):0.00203497,((57:0.00358514,(50:0.00101675,53:5.0762E-4):5.1072E-4):2.5868E-4,(54:5.079E-4,(55:1.0E-8,56:1.0E-8):1.0E-8):0.00228989):2.5256E-4):2.3509E-4):0.00581657):0.00635166,((45:0.00925154,((41:1.0E-8,42:5.1062E-4):0.00420213,(43:1.0E-8,44:2.5568E-4):0.00756623):0.01048686):0.00478004,((40:1.0E-8,(37:2.5515E-4,(38:1.0E-8,39:1.0E-8):1.0E-8):2.5356E-4):0.01025596,(((31:0.00442664,(30:0.00999831,(28:0.00108451,29:0.00149161):0.00508923):0.00249186):6.4311E-4,(32:0.00417191,(33:2.5152E-4,(35:2.573E-4,(34:1.0E-8,36:7.6658E-4):1.0E-8):0.00180024):0.00259661):0.00102818):0.00252796,(27:0.00184178,(26:7.7797E-4,(25:0.00292126,(23:1.0E-8,((21:5.7467E-4,22:1.0E-8):7.7827E-4,(16:0.00103802,(19:2.589E-4,(15:2.5721E-4,(17:1.0E-8,(24:0.00103656,(20:1.0E-8,(14:2.5739E-4,18:2.576E-4):2.5719E-4):1.0E-8):1.0E-8):5.1465E-4):1.0E-8):1.0E-8):0.00155159):2.5375E-4):6.7853E-4):0.00242733):0.00127351):0.0091567):9.5303E-4):0.00743895):0.00331221):0.00564214):0.04466348):0.01530133); END;