#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 4:33 GMT TreeBASE (cc) 1994-2008 Study reference: Kocsube S., Perrone G., Magista' D., Houbraken J., Varga J., Szigeti G., Hubka V., Hong S., Frisvad J.C., & Samson R. 2016. Aspergillus is monophyletic: Evidence from multiple gene phylogenies and extrolites profiles. Studies in Mycology, 85: 199–213. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S20285] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=96; TAXLABELS Aspergillus_acanthosporus Aspergillus_aculeatus Aspergillus_amstelodami Aspergillus_arenarius Aspergillus_avenaceus Aspergillus_biplanus Aspergillus_bisporus Aspergillus_brunneouniseriatus Aspergillus_calidoustus Aspergillus_candidus Aspergillus_cavernicola Aspergillus_cervinus Aspergillus_clavatoflavus Aspergillus_clavatus Aspergillus_conjunctus Aspergillus_coremiiformis Aspergillus_egyptiacus Aspergillus_fischeri Aspergillus_flavipes Aspergillus_flavus Aspergillus_fumigatus Aspergillus_funiculosus Aspergillus_glaucus Aspergillus_janus Aspergillus_kanagawaensis Aspergillus_leporis Aspergillus_nidulans Aspergillus_niger Aspergillus_ochraceoroseus Aspergillus_ochraceus Aspergillus_oryzae Aspergillus_penicillioides Aspergillus_pulvinus Aspergillus_restrictus Aspergillus_robustus Aspergillus_sparsus Aspergillus_steynii Aspergillus_sydowii Aspergillus_terreus Aspergillus_togoensis Aspergillus_versicolor Aspergillus_wentii Aspergillus_zonatus Basipetospora_halophila Byssochlamys_nivea Byssochlamys_spectabilis Hamigera_avellanea Hamigera_striata Monascus_purpureus Penicilliopsis_clavariiformis Penicillium_adametzii Penicillium_arenicola Penicillium_canescens Penicillium_catenatum Penicillium_charlesii Penicillium_chrysogenum Penicillium_cinnamopurpureum Penicillium_citreonigrum Penicillium_citrinum Penicillium_coffeae Penicillium_cryptum Penicillium_dimorphosporum Penicillium_euglaucum Penicillium_expansum Penicillium_glabrum Penicillium_griseofulvum Penicillium_griseolum Penicillium_herquei Penicillium_hirayamae Penicillium_idahoense Penicillium_janthinellum Penicillium_javanicum Penicillium_lagena Penicillium_lanosum Penicillium_lapidosum Penicillium_lassenii Penicillium_macrosclerotiorum Penicillium_malachiteum Penicillium_megasporum Penicillium_ochrosalmoneum Penicillium_olsonii Penicillium_paradoxum Penicillium_ramusculum Penicillium_restrictum Penicillium_shearii Penicillium_simplicissimum Penicillium_stolkiae Penicillium_thiersii Penicillium_tularense Polypaecilum_insolitum Sclerocleista_ornata Sclerocleista_thaxteri Talaromyces_flavus Talaromyces_leycettanus Thermoascus_crustaceus Warcupiella_spinulosa ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M39269] TITLE Aspergillus; LINK TAXA = Taxa1; DIMENSIONS NCHAR=3395; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aspergillus_acanthosporus TATCGCCCCAGCGTAACGGCCCACTCATGGGTATTGTGCAAGACACTCTTTGCGGTATCTATAAGATCTGCCGCCGTGATATATTCCTCACCAAGGAACAGGTGATGAACATTATGTTGTGGGTTCCCGATTGGGATGGAGTCATTCCTCCCCCGGCTATCCTCAAGCCTAGACCCAGATGGACTGGAAAACAGATGATCAGCATGGCTCTTCCGTCGGGTCTCAACCTGCTGCGTGTGGA---AAAGGATAACTCTTCTCTGGCAGAGAAGTTCTCTCCTTTGACAGACAGCGGTGTCCTCATCCACGGTGGACAGTTGATGTATGGAATGCTGTCCAAGAAGACTGTTGGTGCTAGTGGTGGTGGTGTCATCCACACAATCTTTAACGAGTATGGGCCGGAGACCGCAGTGGCTTTCTTCAATGGAGCCCAAACCATTGTCAACTATTGGTTGCTGCACAATGGATTCAGCATTGGTATCGGTGATACCATTCCGGATGCGCTCACGATCCAGCGAATTGAGAACTGTGTGCGTGAGCGGAAGCAGGAAGTCGAGGCTATTACAGCAAGTGCTACGGAAAATACCCTGGAGCCCTTACCCGGTATGAACGTGCGAGAGACTTTCGAAAGCAAGGTCTCGCGCGCTCTGAACAACGCTCGTGATGAGGCAGGTAGTGAGACCGAAAAGAGCTTGAAGGACCTCAACAACGCCATTCAAATGGCCCGTTCTGGATCCAAGGGTTCGACGATCAATATCTCTCAGATGATGTGTTGAAACCAACAGGGAAATCTACCTCAACATCGGTATTAAGGCCAGTACCTTGACAGGAGGTCTGAAATATGCCCTCGCCACGGGTAACTGGGGAGAACAGAAGAAGGCAGCAAGCTCCAAGGCTGGTGTCTCACAGGTGCTGTCTCGTTACACTTATTCTTCGACCCTGTCGCATTTGCGCCGAACCAATACCCCCATCGGACGTGATGGTAAGATCGCCAAACCTCGTCAGCTTCATAACACGCATTGGGGTCTGGTCTGTCCGGCAGAGACACCCGAAGGTCAGGCTTGTGGTCTAGTTAAGAATTTGGCTCTCATGTGTTACATCACTGTCGGTACCCCGAGCGAACCCATCATTGATTTCATGATTCAGCGCAACATGGAGGTTCTTGAGGAATTCGAGCCTCAAGTGACGCCAAACGCTACAAAAGTATTTGTGAACGGTGTCTGGGTTGGTGTTCACAGAGATCCTGCTCATTTGGTCAACACCATGCTTTCTCTGCGTCGTCGCAACATGATCTCGCATGAGGTCAGCTTGATTCGTGACATCCGTGAGCGCGAGTTCAAGATTTTCACCGATACTGGACGTGTTTGTCGACCACTCTTCGTCATTGACAATGACGCGAAGAGTGAGAACTGCGGCTCCCTGGTGCTGAACAAGGAGCATATTCGCAAGCTGGAGCAAGACAAAGAGC---------TGTCCCCAGATCTTGACCCTGAGGAGCGTAGAGAACGCTACTTTGGCTGGGATGGATTGGTCAAGTCTGGAGTTGTGGAGTATGTCGATGCCGAGGAAGAAGAGACCATCATGATTTCCATGACCCCGGAGGATCTCGAGATCTCCAAGCAACTTCAGGCCGGTTATGCTCTTCCCGAGGAGGAGCTGAATGACCCGAACAAGCGTGTCCGCTCAATTCTGAGCCAGAGGGCACATACCTGGACGCACTGCGATAGTCCCTGGGAGACTGCGGAGGATCGTGCACACGAACCCGAGGATTGGCGCCGACTTCTGCAGGTTATTGACTACAAGGGTTCCAAGAACAGAATCCTTCGGGAAGCTCTCGTTGGTGGCGTGAGCCCTGGAACGAGGGTCGATGTTCACTTGCGCGCAGTACCTTCTTCGCTCCGCAACCGTCAGCAGCCCCTCTCCCTTTTCTC-GCTGCTCCGTCACGAGCACAAACACACCGTTGTCAACGTAAACATGCACCTCAACGCTAGCGTGGAGGAGCCCCTCAAGTCGAAGGAAGAGCTGATCGTGCAGTGCGGTCCCCGCCGTCTGGTCGTCAACCCGGTCTTCTCCGCGGGCGACAACACCCCGAACAATGTTCACAAGTTCGACCGATTCCTGCACCCAGGACGCAGCGCGATTGCCACCTGGATTGGCCCCCTCACCTGGGGCGCCGTGCCAGTCCTCGTATTCAAGAACAAGCGCACC---------CAGGACCCCGAGGTCCTGGATTCCGCAGACG---------------ACGACACAGAAGACCAGATCCACCCCGACAACCTGGAGCTCATCGGCACCGGTACTGTCGTTGCCCCCGACCAGTCCCGCGTGGTTGCCAAGCGCGCCATCCGCAAGGCCAAGGTCGGCGTGTTTAGCTGCCCCATCGATATCTCCCAGACCGAAACCAAGGGCACCGTGCTCTTGAAGAATGCCCAAGAGATGCTCGACTTCTCGAAGGGCGAGGAGGACCGCCTGGAGGCCGCCATCAAGGAGCTTTATGACTCCGGCCTTCGTGTTGTCGTTGCTGGCTCCTCCGTTGGTGATCTGGCTTTGCATTACCTCAACCGGTTCAACATCCTTGTGGTCAAGATTCTTTCTAAGTTCGAGCTTCGCCGGCTGTGCCGTGTCGTCGGTGCGACGCCGCTTGCTCGTCTTGGTGCCCCAATGCCCGACGAGATGGGTAGCGTTGATGTCGTCGAGACTACCGAGATTGGTGGCGACCGCGTGACCGTTTTCCGTCAAGAAGATGCCAACGCTGTCACTCGTACCGCTACCATCGTCCTGCGTGGAGCGACCCAAAACCACCTCGACGATGTCGAGCGTGCTATCGACGACGGTGTCAATGCCGTCAAGGCCATCACCAAAGATCCCCGTCTTGTTCCTGGCGCTGGCGCTACTGAGATCCAGCTCGTAGAGAAGGTCACTGCGTTTGCTGACAAGACCCCGGGGTTGCCCCAGTACGCCATTCGCAAGTACGCCGAGGCCTTTGAGGTCATCCCCCGTACTCTTGCGGAATCCGCCGGCTTAGACGCCACAGAGGTTCTCTCTCGTCTCTACACAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCA----CTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGCCAATGGTGACAAGTATGTTCCTCGTGCCGTCCTTGTCGATCTCGAGCC-CGGTACCATGGATG------------------AGATCACCACCAAGGAGTTGGGTACCGTTATGCGCTCTCTGGGCCAGAACCCTTCCGAGTCGGAGCTCCAGGACATGATCAACGAGGTTGATGCCGACAACAACGGCACCATTGATTTCCCCGAGTTCCTCA Aspergillus_aculeatus TTTCCCCCCAGCGAAACGGCCCACTTATGGGTATCGTGCAGGATACTCTTTGCGGTATTTATAAGATTTGCCGACGTGATGTCTTCCTGACGAAGGATCAGGTCATGAATCTGATGATGTGGGTGCCAGACTGGGATGGTGTTATTCCTCCCCCAGCTATCTTGAAACCCAGACCCCGGTGGACTGGAAAGCAGATGATTAGTATGGCCCTGCCTCCTGGCCTGAACCTCTTACGTGTGGA---CAAGGACAGCTCGCCATTGGCGGAGAAATTCTCTCCCTTGGCTGATGGTGGTCTCCTCATCCACGGAGGACAGTTGATGTATGGTATGTTTTCCAAGAAGACTGTCGGAGCAAGCGGTGGCGGTGTCATCCACACCATTTTCAACGAAAACGGGCCTTGGGCTGCTGTGGGTTTCTTTAACGGTGCTCAAAGAATTGTCAACTACTGGTTGCTACACAACGGTTTCAGTATCGGTATTGGTGACACCATTCCTGACGAGTTAACAATCCAGCGCATCGAGAACTGTGTGAAGAACCGCAAGAAGGAGGTTGAGGAAATCACTGCTAGCGCCACCGACAACACGCTCGAGCCTCTACCTGGTATGAACGTCCGTGAGACTTTTGAGAGCAAGGTCTCGCGTGCTCTGAACAATGCTCGTGATGAAGCTGGTAGCGAGACGGAGAAGAGTTTGAAGGATCTGAATAACGCCATCCAGATGGCTCGCTCCGGTTCCAAGGGTTCAACCATTAACATCTCTCAGATGGTGCGTGGAGACGAACAGAGAGATTTACCTGAATATTGGTATCAAGGCTAGCACCTTGACGGGAGGATTGAAGTATGCTCTTGCTACGGGTAACTGGGGCGAGCAGAAGAAGGCAGCCAGCTCCAAGGCCGGTGTGTCTCAAGTGCTCAGTCGTTACACTTACGCCTCCACCTTGTCCCATCTTCGCCGAACCAATACACCCATCGGGCGAGACGGAAAGATTGCCAAGCCTCGTCAGCTTCACAACACTCATTGGGGCCTGGTGTGTCCGGCTGAAACCCCTGAAGGTCAAGCTTGTGGTTTGGTCAAGAACTTGGCTCTCATGTGCTACATCACTGTCGGTACGCCCAGCGAGCCTATCATTGATTTCATGATTCAGCGTAATATGGAAGTCCTCGAGGAGTTCGAACCTCAAGTGACACCGAACGCTACCAAGGTATTTGTCAATGGTGTCTGGGTTGGTATCCACAGAGACCCCGCTCACCTTGTCAACACGATGCTTTCCCTTCGTCGCCGCAACATGATTTCGCACGAGGTCAGTCTGATTCGAGACATTCGTGAGCGGGAGTTCAAGATTTTCACCGATGCTGGACGTGTCTGCCGACCGCTCTACGTCATTGACAATGACCCGAAGAGTGAAAACTGCGGCTCTCTGGTGCTCAACAAAGAACACATCCGCAAACTGGAACAAGATAAAGACC---------TGCCTCCAGACTTGGATCCAGAAGACCGCCGCGATCGTTACTTCGGTTGGGATGGCCTGGTGAAGTCTGGTGTAGTGGAGTATGTCGATGCTGAAGAAGAAGAGACCATCATGATTTCCATGACTCCGGAAGATCTCGAAATTTCCAAGCAACTCCAGGCTGGTTATGCTCTTCCGGATGAGGAGCTACACGATCCGAACAAGCGTGTACGCTCCATTCTGAGTCAAAAGGCGCACACTTGGACTCACTGCGACAGCCCGTGGGAGACCTCCGAGGACCGCGCGCACGAGCCCGAGGACTGGCGCCGGCTGCTCCAGTTCGCCGACTACAAGGGCGCGAGGAACAAGTTCCTCCGCGAAGCTCTCGTCGGCGGCGTCAACCCCGGCGCGCGGGTGGATGTGCACCTGCGCGCTGTGCCCGCCGCCCTCCGCAACCGCCCGCAACCCCTCTCTCTCTTCTC-GCTGCTGCGTCACGAACACAAGCACACGGTGGTCAACATCAACATGCACCTCAACTCGAGCGTCGAGGAGCCCCTCAAGTCCAAGGAGGAACTGATCGTCCAGTACGGCCCGCGCCGCCTGGTCGTCAACCCGATCTTCTCCGCGGGCGACAACACCCCCAACAACGTCCACAAATTCGACCGCTTCCTGCACCCCGGCCGCAGCGCCGTCGCCACCTGGATCGGCCCCTTGACCTGGGGCGCGGTGCCCGTGCTCGTCTTCAAGAGCAAGAAA---------CCCGCCGCCGCCGAGGACCCCGAGGAGATGGTCGACGCC------GTCGACGAGGAAGAAGAAAGCCCCCGTCTCGACCGCCTCGAGCTCATCGGCAAAGGCACCGTCATCGCCCCGGACCAGAACCGCGTCGTGGCCAAGCGCGCCATTACCAAGGCCAAGGTTGGAGTCTTCAGCTGCCCCATCGACATTTCTCAGACTGAGACCAAGGGTACCGTGCTGTTGAAGAACGCGCAGGAAATGCTGGACTTCACAAAGGGCGAGGAGGAGCGTTTGGAGGCGGCTATCAAGGAGCTTTACGACTCTGGTCTGCGTGTTGTCGTCTGCGGTTCCACCGTTGGTGACCTGGCCATGCACTTCCTTAACCGCTTCAACATCCTTGTGATCAAGATTCTCTCGAAGTTCGAGCTGCGCAGACTGTGCCGTGTTGTTGGCGCCACCCCTCTCGCTCGCCTGGGCGCCCCGATGCCCGACGAGATGGGTAGCATCGATGTTGTCGAGACTACCGAGATCGGCGGTGACCGGGTGACCGTCTTCCGTCAAGAGGATGCCAACGCTGTCACTCGTACGTCCACCATTGTCCTGCGTGGCGCTACCCAAAACCATCTCGATGACGTTGAGCGTGCGATCGACGATGGTGTCAACGCAGTCAAAGCTATCACCAAGGATCCCCGCCTGGTTCCTGGTGCCGGTGCCACCGAGACTCAACTTGTGGAGAGAATCTCCGCCTTCGCGGATAAGACTCCTGGCTTGCCCCAGCACGCTATTCGCAAGTACGCTGAAGCGTTCGAAGTGGTTCCTCGCACCCTGGCCGAGTCGGCTGGTCTGGACGCAACTGAGGTTCTGTCTCGTCTCTACACAGACCATCTCTGGTGAGCACGGCCTCGATGGCGCCGGTGT----TTACAATGGCTCCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGCTAGCGGCAACAAGTATGTTCCCCGTGCCGTCCTCGTCGACCTCGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGACAAATTACCACCAAGGAGTTGGGTACCGTTATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCTGAGCTCCAGGACATGATCAACGAGGTTGATGCTGACAACAATGGCACTATCGACTTCCCCGAATTCCTTA Aspergillus_amstelodami TGTCGCCTCAGCGTAACGGCCCCCTCATGGGTATCGTTCAAGATACTCTCTGTGGTATTTACAAGATTTGTCGACGGGACACCTTCTTGACCAAAGAGCAGGTGATGAATATTATGCTTTGGGTTCCTGACTGGGACGGAGTTATCCCACCACCGGCTATCATCAAGCCTAGACCCAGATGGACAGGGAAACAGATGATTAGCATGGCGCTTCCCTCCGGGTTGAACCTTCTCCGTGTGGA---CAAGGACAACTCTGCACTCGCGGAGAAGTTCTCTCCTCTGGCTGACGGTGGTCTTCTTATCCACGGAGGCCAGCTCATGTATGGATTGCTTTCCAAGAAGACCGTTGGTGCTAGTGGCGGTGGTGTTATTCACACCATTTTCAACGAGTATGGCCCAGAAGCCACAGTGGGCTTTTTCAACGGCGCCCAGGCCATCGTCAACTATTGGTTGCTGCACAACGGTTTCAGTATTGGTATCGGTGATACGATTCCGGACCCGCTTACAATTCAGAGAATTGAAAACTGTGTTCGCAATAGAAAGAAGGAGGTTGAGGAAATCACTGCCATCGCCACAGAGAACCAGCTTGAGGCACTACCCGGTATGAACGTGCGAGAAACCTTTGAAAGTAAGGTCTCACGCGCTCTCAACAATGCTCGTGATGAAGCCGGTAGTGAGACCGAGAAGAGTTTGAAGGATCTGAACCACGCTATTCAGATGGCTCGCTCTGGATCCAAGGGTTCGACGATCAACATTTCTCAGATGATGTGTGGAAACCAACCGTGAGATCTACTTGAACATTGGTATCAAGGCTAGCACCTTGACCGGAGGTTTGAAATATGCTTTGGCCACAGGTAACTGGGGTGAACAAAAGAAGGCGGCTAGTGCGAAGGCAGGTGTGTCGCAGGTGCTGAGTCGATACACATATGCCTCTACCTTGTCGCATCTTCGTCGGACAAACACCCCGATTGGTCGTGACGGAAAGATTGCCAAACCGCGACAACTCCACAACACTCACTGGGGTCTGGTGTGTCCAGCAGAAACTCCAGAAGGTCAAGCTTGTGGTCTGGTCAAGAACCTGGCACTTATGTGCTACATTACAGTTGGTACGCCTAGCGAGCCTATTATCGATTTTATGATTCAGCGGAACATGGAAGTTCTCGAAGAGTTCGAACCTCAAGTTACGCCTAATGCCACCAAAGTCTTTGTCAATGGTGTCTGGGTTGGTATTCACCGGGACTCTGCGCATCTAGTGAACACCATGCTTGCTCTGCGTCGACGCAACATGATTTCGCATGAAGTTAGTTTGGTTCGGGATATCCGTGAGCGTGAGTTCAAGATCTTTACCGATGCTGGTCGTGTTTGCCGGCCGCTGTTCGTCATCGACAATGACCCGAAGAGTGATAACAGCGGTTCGCTGGTGCTCAACAAGGAGCATATTCGGAAGCTTGAGCAAGACAAGGAAT---------TGCCCCCCGACCTTGATCCGGAAGAGCGCAGGGAACGCTACTTCGGGTGGGATGGTCTTGTGAAGTCGGGAGTTGTGGAATATGTCGATGCAGAAGAAGAAGAGACAATTATGATTTCCATGACGCCCGAAGACTTGGAAATTTCGAAACAACTCCAGGCTGGTTATGCCCTTCCTCCGGAAGAA------GATCCCAACAAGCGTGTACGATCGATCCTGAGTCAGAAAGCGCACACATGGACGCACTGCGACAGCACTTGGGAAACAGCCCCAGACCGTCCTTATGAACCCGAAGACTGGCGCCGCCTCCTCCAATTCGCCGACTACAAGGGCTCCAAGAACAAGGCTGTCCGCGAAGCCCTAGCCGGCGGCGTCAGCCCGGGCACCAGAGTTGACATCCACCTCCGCGCGGTGCCCTCCACCCTCCGCACCCGCCTCCAACCCCTCTCCCTCTTTTC-CCTCCTTCGCCACGAGCACAAACACACCGTGGTCAATGTCAACATGACCCTAAGCTCTGGCGTCGAAGAACCCCTCAAATCCAAGGAGGAGCTCGTCATCCAATACGGCCCGCGCCGCGTCGTCGCCAACCCCATCTTCTCCGCAAACGACAACACCCGCAATAACATTCACAAATTCGACCGCTACCTGCACCCCGGCCGCAGCGCAATCGCCTCCTTCATCGGCCCGCTAACCTTCGGTTCCGTGCCCATCCTCGTCTTCAAAACCAAATCCCCCCAAA---ATGACGACCCCGAGGTCCTCGACGCCGCAGACTCCGAC------------GGCCTCGACA------------TCAACAACCTCGACCTCATCGCAACAGGCACTGTCGTCGCACCCGACCAATCCCGCGTCGTCGCCAAGCGCTCCATCACCAAGGCCAAGGTCGGCGTTTTCAGCTGCCCTATCGATGTCTCTCAGACCGAGACCAAAGGAACTGTGCTCTTGAAGAATGCTGAGGAGATGATGAACTACAGTAAGGGTGAGGAGGAGCGCCTTGAGTCTGCTATTAAGGAACTGCATGACTCGGGTCTTCGCGTTGTGGTTGCCGGTGCGAATGTTGGCGACTTGGCTATGCATTACCTTAACCGATTTAACATTCTCGTCGTCAAGGTTCTCTCCAAGTTTGAACTCCGTCGGCTGTGTCGTGTCGTCGGTGCCACACCTCTTGCCCGTCTGGGTGCCCCGATGCCCGACGAGATGGGTGCTGTCGACGTTGTTGAGACCGCTGAGATTGGTGGAGACCGTGTCACCGTCTTCCGTCAGGAGGATGTGAATTCTCCTACCCGTACCGCCACCATCGTCCTCCGCGGTGCCACTCAAAACCACCTTGAAGACGTTGAGCGTGCTATCGACGACGGTGTCAACGTTGTCAAGGCTATTACCAAGGACCCCCGTCTTGTTCCTGGCGCAGGCGCTACTGAAATCCAGCTCGTCGAGAGAATCTCTGCATTTGCCGACAAGACTCCGGGTCTGCCCCAACATGCCATCCGGAAGTTCGCTGAGGCCTTTGAAGTGATCCCTCGCACTCTCGCAGAGTCTGGTGGTCTGGACGCCACCGAGGTTCTCTCCCGTCTCTACACAGACTATCTCCGGCGAGCACGGTCTCGACGGCTCTGGTGT----CTACAACGGATCCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACGAGGCCTCCAACAACAAATATGTCCCCCGTGCCGTCCTCGTCGACCTTGAGCC-AGGTACCATGGATGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTGGGTACCGTTATGCGCTCGCTGGGCCAGAACCCTTCCGAGTCGGAGTTGCAGGACATGATCAATGAGGTTGACGCTGACAACAACGGCACCATCGATTTCCCTGAATTCCTTA Aspergillus_arenarius TCTCTCCTCAGCGAAATGGCCCTCTCATGGGTATTGTCCAGGATACTCTTTGCGGTATCTACAAGATCTGCCGGCGTGATGTCTTCCTGACCAAGGACCAGGTCATGAACACTATGATGTGGGTTCCCGACTGGGACGGGGTCATCCCCCCTCCAGCTATCATGAAGCCCAGGCCTCGATGGACCGGAAAGCAGATGATCAGTATGGCTTTCCCTTCGGGTCTCAACCTTCTTCGTGTCGA---CAAGGATAACTCGGCTCTTTCTGAGAAATTTTCTCCCTTGGCCGACGGTGGTCTCCTTATCCACAGCGGACAGTTGATGTATGGAATGCTCTCGAAGAAGACGGTTGGTGCCAGTGGTGGTGGTGTCATCCACACTATTTTCAACGAATATGGCCCAGACGCTGCGGTCGCTTTCTTCAATGGCGCGCAGGCGATTGTGAACTACTGGTTGCTTCACAATGGGTTCAGTATTGGTATTGGTGATACAATTCCAGACGAGAACACTATCCGCCGAATCGAGAGCTGTGTGCGCAACAGAAAGAAGGAAGTGGAGGAGATTACCGCCAGCGCTACCGAGAACACCCTTGAGCCTTTGCCTGGTATGAATGTGCGAGAAACGTTCGAGAGTAAGGTATCTCGTGCCTTGAACAATGCTCGTGATGAAGCCGGTAGCGAGACCGAGAAGAGTCTGAAGGATTTGAACCATGCCATTCAGATGGCCCGCTCTGGGTCTAAGGGATCGACCATCAACATTTCGCAAATGATGCGTTGAGACGAACAGGGAGATCTATTTGAACATTGGTGTCAAGGCCAGCACACTGACTGGTGGTCTGAAATATGCTCTTGCCACCGGTAACTGGGGTGAGCAGAAGAAGGCGGCGAGCTCCAAGGCGGGTGTGTCGCAGGTGCTCAGTCGTTACACCTATGCTTCTACGCTTTCTCACCTGCGTCGGACCAACACTCCTATTGGTCGTGATGGTAAAATTGCCAAACCACGGCAACTGCACAACACGCACTGGGGTCTGGTCTGCCCAGCTGAGACTCCTGAAGGTCAGGCTTGTGGTCTGGTCAAGAACCTGGCACTCATGTGCTACATTACCGTTGGTACGCCCAGCGAGCCCATCATTGATTTCATGATCCAGCGAAACATGGAGGTTCTGGAAGAATTCGAGCCTCAGGTCACCCCCAATGCGACCAAGGTGTTTGTGAACGGTGTTTGGGTTGGTATCCACCGTGATCCCGCACACCTGGTAAACACAATGCAGTCGCTGCGTCGCCGCAACATGATCTCGCACGAGGTCAGTTTGATCCGTGACATCCGTGAGCGGGAGTTCAAGATCTTCACCGACGCTGGACGTGTATGCCGACCACTGTTTGTTGTTGACAACGACCCGAAGAGCGACAATTGCGGCTCGTTGGTGCTCAACAAGGAGCATATCCGCAAGTTGGAACAGGACAAGGAGA---------TTCCACCAGACTTGGACCCCGAAGAGCGCAGGGAACGCTACTTCGGATGGGATGGTTTAGTGAAGTCAGGAGTCGTGGAATACGTGGATGCTGAGGAGGAGGAGACGATCATGATCGTGATGACGCCCGAGGACCTGGAGATTTCGAAGCAACTCCAGGCTGGTTACGCCCTGCCTGAGGAGGAGTACAACGATCCCAACAAGCGTGTCCGGTCTATCCTCAGTCAAAAGGCGCACACTTGGACACACTGCGACAGTATGTGGGAAACAGCCGAGGATCGACCTCACGAGCCCGAAGACTGGCGCCGGCTGCTGCAATTTGCCGACTACAAGGGATCCAAGAACAGGACTGTCCGCGAGGCCCTCATCGGTGGTGTGAGCCCCGGAACCCGCGTGGATGTTCACCTGCGAGGTGTCCCAGCCGCTCTGCGCACCCGACCCCAGCCAACCGCTCTCTTCTC-CCTCCTCCGGCACGAGCACAAGCACACGGTCGTCAACGTAAACATGCACCTGCACAGCAGCTACGAGGAACCCCTCAAGTCCAAGGAGGAACTCGTCGTGCAGGTCGGCCCCCGCCGCCTCATCACCAAGCCCATCTTCTCCTCCGCAGACAACACCCCGAACAACGTCCACAAATTCGACCGTTTCCTGCACCCAGGCCGCAGCGCCATCGCAACCTGGATCGGCCCTCTGACCTGGGGCGCGGTCCCTGTTCTCGTTTTCAAAAACAAGTCG---------ACCCAAGACCCCGAAGTCCTCGACGGGGCAACAGAAGGG------GACAAGAAGCCGCAGG------------TCGATCACCTCGAGCTCATTGCCACCGGCACCGTCGTCGCGCCCGACCAGTCCCGTGTCGTCGCGAAGCGGGCCATCCGCAAGGCCAAGGTGGGCGTTTTCAGCTGCCCGCTCGACATCTCGCAGACCGAGACCAAGGGCACTGTGCTGTTGAAGAACGCCGACGAGATGCTTAACTTCACCAAGGGCGAGGAGGAGCGCCTGGAGGCCGCCATCAAGGAGCTTTACGACTCTGGAGTGCGTGTGGTCGTTTGTGGTGCCTCGGTGGGTGACTTGGCGATGCATTACCTCAACCGCTTCAACATCCTGGTCATCAAGGTCCTTTCCAAGTTCGAGCTGCGCCGCCTTTGCCGTGTCGTGGGTGCCACCCCGCTTGCGCGATTTGGCGCTCCGATGCCCGACGAAATGGGCTCCATCGATGTGGTCGAAACCGAAGAGATTGGCGGTGACCGTGTCACCGTGTTCCGCCAAGAAGACGCGAACACCGTGACGCGGACGGCCACGATCGTCCTCCGCGGTGCGACTCAAAACCACCTGGAAGACGTAGAGCGTGCCATTGACGACGGTGTCAATGCCGTCAAGGCGGTCACTAAAGACCCCCGACTGGTACCCGGTGCCGGAGCCACGGAAATCCAGCTGGTGGAGCGGATCTCTGCGTTTGCCGACAAGACCCCTGGTCTGCCGCAACACGCCATCCGCAAGTTCGCGGAGGCCTTCGAAGTCATTCCCCGCACCCTGGCCGAATCGGCTGGTCTGGATGCTACTGAGGTTCTGTCTCGACTCTACACAAACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGT----TTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGAAACAAGTATGTCCCTCGTGCCGTCCTCGTTGATCTTGAGCC-TGGTACCATGGACGACAAGGATGGCGATGGCCAAATCACCACCAAGGAATTGGGCACCGTAATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGACATGATTAACGAGGTCGATGCCGACAACAACGGCACCATCGATTTCCCTGAGTTCCTGA Aspergillus_avenaceus TGTCACCCCAGCGAAACGGACCACTCATGGGTATTGTGCAGGATACTCTTTGCGGTATTTACAAGATATGCCGACGTGACACTTTCCTGACCAAAGACCAGGTGATGAACATCATGATGTGGGTTCCTGATTGGGACGGTGTCATTCCACCACCAGCCATTTTGAAGCCTCGGCCTAGGTGGACTGGTAAGCAAATGATCAGCATGGCGCTTCCCTCTGGTCTTAACCTGCTCCGTGTTGA---TAAAGATAACTCGGCGTTGTCCGAGAAATTCGCACCTCTTAATGATGGAGGTCTTTTGATCCACAACGGCCAGCTAATGTACGGAATGTTCTCCAAGAAAACTGTCGGTGCCAGCGGTGGTGGTGTTATCCATACGATCTTCAACGAGTACGGACCCGGTACTGCTGTTGCCTTCTTTAACGGTGCCCAGACCATCGTCAATTATTGGCTTCTCCATCATGGCTTCAGTATCGGTATTGGTGATACTATCCCTGATGCACTCACGATACAAAGAATCGAAAATTGCGTTCGGGAAAGGAAGAAGGAAGTCGAGTCCATCACTGCAAGTGCTACTGACAACACTCTCGAGCCATTGCCTGGTATGAACGTGCGAGAAACCTTTGAAAGCAAGGTATCGCGTGCTCTGAACAATGCCCGTGATGAAGCTGGTAGTGAGACCGAGAAAAGCTTGAAGGATCTAAACAACGCCATTCAAATGGCTCGTTCGGGATCCAAGGGTTCAACTATCAACATTTCTCAAATGATGTGTTGAGACCAACAGAGAGATTTACTTGAACATTGGTATCAAGGCTAGCACACTTACTGGTGGTTTGAAGTATGCCCTCGCCACCGGTAACTGGGGTGAACAAAAGAAGGCCGCCAGCGCAAAGGCTGGTGTGTCACAAGTGCTCAGTCGTTACACCTACGCTTCTACCTTGTCGCATCTTCGGCGAACTAATACACCTATTGGACGTGATGGTAAAATTGCCAAACCTCGTCAGCTTCACAATACGCACTGGGGTCTGGTCTGTCCGGCAGAGACTCCTGAAGGTCAAGCTTGTGGTTTGGTCAAAAACTTGGCTCTCATGTGTTACATCACCGTCGGTACACCCAGCGAACCTATCATTGATTTCATGATTCAGCGTAACATGGAAGTTCTTGAAGAATTCGAGCCCCAGGTGACGCCCAACGCGACCAAGGTCTTTGTAAACGGTGTCTGGGTTGGTATCCACAGAGACCCGGCTCATCTTGTCAACACAATGTTGTCGCTCCGTCGCCGAAGCATGATATCCCACGAGGTCAGTTTGATCCGTGACATTCGTGAACGGGAGTTCAAAATCTTCACCGACGCTGGTCGAGTCTGCCGGCCATTGTACGTTATCGACAATGACCCGAAGAGCGAGAATTGTGGTTCTCTCGTTCTTAACAAAGAGCACATTCGTAAATTAGAGCAAGATAAAGAGT---------TGCCCCCTGACCTTGACCCAGAAGATCGCAGGGAACGTTATTTCGGATGGGATGGGTTGGTGAAGTCGGGTGTCGTTGAATACGTTGATGCCGAGGAAGAAGAGACTATCATGATCGTCATGACGCCGGAGGACTTGGAGATCTCTAAACAGCTCCAGGCCGGATATGCTCTTCCGGACGACGATCTTCAGGATCATAACAAGCGTGTCCGTTCTATCCTGAGTCAGAAGGCGCATACCTGGACGCATTGCGACAGCCCGTGGGAGACAAGAGAGGACCGGCCTCACGAGCCCGAGGACTGGCGCCGACTGCTCCAATTCGGCGACTACAAGGGCGCCAAGAACCGCACCATCAGAGAAGCCCTTATCGGCGGCGTGAACCCTGGCATACGTGTGGATGTGCATCTGCGCGCCGTCCCAGCTGCTCTTCGCAGCAAGCAACTGCCCCTCTGTCTGTTCTC-GCTCCTCCGCCACGAGCACAAGAACACCGTCGTCAACATGAACATGACCCTGAACTCGAGCGTCGAGGAGCCCCTTAAGGCCAAGGAGGAACTCATAATCCAGTGCGGACCGCGCCGTATGGTTGTCAACCCCATCTTCTCGTCGAACGACAACACCCCCAACAACGTTCACAAGTTCGACCGCTTCCTGCACCCCGGCCGCAGCGCCATCGCCACCTGGATCGGCCCTCTAACCTGGGGCGCCGTGCCCGTCCTCGTCTTCAAGAACAAGACC---------GTTGAAGATCCCGAAGTCATGGAT---GGCGACA---------------CCCAACCCGACG------------TCGAGCAGTTGGACCTCATCGCCACCGGCACCATCGTGGCCCCCGACCCAGGCCGCGTGATCGCCAAGCGTGCCATACAGAAGGCCAAGGTCGGCGTGTTCAGCTGCCCGATTGATATTTCTCAGACCGAAACCAAGGGTACCGTGCTGCTGAAGAATGCGGAGGAAATGCTTAACTTCACCAAGGGTGAGGAGGAACGCCTCGAGGCTGATATCAAGGAACTCTACGATTCCGGTGTTCGTGTCGTCGTTTGTGGCTCTACTGTTGGTGATTTGGCTATGCACTACCTCAACCGCTTCAACATCCTCGTGATCAAGATTCTTTCCAAGTTCGAACTCCGCAGGCTGTGCCGTGTCGTGGGTGCCACCCCTCTCGCCCGTCTGGGAGCCCCCATGCCCGACGAAATGGGTAGCATCGACGTGGTTGAGACCACCGAGATCGGTGGTGACCGTGTCACCGTTTTCCGCCAAGAAGACCCCAGTGCTGTGACTCGCACAGCGACCATTGTCCTGCGTGGAGCCACACAGAACCACTTGGATGATGTTGAGCGTGCCATCGATGACGGTGTCAACGCCGTCAAGGCTATCACTAAAGACCCCCGTCTGGTTCCCGGCGCAGGCGCTACTGAAATCCAGCTCGTGGAGAAGATTTCTGCGTTTGCGGACCGGACCCCAGGCCTGCCCCAGCATGCTATCCGCAAGTATGCCGAGGCTTTCGAGGTTATCCCCCGCACTCTCGCCGAGTCTGCCGGTCTGGACGCTACTGAGGTTCTCTCTCGTCTCTACACAAACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGT----CTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGCTAGCGGCAACAAGTATGTTCCTCGTGCCGTCCTCGTCGACCTTGAGCC-CGGTACCATGGACGACAAGGATGGTGATGGCCAGATCACCACCAAGGAGTTGGGTACTGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCGGAACTGCAGGACATGATCAACGAGGTCGACGCCGACAACAATGGCACTATTGATTTCCCTGAGTTCCTTA Aspergillus_biplanus TTTCCCCACAGCGGAATGGACCGCTTATGGGTATTGTGCAGGATACTCTGTGTGGTATTTATAAGATTTGCCGTCGTGATATCTTTTTGACTAAGGATCAAGTCATGAACCTCATGATGTGGGTTCCTGATTGGGATGGGGTTATTCCTCCGCCTGCTATCTTGAAGCCTCGACCTAGGTGGACAGGAAAACAAATGATCAGCATGGCCCTCCCTTCTGGCCTCAATCTTTTGCGGGTTGA---GAAAGATAGTTCACCACTCTCAGAGAAGTTCTCTCCTCTGAACGATGGTGGCCTTCTTGTCCATGGCGGACAGCTGATGTACGGAATGTTCTCCAAGAAAACTGTCGGCGCCACTGGTGGAGGCGTGATTCACACCATCTTTAATGAATATGGGCCACAGACCGCTGTGGCTTTCTTCAACGGTGCCCAGACCATTGTGGGCTACTGGTTACTCCATAATGGCTTCAGCATCGGTATTGGTGACACTATTCCCGATGAGATGACTATTCAGAAGATTGAGAATTGCGTGCGGGTGAGAAAGCAAGAGGTTGAATCCATTACTGCTAGCGCCACAGAGAATACACTTGAGCCCCTACCCGGTATGAACGTGCGTGAGACCTTTGAGAGTAAGGTTTCGCGTGCTCTCAACAATGCGCGTGATGAAGCTGGTAGTGAGACAGAAAAGAGCTTGAAGGATCTCAACAACGCCATTCAAATGGCTCGTTCAGGTTCTAAGGGTTCAACTATCAATATTTCACAAATGGTGTGTGGAAACAAACCGTGAGATTTACCTGAACATTGGTATCAAGGCAAGCACCCTGACGGGAGGTTTGAAATACGCCCTCGCGACCGGTAACTGGGGAGAGCAGAAGAAGGCGGCCAGCGCCAAAGCGGGTGTGTCGCAAGTGCTCAGTCGCTACACCTATGCTTCTACATTGTCCCATCTTCGCCGCACAAATACACCGATTGGTCGTGACGGAAAGATCGCCAAACCTCGTCAGCTACACAATACCCACTGGGGATTGGTTTGTCCTGCAGAAACTCCAGAGGGTCAGGCTTGCGGTCTGGTCAAGAACCTGGCTCTCATGTGTTACATCACAGTCGGTACACCTAGCGAGCCGATCATTGATTTCATGATCCAGCGAAATATGGAGGTCCTAGAAGAATTTGAGCCCCAAGTAACTCCTAACGCGACCAAGGTATTTGTTAACGGTGTCTGGGTCGGTATCCATCGCGACCCCGCCCACCTGGTGAACACCATGCTTTCTCTGCGCCGGCGAAACATGATTTCTCACGAGGTCAGTCTTATTCGGGATATCCGCGAGCGAGAATTCAAGATCTTCACCGATGCAGGACGTGTTTGCAGACCGCTTTTCGTCATCGACAATGATCCGAAGAGTGAGAACTGTGGCTCCTTGGTGCTCAATAAGGAACACATTCACAAGTTGGAGCAGGATAAAGAAC---------TGCCTCCCGACCTGGATCCGGAAGAACGCAGGGAGCGATACTTTGGGTGGGATGGATTGGTGAAATCTGGGGTCGTTGAATATGTGGATGCCGAGGAGGAGGAGACTATCATGATTTCGATGACACCAGAGGACTTAGAGATATCCAAGCAATTGCAGGCAGGCTACGCGCTCCCAGAAGAGGAGCTCCACGACCCCAACAAACGTGTGCGGTCCATCCTGAGTCAAAAAGCGCATACCTGGACACACTGCGAAAGTCCGTGGGAGATCTCCGAGGATCGACCTCATGAACCCGAGGACTGGCGCCGACTTCTCCAATTCGGTGATTACAAGGGCTCCAAGAATAGGACTGTCAGAGAAGCCCTTATTGGGGGGGTTAGTCCTGGAACACGTGTTGATGTACACCTGCGCGCGGTTCCCGCTTCTCTTCAGAAGAAGCCTCAGCCTTTGGCTCTCTTTTC-GCTCCTCCGACACGAACACAAGCACACCGCGGTAAACATTAACATGCACTTGAATGCAAACGTCGAGGAGCCACTGAAGGCCAAGGAGGAACTGATTGTCCAGTATGGACCTCGTCGTCTAGCTGTTAAACCGATATTCTCGGCGGGAGACAACACCGCAAACAACGTGCACAAGTTCGATCGATTCCTGCACCCTGGTCGCAGCGCAATTGCCACCTGGATCGGGCCCATGACCTGGGGCTCTGTCCCTGTCCTTGTGTTCAAAGCCAGGAAA---------AACGACGATCCCGAAGTCCTTGATTCCGCAGATGCAGA------------CG---CAGCCGCCGAGTTCAACATTGATCAACTAGAACTCATCGGAACGGGTACCGTTGTTGCCCCCGATCCCTCTCGAGTGGTGGCGAAGCGCGCGATCCGCAAGGCCAAGGTTGGTGTATTCAGCTGCCCGATCGACATCTCCCAGACCGAGACAAAGGGCACCGTACTGTTGAAAAATGCCCAGGAAATGCTCGACTTCACCAAGGGCGAGGAGGAGCGTCTCGAGACAGCCATCAAGGAACTGTACGATTCGGGTCTCCGCGTCGTCGTCGCGGGAGCCACCATCGGTGACCTCGCCATGCACTACCTCAACCGCTTCAACATTCTCGTGATCAAGATCCTCTCGAAATTCGAACTCCGCCGCCTTTGCCGGGTTGTCGGCGCCACCCCGCTCGCCCGTCTCGGTGCACCCATGCCTGACGAAATGGGATCCATTGACGTTGTCGAAACCACCGAAATCGGCGGTGACCGCGTCACCGTCTTCCGCCAGGAGGATTCTACTGCTGTCACTCGCACCTCCACCATCGTCCTCCGTGGCGCAACCCAGAACCACCTCGATGACGTCGAACGCGCCATCGACGATGGAGTCAACGCCGTTAAGGCCGTCACCAAGGATCCCCGCCTCGTCCCTGGTGCAGGAGCTACCGAGATCCAGCTGGTCGACCGCATCTCTGCTTTCGCCGATAAGACTCCCGGTTTGCCCCAGCACGCTATCCGCAAGTATGCCGAGGCGTTCGAGGTCATCCCGCGCATCCTGGCCGAATCCGCCGGCCTGGACGCAACAGAGGTCCTCTCCCGCCTATACACAAACCATTTCCGGCGAACACGGCCTCGATGGCTCCGGCGT----TTACAATGGTACCTCCGACCTCCAGTTGGAACGTATGAACGTTTATTTCAACGAGGCTAGCGGAAATAAGTATGTTCCTCGCGCCGTCCTTGTCGACCTTGAGCC-CGGCACTATGGATGACAAGGATGGCGATGGCCAAATCACTACCAAGGAGCTCGGCACTGTCATGCGCTCACTCGGCCAAAACCCCTCCGAGTCTGAACTCCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACTATTGATTTCCCTGAATTCCTTA Aspergillus_bisporus TCTCTCCTCAACGAAACGGTCCACTCATGGGTATCGTGCAGGATACTCTGTGTGGTATTTATAAGATTTGCCGACGCGATGTCTTCCTGACCAAGGAACAGGTTATGAACATCATGATGTGGGTACCTGATTGGGATGGCGTTATCCCCCCACCTGCGATCTTTAAACCTAGACCAAGATGGACGGGAAAGCAGATGATCAGCATGGCGCTTCCAGCCGGTCTCAATCTTCTGCGTGTTGA---GAAGGACGGCTCTCCACTCACTGAAAAGTTCTCCCCTCTAAATGATGGCGGCCTACTCATTCACAATGGACAGTTGATGTATGGAATGTTTTCCAAGAAGACTGTTGGTGCTAGTGGTGGAGGTGTCATTCACACGATCTTTAACGAGTACGGCCCGGACACAGCTGTTGCCTTCTTCAACGGCGCGCAGACCATTGTAAACTACTGGTTGCTTCACCACAGTTTCAGTATCGGTATCGGTGACACTATCCCTGATGAGGTCACTATTCAGCGCATCGAGAATTGTGTGCGCATCCGGAAGGAAGAGGTTGAGGCCATCACTGCCAGTGCCACCGAGAGCACATTGGAGCCTCTGCCCGGTATGAACGTCCGAGAAACCTTTGAGAGCAAGGTCTCGCGTGCTCTCAACAACGCTCGTGATGAGGCTGGTAGTGAGACCGAGAAGAGCTTGAAGGATCTCAACAATGCCATCCAAATGGCTCGCTCTGGTTCAAAGGGCTCAACTATCAACATCTCGCAGATGGTGTGTGGAGACTAATCGGGAGATTTACCTCAACATTGGTCTGAAGGCTAGCACCTTGACTGGCGGTTTGAAGTATGCTCTCGCCACTGGTAACTGGGGAGAACAGAAGAAGGCAGCCAGCGCCAAGGCTGGTGTGTCCCAAGTGCTCAGTCGCTACACATATTCTTCTACGTTGTCGCATCTTCGACGGACAAACACGCCCATCGGTCGTGATGGCAAGATCGCGAAACCTCGTCAGCTGCACAATACCCACTGGGGCCTGGTGTGCCCTGCCGAAACACCTGAAGGTCAGGCTTGCGGTCTGGTCAAGAACCTGGCCCTTATGTGCTACATCACTGTCGGTACGCCTAGTGAGCCCATCATCGACTTCATGATCCAGCGTAACATGGAAGTCCTTGAGGAATTCGAGCCTCAAGTGACTCCCAACGCGACCAAGGTCTTCGTGAACGGTGTCTGGGTTGGTGTCCACCGCGATCCTTCACACCTCGTCAATACCATGCTTTCTCTGCGTCGACGAAACATGATCTCTCACGAAGTCAGTCTTATCCGTGATATCCGTGAACGAGAGTTCAAGATCTTTACGGATGCTGGTCGTGTCTGCAGACCCCTATTCGTCATTGATAACGACCCGAAGAGCGAGAACTGCGGCAATCTCATACTGAATAAGGACCATATCCACAAGCTAGAGCAAGACAAGGAAC---------TTCCACCCGATCTGGATCCAGAGGAACGCCGGGAGCGCTACTTTGGATGGGACGGACTGGTCAAATCGGGCGTTGTCGAGTATGTGGATGCCGAAGAGGAAGAAACGATCATGATTGTCATGACGCCCGAGGATCTGGAAATCTCGAAGCAGCTTCAGGCTGGCTATGCTCTACCTGAGGAGGAG---CACGATCCTAATAAACGTGTCCGGTCTGTTCTGAGCCAGAAAGCGCATACCTGGACACACTGCGACAGCCCATGGAATACAGCAGAGGACCGACCCCACGAACCTGAGGACTGGCGCCGACTGCTCCAAATCGGCGACTACAAGGGATCTAAAAACAGGATGCTAAGGGAAGCTCTCATCGGAGGTGTCAACCCAGGTACACGGGTCGACGTACATCTACGCGCGGTGCCTGCATCCCTTCGCAACCAACGACCGCCGCTATCCCTGTTCTC-ACTCCTTCGACACGAGCACAAACACACCGTCGTCAACGTCAACATGCACCTGAACGCCAGCGTCGAAGCACCCCTGAAGTCCAAGGAAGAGCTTATCGTCCAGTACGGACCCCGCCGCCTGGTCGTCAACCCCATCTTCTCCGCGGCCGACAACACCCCGAACAACGTCCACAAATTCGACCGCTTCCTCCACCCCGGGCGCAGCGCCATGGCCACCTGGATCGGCCCGATGACATGGGGCTCTGTCCCTGTCCTCGTCTTCAAGACCAAGAGC---------AGCGACGACCCCGAAGTCCTCGACTCAGCAGACGCAAA------------CC---CCGCCGCCGAATTCCACGTCGATAACCTCGAACTCATTGGAACGGGTACCGTCGTCGCCCCTGATCCATCCCGCGTCGTCGCTAAGCGCGCCATGCGCAAGGCCAAGGTCGGTGTCTTCAGCTGCCCGATCGACATCTCCCAGACAGAGACCAAGGGCACGGTCCTCCTGAAGAACGCCCAGGATATGCTCAATTTCAGCCGTGGTGAGGAGGACCGTCTCGAGGCTGCGATTAAGGAACTCTACGACTCGGGTCTTCGCGTCGTCGTTGCAGGCGCCACCGTCGGCGACCTGGCATTGCACTACCTCAACCGCTTCAACATCCTCGTGGTCAAGATCCTCTCCAAGTACGAGCTCCGCCGCCTGTGCCGTGTCGTCGGCGCCACCCCGCTCGCCCGCCTAGGCGCCCCCATGCCCGACGAGATGGGCTCTGTCGACGTTGTCGAGACCACCGAGATCGGCGGCGACCGCGTCACCGTCTTCCGCCAGGAAGATTCCACCGCGGTCACCCGCACGTCAACCATCGTTCTCCGCGGCGCTACGCAGAACCACCTCGATGACGTCGAGCGCGCCATCGACGACGGCGTCAACGCCGTCAAGGCCATCACCAAGGACCCGCGTCTCGTCCCCGGAGCCGGCGCCACCGAAATCCAACTCGTCGAACGCATCTCCGCCTTCGCAGACAGAACACCCGGTCTGCCCCAGCACGCCATCCGCAAATACGCCGAAGCCTTCGAGGTCATCCCGCGCACCCTCGCTGAATCCGCGGGCCTAGACGCCACAGAGGTCCTCTCCCGTCTCTACACAGACCATTTCTGGTGAGCACGGCCTCGATGGCGCCGGTGT----TTACAATGGCACCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGTAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCC-CGGTACCATGGACGACAAGGATGGCGACGGCCAGATCACCACGAAGGAACTCGGCACTGTGATGCGCTCGCTCGGCCAGAACCCCTCCGAGTCTGAACTTCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATCGACTTTCCGGAGTTCCTTA Aspergillus_brunneouniseriatus TGTCACCTCAGAGAAACGGTCCCCTGATGGGTATTGTCCAGGATACTCTTTGTGGTGTTTACAAGATTTGCAGGCGTGATGTGTTCTTGACTAAGGAGCAGGTGATGAACATCATGCTTTGGGTCCCTGATTGGGATGGTGTGATTCCTCCGCCAGCTATTTTGAAGCCTAGGCCAAGATGGACTGGTAAACAGATCATTAGTATGGCTCTTCCCTCTGGCCTGAACCTTCTCCGTGTCGA---CAAAGATAGTTCGCCCCTTTCCGAAAAGTTTTCTCCTTTGGCCGATGGCGGTCTTTTGATCCACGGTGGACAGTTGATGTATGGAATGTTCGCCAAGAAAACAGTCGGTGCTACTGGTGGAGGTGTCATCCATACGATTTTCAACGAGTATGGACCAGATGCCGCCGTGGGTTTCTTCAACGGCACACAGGCTATTGTCAATTACTGGCTTTTACATAATGGTTTCAGTATTGGAATCGGTGACACTATTCCAGACGCGGTTACGATCCAGAGGATCGAGAATTGCGTTCGTAACCGAAAGAACGAGGTTGAAACCATTACTGCAAGCGCAACGGAAAACACACTCGAGGCTTTGCCTGGTATGAACGTGCGAGAAACCTTTGAGAGTAAAGTTTCGCGTGCTCTTAACAATGCTCGTGACGAAGCCGGTAGTGAGACTGAAAAGAGTTTGAAGGATCTTAACAATGCCATCCAGATGGCTCGTTCTGGTTCTAAGGGATCAACCATTAACATCTCTCAGATGATGTGTGGAAACCAACAGAGAAATTTACCTGAACATTGGTATCAAGGCCAGCACCTTGACTGGTGGCTTGAAGTATGCTCTTGCTACCGGTAACTGGGGAGAGCAGAAGAAGGCGGCCAGCGCCAAAGCTGGTGTCTCTCAGGTTCTTAGTCGATACACCTATGCTTCTAGTTTGTCACATCTTCGGCGAACCAACACTCCCATCGGACGAGATGGCAAAATTGCCAAACCTCGTCAACTTCACAATACGCACTGGGGCTTGGTTTGCCCGGCAGAGACTCCGGAAGGTCAAGCTTGTGGTCTGGTCAAGAATTTAGCGCTTATGTGCTACATCACCGTTGGTACACCCAGTGAGCCTATCATTGATTTCATGATTCAGCGTAACATGGAGGTTCTTGAGGAATTCGAGCCTCAGGTGACGCCTAATGCAACAAAGGTCTTTGTGAATGGTGTTTGGGTCGGTATCCATAGAGATCCTGCGCATCTCGTTAACACGATGTCGTCCCTGCGTCGACGAAACATGATTTCCCACGAAGTCAGTTTGATTCGGGATATTCGTGAGCGTGAATTCAAGATCTTCACTGATACTGGTCGTGTATGCCGGCCGCTGTTCGTTATCGACAATGACCCCAAGAGCGAGAATTGCGGATCGCTGGTGCTCAACAAGGACCACATCCGTAGACTGGAGCAGGACAAAGAAT---------TGCCCCATGATCTGGATCCAGAAGAGCGCAGAGAACGCTACTTCGGCTGGGACGGTCTTGTCAAGTCGGGAGCTGTGGAATACGTTGATGCAGAGGAAGAAGAGACGATTATGATTGTCATGACTCCGGAAGATCTTGAAATTTCCAAACAGCTGCAAGCGGGTTATGCCCTTCCAGAAGAGGA---TAGCGACCCCAACAAGCGTGTCCGATCCGTTCTGACCCAGAAGGCCCACACCTGGACACACTGCGACAGTCCCTGGGATACAACCGAGGATCGTCCGCATGAGCCAGAGGACTGGCGCCGACTGCTCCAATTTTCAGATTACAAGGGATCCAAGAACAGGACCATCCGAGAGGCCCTGGTCGGCGGTGTCAACCCCGGTATTCGCGTTAACGTCCACCTGCGTGCAGTCCCATCATCGCTTCGCAGCCGCCCACAACCGTTGTCTCTCTTCTC-CCTTCTTCGACACGAACACAAGCAAACCGTTGTTAACGTCAACATGTACTTGAACTCCGAGGTTGAGGAGCCGCTCAAGTCCAAGGAAGAACTGGTCGTCCAGTGTGGACCTCGCCGTATGGTTGTGAACCCGATCTTCTCCGCTGGAGACAACACACCGAACAACGTACACAAATACGACCGATACCTGCATCCCGGCCGTAGCGCCATTGCCACCTGGATCGGCCCACTGACATGGGGAGCAGTCCCAGTTCTTATCTTCAAGAACAAGC---CC------ACCCAGGACCCCGAAGTCCTCGCCGATGACAACGGC-------------CAAATCCAGCCGGAT--------CTCGACCACCTGGAGCTCATCGGAACCGGTACTGTTGTGGCACCCGACCAGTCGCGTGTCGTTGCCAAGCGGTCAATCCGCAAGGCCAAGGTCGGTGTCTTCAGCTGCCCTATCGATATCTCCCAGACCGAGACCAAGGGTACTGTCCTTTTGAAGAACGCACAGGAGATGCTTGACTTCACAAAGGGCGAGGAGGAGCGTCTCGAGGCCGCCATCAAGGAGCTTTATGATTCGGGAGTCCGCGTCGTCGTTGCCGGTGCCCAGATCGGTGACTTGGCTCTCCACTTCCTCAACCGATTCAACATCCTTGTCGTTAAGATTCTATCCAAGTTTGAGCTCCGCCGCCTTTGCCGTGTCGTGGGTGCTACTCCTCTTGCCCGTTTGGGAGCCCCCATGCCCGATGAGATGGGCAGCGTCGATGTGGTTGAGACTACTGAAATCGGTGGTGACCGTGTGACCGTTTTCCGCCAGGAGGACAACACCACTGTGACTCGCACAGCTACCATTGTCCTACGGGGTGCCACCCAGAACCACTTGGATGATGTTGAGCGTGCCATTGATGATGGTGTCAATGCTGTGAAGGCTATCACTAAGGACCCCCGTCTGGTTCCTGGTGCTGGAGCTACTGAGATCCAGCTCGTTGAAAGAATCTCTGCCTTTGCAGACAAGACCCCCGGACTTCCCCAATATGCTATTCGGAAGTTCGCAGAGGCTTTCGAGGTTGTTCCTCGTACTCTTGCTGAGTCCGCTGGTTTGGACGCTACCGAAGTTCTCTCCCGTCTCTACGCAGACCATCTCTGGTGAGCACGGCCTTGATGGCTCTGGTGT----CTACAATGGTACCTCCGACCTCCAGTTGGAGCGCATGAACGTCTACTTCAACGAGGCAAACGGACACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTTGAGCC-CGGTACCATGGACGACAAGGACGGTGATGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCGCTAGGCCAGAACCCTTCCGAGTCCGAATTGCAGGACATGATCAACGAGGTTGACGCCGATAACAACGGCACCATTGATTTCCCTGAGTTCTTGA Aspergillus_calidoustus TCTCGCCTCAGCGAAATGGTCCACTCATGGGTATCGTACAGGATACTCTGTGCGGTATCTACAAGATTTGCAGACGTGATATCTTTTTGACCAAGGAACAAGTCATGAATGTTATGATGTGGGTTCCCGAATGGGATGGGGTGATTCCTCCGCCTGCAATCCTGAAGCCCAGACCCCGGTGGACTGGTAAACAGATGATCAGTATGGCGCTCCCGTCCGGTCTCAACCTTTTGCGAGTTGA---GAAAGAGGGCTCTCCACTTTCAGAGAAGTTTTCTCCTCTGCATGACGGTGGCCTTCTTATTCACGGCGGACAGTTGATGTATGGAATGTTCTCCAAGAAGACTGTTGGTGCTAGTGGTGGTGGTGTCATCCACACTATTTTCAACGAGTATGGTCCGCAAACAGCCGTGGCTTTCTTCAACGGCGCGCAGGCCATTGTCGGCTATTGGCTGTTGCACAACGGTTTCAGTATCGGTATCGGTGATACTATTCCCGATGAATTGACCATCCAGCGCATTGAGAACTGCGTTCGCGCCCGGAAGCAGGAAGTCGAGTCGATTACCGCTAGCGCCACTGATAATACGCTCGAACCCCTGCCTGGTATGAATGTGCGTGAGACGTTTGAGAGTAAGGTTTCTCGTGCTCTCAACAATGCCCGTGATGAAGCCGGTAGCGAAACCGAGAAGAGCTTGAAGGATTTGAACAACGCCATTCAAATGGCCCGCTCTGGATCCAAGGGTTCAACCATTAACATTTCACAAATGCTGTGTGGAAACAAACAGAGAAATTTACCTAAACATTGGTATCAAGGCCAGCACCTTGACAGGTGGTCTGAAGTATGCCCTCGCCACTGGTAACTGGGGCGAGCAGAAAAAGGCAGCTAGCGCCAAGGCTGGTGTGTCGCAAGTGCTCAGTCGTTATACATATGCTTCTACACTTTCACATCTTCGGCGAACGAATACACCAATTGGCCGTGACGGCAAGATCGCTAAACCCCGCCAGCTACACAACACTCACTGGGGCTTGGTATGTCCTGCAGAAACACCGGAAGGTCAGGCTTGTGGTTTGGTCAAGAACTTGGCTCTCATGTGCTACATCACTGTCGGTACTCCCAGCGAGCCCATCATTGACTTTATGATCCAACGAAACATGGAAGTTCTTGAGGAATTCGAGCCTCAAGTTACCCCAAATGCAACCAAGGTGTTTGTGAACGGCGTCTGGGTTGGTGTTCACCGCGATCCCGCGCATCTCGTCAATACTATGCTCTCTCTGCGCCGACGGAACATGATCTCCCACGAAGTCAGTCTTATCCGGGATATTCGTGAGCGTGAATTCAAGATCTTCACCGATGCTGGCCGTGTTTGCCGACCACTCTATGTCATCGATAACGATCCGAAGAGCGAGAACTGCGGTAACCTAGTCCTGAACAAGGAGCATATTCGCAAGTTGGAGCAGGACAAGGATC---------TCCCACCGGATCTTGATCCAGAAGACCGCCGCGAGCGATACTTCGGATGGGACGGACTAGTCAAGTCAGGAGTTGTTGAGTACGTGGATGCGGAAGAAGAGGAGACAATCATGATTGTCATGACGCCAGAGGATCTGGAGATCTCAAAACAGCTTCAAGCGGGATACGCGCTTCCTGAAGAGGAG---CACGACAAGAACAAGCGCGTGCGGTCCATTCTGAGCCAGCGCGCGCACACCTGGACGCATTGCGACAGCCCCTGGAACACGTCCGCGGACCGGGCTCACGAACCCGAGGACTGGCGCCGCCTCTTGCAGTTCGGCGACTACAAGGGCTCCAAGAACCGCATCCTCCGCGAAGCCCTCGTTGGCGGCGTTAACCCCGGCACACGAGTCGACGTCCACCTCCGCGCAGTCCCCGCCTCCCTCCGCCACCGCCCCCAACCCATCTCCCTCTTCTC-CCTCCTCCGCCACGAACACAAGCACACCGTCGTCAACATCAACATGCACCTCAACGCCACGGCCGAAGCACCCCTCAAAGCCAAGGAAGAGCTCATCGTGCAGTACGGCCCGCGCCGCCTGGTCGTCAACCCCGTCTTCTCTTCCGCCGACAACACCCCGAACAACGTCCACAAATACGACCGCTTCCTGCACCCCGGCCGCAGCGCAATCGCCACCTGGATCGGCCCGCAAACATGGGGCTCCGTCCCCGTCCTCGTCTTCAAGGCGAGGAAGCCCGAAT---CTGACGACCCGGAGGTCCTCGACTCGGCAGACGCAGAGCCAACCGCACCTACAACCGCCGCGGACTTTACAACGGATAACCTCGAGCTCATCGGCACAGGCACAGTCGTCGCCCCCGACCCAACTCGTGTTGTCGCGAAGCGCGCTATCCGCAAGGCCAAGGTCGGAGTCTTCAGCTGCCCGATCGACATCTCCCAGACCGAAACCAAGGGCACAGTCCTTCTGAAGAACGCCCAGGAGATGCTCGACTTCACCAAGGGTGAAGAAGAGCGCCTCGAACTAGCCATCAAGGAGCTTTACGACTCCGGACTTCGCGTCGTCGTTGCGGGCGCCACGGTCGGCGACCTCGCGCTCCACTACCTCAACCGCTTCAACATCCTCGTGATCAAGATCCTCTCCAAGTACGAGCTCCGCCGACTCTGCCGCGTCGTTGGTGCTACGCCCCTCGCTCGCCTCGGCGCTCCCATGCCCGATGAGATGGGATCCATCGACGTCGTCGAGACCACCGAGATCGGCGGCGACCGCGTCACCGTCTTCCGCCAGGAAGACTCCACGGCCGTCACGCGCACCTCGACCATCGTCCTCCGCGGCGCCACCCAGAACCACCTCGATGACGTCGAGCGCGCCATCGACGACGGCGTCAACGCCGTCAAGGCCATCACCAAGGACCCCCGCCTCGTCCCGGGAGCCGGCGCCACAGAGATCCAGCTCGTCAACCGCATCTCCGCCTTCGCAGACAGGACACCCGGTCTGCCTCAGTATGCTATCCGCAAGTACGCCGAGGCGTTCGAGGTTGTCCCGCGCACCCTCGCCGAGTCCGCGGGTCTCGACGCGACCGAGGTCCTCTCTCGTCTTTACACAAACCATCTCTGGTGAACACGGCCTCGATGGCTCTGGTGT----TTACAATGGCACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCC-CGGCACCATGGACGACAAGGATGGTGATGGCCAGATTACCACCAAGGAACTCGGCACTGTGATGCGCTCGCTCGGGCAGAACCCCTCCGAGTCTGAACTCCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGATTTCCCAGAGTTCCTCA Aspergillus_candidus TTTCCCCTCAGCGAAATGGTCCCCTCATGGGTATCGTGCAGGATACTCTCTGTGGTATCTACAAGATTTGCCGACGTGATGTGTTTCTCACCAAGGACCAGGTCATGAACCTCATGCTGTGGGTCCCTGATTGGGACGGGGTAATCCCGCCTCCGGCAATCTTGAAACCTCGGCCCAGATGGACCGGCAAGCAGGTGATCAGCATGGCTTTCCCATCCGGTCTCAACCTCTTGCGCGTCGA---CAAGGATAATTCCACACTGTCGGAGAAGTTCTCCCCGCTGTCCGATGGCGGCGTTCTTATTCATGGTGGTCAGCTGATGTATGGTATGCTGTCGAAGAAGACTGTGGGTGCTACCGGTGGTGGTGTCATCCACACCATCTTCAACGAATACGGTCCCAGGACTGCTGTGGCTTTCTTCAACGGTGCCCAGACCATCGTGAACTATTGGCTTCTCCATAACGGGTTTAGCATTGGTATTGGTGACACCATTCCCGATGCGCTCACGATCCAGAGAATCGAGAACTGTGTGCGCAACAGGAAGAATGAAGTTGAAGAGATCACCGCGAGCGCGACCGAGAACCAGCTTGAGGCGCTGCCGGGTATGAACGTGCGTGAGACGTTTGAAAGCAAGGTTTCCCGCGCTTTGAATAATGCCCGTGACGAAGCCGGTAGCGAGACGGAGAAGAGTCTGAAGGATCTGAACAATGCCATCCAAATGGCCCGCTCAGGATCCAAGGGTTCTACGATCAACATTTCCCAGATGCTGCGTGGAGACCAACCGTGAAATCTACTTGAACATCGGTATCAAGGCCAGCACCTTGACGGGAGGTCTGAAATATGCCCTCGCCACGGGTAACTGGGGCGAGCAGAAGAAGGCGGCCAGTTCCAAGGCCGGTGTGTCGCAGGTGCTCAGTCGTTATACCTACGCCTCAACCCTGTCCCATTTGCGTCGGACCAACACCCCCATTGGTCGAGACGGCAAGATCGCCAAGCCCCGTCAACTGCACAACACGCACTGGGGCTTGGTCTGTCCCGCCGAGACGCCTGAAGGTCAGGCTTGTGGTCTTGTTAAGAATCTGGCACTTATGTGTTACATCACTGTCGGTACTCCCAGTGAGCCTATCATCGATTTCATGATTCAGCGGAACATGGAGGTTCTCGAGGAATTCGAGCCCCAGGTCACACCGAACGCCACCAAGGTGTTTGTGAACGGCGTGTGGGTTGGAATTCACCGCGACCCGGCGCACCTGGTCAATACGATGCAGTCGCTGCGCCGGCGGAACATGATCTCGCACGAGGTCAGTCTGATTCGTGACATCCGTGAGCGGGAGTTCAAGATCTTCACCGATGCCGGGCGCGTGTGCCGTCCGTTGTTCGTGATTGACAACGACCCGAAGAGCGAGAATTGCGGATCGTTGGTTCTCAACAAGGAGCACATCCGCAAGCTCGAGCAGGACCGAGAGC---------TGCCGCCGGACCTGGACCCGGAAGAGCGCCGGGAACGCTACTTCGGATGGGATGGTCTGGTGAAGTCCGGAGCGGTCGAGTACGTCGATGCAGAGGAAGAAGAAACGATCATGATCGTTATGACCCCCGAGGATTTGGAGATCTCCAAGCAGCTCCAGGCCGGCTACGCACTCCCCGAGGAAGAGCTGCATGACCCGAACAAGCGTGTGCGTTCCATCCTAAGTCAGCGGGCTCACACATGGACGCATTGTGACAGCGTCTGGGAGACGTCAGAAGACCGTCCCTACGAGCCCGAAGACTGGCGCCGACTCCTCCAAGTCGGCGACTACAAGGGCATCAGGAACCGCACCCTCCGCGAAGCCCTCATCGGCGGCGTGAACCCCGGCAACCGCGTCGACGTCCACCTGCGCGCCGTCCCCGCAACCCTGCGCAGCCGGCCGCAGCCCCTCTCCCTCTTCTC-GCTGCTCCGCCACGAGCACAAGCACACCGCCGTCAACGTGAACATGCACCTCAGCGCGAGCTACGAGGAGCCCCTCAAATCCAAGGAGGAGCTCATCGTGCAAGTCGGCCCCCGCCGCCTCGTCGTCAAACCCGTCTTCTCCTCCGCCGACAACACCCCCAACAATGTGCACAAGTTCGACCGCTTCCTGCACCCAGGCCGCAGCGCCCTCGCCACGTGGATCGGCCCCGTAACATGGGGCGCCGTCCCGGTTCTCGTCTTCAAGAACCAGCGC---------GTCCAGGACCCCGAGGTCCTCGACGACGCCGCCGCCGAC------AACG----GCCCC---------------TCG--CGCCTCGAGCTCATCGCCACCGGCACGGTCGTCGCGCCGGACCCGTCCCGCGTCGTCGCCAAGCGCTCCATCCAGAAGGCCAAGGTCGGCGTGTTCAGCTGCCCGATCGATATTTCCCAGACCGAGACCAAGGGCACTGTCCTCCTGAAGAACGCCGAGGAGATGCTCAACTTCACCAAGGGCGAGGAGGAGCGCCTGGAGGCGGCCGTCAAGGAGCTGTACGACTCCGGCGTCCGCGTCGTCGTCTGCGGCTCCACCGTCGGTGACCTCGCCATGCACTACCTCAACCGCTTCAACATCCTCGTGGTCAAGATTCTCTCGAAATTCGAGCTCCGCCGACTCTGCCGCGTCGTGGGTGCCACCCCCCTGGCCCGTCTGGGCGCCCCCATGCCCGACGAGATGGGCTCCATCGACGTGGTCGAGACCACCGAGATCGGTGGTGACCGCGTGACGGTCTTCCGCCAGGAGGACCCCAGCACCATCACCCGCACGGCGACCATCGTCCTGCGGGGCGCCACGCAGAACCACCTGGACGACGTGGAGCGGGCCATTGATGACGGCGTCAACGCCGTCAAGGCCGTCACCAAGGATCCTCGCCTGGTGCCCGGTGCCGGAGCGACCGAGATCCAGCTGGTCGAGCGGATCACCGCCTTCGCCGACCGGACGCCCGGCCTGCCGCAGTATGCCATCCGCAAGTACGCCGAAGCCTTCGAGGTGATCCCGCGCACGCTGGCGGAATCCGCGGGTCTCGACGCCACCGAGGTTCTCTCCCGGCTCTACACAAACCATCTCCGGCGAGCACGGCCTTGATGGCTCCGGTGTGTAAGTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGCTAGCGGCAACAAGTATGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCC-CGGTACCATGGACGATAAGGATGGCGATGGACAAATCACCACCAAGGAGCTGGGCACCGTCATGCGGTCGCTGGGCCAGAACCCCTCCGAGTCGGAACTCCAGGACATGATCAACGAGGTTGACGCGGACAACAACGGCACCATCGATTTCCCTGAATTCCTCA Aspergillus_cavernicola TGTCTCCTCAGCGCAATGGTCCACTTATGGGTATTGTGCAGGATACTCTGTGCGGTATCTTTAAACTTTGCCGACGTGATATCTTTCTGAGCAAGGAACAAATCATGAATGCTATGATGTGGGTTCCTGATTGGGATGGCGTTATTCCTCCGCCTGCGATCTTAAAACCTAGACCTAGGTGGACGGGAAAGCAGTTGATCAGCATGGCCCTTCCATCCGGCCTCAACCTTTTGCGTGTCGA---GAAGGACGGGTCCCCGCTTTCTGAAAAGTTCTCTCCCCTGCATGATGGTGGTCTTCTTGTCCACGGCGGACAGCTGATGTATGGAATGTTCTCCAAGAAGACTGTTGGTGCTAGTGGTGGAGGTGTCATCCACACTATCTTCAATGAATACGGACCGGGCACTGCCGTGGCCTTCTTCAATGGCGCGCAAGCCATTGTTGGCTATTGGCTGCTACACCACGGTTTCAGTATCGGTATCGGTGATACTATCCCTGATGAGCATACTATTCAAACCATTGAAAACTGTGTGCGTGTTCGCAAGCAGGAAGTCGAGTCGATCACTGCCAGTGCCACGGAGAACACACTTGAGGCCCTTCCTGGTATGAATGTCCGAGAAACCTTTGAGAGCAAAGTCTCCCGTGCTCTTAACAATGCTCGTGACGAAGCTGGTAGTGAAACCGAGAAGAGTCTAAAGGATTTGAATAACGCCATTCAAATGGCTCGTTCTGGATCGAAGGGTTCAACTATCAACATCTCGCAGATGGTGTGTTGAAACCAACCGAGAGATTTACCTCAACATCGGTATCAAGGCTAGCACCTTGACCGGCGGGTTGAAGTATGCTCTCGCTACTGGTAACTGGGGTGAACAAAAGAAGGCAGCCAGCGCCAAGGCTGGTGTATCGCAAGTGCTCAGTCGCTACACCTATGCCTCTACCTTGTCACATCTTCGGCGAACAAACACACCAATCGGTCGTGACGGAAAGATTGCCAAACCTCGCCAGCTACACAACACCCACTGGGGCTTGGTGTGCCCTGCGGAAACTCCGGAAGGTCAGGCTTGTGGTTTGGTCAAGAATTTGGCTCTCATGTGCTACATCACTGTCGGTACTCCTAGCGAGCCTATCATTGATTTCATGATCCAGCGTAACATGGAAGTACTCGAGGAGTTTGAACCTCAAGTGACTCCCAACGCGACCAAGGTGTTTGTGAATGGTGTCTGGGTTGGTGTTCATCGTGACCCTGCCCACCTTGTCAGTACCATGCTTTCTCTGCGTCGCCGGAATATGATCTCCCACGAAGTCAGTCTTATTCGTGACATCCGTGAGCGAGAGTTCAAGATCTTCACCGACGCTGGTCGTGTTTGCAGACCGCTGTACGTGATTGACAACGACCCTAAGAGTGAGAATTGCGGTAACCTGGTCCTTAATAAGGACCACATCCATAAATTGGAGCAAGATAAAGAAC---------TTTCGCCGGACCTGGATCCCGAGGATCGCCGGGAGCGCTACTTTGGGTGGGATGGTCTGGTTAAATCGGGTGTGGTCGAGTATGTGGATGCGGAAGAAGAAGAGACAATCATGATCGTCATGACCCCCGAGGATCTCGAGATCTCAAAGCAGCTTCAGGCGGGATACGCGCTTCCGGAAGAGGAA---AACGATCCAAACAAACGTGTGCGGTCGATTCTCAGTCAACGGGCGCATACCTGGACACATTGTGACAGCCCTTGGAACACATCCGAGGACCGGCCCCACGAACCCGAAGACTGGCGTCGACTCCTCCAATTCGGCGACTACAAGGGATCCAAGAATAGGATCCTCAGAGAGGCCCTCATCGGCGGCGTCAACCCGGGCGCGCGAGTCGACGTCCATCTCCACGCAGTCCCAACCTCACTTCGCAACCAACCCCAACCCCTCTCCATCTTCTC-CCTCCTCCGCCACGAACACAAGCACACCGTCGTCAACGTCAACATGCACCTCAACGCCACCCTCGAGGAACCCCTCAAGGCCAAAGAAGAGATAATCGTCCAATACGGCCCGCGCCGCCTAATCGTCAACCCCGTCTTCTCCTCCGCAGACAACACCCCAAACAACGTCCACAAATACGACCGTTTCCTCCACCCAGGCCGCAGCGCAATGGCCACATGGATCGGTCCCCTAACATGGGGCTCCGTCCCCGTCCTCGTCTTCAAAGCAAAGAAACCCG------CCGCGGACCCGGAAGTCCTCGACTCCGCAGACGCA------------CCTACCCCCACTGCAGACTTCACCATCAACAACTTCGACCTCATCGGAACAGGCACAATCGTAGCCCCTGACCCATCCCGCGTCATCGCCAAACGTGCCATCCGCAAGGCTAAGGTCGGTGTTTTCAGCTGCCCGATCGACATCTCTCAGACCGAAACCAAAGGCACCGTCCTCCTCAAGAACGCCCAGGAGATGCTCGACTTCACCAAGGGTGAAGAAGGGCGCCTCGAAGCCGCCATCAAGGAGCTCTACGACTCTGGTATCCGCGTCGTTGTCTGCGGCGCCACAGTCGGCGACCTCGCCCTCCATTATCTCAACCGCTTCAACATCCTCGCGATCAAGATCCTCTCCAAGTACGAGCTCCGCCGCCTCTGCCGTGTTGTCGGTGCCACCCCGCTTGCCCGCCTCGGTGCCCCCATGCCCGATGAAATGGGCTCCATCGACGTCGTCGAAACCACCGAGATCGGAGGCGACCGTGTCACCGTATTCCGCCAGGTAGATGACACCGCCGTCACGCGCACCTCCACCATCGTCCTCCGCGGCGCCACCCAGAACCACCTCGATGACGTCGAGCGCGCCATCGACGACGGCGTCAACGCCGTCAAGGCCATCACCAAGGACCCGCGTCTCGTCCCCGGAGCCGGCGCCACAGAGATCCAGCTTGTCGCGCGCATCTCCGCCTTCGCCGATCGGACACCCGGTCTCCCCCAGCACGCTATCCGCAAGTTCGCCGAGGCCTTCGAGGTCATCCCGCGCACGCTCGCCGAATCCGCCGGTCTCGACGCCACCGAGGTCCTCTCCCGTCTCTACACAGACCATCTCCGGCGAACACGGCCTTGACGGCTCCGGTGT----TTACAATGGTACCTCCGACTTGCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGCCAACGGTAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATTACCACCAAAGAACTCGGCACTGTGATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCGGAACTTCAGGACATGATCAACGAAGTCGACGCCGACAACAATGGCACTATTGATTTCCCAGAGTTCCTTA Aspergillus_cervinus TATCTCCCCAGCGAAATGGTCCACTCATGGGTATCGTGCAAGATACTCTGTGCGGTATCTATAAGATTTGCCGGCGTGATGTTTTCTTGACTAAAGAGCAAGTAATGAACATTATGCTATGGGTTCCTGATTGGGATGGGGTGATTCCCCCGCCAGCCATCTTGAAACCTCGACCTCGATGGACGGGAAAGCAGATGATCAGCATGGCACTTCCCCCAGGTCTTAACTTGTTACGTATCGA---TAAAGATAACTCGCCCCTGTCGGAGAAATTTTCTCCTCTAGCGGATGGCGGTCTCCTCATCCATGGCGGACAGTTGATGTATGGAATGTTCTCCAAGAAGACTGTTGGCGCTAGTGGTGGAGGTGTCATCCACACTATTTTCAATGAGTATGGCGCGGATACTGCCGTGTCTTTCTTCAACGGTGCTCAGGCTATTGTCGGCTACTGGTTGCTACACAACGGTTTTAGTATCGGAATTGGTGATACCATTCCGGACGCGGTTACGATCCAAAGAATCGAGAATTGCGTACGTGTGAGAAAACAGGAGGTTGAGGCTATAACGGCAAGTGCTACGGAGAACACGCTGGAAGCATTACCCGGTATGAATGTGCGAGAAACCTTTGAAAGTAAGGTCTCGCGTGCTCTGAACAATGCTCGTGATGAAGCTGGTAGTGAGACCGAGAAGAGCTTGAAAGATCTCAACAATGCTATTCAGATGGCGCGCTCTGGTTCTAAGGGCTCAACCATTAATATTTCTCAAATGATGTGTGGAGACAAACCGAGAGATTTACTTGAATATTGGTATTAAGGCTAGTACCTTGACTGGAGGTTTAAAATATGCCCTCGCCACAGGTAATTGGGGAGAACAGAAGAAAGCAGCAAGCGCCAAGGCAGGTGTGTCGCAAGTGCTTTCTCGCTACACATATGCCTCCACTTTGTCGCATCTTCGCCGTACCAACACACCAATTGGTCGTGATGGTAAAATCGCCAAGCCTCGTCAACTTCACAACACACATTGGGGTTTGGTCTGTCCAGCAGAAACCCCGGAAGGTCAGGCTTGTGGTCTGGTCAAGAATTTGGCTCTCATGTGTTACATTACTGTCGGTACACCTAGCGAACCCATCATTGACTTCATGATCCAACGAAATATGGAAGTGCTTGAGGAATTCGAGCCTCAGGTGACACCGAATGCGACAAAAGTGTTTGTCAATGGTGTCTGGGTCGGTATTCACAGAGATCCAACCCACCTTGTCAACACCATGCTTTCTCTGCGTCGTCGGAATATGATCTCCCACGAGGTTAGCTTGATTCGGGACATTCGCGAGCGTGAATTTAAGATCTTTACCGATACTGGGCGTGTCTGTCGGCCGCTGTATGTTATTGATAACGACCCTAAGAGCGAGAATCGTGGATCTTTAGTCCTCAACAAGGAGCACATTCACAAGCTGGAGCAAGATAAAGAGT---------TGCCTGATGATCTGGATCCGGAAGACCGCAGAGAACGCTACTTTGGATGGGATGGACTCGTGAAGTCGGGTGTTGTTGAATATGTTGATGCCGAGGAGGAAGAAACAATCATGATTGCGATGTCGCCGGAGGATTTGGAAATCTCTAAACAGCTCCAGGCCGGTTATGCCATTCCTGAAGAGGAACTCAACGATCCTAACAAGCGTGTTCGGTCAATTCTGAGCCAGAAGGCGCATACTTGGACCCACTGTGACAGCCCCTGGGAGACGTCGGAAGATCGCGCACACGAACCGGAAGATTGGCGTCGACTGCTCCAACTTGTCGACTATAAGGGCTCTAAGAACAAAACTATCCGGGAAGCTCTGGTCGGTGGTGTCAAGCCAGGACTCCGGGTGGATGTCCATCTCCGCGCAGTCCCATCCTTGCTTCGTAACCGCCCACAGCCCTTATCTCTCTTCTC-GCTGCTCCGACATGAGCACAGACATACAGTCGTCAATGTCAACATGCGTTTGAACTCTGACCTCGAGGATCCCATCAAGTCCAAGGAAGAACTCGTTGTACAGTGCGGCCCTCGCCGTTTAGTCGTCAAGCCCATCTTCTCTGCGGATGGAAATACCCCCAACAATGTGCACAAATTTGACCGGTACCTCCACCCTGGCCGCAGTGCTATTGCAACCTGGATTGGACCTTTGACATGGGGTGCCGTCCCGATCCTTGTTTTCAAGAAGAAGC---AA------ACGCAGGACCCAGAGGTCCTTGATTCAGCAGAGG----------------AGGACCCGCTCAAG--------ATTGATAACCTAGAGCTTATCGGAACAGGTACAGTTGTTGCCCCTGATCACTCTCGAGTAATCGCGAAGCGGGCCATCCGCAAGGCTAAGGTCGGCGTTTTCAGCTGTCCCATCGATATCTCTCAGACCGAGACCAAGGGTACTGTGCTCTTGAAAAATGCCCAGGAGATGCTTGACTTCACAAAGGGCGAGGAGGACCGCCTGGAGTCAGCCATCAAGGAGCTTTATGACTCGGGACTTCGTGTTGTGGTTGCTGGCTCCACTGTCAGTGACCTAGCGATGCACTACCTCAACCGATTCAACATTCTTGTTATCAAAATCCTTTCCAAGTTCGAGCTCCGCCGACTCTGCCGTGTCGTGGGTGCTACCCCTCTTGCTCGTCTGGGTGCCCCTATGCCGGATGAGATGGGTAGCATTGACGTGGTCGAGACTACCGAAATCGGCGGTGACCGTGTCACAGTTTTCCGTCAAGAGGAAGCCAACGCCGTAACGCGCACTGCCACTATTGTTCTGCGTGGAGCGACTCAGAACCATTTGGATGATGTTGAGCGTGCCATTGATGATGGTGTCAATGCTGTTAAGGCTATCACTAAAGATCCCCGTCTTGTTCCTGGCGCTGGCGCTACCGAAATCCAGCTCGTTGAGAGAATCTCTGCGTTTGCAGACAAGACACCTGGCCTGCCCCAGCATGCCATTCGCAAGTTTGCCGAGGCTTTCGAGGTCATCCCACGGACTCTGGCGGAATCTGCTGGTCTGAACGCCACCGAGGTCCTTTCTCGTCTTTACACAGACTATCTCTGGTGAGCACGGCCTTGATGGCTCTGGCCA----CTACAATGGCTCCTCCGACCTCCAGCTCGAGCGTATGAACGTTTACTTCAACGAGGCCAGCAATAACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCC-CGGTACCATGGATGACAAGGATGGTGATGGCCAGATCACCACTAAGGAATTGGGCACTGTTATGCGTTCGTTGGGCCAGAACCCTTCGGAGTCGGAGCTGCAGGATATGATTAATGAGGTCGATGCTGACAACAATGGCACCATTGATTTCCCTGAATTCCTTA Aspergillus_clavatoflavus TCTCACCTCAGCGCAATGGTCCCCTGATGGGTATTGTGCAGGATACGCTTTGTGGTATCTACAAAATCTGTCGTCGTGATTCCTTTCTCACCAAGGACCAAGTCATGAACATCATGCTCTGGGTACCTGATTGGGATGGAGTTATTCCTCCACCAGCTATCCTGAAACCGAGACCTAGATGGACCGGAAAACAGATGATTAGTATGGCGCTTCCATCGGGCTTGAACCTTCTACGCGTTGA---TAAGGATGGCCTACCA---GGCGAAAAGTTTGCTCCTTTGAACGATGGTGGTGTCCTTATCCATGGTGGTGAGTTGATGTACGGAATGTTCTCCAAGAAGACAGTCGGTGCAAGTGGTGGAGGTGTTATTCATACCATCTTCAACGAATGGGGACCTTGGGCTGCTGTCAAGTTTTTCAATGCTGCACAGACGATTGTCAACTATTGGCTCTTGCACAATGGTTTCAGTATCGGTATCGGTGACACGATTCCCGATGCAAATACGATTAAGAAGATCGAACAAGCTGTCAGGGAAAAGAAGGATGAGGTTGATATCATCACTGCCGAGGCAACTAACAATACGCTCGAGGCACTACCGGGTATGAATGTTCGGGAGACATTCGAGAGTAAAGTTTCACGCGCTCTCAACAATGCTCGTGATAAAGCCGGTAGCGTGACAGAGGACAGTCTGAAAGACTTGAATAACGCCGTCCAGATGGCTCGTTCCGGATCTAAGGGTTCGACGATCAACATCTCGCAGATGATGCGTGGAAACTGGTCGTGAAATCTACTTGAACATCGGTATTAAGGCCAGCACCTTGACTGGCGGTCTGAAGTATGCGCTCGCCACAGGTAACTGGGGTGAACAGAAGAAAGCAGCCAGCTCCAAGGCAGGTGTATCTCAAGTGCTCAGTCGTTACACTTACGCCTCCACACTCTCACATCTTCGTCGTACCAACACACCTATCGGCCGTGATGGAAAAATTGCAAAACCTCGTCAACTTCACAATACCCATTGGGGTCTGGTGTGTCCGGCCGAAACGCCAGAAGGTCAAGCTTGTGGTCTTGTCAAAAATCTGGCACTTATGTGTTATATCACTGTCGGAACGCCGAGCGAGCCCATTATCGACTTCATGATCCAGCGAAACATGGAGGTACTCGAGGAATTTGAGCCTCAAGTAACACCAAATGCCACAAAGGTCTTCGTAAATGGTATCTGGGTTGGTGTCCATCGCGATCCAGCCCATCTGGTCAACACTATGCTCTCACTTCGCCGCCGCAACATGATCTCCCACGAAGTCAGCTTGATTCGTGATATCCGTGAGCGTGAGTTCAAGATTTTCACTGACACTGGTCGTGTGTGTCGGCCTTTGTTCGTGATTGATAACGATCCAAAGAGTGAGAACTGTGGCTCGTTAGTCCTTAACAAGGAGCATATTCGCAAATTGGAGCAGGATAAGGAAT---------TGCCACCAGACTTGGACCCGGAGGAGCGCAGAGAACGGTACTTCGGCTGGGATGGTCTCGTGAAGTCGGGCGTCGTCGAGTATGTTGATGCCGAAGAAGAAGAAACAATTATGATTTCTATGACTCCAGAGGACCTTGAGATTTCTAAACAACTTCAAGCCGGCTATGCTCTTCCGGAGGATGACGGCAACGATCTAAATAAGCGTGTTCGCTCCGTTCTGAGTCAGAAGGCGCATACTTGGACTCATTGTGATAGCCCCTGGGAGACAACAGAAGACCGTCCTCACGAGCCCGAGGATTGGCGTCGGCTGCTTCAATTTGGCGATTATAAAGGCTCCAAAAACAAGACCCTTAGAGAAGCTCTGGTTGGTGGTGTAAATCCTGGTCTTCGTGTTGACGTCCACCTTCGCGCGGTACCAGCCTCACTTCGCAATCGTCCTCAACCGTTATCTCTCTTCTC-CCTGCTTAGACACGAGCACAAGCACACTGTCGTCAATGTCAATATGTCCTTGAACTCTGGCATCGAGGAGCCGCTGAAGTCGAAGGAAGAGGTCATTGTCCAGTGCGGACCTCGCCGTTTGGTTGTCAACCCCGTCTTCTCTGCAGCAGACAATACTCCCAACAATGTGCACAAATTTGACAGATTCCTACACCCCGGCCGGAACGCTATTGCCACATGGATTGGCCCTCTCCTTTGGGGTGCTGTGCCAGTGCTTGTATTC---AAGAACAAGCAA------GTCCAGGACCCTGAAGTCCTTGATTCAGATGATG---------------CGAATGGCTCGGAAGGGCCCTCTATCAGTCGGCTCGAGCTCATCGGCACCGGAACCGTTGTGGCTCCCGACCAGGCTCGTGTTGTTGCCAAGCGTGTGATCCGTAAGGCCAAGGTCGGTGTCTTCAGCTGCCCGATCGATATCTCCCAGACCGAGACCAAGGGTACTGTGCTGCTGAAGAACGCTCAGGATATGCTGGACTTCACCAAGGGTGAGGAGGATCGCCTCGAGACTGCTATCAAGGAGCTTTATGATTCGGGCCTGCGCGTGGTCGTTGCTGGTGCCAACATCGGCGAACTAGCTCTCCATTATCTCAACCGCTTCAATATTCTTGTCATCAAGATTCTTTCCAAGTTCGAGCTCCGCCGTTTGTGCCGCGTTGTTGGTGCCACTCCCCTTGCCCGCTTGGGTGCCCCTATGCCCGATGAGATGGGAAGCATCGACGTGGTTGAGACTACTGAGATCGGAGGAGACCGGGTTACCGTTTTCCGTCAGGAGGAGGCTAATACGGTGACTCGCACTGCCACGATTGTTTTGCGTGGTGCTACTCAGAACCATCTCGATGACGTTGAGCGGGCCATCGATGATGGTGTGAACGTGGTCAAGGCTATCACCAAGGACCCCCGTCTCGTACCCGGTGCAGGCGCTACTGAGATCCAGCTCGTCGAGCGACTTACTGCTTTCGCACAAAGAACCCCCGGCTTGTCCCAGCATGCTATCCTCAAGTACGCAGAGGCTTTCGAGGTCATCCCCCGCACACTTGCCGAGTCCGCTGGCTTGGACGCCACAGAGGTTCTCTCGCGTCTGTATACAGACCATCTCTGGCGAGCACGGCCTCGATGGCTCCGGTGT----TTACAATGGCTCCTCTGACCTCCAGTTGGAGCGCATGAACGTTTACTTCAACGAGGCCAGCGGAAACAAATATGTCCCTCGTGCGGTTCTGGTCGATCTCGAGCC-TGGCACCATGGACGACAAGGATGGTGATGGGCAAATCACCACCAAGGAGTTGGGTACCGTCATGCGCTCTCTTGGCCAGAACCCTTCCGAGTCCGAGTTGCAGGACATGATTAACGAGGTCGATGCTGACAACAATGGAACCATTGATTTCCCTGAATTCCTCA Aspergillus_clavatus TGTCACCCCAGCGTAACGGTCCGCTCATGGGTATTGTACAAGACACTCTTTGCGGTATCTATAAGATCTGTCGTCGTGATATATTCCTCACCAAGGAACAGGTGATGAACATCATGCTATGGGTTCCCGATTGGGATGGTGTCATTCCTCCCCCGGCTATCCTCAAGCCTCGACCCAGATGGACCGGAAAACAGATGATCAGCATGGCGCTTCCGTCGGGTCTCAACTTGCTGCGTGTGGA---GAAGGATAACTCTTCCCTGGCGGAGAAGTTCTCTCCTTTAACGGACGGCGGTGTCCTCATCCACGGCGGACAGTTGATGTATGGAATGCTGTCCAAGAAGACTGTTGGTGCTAGTGGTGGTGGTGTCATCCACACGATCTTTAACGAGTATGGACCGGAGACTGCAGTGGCTTTCTTCAATGGAGCTCAAACCATTGTTAACTATTGGTTGCTCCATAATGGATTCAGCATTGGTATCGGTGATACCATTCCGGACGCAGTCACAATCCAACGGATTGAGAACTGTGTGCGTGAGCGGAAGCAAGAAGTTGAGGCTATCACAGCAAGTGCTACGGAGAATACCCTGGAGCCCTTACCTGGTATGAACGTGCGAGAGACTTTCGAAAGCAAGGTCTCGCGCGCTCTGAACAACGCTCGTGATGAGGCAGGTAGTGAGACCGAAAAGAGCTTGAAGGACCTCAACAACGCCATTCAAATGGCTCGTTCTGGATCCAAGGGTTCGACGATCAATATTTCTCAGATGATGTGTTGAAACCAACAGGGAAATCTACCTCAATATCGGTATCAAGGCCAGTACCTTGACAGGAGGTCTGAAATATGCCCTCGCCACGGGTAACTGGGGAGAACAGAAAAAAGCAGCGAGCTCCAAAGCCGGTGTCTCGCAGGTGCTGTCTCGTTACACCTATTCTTCCACCTTGTCACATCTGCGCCGAACCAACACGCCCATCGGCCGTGACGGTAAGATCGCCAAACCTCGTCAGCTTCATAACACGCACTGGGGTCTGGTCTGCCCGGCAGAGACACCCGAAGGTCAGGCTTGTGGTCTGGTCAAGAACTTGGCTCTGATGTGTTACATCACTGTCGGTACCCCCAGCGAACCCATCATTGATTTCATGATTCAGCGCAACATGGAGGTTCTTGAGGAATTCGAGCCCCAAGTGACACCGAACGCCACGAAAGTGTTCGTGAACGGTGTCTGGGTTGGTGTCCACAGAGATCCAGCTCATTTGGTTAACACGATGCTCTCTCTGCGTCGTCGTAACATGATTTCGCATGAGGTCAGCTTGATTCGTGACATCCGTGAGCGTGAGTTCAAGATCTTCACTGATGCTGGACGTGTTTGTCGACCACTCTTTGTCATCGACAATGACCCGAAGAGTGAGAACTGCGGCTCTCTGGTGCTGAACAAGGAGCATATTCGCAAGCTGGAGCAAGACAAAGAAC---------TGCCCCCAGATCTTGACCCTGAGGAGCGTAGAGAACGCTACTTTGGCTGGGATGGTCTGGTCAAGTCGGGAGTCGTGGAGTATGTCGATGCTGAGGAAGAAGAGCATATCATGATTTCCATGACGCCGGAGGACCTCGAGATCTCCAAGCAACTCCAGGCCGGTTACGCTCTTCCCGAAGAGGAGCTGAATGACCCGAACAAGCGTGTCCGCTCAATTCTGAGTCAGAGGGCGCATACCTGGACGCATTGCGACAGTCCTTGGGAGACTGTGGAGGATCGTGCACATGAACCCGAGGATTGGCGCCGACTTCTGCAGGTTATCGACTACAAGGGCTCCAAGAACAGAATTCTTCGGGAAGCTCTCGTTGGTGGCGTGAGCCCAGGAACGAGAGTCGATGTCCACCTGCGCGCAGTACCTTCTTCGCTCCGCAACCGTCCGCAGCCCTCGTCCCTTTTCTC-GCTGCTTCGTCACGAACACAAGCACACCGTTGTCAACGTGAACATGCACCTCAACGCCAGCGTGGAGCAGCCCCTCAAGTCCAAGGAAGAGCTGATCGTGCAGTGCGGTCCCCGCCGCCTGGTCGTCAAGCCGGTCTTCTCCGCGGGCGACAACACCCCCAACAATGTGCACAAGTTCGACCGATTCTTGCACCCAGGACGCAGCGCGATTGCCACCTGGATTGGCCCCCTCACCTGGGGTGCCGTGCCAGTCCTCGTATTCAAGAACAAGCGCACT---------CAGGACCCTGAGGTTCTCGATTCCGCGGACG---------------ATGACACGGAAGACCAGATCCATCCCGACAACCTGGAACTCATTGGCACCGGCACTGTCGTTGCCCCCGACCAGTCCCGCGTGGTTGCGAAGCGCGCTATCCGCAAGGCCAAGGTCGGCGTGTTCAGCTGCCCCATTGATATCTCCCAGACCGAAACCAAGGGCACTGTGCTCTTGAAGAACGCTCAAGAGATGCTCGACTTCTCGAAGGGCGAGGAGGACCGCCTGGAGGCCGCTATCAAGGAGCTCTATGACTCCGGCCTTCGCGTTGTCGTTGCTGGCTCCTCTGTCGGTGATCTGGCTTTGCACTACCTCAACCGGTTCAACATCCTCGTGATCAAGATTCTCTCTAAATTCGAGCTGCGCCGGCTGTGCCGTGTTGTCGGTGCTACGCCGCTTGCTCGTCTGGGTGCCCCGATGCCCGACGAGATGGGTAGCGTTGATATCGTTGAGACTACGGAGATTGGAGGTGACCGCGTGACCGTTTTCCGCCAAGAAGATGCCAACACCGTCACCCGGACCGCTACTATCGTCCTGCGTGGAGCGACTCAAAACCACCTCGACGACGTCGAGCGTGCCATCGACGACGGTGTCAATGCCGTCAAGGCCATCACCAAAGACCCCCGTCTTGTTCCTGGCGCTGGCGCTACTGAGATCCAGCTCGTGGAGAAGATCTCTGCGTTTGCTGACAAGACCCCGGGGTTGCCGCAGTACGCCATTCGCAAGTACGCTGAAGCCTTTGAGGTCATCCCCCGTACTCTTGCGGAATCCGCCGGCTTAGATGCCACCGAGGTTCTCTCTCGTCTCTACACAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCA----CTACAATGGCACCTCCGATCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCC-CGGTACCATGGACGACAAGGATGGTGATGGCCAGATCACCACCAAGGAGTTGGGTACCGTTATGCGCTCTCTGGGCCAGAACCCTTCCGAGTCGGAGCTCCAGGACATGATCAATGAGGTTGATGCCGACAACAACGGCACCATTGATTTTCCCGAGTTCCTCA Aspergillus_conjunctus TTTCTCCCCAGCGTAATGGACCGCTCATGGGTATTGTGCAAGATACACTCTGTGGTGTCTACAAGATTTGCCGGCGTGATGTCTTCTTGACTAAAGATCAGGTCATGAACATCATGATGTGGGTTCCCGATTGGGATGGTGTTATTCCTCCGCCTGCTATATTGAAACCTAGACCCAGGTGGACGGGGAAACAGATGATCAGCATGGCCCTCCCGTCTGGCCTTAACTTGCTGCGCGTCGA---AAAGGACGGTTCTCCCGTCTCCGAGAAGTTCTCCCCTCTGAATGACGGTGGCGTTCTCATCCATGGCGGACAGTTGTTGTATGGAATGTTCGCCAAGGGGACTGTCGGTGCTACTGGTGGAGGTGTGATCCACACTATCTTTAATGAGTATGGACCAGGCACAGCTGTTGCTTTCTTCAATGGTGCCCAAAATATTGTGAACTACTGGTTACTTCACAACGGTTTTAGTATTGGTATTGGTGACACTATTCCTGACGAGGGAACTATCCAGAAGATCGAGGACTGTGTGCGGATCAGGAAGCAGGAGGTTGAGTCCATCACTGCTAGTGCTACCGAGAACACACTCGAAGCTCTCCCAGGTATGAATGTTCGTGAGACCTTCGAGAGTAAGGTCTCGCGTGCTCTTAACAATGCTCGTGATGAGGCTGGTGCTGCGACAGAGAAGAGTTTGAAGGATCTTAACAACGCTGTTCAAATGGCTCGTTCTGGCTCTAAGGGTTCAACCATCAATATTTCCCAGATGGTGCGTCGAAACCAACCGTGAGATTTACCTAAACATTGGTATCAAGGCTAGCACTTTGACTGGAGGTTTGAAATATGCTCTCGCTACTGGCAACTGGGGAGAACAAAAGAAGGCTGCCAGCGCCAAAGCTGGTGTGTCGCAAGTGCTCAGTCGCTACACTTATGCGTCTACGTTGTCACATCTTCGTCGTACCAATACGCCCATTGGCCGTGATGGAAAGATTGCCAAACCCCGTCAGCTACACAATACCCACTGGGGCTTAGTCTGTCCTGCTGAAACTCCGGAAGGTCAAGCTTGCGGCCTGGTTAAGAATTTGGCACTTATGTGCTACATCACTGTCGGTACACCTAGTGAGCCCATCATTGATTTCATGATACAGAGGAACATGGAAGTTCTTGAAGAGTTCGAACCGCAAGTGACACCGAACGCGACCAAGGTGTTCGTCAACGGTGTGTGGGTTGGTATTCACCGTGACCCTGCCCATCTGGTTAACACGATGTTGTCTCTTCGCCGTCGAAACATGATCTCGCACGAGGTCAGTCTTATTCGAGATATTCGTGAGCGAGAATTCAAGATCTTCACCGATGCCGGGCGTGTCTGCAGACCGCTTTTCGTCATTGATAATGACCCGAAGAGTGAAAACATCGGCTCATTAGTCCTTAACAAGGAGCACATCCGCAAATTAGAGGCAGACAAAGAGC---------TTCCTCCAGATCTGGATCCTGAAGAGCGCCGGGAGCGCTACTTCGGATGGGATGGCTTGGTGAAATCGGGTGTGGTTGAGTATGTCGATGCGGAGGAGGAGGAGACAATCATGATTGTTATGACACCGGAAGACTTGGAAATCTCCAAGCAACTCCAGGCAGGCTACGCGCTCCCTGAGGATGATCTTCACAACCCGAACAAGCGTGTTCGATCGGTGCTGAGCCAGAAAGCACATACGTGGACACACTGCGAGAGCCCCTGGGAGACCTCCGAGGACCGACCTCATGAGCCCGAAGAGTGGCGCCGTCTGCTCCAGTTCGGCGATTACAAGGGCTCGAAGAACCGAATCATCCGAGAGGCCCTCATCGGCGGTGTCACCCCCGGTACACGAGTTGAGGTGCACCTCCGCGCAGTCCCTGCCTCCCTTCGCAACCGGCCACAGCCCTTGTCGATGTTCTC-GCTCCTTCGACACGAGCACAAACACACCGTCGTCAACATCAACATGCACCTCAACGCCAGCGTCGAGGAGCCCCTGAGGTCCAAGGAAGAGCTCATCGTCCAATACGGCCCCCGCCGCCAGGTCGTCAAGCCTATCTTCTCCGCCGGCGACAACACCGCCAACAACGTCCACAAGTTCGACCGATTCCTCCACCCCGGCCGCAGTGCCATCGCCTCCTGGATCGGTCCCATGACCTGGGGTTCCGTGCCCGTGCTGGTCTTTAGGACCAAGAAATCC------AACGATGACCCAGAGGTCCTCGACTCTGCAGACGACAA------------CAACACAACAGCAGACCTCAACATCGACCAGCTGGAACTCATCGGAACCGGCACCGTCGTCGCCCCCGATCCAACCCGAGTCGTCGCCAAGCGCGCCATCCGCAAGGCCAAGGTCGGCGTGTTCAGCTGCCCCATCGATATCTCTCAGACCGAAACAAAGGGAACCGTTCTCCTGAAGAATGCCCAGGAGATGCTCGACTTCACGAAGGGAGAGGAAGCCCGCCTCGAGGCCGCTGTCAAGGAGCTATATGACTCCGGGCTGCGCGTCGTCGTTGCAGGCTCCACTGTCGGCGATCTGGCCATGCACTACCTTAACCGCTTCAACATCCTTGTGATCAAGATCCTCTCTAAATTCGAGCTTCGCCGGCTCTGCCGCGTCGTCGGTGCCACCCCGCTCGCCCGCCTGGGAGCCCCCATGCCCGACGAAATGGGCTCCATCGACGTCGTCGAAACCACCGAAATCGGCGGTGACCGTGTCACCGTCTTCCGCCAGGAAGATTCCACTGCCGTCACCCGTACTTCCACGATCGTCCTCCGCGGCGCCACCCAGAACCACCTCGACGATGTCGAACGCGCCATCGACGACGGCGTCAACGCTGTCAAAGCCATCACCAAGGACCCCCGTCTCGTACCCGGTGCCGGAGCCTCGGAGATCCAGCTCGTCGAGCGCATCTCTGCCTTTGCTGATAGGACCCCCGGTCTGCCCCAGCATGCCATCCGCAAGTACGCCGAGGCCTTCGAAGTCATCCCGCGCACGCTGGCCGAATCCGCTGGTCTTGATGCCACGGAAGTCCTATCCCGTTTGTACACAGACCATTTCCGGTGAACACGGCCTCGATGGCTCCGGTGT----TTACAATGGCTCCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGAAACAAGTACGTTCCTCGTGCGGTTCTGGTCGATCTTGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGTCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTCTCGGCCAGAACCCCTCTGAGTCTGAACTTCAGGATATGATCAACGAGGTTGATGCCGACAACAACGGCACCATTGATTTCCCTGAATTCCTCA Aspergillus_coremiiformis TGTCTCCCCAGCGAAATGGACCCCTTATGGGTATCGTGCAGGATACTCTTTGCGGTATTTACAAGTTCTGTAGACGTGATACTTTCTTGACAAAAGAGCAGGTGATGAACGTTATGATGTGGGTCCCAGATTGGGACGGTGTTATTCCCCCACCAGCGATATTAAAACCGAGGCCCAGATGGACCGGTAAGCAAATGATTAGCATGGCGCTTCCTTCGGGACTCAATCTCTTGCGTGTGGA---GAAAGATAACTCTGCACTTTCTGAGAAATTTGCCCCTCTAAATGACGGCGGCCTTCTCATCCATGGTGGACAGTTGATGTACGGAATGTTTTCCAAGAAGACTGTTGGTGCCAGCGGTGGTGGTGTTATCCACACGATCTTCAATGAATATGGACCAGGTACTGCTGTGGCTTTCTTCAACGGTGCACAGGCCATTATCAACTACTGGCTGCTTCACAATGGCTTCAGTATTGGTATTGGTGACACCATCCCAGACGCGCTCACAATACAGAGAATTGAAAATTGCGTTCGGGCACGGAAGAAGGAGGTTGAAAGTATTACTGCAAGCGCTACTGACAATACCTTGGAGCCACTGCCTGGTATGAACGTGCGAGAGACTTTTGAAAGCAAGGTTTCGCGTGCACTCAATAATGCACGTGATGAAGCCGGTAGTGAAACTGAGAAGAGCTTAAAGGATCTGAACAATGCCATCCAAATGGCTCGTTCGGGATCAAAGGGATCAACCATCAACATCTCCCAGATGATGTGTTGAGACCAACCGAGAAATCTACCTCAATATTGGTATCAAGGCCAGCACACTGACTGGTGGCTTGAAGTATGCTCTTGCTACTGGTAATTGGGGTGAACAGAAGAAGGCCGCAAGTGCGAAGGCTGGTGTGTCGCAAGTGCTTAGTCGTTACACCTACGCTTCTACTTTGTCACATCTTCGCCGAACCAACACACCTATTGGCCGTGACGGTAAAATTGCTAAACCTCGTCAGCTTCATAATACCCACTGGGGTTTGGTTTGTCCAGCAGAAACACCGGAAGGTCAGGCTTGTGGTTTGGTCAAGAACTTGGCCCTGATGTGTTATATCACTGTTGGGACACCCAGTGAGCCTATCATTGACTTCATGATTCAGCGTAACATGGAAGTCCTCGAAGAGTTCGAGCCTCAGGTTACACCCAACGCAACAAAGGTCTTCGTGAATGGTGTATGGGTCGGTATTCACAGAGATCCTGCTCATCTTGTCAACACGATGCTGTCGCTGCGGCGTCGAAATATGATCTCTCACGAAGTCAGTTTGATTCGTGATATCCGTGAGCGAGAGTTCAAAATATTTACGGACGCTGGACGTGTTTGTAGACCATTGTTCGTTATTGACAACGACCCGAAGAGTGAAAACTGCGGTGGATTGGTCTTGAACAAGGAGCACATCCGCAAGTTGGAGCAAGACAAAGAAT---------TGCCTCCAGACCTTGATCCTGAAGAACGCAGAGAACGCTACTTCGGATGGGATGGGTTGGTGAAGTCCGGTGTTGTGGAGTACGTTGATGCCGAGGAGGAGGAGACTATCATGATTGTAATGACACCAGAAGACCTGGATATTTCCAAACAGCTTCAGGCTGGTTATGCCCTTCCTGAAGAAGAGCTTCACGATCCTAACAAGCGTGTCCGCTCGATTCTGAGCCAGAAGGCGCATACGTGGACGCACTGCGACAGTCCCTGGGAGACAAAGGAGGACCGGCCTCACGAGCCAGAGGATTGGCGTCGACTGCTTCAGATCATCGATTACAAGGGCTCAAAGAACCGGACTGTCAGAGAAGCCCTGATCGGCGGTGTCAACCCTGGTCTTCGCGTGGACGTCCATCTTCGCGCAGTATCAGCTCTTCTCAGCAAAAAGCCACAGCCGCTGTGTCTCTTCTC-CTTGCTCCGCCACGAGCACAAGAATACCGTTGTCAACGTGAACATGACCCTGAACGCAAGCAGAGAGGAGCCCTTGAAGTCGAAGGAAGAACTCATCGTGCAATGTGGACCCCGCCGCCTGGTCGTCAACCCGATCTTCTCCTCGAACGGCAACACCCCGAACAACGTGCACAAATTCGACCGTTTCCTGCACCCGGGCCGCAGTGCCATTGCAACCTGGATTGGTCCTCTTACCTGGGGCGCCGTCCCTATTCTGGTCTTCAAGAACAAGGTC---------GTCCAAGACCCAGAGGTCCTTGAC---GGCGACA---------------ACCAGCCCGATG------------TGGAGCAGCTAGAGCTAATCGCAACCGGCACAGTCGTGGCACCCGACCCATCCCGCGTTATTGCGAAGCGTGCAATTACCAAGGCCAAGGTCGGCGTCTTCAGCTGCCCCATTGACATCTCTCAGACCGAAACCAAGGGCACTGTCCTGCTGAAGAGTGCGGATGAGATGCTCAACTTCACCAAGGGCGAGGAGCAACGCCTGGAGTCCGCCATTAAGGAGCTCTATGACTCGGGTGTTCGTGTCGTTGTTGCCGGTTCCTCCGTCGGTGACTTGGCAATGCACTACCTGAACCGTTTCAACATCCTTGTGATCAAGATCCTCTCCAAGTTCGAACTTCGCAGACTCTGCCGTGTCGTCAGTGCCACGCCTCTGGCCCGTCTGGGTGCCCCTATGCCCGACGAAATGGGCAGCATCGACGTCGTTGAGACCACCGAAATTGGCGGAGACCGTGTGACTGTGTTCCGTCAAGAGGATGCGAACGCCGTAACTCGCACGGCCACCATTGTTTTGCGTGGAGCGACGCAGAACCACTTGGATGATGTCGAGCGTGCCATCGATGATGGTGTGAACGCGGTGAAGGCCATCACCAAAGACCCCCGTCTGGTTCCCGGCGCAGGCGCTACCGAAATCCAGCTCGTGGAGAAGATTTCTGCGTTCGCCGATCGGACTCCAGGCCTGCCCCAGTATGCCATCCGCAAGTACGCCGAGGCCTTTGAGGTCATTCCCCGTACGCTAGCGGATTCTGCGGGCTTGGATGCTACCGAGGTTCTTTCCCGTCTCTACACAGACTATCTCTGGCGAACACGGCCTTGACGGCTCCGGTGTGTAATTACAATGGCTCCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTTAACGAGGCTAGCGGAAACAAGTATGTACCTCGTGCCGTCCTCGTCGATCTTGAACC-CGGTACCATGGACGATAAGGATGGTGATGGCCAGATCACCACAAAGGAGTTGGGCACTGTGATGCGCTCACTGGGTCAGAACCCTTCTGAGTCGGAACTCCAGGACATGATTAACGAGGTTGATGCCGATAACAATGGCACCATCGACTTCCCTGAGTTCCTTA Aspergillus_egyptiacus TATCTCCTCAGCGTAACGGTCCGCTCATGGGTATCGTGCAGGATACTCTGTGCGGTATCTACAAGATATGCCGACGTGATGTCTTCCTGAGCAAGGAGCAGGTGATGAACATAATGATGTGGGTGCCCGACTGGGATGGTGTCATCCCCCCGCCTGCGATCTTGAAACCTAGACCCAGGTGGACCGGGAAACAAATGATCAGTATGGCGCTTCCGCCCGGTCTCAACCTTCTGCGAGTTGA---GAAAGATGGCTCCCCGCTTTCTGAAAAGTTCTCTCCTCTCAATGATGGTGGCCTTCTCATTCACGGTGGGCAGTTGATGTACGGAATGTTCTCCAAGAAAACCGTCGGTGCCAGTGGTGGAGGTGTCATCCACACCATTTACAACGAATACGGACCGGACACTGCTGTTGCTTTTTTCAACGGCTGTCAAGCCATTGTCGGCTACTGGTTGCTCCACAACGGTTTCAGTATCGGCATTGGTGACACTATCCCCGATGAGCTTACCATTCAGCGCATTGAAAACTGCGTGCGTAATCGGAAGCAGGAAGTCGAGGCTATCACTGCCAGTGCCACTGAGAACACTCTCGAGGCCCTTCCCGGTATGAACGTCCGAGAAACTTTTGAGAGCAAAGTCTCCCGTGCTCTCAACAACGCTCGTGATGAAGCTGGTAGTGAAACCGAGAAAAGCTTGAAGGATTTGAACAACGCCATCCAGATGGCTCGTTCTGGATCGAAGGGTTCAACCATCAACATCTCACAGATGATGTGTGGAGTCCAACCGTGAGATCTACCTCAACATCGGTATCAAGGCTAGCACCTTGACTGGTGGTTTGAAGTATGCTCTCGCTACCGGTAACTGGGGAGAGCAAAAGAAGGCAGCCAGCGCCAAGGCTGGGGTGTCACAAGTGCTCAGTCGCTACACATACGCGTCTACATTGTCACATCTTCGGCGAACAAACACGCCCATCGGTCGTGACGGGAAGATAGCCAAACCCCGCCAGCTGCATAACACCCACTGGGGCTTGGTATGCCCTGCAGAGACTCCGGAAGGTCAGGCTTGCGGTTTGGTCAAGAACCTGGCGCTCATGTGCTACATTACTGTCGGTACTCCCAGTGAGCCTATTATTGACTTCATGATCCAACGTAACATGGAAGTGCTTGAGGAGTTCGAGCCTCAAGTAACCCCTAACGCGACCAAAGTGTTTGTCAACGGAGTCTGGGTCGGTGTTCATCGCCACCCTTCTCATCTTGTTGACACCATGCTTTCGCTGCGTCGTCGAAACATGATTTCACACGAAGTCAGTCTCATCCGTGACATTCGTGAGCGAGAGTTCAAGATCTTCACAGATGCAGGTCGTGTCTGCAGACCGCTGTTCGTGGTTGACAACGATCCGAAGAGCGAGAACTGTGGCAACCTGGTCCTGAATAAGGAGCACATTCGCAAACTGGAGCAAGATAAAGAAC---------TCCCACCGGATTTGGATCCGGAGGACCGCCGAGAGCGCTACTTCGGATGGGATGGTCTGGTCAAATCGGGTGTTGTCGAGTATGTGGATGCGGAAGAAGAAGAGACAATCATGATCGTGATGACACCGGAGGACTTGGAAATCTCGAAGCAGCTCCAAGCGGGTTACGCACTTCCCGAGGAGCAG------GATCCGAACAAACGTGTGAGATCAATCCTCAGTCAGAGGGCGCATACTTGGACTCACTGCGACAGCCCGTGGAACACTGCCGAGGACCGACCCCACGAGCCCGAAGACTGGCGCCGACTCCTCCAGTTCGGGGACTACAAGGGCTCCAAGAACAGGATCCTGCGCGAGGCGCTCGTTGGCGGCGTCAACCCGGGCACCCGAGTGGCCGTCCACCTCCGCGCAGTGCCTGCCTTGCTCCGCACCAAAGCCGCACCTCTTTCCCTCTTCTC-CCTCCTCCGCCACGAACACAAACATACCGTCGTGAACATCAACATGCACCTCAACGCCACCGTCGAGGACCCACTCAAAGCCAAGGAAGAGCTCATCGTCCAATACGGCCCGCGCCGCCTAGTCGTCAACCCCGTCTTCTCTTCCGCAGACAACACCCCGAACAACGTCCACAAATTCGACCGTTTCCTGCACCCGGGCCGCAGCGCAATCGCCACCTGGATCGGGCCGCTAACGTGGGGCTCCGTGCCCGTCCTGGTCTTCAAAGCCAAGAAGCCCA------GCGAGGATCCCGAAGTCCTCGACACTGCTGATGA---------------CGCCCCGGCGACGGACTTCAGTGTTGACAACCTCGACCTCATCGGCACAGGCACGGTCGTCGCGCCTGATCCCACCCGTGTCGTCGCCAAACGCGCCATCCACAAGGCCAAGGTCGGCGTTTTCAGCTGCCCGATCGACATCTCCCAAACCGAAACCAAGGGTACTGTCCTACTCAAGAACGCCCAGGAGATGCTCAACTTTACCAAGGGCGAAGAAGAGCGCCTGGAAGCCGCCATCAAGGAGCTGTACGACTCGGGCCTCCGCGTCGTCGTCTGCGGCGCCTCCGTCGGCGACCTCGCCCTCCACTACCTCAACCGCTTCAACATCCTCGTGATTAAGATCCTCTCCAAGTACGAGCTCCGCCGCCTCTGCCGCGTGGTCGGGGCTACGCCCCTCGCCCGCCTCGGCGCCCCCATGCCGGATGAAATGGGTTCCATTGACGTCGTCGAAACCACCGAGATCGGCGGCGACCGCGTCACTGTCTTCCGCCAGGAAGACGAGACCGCTGTCACCCGAACCTCCACCATCGTCCTCCGCGGCGCAACCCAGAACCACCTCGACGACGTCGAGCGCGCCATCGACGACGGCGTCAACGCCGTCAAGGCCATCACCAAGGACCCCCGTCTTGTCCCCGGCGCCGGCGCCACCGAGATCCAGCTCGTCGAGCGCATCTCCGCCTTCGCAGACCGCACGCCGGGTCTCCCCCAGCACGCGATCCGCAAATACGCCGAAGCCTTCGAAGTCGTGCCCCGCACGCTGGCCGAATCCGCCGGTCTCGACGCCACCGAGGTCCTCTCTCGTCTCTACACAGACCATCTCTGGCGAACACGGCCTTGACGGCTCCGGCGT----GTACAATGGCTCTTCCGACCTGCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGCCAACGGTAACAAGTATGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCC-CGGTACTATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTCGGCACTGTGATGCGCTCGCTCGGCCAGAACCCCTCTGAGTCCGAACTCCAGGACATGATCAACGAAGTCGATGCCGACAACAATGGCACCATCGATTTCCCAGAGTTCCTCA Aspergillus_fischeri TGTCTCCCCAGCGTAACGGTCCCCTTATGGGTATCGTGCAAGATACTCTCTGCGGTATCTACAAGATTTGCCGACGTGATGTCTTCTTGAGCAAAGAACAGGTCATGAACATTATGTTGTGGGTTCCAGACTGGGATGGAGTTATCCCTCCGCCAGCCATCTTGAAGCCTAGACCTAGGTGGACTGGAAAGCAGATGATAAGCATGGCTCTTCCATCTGGGCTCAATTTGTTGCGTGTGGA---GAAAGATAACTCTAGTCTGGCAGAGAAGTTCTCGCCTCTGACAGACGGTGGTCTGCTCATCCACGGCGGACAGTTGATGTATGGAATGTTCTCCAAGAAGACTGTTGGTGCTAGCGGTGGTGGTGTCATTCACACAATCTTCAATGAGTACGGGCCGGATACTGCGGTGGCTTTCTTCAATGGTGCACAAACCATTGTCAACTACTGGCTGCTTCACAATGGTTTCAGTATAGGTATTGGTGACACCATTCCCGACGCGATCACGATTCAGCGAATCGAGAATTGTGTGCGAGAGAGGAAGAAGGAAGTCGAGGCTATCACAGCAAGCGCCACGGAGAATACTCTGGAGCCCCTGCCTGGTATGAACGTTCGAGAGACCTTTGAGAGCAAGGTTTCGCGTGCGCTCAACAATGCCCGTGACGAAGCTGGTAGTGAGACTGAGAAGAGTCTGAAGGATCTCAATAACGCCATCCAGATGGCCCGGTCTGGATCTAAGGGTTCGACGATCAATATCTCTCAGATGATGTGTGGAAACTAATCGTGAAATCTACTTGAACATCGGTATCAAGGCCAGTACCTTGACTGGAGGTCTGAAATATGCCCTCGCCACCGGTAACTGGGGAGAACAGAAAAAGGCAGCAAGTTCGAAGGCAGGTGTCTCGCAGGTGCTGTCTCGTTACACCTATGCCTCCACCTTGTCACATCTTCGGCGTACCAACACGCCAATTGGTCGTGACGGTAAAATCGCGAAGCCTCGTCAGCTTCACAACACCCATTGGGGCTTGGTCTGTCCTGCAGAAACTCCTGAAGGTCAAGCTTGTGGTCTGGTCAAGAACCTGGCTCTCATGTGTTATATCACTGTCGGCACACCCAGCGAGCCCATCATCGATTTTATGATCCAGCGCAACATGGAAGTGCTTGAGGAGTTTGAGCCTCAGGTGACGCCCAATGCAACGAAGGTGTTTGTGAACGGTGTTTGGGTCGGTGTCCACCGAGATCCCGCGCACTTGGTCAACACCATGCTCTCTCTGCGTCGGCGCAACATGATCTCTCACGAGGTCAGCTTGATTCGGGACATTCGTGAGCGTGAATTCAAGATCTTCACAGACGCTGGGCGTGTGTGTCGACCACTTTTCGTCGTTGACAATGACCCTAAGAGCGAGAACTGCGGCTCGCTGGTGCTCAACAAGGAGCATATCCGCAAGCTAGAGCAAGATAAAGAAC---------TGCCCGCGGACCTTGATCCCGAAGATCGCAGGGAACGTTATTTCGGTTGGGATGGCTTGGTCAAGTCAGGAGTTGTCGAGTATGTCGATGCCGAGGAAGAAGAGACGATTATGATCGTCATGACCCCGGAAGACCTCGAAATCTCCAAGCAGCTTCAGGCGGGTTACGCTCTTCCGGAAGAAGA------CGATCCCAACAAGCGTGTTCGTTCGATCCTCAGTCAAAAGGCACACACTTGGACGCATTGCGATAGCCCTTGGGAGACTACAGAGGACCGTCCGCATGAACCAGAGGACTGGCGCCGGCTGCTGCAGATCGTGGATTACAAAGGCTCCAAGAACAGAACTCTCCGTGAAGCTCTGGTTGGCGGTGTGAACCCTGGCATAAGGGTTGATGTCCACTTGCGCGGAGTGCCATCCTCGCTCCGTAACCGCCGGCAGCCCCTGTCGCTCTTCTC-ACTCCTCCGTCACGAGCACAAGCATACCGTAGTCAACGTGGACATGCACTTGAACGCTAGCGTTGAGGAGCCCCTCAAGTCCAAGGAGGAACTCGTCGTTCAATGCGGCCCCCGCCGTCTGATCGTCAAGCCGATCTTCTCTGCTGGCGACAACACCCGGAATAACGTGCACAAGTTCGATAGATTCCTGCACCCCGGCCGCAGCGCGATTGCTACCTGGATTGGACCTCTCACATGGGGCGCCGTTCCTATCCTCGTTTTCAAGAGCAAGCAA---------AACCAGGATCCCGAGGTTCTCGACTCGGCCGATGCCG---------------ACGCAGAGGCCCCGATCGATATCGACAACCTGGAGCTCATCGGCAAGGGCACCGTCGTCGCCCCTGACCAGTCCCGCGTTGTCGCGAAGCGAGCCATCCGCAAGGCAAAGGTTGGAGTTTTCAGCTGTCCTATTGATATTTCTCAGACCGAAACCAAGGGCACCGTGCTCTTGAAGAATGCCCAGGAGATGCTCAACTTCTCAAAGGGAGAGGAGGAGCGCCTGGAGTCGACCATCAAGGAGCTTTACGACTCCGGACTCCGTGTTGTCGTTGCTGGCTCCTCCGTCGGTGACTTGGCTCTGCACTATCTCAACCGATTCAACATTCTTGTCATCAAGATTCTTTCCAAATTCGAGCTTCGCCGTCTCTGCCGTGTCGTTGGCGCTACGCCTCTGGCTCGTCTTGGCGCTCCCATGCCCGACGAGATGGGCAGCGTTGACGTTGTCGAGACCACTGAGATTGGTGGTGACCGTGTGACCGTTTTCCGTCAGGAAGAAGCCAACGCTGTAACGCGTACCGCCACCATTGTTCTGCGTGGAGCGACTCAGAACCACCTAGACGACGTCGAGCGTGCCATCGACGACGGCGTCAATGCTGTCAAGGCTATCACGAAGGACCCTCGACTTGTTCCTGGCGCTGGCGCTACTGAGATTCAGCTCGTGGAGAAGATCTCGGCTTTTGCTGACAAGACCCCCGGTTTGCCCCAGTATGCCATTCGCAAATACGCCGAGGCTTTCGAGGTCATTCCTCGTACTCTCGCGGAGTCCGCTGGCTTAGACGCCACGGAGGTTCTCTCACGTCTCTATACAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCA----CTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCC-TGGTACCATGGACGACAAGGATGGTGATGGCCAGATCACCACTAAGGAATTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTACAAGATATGATCAACGAGGTGGATGCTGACAACAACGGCACCATCGATTTCCCTGAATTCCTTA Aspergillus_flavipes TCTCTCCACAGAGAAACGGTCCGCTCATGGGTATTGTGCAGGACACACTCTGCGG{AT}ATCTACAAGATTTGCCGTCGTGATGTCTTCTTGACGAAGGACCAAGTCATGAACACCATGATGTGGGTTCCTGACTGGGATGGTGTTATCCCCCCGCCCGCCATCTTGAAGCCCCGTCCAAGATGGACGGGAAAACAAATGATCAGCATGGCTCTTCCCTCTGGTCTCAACCTTCTGCGTGTTGA---CAAGGACAACTCTCCTCTTTCGGAGAAATTCTCTCCCTTGGCTGATGGCGGTCTTCTCATTCATGGTGGTCAGCTGTTATATGGAATGTTCTCCAAGAAGACTGTCGGTGCTAGTGGTGGTGGTGTTATCCACACCATCTTCAACGAGTACGGACCTGGCACTGCTGTGGCGTTCTTCAATGGAGCGCAGTCTATTGTTGGCTACTGGCTGCTGCACAATGGCTTTAGTATCGGAATTGGTGACACTATTCCTGATGCTCTCACCATTCAAAGAATCGAGAATTGTGTGCGGGAAAGAAAACAAGAGGTCGAGGCTATCACTGCCAGCGCTACTGATAACACTCTGGAGCCCTTGCCCGGTATGAATGTGCGTGAAACCTTTGAGAGTAAGGTCTCTCGCGCATTGAACAATGCTCGTGATGAGGCTGGTAGCGAGACCGAGAAGAGTCTGAAGGATCTCAACAATGCCATCCAGATGGCTCGCTCTGGTTCGAAGGGTTCCACCATTAACATTTCTCAAATGATGTGTTGAGACGAACCGGGAGATCTACTTGAACATTGGTATCAAGGCCAGCACGCTGACGGGTGGTCTTAAGTATGCACTTGCCACAGGAAACTGGGGTGAGCAGAAGAAGGCGGCCAGTGCGAAAGCGGGCGTGTCCCAAGTGCTCAGTCGTTATACCTACGCTTCTACGTTGTCTCATCTTCGTCGGACGAACACTCCGATCGGTCGTGATGGAAAGATTGCCAAGCCTCGACAGCTTCATAACACTCACTGGGGTCTGGTGTGTCCTGCAGAAACTCCAGAAGGACAGGCTTGTGGTCTCGTCAAGAACTTGGCGCTCATGTGCTACATTACCGTCGGTACGCCTAGCGAGCCGATCATTGATTTCATGATTCAGCGCAACATGGAGGTCTTGGAAGAGTTCGAGCCTCAGGTTACGCCGAATGCAACGAAGGTCTTTGTCAATGGTGTCTGGGTTGGTATTCACCGGGACCCTGCTCACCTTGTCAACACGATGTCCTCCCTGCGCCGTCGGAACATGATCTCGCACGAAGTCAGCTTGATTCGCGATATCCGTGAACGAGAATTCAAGATCTTCACAGATGCCGGACGTGTCTGTCGACCACTGTTCGTCGTTGACAATGACCCGAAGAGTGAGAGCTGTGGTTCCCTCGTCCTTAACAAGGAACACATTCGCAAGCTCGAACAGGACAAAGACC---------TTCCACCTGATCTCGACCCAGAAGAGCGCAGAGAACGCTACTTCGGATGGGATGGATTGGTCAAGTCTGGTGTGGTCGAATATGTCGATGCTGAAGAGGAGGAGACGATCATGATTGTGATGACACCGGAGGACTTGGAGATCTCCAAGCAGCTTCAGGCTGGTTATGCCCTCCCGGAGGAGGAGCTCCATGACCCTAACAAGCGTGTCCGTTCCATCCTCAGCCAAAAGGCGCACACCTGGACTCACTGCGACAGCCCCTGGGAGACGTCCGAGGACCGACCCCACGAACCCGAAGACTGGCGCCGTCTGCTCCAGTTTGCCGACTACAAGGGCTCCAAGAACCGGACGATCCGCGAAGCCCTCGTCGGCGGCGTCAGCCCGGGTACCCGCGTCGACGTACACCTCCGCGCGGTGCCGACGTCCCTCCGCA-CCG--TCCAACCGCAATCGCTCTTCTC-CCTGCTCCGCCACGAGCACAAGAACATCGTCGTGAACGTGAACATGCACCTCAACTCGAGTGTCGAGACGCCGCTCAAATCCAAGGAGGAGCTGATCGTCCAATGCGGCCACCGCCGCCTGGTCGTCAAACCCGTCTTCTCCTCCAACGACAACACCCCCAACAACGTCCACAAGTACGACCGCTTCCTGCACCCGGGCCGCAGCGCCATCGCCACCTGGATCGGCCCGCTCACCTGGGGTGCGGTCCCCGTCCTCGTCTTCAAGAGCAAGCCC---------GTCGACGACGGCGAG---ATGGAGGACGCCGACGCCGCC------GACACCACTGTCGACA------------CGACCCGCCTTGAGCTCATCGGCAACGGCACCGTCGTGGCACCGGACCAGGCCCGTGTCGTCGCCAAACGCGCCATTAGCCGCGCCAAGGTCGGTGTGTTCAGCTGCCCCATCGATATCTCCCAGACCGAGACCAAGGGTACTGTCCTGTTGAAGAACGCCCAGGAGATGCTTGACTTCACTAAGGGTGAGGAGGAGCGTCTGGAGGCGGCGATCAAGGAGTTGTACGACTCTGGTCTCCGTGTCGTCGTGGCCGGCTCCACCGTTGGCGACCTCGCCATGCACTACCTCAACCGCTTCAACATCCTTGTTATCAAGATTCTGTCCAAGTTCGAGCTGCGCCGCCTGTGCCGCGTCGTGGGTGCCACCCCGCTGGCCCGTCTGGGCGCCCCTATGCCCGACGAGATGGGCTCCATCGATGTCGTGGAGACCACTGAGATCGGAGGTGACCGTGTGACGGTGTTCCGTCAGGAGGATTCCAACGCTGTCACCCGCACTGCGACCATCGTCCTGCGCGGTGCTACCCAGAACCACCTGGATGACGTTGAGCGGGCGATTGACGATGGTGTCAACGCCGTCAAGGCCATCACGAAAGACCCCCGTCTGGTGCCCGGTGCTGGTGCCACCGAGATCCAGCTGGTGGAGCGCATCTCCGCGTTCGCCGACCGTACCCCCGGACTTCCCCAGCACGCCATCCGCAAGTACGCCGAGGCCTTCGAGGTGATCCCGCGGACGCTGGCGGAATCCGCTGGTCTTGATGCCACCGAGGCGCTGTCGCGTCTCTACACAGACCATCTCCGGCGAGCACGGCCTCGACGGCTCCGGTGTGTAACTACAATGGCTCCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGCTAGCGGAAACAAGTATGTCCCTCGTGCCGTCCTCGTCGATCTTGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTGGGAACCGTCATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCGGAGCTTCAGGACATGATCAACGAGGTTGATGCCGACAACAACGGCACCATTGATTTCCCTGAGTTCCTTA Aspergillus_flavus TATCCCCTCAGCGAAACGGACCTCTTATGGGTATCGTACAGGATACTCTCTGCGGTATCTACAAGATTTGTCGGCGTGATACATTCTTGACAAAGGAACAAGTTATGAACCTTATGATGTGGGTTCCTGACTGGGACGGCGTGATTCCCCCACCAGCAATCTTGAAGCCTAGGCCCAGATGGACTGGCAAGCAAATTATTAGCATGGCGCTTCCTTCGGGGCTCAATCTTCTCCGTGTGGA---TAAGGACAACTCAGCGCTCTCTGAGAAGTTTGCCCCTCTGAATGATGGTGGTCTTCTCATTCATGGTGGACAGTTGATGTATGGAATGTTTTCCAAGAAGACTGTTGGTGCCAGTGGTGGTGGTGTCATCCACACCATTTTCAATGAATATGGGCCAGGTACTGCTGTGGCCTTTTTCAATGGTGCACAGGCTATTGTTAACTACTGGCTACTTCACAATGGCTTCAGTATTGGTATTGGTGACACTATTCCAGACGCGGTTACTATACAAAGAATTGAGAACTGCGTCCGGGAACGAAAGAAGGAGGTTGAAACTATCACTGCAAGTGCTACGGACAATACCCTGGAGCCGTTGCCGGGTATGAATGTGCGAGAAACCTTTGAAAGTAAGGTTTCACGTGCACTTAACAATGCTCGTGACGAAGCTGGTAGTGAAACTGAGAAGAGCTTAAAGGATCTGAACAACGCCATCCAGATGGCTCGTTCTGGATCAAAGGGATCAACCATCAACATATCCCAGATGATGTGTTGAGACCAACAGAGAGATCTACCTCAATATTGGTATCAAGGCCAGTACACTGACTGGTGGCTTGAAGTACGCCCTTGCTACTGGTAATTGGGGCGAACAGAAGAAGGCCGCAAGTGCTAAGGCTGGCGTGTCGCAAGTGCTCAGTCGTTATACCTACGCTTCTACTTTGTCACATCTTCGCCGAACCAATACGCCTATTGGTCGTGATGGTAAAATTGCTAAACCCCGCCAGCTTCACAATACTCATTGGGGGTTGGTTTGTCCAGCAGAGACTCCTGAAGGTCAGGCCTGTGGTCTGGTCAAGAACTTGGCCCTCATGTGTTATGTCACTGTTGGTACACCCAGCGAACCTATCATTGACTTCATGATTCAGCGTAACATGGAAGTTCTTGAGGAGTTTGAGCCTCAGGTCACTCCCAACGCAACGAAGGTCTTCGTCAATGGAGTGTGGGTCGGTATCCATAGAGATCCCGCCCATCTTGTCAATACGATGCAGTCACTGCGGCGACGAAATATGATCTCCCACGAGGTCAGTTTGATTCGTGATATCCGTGAGCGGGAGTTCAAGATCTTCACCGATGCTGGACGTGTTTGCAGGCCGTTGTTCGTCATTGACAATGACCCGAAGAGCGAAAATTGCGGTGGTTTGGTGTTGAACAAAGAGCACATCCGCAAGTTGGAACAAGACAAAGAAT---------TACCACCCGACCTCGACCCTGAGGATCGTAGAGAACGTTACTTTGGATGGGATGGGTTAGTGAGATCGGGTGTGGTAGAGTATGTTGACGCCGAAGAAGAGGAGACGATCATGATTTCCATGACACCGGAAGACCTGGAAATTTCCAAACAGCTTCAGGCTGGCTACGCCCTTCCTGAAGAAGAGCT---CGATCCCAACAAGCGCGTCCGCTCTATACTGAGCCAGAAGGCACATACTTGGACACACTGTGACAGTCCTTGGGAGACAAGGGAAGACCGACCCCACGAACCAGAGGACTGGCGTCGTCTGCTTCAGATCATTGATTACAAGGGTACCAAGAACAGGACTGTCAGGGAGGCCCTTATCGGTGGTGTTAACCCTGGTATCCGCGTGGACGTACACCTTCGTGCCGTGTCAACGTCTCTTCGCAACAAGCCGCAGCGGTTTCATCAAGGAGAGTCTGGGTACTCACGGTTACTTCAAGGCTACCTTCGATGCCAAGATCA-----ACCCTCAAGATTCGATCGGTATT--AGCTTGTACAAGCGGGTCTTCCCTCGGAAGGCTCGCGCTCTGGAAGAGGTTACTGCTTAAGGGTTTCTTGTGTTCTTGCCGCTGGGATTTAGGATTGATATGGGCGGTTTCAAA-----GGGAAAGATGATATGATACCACAAAGTCGG----TTGCATGAATTGACGATTCTCACCTC---TTGAAAGATAGGGGTGTTCT-------AAAAGCATTAGGATTTCATATAGATTTCAATAAG------------------------------TAGATCAGGTCAAGCTTTAATGAGTTACGATCTTTCTTTTTCTG--------------------------------------TACCAAGGCTAAGGTCGGCGTGTTCAGCTGCCCCATCGACATTTCTCAGACCGAAACCAAGGGCACTGTGTTGTTGAAGACCGCGGATGAGATGCTCAACTTCACCAAGGGTGAGGAGGAACGCCTCGAGACGGCCATTAAGGAGCTCTATGACTCCGGTGTTCGCGTCGTTGTGGCCGGTTCCACCGTTGGTGACCTGGCCATGCACTACCTCAACCGCTTCAACATCCTTGTGATCAAAATCCTCTCCAAGTTCGAACTCCGCAGACTTTGCCGTGTCGTCGGCGCCACTCCTCTTGCTCGTCTAGGAGCCCCTATGCCCGACGAGATGGGCAGCGTCGATGTCGTTGAGACCACCGAAATCGGCGGTGATCGTGTGACCGTCTTCCGTCAGGAGGAGGCCAACGCCGTGACTCGCACAGCTACCATTGTTCTGCGTGGAGCGACACAAAACCACTTGGACGATGTCGAGCGTGCCATCGATGATGGTGTGAACGCCGTCAAGGCCATTACCAAGGACCCCCGTCTGGTTCCCGGCGCAGGCGCTACTGAAATCCAGCTCGTAGAGAAGATTTCTGCATTCGCCGATCGGACCCCCGGATTGCCTCAACATGCCATTCGTAAGTACGCTGAGGCTTTCGAGGTCATTCCCCGCACCCTTGCGGAGTCTGCTGGTCTCGATGCCACCGAGGTTCTTTCTCGTCTTTACACAAACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGT----TTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGAAACAAGTATGTCCCTCGTGCCGTCCTCGTTGATCTTGAGCC-TGGTACCATGGACGACAAGGACGGTGATGGCCAGATCACCACCAAGGAGTTGGGCACTGTCATGCGCTCTCTGGGCCAAAACCCCTCTGAGTCGGAACTCCAGGACATGATTAACGAGGTTGACGCCGACAACAATGGCACCATTGACTTCCCTGAGTTCCTGA Aspergillus_fumigatus TGTCTCCCCAGCGTAATGGTCCCCTTATGGGGATCGTGCAAGATACTCTCTGCGGTATTTACAAGATTTGCCGACGTGATGTCTTCTTGACCAAAGAACAGGTCATGAACATTATGTTGTGGGTTCCAGACTGGGATGGAGTTATCCCTCCGCCAGCCATCTTGAAGCCTAGACCTAGGTGGACTGGAAAGCAGATGATAAGCATGGCTCTTCCATCTGGGCTCAATTTGTTGCGTGTGGA---GAAAGATAACTCTAGTCTGGCAGAGAAGTTCTCGCCCTTGACAGACGGTGGTCTGCTCATCCACGGTGGACAGTTGATGTATGGAATGTTTTCCAAGAAGACTGTTGGTGCTAGCGGTGGTGGTGTCATTCACACTATCTTTAATGAGTACGGGCCGGATACTGCGGTGGCCTTCTTCAATGGGGCACAAACCATTGTCAACTACTGGCTGCTTCACAATGGTTTCAGTATAGGTATTGGTGACACCATTCCCGACGCGATCACGATTCAGCGAATCGAGAATTGTGTGCGAGAGAGGAAGAAGGAAGTCGAAGCTATCACAGCAAGCGCTACGGAGAATACCTTGGAGCCCCTGCCTGGTATGAACGTTCGAGAGACCTTCGAGAGCAAGGTTTCGCGTGCGCTCAACAATGCTCGTGACGAAGCTGGTAGTGAGACTGAGAAGAGTTTGAAGGATCTGAACAACGCCATCCAGATGGCCCGGTCTGGATCTAAGGGTTCGACGATCAATATCTCTCAGATGATGTGTGGAAACTAATCGTGAAATCTACCTGAACATCGGTATCAAGGCTAGTACCTTGACTGGAGGTCTGAAATATGCCCTCGCCACCGGTAACTGGGGAGAACAGAAAAAGGCAGCAAGTTCGAAGGCAGGTGTCTCGCAGGTACTGTCTCGTTACACCTATGCCTCCACCTTGTCACATCTTCGGCGTACCAACACGCCAATTGGTCGTGATGGTAAGATCGCAAAGCCTCGTCAGCTTCACAACACCCATTGGGGCTTGGTCTGTCCTGCAGAAACTCCTGAAGGTCAGGCTTGTGGTCTGGTCAAGAACCTGGCTCTCATGTGTTATATCACTGTCGGCACACCCAGCGAGCCCATCATCGATTTCATGATTCAGCGCAACATGGAAGTGCTTGAGGAGTTTGAGCCTCAGGTGACACCCAATGCAACGAAGGTGTTTGTGAACGGTGTTTGGGTCGGTGTCCACCGAGATCCCGCGCACTTGGTCAACACCATGCTCTCTCTGCGTCGGCGCAACATGATCTCTCACGAGGTCAGCTTGATTCGGGACATTCGTGAGCGTGAATTCAAGATCTTCACAGACGCTGGGCGTGTGTGTCGACCACTTTTCGTCGTTGACAATGACCCTAAGAGCGAGAACTGCGGCTCGCTGGTGCTCAACAAGGATCATATCCGCAAGCTAGAGCAAGATAAAGAAC---------TACCCGCGGACCTTGATCCCGAAGATCGCAGGGAACGTTATTTCGGTTGGGATGGTTTGGTCAAGTCAGGAGTTGTCGAGTATGTCGATGCCGAGGAAGAAGAGACGATTATGATCGTTATGACCCCCGAAGACCTCGAAATCTCCAAACAGCTTCAGGCGGGTTACGCTCTTCCGGAAGAAGA------CGATCCCAACAAGCGTGTTCGTTCAGTCCTCAGTCAAAAGGCACACACTTGGACGCATTGCGATAGCCATTGGGAGACTGCAGAGGACCGTCCGCATGAACCAGAGGACTGGCGCCGGCTGCTGCAGATTGTGGATTACAAAGGCTCCAAGAACAAAACTCTCCGTGAAGCTCTGGTTGGCGGTGTGAAGCCTGGCATAAGGGTTGATGTCCACTTGCGTGGAGTGCCATCGTCGCTCCGTAATCGCCGGCAGCCCCTGTCTCTCTTCTC-ACTTCTCCGTCACGAGCACAAACATACCGTAGTCAACGTGAACATGCACTTGAACTCTAGCGTTGAGGAGCCCCTCAAGTCCAAGGAAGAACTCATCGTTCAATGCGGCCCCCGCCGTCTGATCGTCAAGCCGATCTTCTCTGCTGGCGACAACACCCCGAATAATGTGCACAAGTTCGATAGATTCCTGCACCCCGGCCGCAGCGCGATTGCTACCTGGATTGGACCTCTCACATGGGGCGCCGTTCCTGTCCTCGTTTTCAAGAGCAAGCAA---------AACCACGATCCCGAGGTCCTCGACTCGGCCGATGCCG---------------ATGCGGAGGGCCAGATCGACATCGACAACCTCGAGCTTATCGGCAAGGGCACTGTCGTCGCCCCTGACCAGTCCCGCATTGTCGCGAAGCGAGCTATCCGCAAGGCAAAGGTTGGCGTTTTCAGCTGCCCTATTGATATTTCTCAGACCGAAACCAAGGGCACCGTGCTCTTGAAGAATGCACAGGATATGCTCAACTTCTCAAAGGGAGAGGAGGACCGCCTGGAGGCGACCATCAAGGAGCTTTACGACTCCGGACTCCGTGTTGTCGTTGCTGGCTCCTCCGTAGGTGACTTGGCTCTACACTACCTCAACCGATTCAACATTCTTGTCGTCAAGATCCTTTCCAAATTCGAGCTTCGCCGTCTCTGCCGTGTCGTTGGCGCTACGCCTCTGGCTCGTCTTGGCGCTCCCATGCCCGACGAGATGGGCAGCGTTGACGTTGTCGAGACCACCGAGATTGGCGGTGACCGTGTGACCGTTTTCCGTCAGGAAGAAGCCAACGCTGTAACACGTACTGCCACCATTGTCCTGCGTGGAGCGACTCAGAACCACCTAGACGACGTCGAGCGTGCCATTGATGACGGCGTCAATGCTGTCAAGGCTATCACAAAAGATCCTCGACTTGTTCCTGGCGCTGGCGCTACTGAGATTCAGCTCGTGGAGAAGATCTCGGCTTTCGCTGACAAGACCCCCGGTCTGCCTCAGTATGCCATTCGCAAATATGCCGAGGCCTTCGAGGTCATTCCTCGTACTCTCGCGGAGTCCGCTGGCTTAGACGCCACGGAGGTTCTCTCACGTCTCTACACAGACCATCTCTGGTGAGCATGGCCTTGACGGCTCTGGCCA----CTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGCCAACGGTGACAAATATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCC-TGGTACCATGGACGACAAGGATGGTGATGGCCAGATCACCACCAAGGAATTGGGCACTGTAATGCGCTCTCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAACGGCACCATCGATTTCCCCGAATTCCTTA Aspergillus_funiculosus TGTCTCCCCAGAGAAACGGACCGCTTATGGGTATTGTGCAAGATACTCTTTGCGGCATCTACAAGATTTGCCGACGTGATATTTTCTTAACAAAGGAGCAGGTTATGAATCTTATGCTTTGGGTTCCTGACTGGGATGGGGTTATTCCTCAACCTGCTATTCTGAAACCCCGACCTAGATGGACCGGAAAACAGATGATCAGCATGGCTCTTCCATCCGGTCTTAACCTTCTGCGTGTCGA---AAAAGATAGCTCCCCGCTTGCCGAGAAATTCTCTCCTTTGAATGATGGCGGAATCCTGGTCCATGGTGGACAGCTGATGTATGGAATGTTTTCCAAGAAGACTGTTGGCGCTACTGGTGGAGGTGTGATTCACACAATCTTTAATGAGTACGGACCAGAAACCGCTGTGGCCTTCTTCAACGGCGCCCAAACTATCGTCAATTATTGGTTGCTCCATAATGGCTTTAGTATTGGTATCGGTGACACCATTCCCGACGAGGTCACTATCCAGAGAATCGAAAACTGTGTACGTCTCAGGAAGCAGGAGGTCGAGTCGATCACTGCAAGTGCAACTGAGAACACCCTCGAGGCTCTGCCTGGTATGAACGTGCGTGAAACTTTCGAAAGTAAAGTTTCACGTGCTCTTAACAACGCCCGTGATGAAGCTGGTAGTGAGACTGAAAAGAGCTTGAAGGATTTGAACAATGCTATCCAGATGGCTCGCTCTGGTTCAAAGGGTTCAACTATCAACATCTCTCAAATGGTGCGTGGAGACCAACCGAGAGATTTATCTCAACATTGGTATCAAGGCTAGCACCTTGACTGGTGGATTGAAATATGCCCTTGCTACTGGTAACTGGGGAGAGCAAAAGAAAGCAGCCAGTGCAAAAGCTGGTGTGTCACAAGTGCTTAGTCGTTATACTTATTCTTCTACATTGTCGCATCTTCGCCGAACGAATACCCCCATTGGCCGTGACGGAAAGATTGCCAAACCTCGTCAGCTACACAACACCCACTGGGGCTTGGTCTGTCCTGCAGAAACTCCCGAGGGTCAGGCTTGCGGTTTGGTCAAAAACTTGGCCCTTATGTGCTATATCACTGTCGGGACCCCCAGCGAGCCCATCATTGACTTCATGATCCAGCGTAATATGGAAGTCCTTGAGGAATTCGAGCCCCAAGTGACACCCAACGCAACAAAGGTTTTCGTGAACGGTGTTTGGGTTGGTATCCATCGTGATCCTGCGCACCTTGTCAACACCATGCTTTCTCTACGTCGGCGAAACATGATCTCTCATGAAGTCAGTCTGATCCGTGATATTCGTGAGCGGGAATTCAAGATTTTCACCGATGCTGGCCGTGTTTGCAGACCGCTTTACGTCATTGATAATGACCCGAAGAGTGAGAACTGTGGCTCCTTAGTCTTGAACAAGGAGCACATTCGCAAGTTGGAGCAGGACAAGGAAC---------TTCCACCAGATCTTGATCCAGAAGACCGTCGGGAGCAACACTTCGGATGGGACGGGTTGGTCAAATCCGGTGTTGTTGAGTATGTAGATGCTGAGGAGGAAGAAACGATCATGATTTCAATGACTCCCGAAGACTTGGAGATATCCAAGCAGCTGCAAGCAGGATATGCTCTCCCTGAGGAGGAG---CACGATCCCAACAAACGTGTGCGATCTATTCTAAGTCAGAAGGCGCATACCTGGACCCATTGCGATAGCCCGTGGGCTACAGCAGAGGATCGACCTCATGAACCCGAAGATTGGCGCCGACTACTTCAATTCGGCGACTTCAAGGGATCTAAAAACCGGATTCTCAGAGAAGCTCTTATCGGAGGTGTCAACCCAGGAACTCGTGTAGATGTTCATCTAAAGGCGGTTCCTGCTTCGCTTCGTAACCGACCACAGCCATTATCCTTATTCTC-TCTTCTTCGACATGAGCACAAGCATACAGTTGTCAACATCAACATGCATCTCAATGCTAGTGTTGAAGAGCCTCTGAAGTCGAAAGAAGAACTCATTGTCCAGTATGGGCCTCGCCGTCTTGTTGTTAATCCCATATTCTCAGCTGCGGCCAACACACCGAACAACGTGCACAAGTACGACCGATTCCTTCATCCTGGACGCAGCGCCATGGCCACATGGATCGGACCGTTGACCTGGGGCTCGGTTCCGGTCCTCGTCTTCAAAACCAAATCA---------AGCGAGGACCCAGAGGTTCTCGATTCTGCTGATGGAAA------------TG---CCGCAGCCGATTTCAATATCGACAGCCTAGAGCTTATTGGAACGGGCACCGTTGTCGCTCCCGATCCATCCCGGGTGGTTGCTAAGCGTGCCATCCGCAAGGCCAAGGTCGGCGTCTTCAGCTGCCCGATCGACATCTCCCAGACAGAGACCAAAGGCACAGTCCTACTGAAGAACGCCCAAGAGATGCTCGACTTCACAAAGGGCGAAGAAGAGCGCCTCGAGTCCGCCATCAAGGAGCTTTACGACTCGGGACTGCGCGTCGTCGTTGCAGGCGCCACCGTCGGCGACCTAGCCCTGCATTACCTCAACCGCTTCAACATCCTCGTGATCAAAATTCTCTCCAAGTATGAGCTGCGCCGCCTTTGCCGCGTTGTCGGTGCCACTCCCCTTGCCCGCCTGGGTGCCCCCATGCCCGACGAGATGGGCTCCGTCGACATCGTCGAGACAACCGAGATCGGCGGTGACCGCGTCACCGTCTTCCGCCAGGAGGACTCCACGGCCGTTACCCGCACCTCCACCATTGTCCTCCGCGGCGCGACGCAAAACCACCTCGATGACGTCGAGCGCGCCATCGACGATGGCGTCAACGCCGTCAAGGCCATCACCAAGGATCCCCGCCTCGTCCCCGGCGCCGGCGCCACGGAGGTCCAGCTCGTTGAGCGCATCTCCGCCTTCGCGGACCGAACCCCCGGTTTGCCCCAGTATGCTATCCGCAAGTACGCTGAGGCCTTCGAGGTCATCCCGCGCACTCTCGCCGAGTCCGCCGGTCTGGATGCTACAGAGGTCCTCTCTCGTCTTTACACAGACCATCTCTGGTGAACACGGCCTCGATGGCTCCGGTGT----TTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGCTAGTGGAAACAAGTACGTTCCTCGTGCCGTCCTAGTCGATCTTGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTGGGCACTGTGATGCGCTCGCTCGGCCAGAATCCGTCCGAGTCTGAATTGCAGGATATGATCAACGAGGTTGATGCTGACAACAATGGCACCATCGATTTCCCTGAGTTCCTCA Aspergillus_glaucus TGTCGCCTCAGCGTAACGGCCCCCTTATGGGTATCGTCCAAGATACACTCTGTGGTATCTACAAGGTTTGTCGGCGGGACACCTTCTTGACCAAAGAGCAGGTGATGAACATTATGCTTTGGGTTCCTGACTGGGACGGAGTTATCCCACCACCGGCTATTATCAAGCCTAGACCCAGATGGACAGGGAAACAGATGATCAGTATGGCGCTTCCCTCCGGGTTGAACCTTCTTCGTGTGGA---CAAGGACAACTCTGCGCTCGCGGAGAAGTTTTCTCCACTGGCTGACGGCGGTCTTCTTATTCACGGAGGCCAGCTCATGTATGGATTGCTCTCTAAGAAGACTGTTGGTGCTAGTGGCGGTGGTGTTATCCACACCATTTTCAACGAGTACGGTACAGACGCTACAGTGGGCTTCTTCAACGGCGCCCAGGCCATCGTCAACTATTGGTTGCTGCACAACGGTTTCAGTATTGGTATCGGTGACACGATCCCAGACCCGCTTACAATTCAGAGAATTGAAAACTGTGTCCGCAATCGAAAGAAGGAGGTTGAGGAAATCACTGCCACTGCCACAGAGAACCAGCTTGAGGCACTGCCCGGTATGAACGTGCGAGAAACCTTTGAAAGTAAGGTCTCGCGCGCTCTCAACAATGCTCGTGATGAAGCCGGTAGCGAGACCGAAAAGAGTTTGAAGGACCTCAACCACGCCATTCAGATGGCTCGCTCTGGATCCAAGGGTTCGACGATCAACATTTCTCAAATGATGTGTGGAGACCAACCGTGAGATATACTTGAACATTGGTATCAAGGCCAGCACCTTGACCGGAGGTTTGAAATACGCCCTGGCCACGGGTAACTGGGGTGAACAGAAGAAGGCGGCCAGCGCGAAGGCAGGTGTGTCGCAAGTGCTCAGTCGATACACATATGCTTCTACCCTATCGCATCTTCGTCGGACAAACACCCCGATTGGCCGTGACGGAAAGATTGCCAAACCGCGGCAACTTCACAACACTCACTGGGGTTTGGTGTGTCCTGCAGAAACTCCGGAAGGTCAAGCTTGTGGTTTGGTCAAGAACCTGGCGCTTATGTGCTACATTACCGTTGGTACGCCCAGCGAGCCTATTATCGACTTCATGATCCAGCGAAACATGGAAGTTCTCGAGGAGTTTGAGCCTCAAGTGACGCCCAATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTATCCATCGTGACTCTGCTCATCTGGTAAACACCATGCTTGCCCTGCGTCGTCGCAACATGATTTCGCACGAAGTTAGTTTGGTTCGGGATATCCGTGAGCGTGAGTTCAAGATCTTTACCGATGCTGGTCGTGTTTGCCGGCCGCTGTTCGTCATCGACAATGACCCGAAGAGCGATAACAGCGGCTCGCTGGTGCTCAACAAAGAGCACATTCGGAAGCTGGAGGAAGACAAGGAAT---------TGCCCCCTGACCTTGATCCCGAAGAGCGCAGGGAACGCTACTTCGGATGGGATGGTCTTGTGAAATCGGGAGTTGTGGAATACGTCGATGCAGAAGAAGAAGAGACAATCATGATTTCCATGACGCCCGAAGATTTGGAAATCTCGAAACAGCTCCAGGCCGGTTATACTCTTCCCCCGGAAGAG------GATCCCAACAAGCGTGTACGGTCGATTCTGAGTCAGAAGGCGCATACATGGACGCACTGCGACAGCGCCTGGGAAACCGCCCCAGACCGTCCCCACGAACCCGAAGACTGGCGCCGTCTCCTCCAATTCGCCGACTACAAGGGCTCCAAGAACAGGGCCATCCGCGAAGCCCTAGTCGGCGGCGTCAACCCCGGCGCCCGCGTCGACATCCACCTCCGCGCGGTGCCCTCCTCCCTCCGCACCCGCCCCCAACCCCTCTCCCTCTTCTC-CCTCCTCCGCCACGAACACAAACACACCGTGGTCAACGTCAACATGACCCTCAACTCCAGCGTCGAACAACCCCTCAAATCCAAGGAGGAGCTCATCATCCAATACGGCCCACGCCGCGTCGTCGCAAACCCCATTTTCTCCGCAAACGACAACACCCGCAACAACATCCACAAATTCGACCGCTACCTACACCCCGGCCGCAGCGCAATCGCCTCCTTTATCGGCCCACTAACCTTCGGCTCCATCCCCATCCTCGTCTTCAAAACCCGGCAATCCCAAA---ACGACGACCCCGAAGTCCTCGACGCCGCAGACACCGAG------------CCCCTCGACA------------TCAACAATCTCGACCTCATCGGCACAGGCACAGTCGTCGCACCCGACCAAGCCCGTGTCGTCGCGAAACGCGCCATCACCAAGGCCAAGGTCGGCGTTTTCAGCTGCCCTATCGATGTCTCGCAGACCGAGACCAAGGGAACTGTGCTCTTGAAGAACGCTGAGGAGATGATGAACTACAGCAAGGGTGAGGAGGAGCGTCTTGAGTCTGCTATCAAGGAACTGCATGACTCGGGTCTCCGCGTTGTGGTTGCCGGTGCGAACGTTGGCGACCTGGCTATGCACTACCTTAACCGATTTAACATTCTCGTCGTCAAGATCCTCTCCAAGTTTGAGCTCCGTCGGCTGTGCCGTGTCGTCGGTGCCACACCTCTTGCCCGTCTGGGTGCCCCGATGCCCGACGAGATGGGTGCTGTCGACGTTGTTGAGACCGCTGAGATTGGTGGAGACCGTGTCACCGTCTTCCGTCAGGAGGATGCGAACTCTCCTACCCGTACCGCCACCATCGTCCTCCGTGGTGCCACTCAAAACCACCTGGAAGATGTTGAGCGTGCTATCGACGACGGTGTCAACGTTGTCAAGGCTATTACCAAGGACCCCCGTCTTGTTCCTGGCGCAGGCGCTACTGAAATCCAGCTCATCGAGAGAATTTCCGCATTTGCAGACAAGACCCCTGGTCTGCCCCAACATGCCATCCGGAAGTTCGCTGAGGCCTTTGAAGTGATCCCGCGCACTCTCGCAGAGTCCGGTGGTCTGGACGCCACCGAGGTTCTCTCCCGTCTCTACACAGACTATCTCCGGCGAGCACGGTCTCGACGGCTCTGGTGT----CTACAATGGCTCCTCTGACCTCCAGTTGGAGCGGATGAACGTCTACTTCAACGAGGCCTCCAACAACAAATATGTCCCCCGTGCCGTCCTCGTCGACCTTGAGCC-CGGTACCATGGACGACAAAGATGGCGATGGCCAGATCACCACCAAGGAGCTGGGTACCGTCATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCGGAGTTGCAGGACATGATCAACGAGGTCGACGCTGACAACAACGGCACCATCGATTTCCCTGAATTCCTTA Aspergillus_janus TGTCTCCTCAGCGAAACGGACCCCTCATGGGTATCGTGCAGGATACCCTGGCTGGTATCTACAAGATTTGCCGACGCGATGTCTTCTTGACTAAGGATCAGGTGATGAATATGATGATGTGGGTTCCGGAATGGGACGGTGTCATCCCCCCTCCCGCTATCTTGAAGCCCAGACCTCGGTGGACAGGAAAGCAAATGATAAGCATGGCCCTCCCTTCAGGTCTCAACCTCCTCCGTGTCGA---TAAAGACAGTGCCGCCATTTCCGAGAAGTTCTCTCCCTTGACAGATGGTGGTCTCCTCATTCATGGAGGTCAGCTGATGTACGGAATGTTTTCCAAGAAGACCGTTGGCGCCAGCGGTGGTGGTGTCATCCACACAATCTTTAACGAGTATGGATCGGGCACGGCTGTGGCCTTCTTCAATGGAGCACAGTCTATTGTCGGCTACTGGTTGCTACACAACGGTTTCAGTATTGGAATTGGTGATACCATCCCAGATGCGACCACGATCCAGAGAATCGAGAACTGCGTCCGTCTAAGAAAGAAGGAAGTCGAAGACATCACTGCAAGTGCTACTGACAACACTCTCGAGGCTTTGCCTGGTATGAACGTGCGTGAAACTTTCGAGAGTAAGGTTTCGCGTGCTTTGAACAATGCTCGTGATGAAGCCGGTAGCGAGACGGAGAAGAGTTTGAAAGATCTCAACAACGCCATCCAAATGGCTCGATCTGGATCCAAGGGTTCCACTATCAACATCTCTCAAATGATGCGTTGAGACAAATAGGGAGATCTACTTGAATATTGGTATCAAGGCTAGCACGTTGACGGGTGGTCTCAAGTACGCCCTTGCTACAGGAAACTGGGGAGAACAGAAGAAAGCTGCAAGCGCCAAGGCTGGTGTATCCCAGGTGCTCAGTCGTTATACCTACGCCTCTACATTGTCACATCTTCGGCGAACGAACACCCCTATCGGTCGTGACGGAAAAATTGCCAAACCCCGTCAACTGCACAATACCCATTGGGGATTGGTGTGTCCTGCAGAGACTCCGGAAGGTCAGGCTTGTGGTTTGGTCAAAAACTTGGCTCTCATGTGCTACATCACCGTGGGTACGCCCAGCGAGCCTATCATTGACTTTATGATCCAGCGCAACATGGAAGTTCTAGAAGAGTTTGAGCCTCAGGTCACACCAAATGCTACTAAGGTCTTTGTGAACGGTGTGTGGGTTGGTATTCACAGAGACCCTGCTCATCTGGTCAACACCATGTCTTCCCTCCGACGCCGGAACATGATTTCACACGAAGTCAGTTTGATTCGGGACATTCGTGAGCGGGAGTTCAAAATCTTCACTGACGCCGGTCGTGTTTGCCGGCCACTCTTCGTTGTTGATAATGACCCAAAGAGCGAAAATGTCGGTTCACTGAACCTTAACAAGGAGCATATTAGAAAACTCGAGCAAGACAAGGACT---------TGCCACCGGACCTAGACCCCGAGGAGCGTAGAGAACGCTACTTCGGTTGGGACGGTTTGGTGAGGTCTGGTGTGGTGGAGTACGTCGATGCCGAGGAAGAGGAAACGATTATGATTGTCATGACGCCCGAGGATCTGGAGATCTCCAAGCAGCTTCAGGCTGGTTATGCGCTACCGGAGGAGGAAACCAATGATCCTAACAAGCGTGTTCGCTCTATCCTGAGTCAAAGGGCACACACTTGGACCCATTGCGATAGCCCCTGGGAGACCTCTGAAGATCGCGCTCACGAGCCCGAGGACTGGCGCCGGTTGCTCCAATTCGCCGACTATAAGGGTTCTCGGAACCGATTTACCCGGGAGGCCTTGGTTGGTGGTGTAAACCCTGGTACACGAGTTGATATTCATCTTCGTGCAGTGCCTATCGCGATGCGCAATCAGCCCCAGCCACTGTCGCTCTTCTC-CCTTCTCCGCCACGAGCACAAGAATACTGTCGTCAATGTCAACATGCACTTGAACTCGAGCGTCGAGGCGCCGTTGAAGTCCAAGGAAGAGCTGATTGTCCAATGCGGCTTCCGCCGTATGGTCGTAAAGCCCATATACTCATCCAATGACAACACTCCTAATAACGTGCACAAGTATGATCGCTTCCTGCACCCTGGTCGCAGCGCCATCGCCACATGGGTCGGCCCTCTAACCTGGGGTGCTGTCCCGGTCCTCGTCTACAAGAACAAGACC---------ACCGAAGACCCCGAGGTCCTTGACTCTGCCGACGGAACC------ACCGACAAGTTCGATA------------TTAACCGCCTTGAACTCATCGGCAATGGAACTGTTGTTGCGCCAGACCAAGCCCGTGTGGTTGCGAAACGCGCCATTCAGAAGGCCAAGGTGGGCGTGTTCAGCTGCCCCATCGATATCTCTCAGACCGAGACCAAGGGTACTGTGCTCCTGAAAAACGCGCAGGAAATGCTGGACTTCACAAAGGGTGAGGAGGAGCGTCTGGAGGCTGCCATCAAGGAGCTCTATGACTCCGGCATCCGTGTCGTCGTTGCTGGTTCGTCTGTCGGTGACTTGGCCATGCACTACCTCAACCGATTCAACATTCTCGTCATCAAGATTCTCTCCAAGTTCGAGCTGCGCCGACTCTGCCGTGTTGTTGGTGCTACCCCTCTCGCTCGCCTGGGTGCTCCTATGCCCGACGAGATGGGCAGCATCGATGTCGTGGAGACGACTGAGATTGGTGGTGACCGCGTCACCGTCTTCCGACAGGAGGAAGCCAATGCTGTCACCCGCACTGCCACCATCGTTCTGCGTGGTGCCACCCAAAACCACCTGGAAGATGTTGAGCGGGCCATTGACGATGGCGTCAACGCCGTCAAGGCTATCACAAAAGACCCTCGTCTTGTCCCTGGCGCTGGCGCTACCGAAATCCAGCTGGTGGAGCGAATCTCCGCGTTCGCTGACAGGACCCCGGGACTGCCCCAGTATGCTATTCGCAAGTACGCCGAGGCGTTCGAAGTGATCCCCCGTACCCTGGCTGAATCTGCCGGTCTCGATGCCACCGAGACGCTTTCTCGTCTGTACACAAACCATCTCTGGCGAGCACGGCCTTGATGGCTCTGGTGTGTAAGTTCAATGGCTCCTCCGATCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGTAACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTTGAGCC-CGGTACCATGGACGACAAGGATGGTGATGGCCAGATCACCACCAAGGAGCTGGGAACCGTCATGCGCTCTTTGGGCCAGAACCCCTCCGAGTCGGAGCTTCAGGACATGATCAACGAGGTCGATGCTGACAACAACGGCACCATTGACTTCCCCGAGTTCCTCA Aspergillus_kanagawaensis TTTCCCCCCAGCGAAATGGTCCACTCATGGGTATCGTGCAAGATACTCTGTGCGGTATCTATAAGCTTTGTCGGCGTGATGTTTTCTTGACTAAAGAGCAAGTTATGAACATTATGTTATGGGTTCCTGATTGGGATGGGGTGATTCCCCCGCCAGCCATCTTGAAACCCCGACCTAGATGGACGGGAAAGCAGATGATAAGCATGGCACTCCCCCCAGGTCTTAACTTGTTACGTATCGA---TAAAGATAATTCGCCCCTTTCGGAGAAATTTTCTCCTCTAGCGGATGGCGGTCTCCTCATCCATGGCGGACAGTTGATGTATGGAATGTTCTCCAAGAAGACTGTTGGCGCTAGTGGTGGAGGTGTCATCCACACCATCTTCAATGAGTATGGGCCGGATACTGCCGTGTCTTTCTTCAACGGTGCTCAGGCTATTGTCGGCTACTGGTTGCTACACAACGGTTTTAGTATTGGAATTGGTGATACAATTCCGGACGCGGTTACGATCCAAAGAATCGAGAACTGCGTGCGTGTGAGAAAACAGGAGGTTGAGGCTATAACTGCAAGTGCTACCGAGAACACGCTGGAAGCATTACCCGGTATGAATGTGCGAGAAACCTTTGAAAGTAAGGTCTCGCGTGCTCTGAACAATGCCCGTGATGAAGCCGGTAGTGAGACCGAGAAGAGCTTGAAAGATCTTAACAATGGCATTCAGATGGCTCGCTCTGGTTCCAAGGGCTCAACCATTAACATTTCGCAGATGATGTGTGGAGACAAACCGAGAGATTTACTTGAATATTGGTATTAAGGCCAGTACCTTGACTGGAGGTTTGAAATATGCCCTCGCCACAGGTAATTGGGGAGAACAGAAGAAGGCGGCAAGCGCCAAGGCAGGTGTGTCGCAAGTGCTTTCTCGATACACATATGCCTCCACTTTGTCACATCTTCGTCGTACCAACACGCCAATTGGTCGTGATGGTAAAATTGCCAAGCCTCGTCAACTTCACAACACACATTGGGGTCTGGTCTGTCCAGCAGAAACCCCGGAAGGTCAGGCTTGTGGTCTGGTCAAGAATTTGGCTCTCATGTGTTACATTACTGTCGGTACACCTAGCGAACCCATCATTGACTTCATGATCCAACGGAATATGGAAGTTCTTGAGGAATTCGAGCCTCAGGTGACTCCGAATGCAACAAAGGTCTTTGTCAATGGTGTCTGGGTTGGTATTCACAGAGACCCGACCCATCTTGTCAACACCATGCTTTCTTTGCGTCGTCGGAACATGATCTCCCACGAGGTTAGCTTGATTCGAGACATTCGCGAGCGTGAATTCAAGATCTTTACCGATACCGGGCGTGTCTGTCGGCCGCTGTACGTTATTGACAACGACCCTAAGAGCGAGAATCGTGGATCTTTGGTTCTCAACAAGGAGCACATTCACAAGCTGGAGCAAGATAAAGAAT---------TGCCTGATGATCTGGATCCGGAAGACCGCAGAGAGCGCTACTTCGGATGGGATGGACTCGTGAAGTCAGGTGTTGTTGAATATGTTGATGCCGAGGAGGAGGAAACAATCATGATTGCGATGTCGCCGGAGGATCTGGAGATCTCCAAACAGCTCCAAGCCGGTTATGCCATTCCTGAGGAGGAGCTCAACGATCCTAATAAGCGTGTTCGGTCGATTCTGAGCCAGAAGGCGCATACTTGGACCCACTGTGACAGCCCCTGGGAGACGTCGGAAGATCGCGCACACGAACCGGAAGAATGGCGTCGCCTGCTCCAATTTGTCGACTACAAGGGCTCCAAGAACAGAACTATCAGGGAAGCTCTGATCGGTGGTGTCAAGCCAGGTCTCCGGGTGAATGTCCATCTCCGCGCAGTCCCATCCTTGCTTCGTAGCCGCCCACAGCCATTATCTCTCTTCTC-GCTGCTCCGGCACGAGCACAGACATACCGTCGTCAATGTCAACATGCGTTTGAACTCTGACCTCGAGGATCCCATCAAGTCCAAGGAAGAGCTCGTTATTCAGTGCGGCCCTCGCCGTTTAGTCGTCAAGCCCATCTTCTCCGCGGATGGCAATACCCCCAACAACGTACACAAGTTCGACCGATACCTCCACCCTGGTCGCAGTGCTATTGCTACCTGGATTGGACCTCTGACATGGGGTGCTGTCCCGATCCTTGTTTTCAAGAACAAGA---AA------ACCCAGGACCCCGAAGTCCTTGACTCAGCAGAGG----------------AGGACCAGCTCAAC--------ACTGATAACCTTGAGCTTATCGGAACAGGTACCGTTGTTGCCCCTGATCACTCTCGAGTCATCGCGAAGCGGGCCATTCGCAAGGCTAAGGTCGGCGTTTTCAGCTGTCCTATCGACATCTCTCAGACTGAGACCAAGGGTACTGTGCTCTTGAAAAATGCCCAGGAGATGCTTGACTTCACAAAGGGCGAGGAGGATCGCCTGGAGGCGGCCATCAAGGAGCTTTATGACTCGGGACTTCGTGTTGTGGTTGCTGGCTCCACCGTCAGTGACTTGGCGATGCACTACCTCAACCGATTCAACATTCTTGTTATCAAAATCCTTTCCAAGTTCGAGCTACGTCGACTCTGCCGTGTCGTGGGTGCTACCCCTCTTGCTCGTCTGGGCGCCCCTATGCCTGACGAGATGGGTAGCATTGATATAGTTGAGACTACCGAAATCGGAGGTGACCGTGTCACAGTTTTCCGTCAAGAGGACGCCAACGCCGTAACGCGCACTGCCACTATCGTTCTGCGTGGAGCGACTCAGAACCATCTGGATGATGTTGAGCGTGCCATTGATGATGGTGTTAATGCTGTCAAAGCTATCACTAAAGATCCCCGTCTTGTTCCTGGCGCTGGCGCTACCGAAATCCAGCTTGTCGAGAGAATCTCTGCATTTGCAGACAAGACACCTGGCCTGCCCCAGCATGCTATCCGTAAGTTTGCCGAGGCTTTCGAGGTCATCCCACGGACTCTGGCGGAATCTGCTGGCCTTAACGCCACCGAGGTCCTCTCTCGTCTTTACACAGACCATCTCTGGTGAGCACGGCCTTGATGGCTCTGGCCA----CTACAATGGCACCTCCGACCTCCAGCTCGAGCGTATGAACGTTTACTTCAACGAGGCCAACGATAACAAGTATGTTCCTCGTGCCGTTTTGGTCGATCTCGAGCC-CGGTACCATGGATGACAAGGATGGCGATGGCCAGATCACCACCAAGGAATTGGGCACTGTTATGCGTTCGTTGGGCCAGAACCCTTCGGAGTCGGAGTTGCAGGATATGATTAATGAGGTCGATGCCGACAACAATGGCACCATTGATTTCCCTGAATTCCTTA Aspergillus_leporis TGTCCCCTCAGCGAAACGGACCACTCATGGGTATCGTGCAAGATACTCTCTGCGGTATTTACAAGATATGTCGCCGTGATACCTTCTTAACCAAAGAGCAAGTGATGAACACCATGATGTGGGTACCCGATTGGGACGGTGTTATCCCTCCCCCAGCTATCCTGAAACCCAGGCCCAGATGGACCGGAAAGCAGATGATTAGCATGGCACTTCCCTCAGGCCTCAATCTCTTGCGTGTCGA---TAAGGATAACTCGGCACTTTCTGAGAAGTTTGCCCCTTTGAACGATGGTGGTCTTCTCATCCACGGTGGTCAGTTGATGTATGGAATGTTTTCCAAGAAGACTGTTGGTGCTAGTGGTGGTGGTGTCATTCACACAATCTTTAACGAGTATGGACCAGGCACTGCTGTTGCTTTCTTCAACGGTGCACAGGCCATCGTAGGCTACTGGCTTCTCCACAATGGCTTCAGTATTGGTATTGGTGACACCATTCCAGACGCGCTCACTATACAGAGAATTGAAAATTGTGTTCGGGTTAGGAAGCAGGAGGTTGAGTCTATCACCGCAAGTGCTACTGATAATACTCTGGAGCCGCTGCCCGGTATGAACGTGCGAGAAACCTTTGAAAGTAAGGTTTCGCGTGCTCTCAACAATGCTCGTGATGAAGCTGGTAGCGAGACCGAGAAGAGCTTGAAGGATCTGAACAACGCCATTCAAATGGCTCGCTCTGGATCAAAGGGATCTACCATCAACATCTCCCAGATGATGCGTCGAGACTAACAGAGAAATCTACCTCAACATTGGTATCAAGGCCAGCACACTGACAGGCGGTTTGAAGTATGCTCTTGCTACCGGTAACTGGGGTGAGCAGAAGAAAGCTGCGAGCGCGAAGGCTGGTGTGTCGCAAGTGCTTAGTCGTTATACATACGCTTCTACGTTGTCACATCTTCGTCGAACTAACACACCTATTGGCCGTGATGGTAAAATTGCCAAACCTCGTCAGCTTCACAATACGCACTGGGGTTTGGTCTGTCCAGCAGAAACTCCAGAAGGCCAGGCTTGTGGTCTGGTTAAGAATTTAGCCCTCATGTGTTACATCACTGTCGGTACACCCAGCGAACCTATCATTGACTTCATGATCCAGCGTAACATGGAAGTTCTTGAAGAGTTCGAGCCTCAGGTCACACCCAATGCGACAAAGGTCTTCGTGAATGGCGTGTGGGTAGGTATCCACAGAGATCCCGCACATCTTGTCAACACGATGCTCTCGCTTCGTCGACGGAACATGATTTCCCACGAAGTTAGTTTGATTCGTGATATCCGTGAACGGGAGTTCAAGATTTTCACTGATGCTGGCCGTGTATGTCGGCCATTGTATGTTGTCGACAATGACCCGAAGAGCGAAAACTGCGGCTCGCTGGTTCTCAACAAAGAGCACATCCGCAAGTTGGAGCAAGACAAAGAAT---------TGCCTCCGGATCTCGATCCGGAAGATCGCAGGGAGCGCTATTTTGGATGGGACGGGTTGGTGAAATCGGGAGTTGTGGAGTACGTTGACGCTGAGGAGGAAGAAACGATTATGATTGTCATGACGCCGGAAGACTTGGAGATCTCCAAACAGCTTCAAGCCGGTTACGCTCTTCCTGAAGAAGAGCTA---GACCCGAACAAGCGTGTCCGCTCTATTCTAAGTCAAAAGGCGCATACCTGGACACACTGCGACAGTCCCTGGGAGACAAGAGAAGACCGGCCTCACGAGCCCGAAGGTTGGCGTCGACTGCTTCAGGTCATTGACTACAAGGGTTCCAAGAACAGGGCCGTCAGGGAAGCCCTCATCGGTGGTGTTAACCCTGGTAACCGCGTAGACGTCCATCTGCGTGCAGTATCAACCACTCTTCGCAACAAGCCACAGCCACTGTGCCTCTTCTC-GCTTCTCCGCCATGAGCACAAGCACACCGTTGTCAACGTGAACATGACCTTGAACTCCAGCATTGAGGAGCCCTTGAAGTCCAAGGAAGAGCTCATCATTCAATGCGGACCCCGTCGTATGGTCGTCAACCCTATCTTCTCCTCTAACGGCAACACCCCGAACAACGTACACAAGTTCGACCGGTACCTTCATCCCGGCCGCAGTGCCATTGCAACATGGATTGGCCCCCTTACCTGGGGCGCAGTTCCCGTCCTTGTCTTTAAGAACAAGCCC---------GTGCAAGATCCCGAGGTCCTTGAC---GGAGACA---------------ACCAACCGGATG------------TCGAGCACCTGGACCTGATCGCAACCGGCACTGTCGTGGCGCCGGACCCGAGCCGTGTTGTCTCCAAGCGCGCCATTCGCAAGGCCAAGGTCGGCGTTTTCAGCTGCCCCCTTGACATCTCTCAGACCGAGACCAAGGGCACCGTACTGTTGAAAAGCGCGGATGACATGCTCAACTTCACTAAGGGCGAAGAGGAACGTCTTGAGACCGCCATCAAGGAGCTCTATGACTCAGGTCTTCGTGTCGTTGTTTGCGGCTCCACTGTTGGTGACCTGGCAATGCACTACCTTAACCGTTTCAACATCCTTGTGATCAAGATCCTTTCCAAGTTCGAACTTCGTAGGCTGTGCCGTGTCGTTGGCGCCACTCCTCTCGCCCGTCTTGGAGCTCCTATGCCCGATGAGATGGGTAGCATCGACGTCGTTGAGACTACTGAGATCGGCGGTGACCGTGTGACTATCTTCCGTCAAGAAGATGCCAACGCCGTGACTCGTACAGCTACCATTGTTTTGCGTGGAGCCACCCAAAACCACTTGGATGATGTGGAGCGCGCTATCGATGATGGTGTGAACGCCGTAAAGGCCATTACCAAAGATTCCCGTCTGGTTCCCGGCGCAGGCGCTACTGAAATCCAGCTCGTGGAGAAGGTTTCTGCATTCGCTGATAGGACCCCGGGTCTGCCCCAGTATGCAATTCGCAAATACGCCGAGGCTTTTGAGGTCATCCCCCGTACGCTAGCCGAATCTGCTGGTCTGGATGCCACCGAGGTTCTTTCTCGTCTCTACACAGACCATCTCTGGCGAGCACGGCCTTGATGGCTCCGGTGT----CTACAATGGCTCCTCCGATCTTCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGCTAGCGGAAACAAGTATGTTCCTCGTGCCGTCCTCGTCGATCTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGTTGGGCACTGTGATGCGCTCGCTGGGTCAGAACCCTTCTGAGTCGGAACTCCAGGACATGATCAACGAGGTTGACGCCGATAACAATGGCACCATCGACTTCCCTGAGTTCCTTA Aspergillus_nidulans TGTCTCCTCAACGAAATGGACCCCTTATGGGTATTGTGCAGGATACGCTTTGCGGTATCTACAAGATCTGCCGTCGCGATGTCTTCCTGACCAAAGAGCAAGTGATGAACATCATGATGTGGGTTCCTGACTGGGATGGCGTTATTCCACCACCTGCGATTTTCAAGCCCAGACCCAGGTGGACAGGAAAACAGATGATTAGCATGGTATTCCCGTCGGGTCTCAATCTCATGCGCACTGATTCTAAAGGCGCAGCTCCTTCTTCTGAGAAGTACTCTCCTCTCCAGGATGGGAACGTCCTCATTCATGAAGGCCAGTTGATGTATGGGATGCTCAACAAAAAGATCGTTGGTGCGAGTGGAGGTGGTGTCATCCACATCATCTTCAATGAATATGGGGCAGATGCTGCTGTGGCATTCTTTAATGGCGCGCAGGCCATTGTTAACTACTGGCTGCTACACAACGGTTTCAGTATCGGTATTGGTGATACTATCCCCAACGACCAGACTATTCAAGCCATTGAGGAGTGTGTGCGCAAGCGGAAACTGGAAGTTGAGGAGATTACTGCCACTGCGACTCAGAATAAGCTCGAACCCCTTCCCGGTATGAACGTGCGTGAAACATTTGAGAGTAAGGTCTCTGTCGCTCTCAACACGGCGCGTGATGAAGCTGGTACTGCCACCGAGAAGAGTTTGAAGGATTTGAACAATGCTGTCCAAATGTCGCGATCTGGATCTAAGGGTTCTATCATTAACATCTCGCAAATGGTGTGTGGAGTCCGACCGAGAGATTTACCTTAATGTTGGTCTCAAGGCAAGCACCGTTACTCAAGGTCTGCGCTATGCCCTCGCTACTGGTAACTGGGGAGAGCAGAAGAAGGCAGCTAGCGCCAAGGCGGGTGTGTCGCAAGTGCTCAGTCGCTACACCTACGCTTCAACATTATCTCATCTTCGGCGAACAAACACGCCTATTGGTCGTGACGGCAAGATTGCTAAACCTCGTCAGCTACACAACACGCATTGGGGTCTGGTATGTCCTGCGGAAACCCCTGAAGGCCAAGCTTGCGGTCTGGTCAAGAACTTGGCTCTTATGTGCTACATTACTGTTGGTACTCCTAGCGAACCCATCATCGATTTCATGATTCAGCGTAACATGGAAGTGCTTGAGGAGTTTGAGCCTCAGGTAACACCGAACGCCACTAAGGTCTTTGTCAATGGCGTCTGGGTTGGTGTCCACCGTCAGCCTTCTCACCTTGTTGAGACCATGCAAGCCCTTCGTCGGCGAAACATGATTTCTCACGAAGTCAGTCTTATTCGAGACATCCGTGAACGAGAATTCAAGATCTTCACCGACGCCGGTCGTGTATGCCGGCCACTCTTCGTCGTTGACAACGATCCCAAGAGTGAGAACTGCGGCAACCTAGTCCTCAACAAGGAGCACATTCGCAAGTTGGAAGAAGACAAGGAAC---------TTCCACCGGATATGGACCCAGAAGACCGACGGGAGCGCTACTTTGGATGGGACGGTCTCGTCAAATCCGGTGTCGTTGAGTACGTAGATGCCGAAGAGGAGGAGACGATCATGATCGTTATGACGCCCGAGGACTTGGAGATTTCAAAGCAGCTGCAGGCTGGTTACGCACTTCCGGAAGAGCAA------GATCCAAACAAGCGTGTGCGGTCGATTCTCAGCCAGAGGGCGCACACCTGGACACACTGCGATAGTCCCTGGAACACAGCGGAGGACCGGCCACACGAGCCCGAGGACTGGCGCCGTCTACTTCAATTCGGCGATTACAAGGGGTCCAAGAACAGGATTCTCAGAGAAGCTCTCGTCGGCGGCGTCAACCCAGGCACCCGCGTCGATGTCCACCTCCGCGCAGTCCCTGCCTTGCTCCGCAACAGACCCCAACCCTTATCTCTCTTCTC-TCTTCTCCGCCATGAACACAAGCACACAGTCGTCAACATCAATATGCACCTCAATGCTGCCGTCGAAGAGCCGATCAAATCCAAGCAAGAACTCATAGTCCAGTACGGCCCGCGCCGCTTAATCGTCAACCCTGTTTTCTCCTCCGCAGACAACACCCCCAACAACGTCCACAAGTTCGACCGCTTCCTCCACCCAGGTCGCAGTGCGGTCGCAACCTGGATCGGTCCTCTCACATGGGGCTCTGTTCCTGTTCTCGTCTTCAAATCCCGCAAGACGTCTG------CTGACCCAGAAATCCTCGACTCTGCTGACGCTCCG------GAATCAACAACAGCTGTGGGCTTCTCAACATCTACCCTTGAGCTTATTGGCACGGGCACCGTCGTGGCTCCAGACCCAACTCGTGTCGTCGCCAAACGCGCCATCCACAAGGCCAAGGTTGGAGTCTTCAGCTGCCCCATCGATATCTCCCAGACCGAAACCAAGGGTACGGTCCTGCTCAAGAACGCGCAGGATATGCTTGACTTCACTAAGGGTGAGGAGGAGCGCCTTGAAGCCGCTATTAAAGAGCTCTACGACTCCGGTTTGCGTGTCGTCGTTGCAGGCGCTCAAGTCGGCGACCTGGCCCTCCACTACCTCAACCGCTTCAACATCCTCGTGATCAAGATTCTCTCCAAGTTCGAGCTCCGCCGCCTGTGCCGCGTTGTTGGCGCCACTCCCCTCGCCCGCCTCGGTGCCCCAATGCCTGACGAAATGGGCTCCGTTGACGTTGTCGAAACTACCGAGATTGGAGGCGACCGCGTCACTGTTTTCCGCCAGGAGGACGCTACAGCCGTCACCCGGACCGCAACGATCGTCCTCCGCGGCGCGACCCAGAATCACCTTGACGATGTTGAGCGCGCCATCGACGACGGCGTCAACGCCGTCAAGGCAATCACCAAGGACCCGCGTCTTGTTCCGGGAGCCGGCGCCACGGAGATTCAGCTCGTCGAACGCATCTCTGCCTTCGCAGATAGGACACCCGGTTTGCCCCAGCATGCTATCCGCAAGTACGCCGAGGCGTTCGAGGTCATCCCTCGCACGCTCGCTGAATCCGCCGGTCTCGAAGCTACCGAGGTCCTTTCTCGTCTTTACACAGACCATCTCCGGTGAGCACGGCCTCGATGGCTCCGGTGT----TTACAATGGTACCTCCGACCTTCAACTCGAGCGTATGAACGTCTACTTCAATGAGGCCAGCGGTAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCC-CGGTACTATGGATGACAAGGATGGCGATGGCCAGATTACCACTAAGGAGCTTGGCACTGTCATGCGCTCGCTCGGTCAGAATCCTTCAGAGTCTGAGCTTCAGGACATGATCAACGAAGTTGACGCCGACAACAATGGCACCATTGACTTTCCAGAGTTCCTTA Aspergillus_niger TTTCTCCCCAGCGAAACGGCCCGCTCATGGGTATCGTGCAGGATACGCTCTGCGGTATCTACAAGATTTGCCGGCGTGATGTCTTCTTGACCAAGGATCAAGTGATGAACATCATGATGTGGGTTCCTGATTGGGATGGGGTGATTCCTCCCCCGGCAATTCTGAAGCCTAGACCTCGCTGGACAGGAAAGCAGATGATCAGTATGGCGCTCCCTTCTGGTCTTAATCTTCTGCGTGTTGA---TAAGGATAACTCGCCGCTTTCTGAGAAGTTCTCGCCTCTGGCTGACGGTGGTCTTCTTATCCATAACGGACAACTGATGTATGGTATGTTCTCTAAGAAGACGGTTGGTGCTAGCGGTGGTGGTGTCATCCATACTATCTTCAACGAGTATGGTCATGGTACGGCTGTTGCTTTCTTCAACGGTGCTCAGAGAATTGTCAACTACTGGCTTCTGCATAACGGTTTCAGTATTGGTATCGGTGACACTATCCCCGATGAGCTTACCATTCAGCGGATTGAGAACTGTGTGCGCAACAGGAAGAAGGAGGTCGAGTCGATTACTGCAAGTGCTACTGACAACACTCTCGAGCCTCTACCCGGTATGAACGTCCGTGAGACCTTTGAGAGTAAGGTGTCTCGTGCTCTGAACAACGCTCGTGATGAGGCTGGTAGTGAGACCGAAAAGAGTTTGAAGGATCTGAACAATGCCATTCAGATGGCGCGGTCTGGTTCAAAGGGTTCAACTATCAACATTTCCCAGATGATGCGTGGAGACGAACAGGGAGATTTACTTGAACATTGGTATCAAGGCCAGCACCTTGACAGGAGGTCTGAAGTACGCTCTTGCCACGGGTAACTGGGGAGAGCAGAAGAAGGCAGCCAGCGCCAAGGCTGGTGTATCTCAAGTGCTCAGTCGTTACACCTATGCCTCTACGTTGTCCCACCTTCGTCGTACCAATACACCAATTGGCCGTGACGGTAAGATCGCCAAACCTCGTCAGCTCCACAACACCCATTGGGGTCTTGTCTGTCCAGCTGAAACCCCTGAGGGTCAAGCTTGTGGTCTGGTCAAGAACTTGGCGCTCATGTGCTACATCACTGTTGGTACGCCTAGTGAGCCCATTATTGATTTCATGATTCAACGCAACATGGAAGTGCTTGAAGAGTTTGAGCCGCAGGTGACGCCAAATGCGACTAAGGTGTTTGTCAACGGTGTCTGGGTGGGTATTCATAGAGATCCCGCGCACCTGGTGAACACCATGCTCTCCCTCCGTCGCCGGAACATGATCTCGCACGAGGTCAGTTTGATTCGCGATATTCGTGAGCGAGAGTTCAAGATCTTTACCGATGCTGGACGTGTGTGTCGACCACTGTTCGTCGTCGACAATGATCCCAAGAGCGAGAACTGCGGCTCGCTGGTACTGAATAAGGAACACATCCGCAAACTGGAGCAAGACAAGGATT---------TGCCCCCCGATCTGGATCCAGAAGATCGCAGGGAGCGCTACTTCGGTTGGGATGGTTTGGTGAAGTCTGGTGTCGTCGAGTACGTCGACGCCGAGGAGGAGGAGACGATCATGATCGTGATGACACCGGAGGATCTGGAGATCTCGAAGCAACTTCAGGCCGGTTATGCCCTTCCCGAAGAAGAGCTGCACGATCCCAACAAGCGTGTCCGTTCCATTCTGAGTCAAAAGGCGCACACCTGGACACACTGCGACAGCCCCTGGGAGACGTCAGAAGACCGTGCCTACGAGCCGGAAGACTGGCGCCGCCTGCTCCAATTCGCGGACTACAAGGGATCCAGGAACAAGTTCCTCCGCGAGGCTCTCGTCGGAGGTGTCACCCCTGGTGTGCGCGTTGATGTGCACCTCAAGGCCGTGCCAGCAACCCTCCGCAGCCGGCCTCAGCCCACATCTCTCTTCTC-TCTACTCCGTCATGAGCACAAGCACACCGTTGTCAACATCAACATGCACTTGAACTCCAGCGTCGAGGAGCCCCTGAAGTCGAAGGAGCAGCTCGTCGTCCAGTGCGGTCCTCGCCGTCTGGTCGTCAACCCCATCTTCTCCGCCGGCGACAACACCCCCAACAACGTGCACAAGTTCGACCGCTTCCTCCACCCAGGCCGCAGCGCCGTCGCCTCCTGGATTGGTCCTTTGACCTGGGGCGCCGTGCCTGTCCTCGTCTTCAAGAACAAGTCC---------AACCAGGACCCCGAGATTATGGACTCCGCCGAGGACG---------------------ACTCCCTCAACAACTTCGACAACCTCGAACTCATCGGAAACGGCACCATCGTGGCCCCCGACCAGTCCCGCGTCGTTGCCAAGCGCGCCATGCAGAAGGCCAAGGTCGGTGTCTTCAGCTGCCCCATTGATATCTCTCAGACCGAGACCAAGGGTACTGTGCTCCTGAAGAACGCGCAGGAGATGTTGGACTTCTCGAAGGGCGAGGAGGAGCGTTTGGAAGCGGCCATCAAGGAGCTTTACGATTCCGGCCTTCGTGTCCTTGTTTGCGGTTCCACGATCGGTGATCTCGCCATGCACTACCTGAACCGTTTCAACATCCTTGTTGTCAAGATCTTGTCCAAGTTCGAGCTGCGCCGTCTCTGCCGCGTGGTGGGTGCCACTCCTCTCGCTCGTCTGGGTGCTCCTATGCCCGATGAGATGGGCTCTATCGACATCGTCGAGACCACTGAGATTGGCGGAGACCGTGTCACTGTTTTCCGTCAAGAAGATTCCAATGCTGTTACTCGCACATCTACTATCGTCCTGCGCGGTGCCACCCAGAACCACCTGGATGACGTCGAGCGTGCCATTGACGACGGTGTCAACGCCGTCAAAGCTATCACTAAGGACCCCCGTCTGGTTCCTGGCGCCGGTGCTACCGAGATTCAGCTTGTTGAGAAGATCTCTGCGTTCGCCGATCGCACTCCCGGATTGCCCCAGCACGCTATCCGCAAGTACGCCGAAGCTTTCGAGGTGATCCCTCGTACTCTGGCGGAGTCCGCTGGCTTGGACGCTACTGAGGTTCTCTCTCGTCTCTACACAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGT----TTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGCTAGCGGTAACAAGTATGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTCGGCACTGTGATGCGCTCCCTTGGCCAGAACCCCTCCGAGTCTGAGCTTCAGGACATGATCAACGAGGTTGACGCTGACAACAACGGAACGATCGACTTCCCCGAATTCCTTA Aspergillus_ochraceoroseus TGTCTCCTCAGCGAAACGGACCACTCATGGGTATTGTGCAAGATACTCTTTGTGGCATCTATAAGATTTGTCGACGTGATGTGTTTTTGACCAAGGAACAGGTCATGAACATCATGATGTGGGTTCCCGATTGGGATGGAGTTATTCCTGCCCCTGCTATCCTGAAGCCTCGACCCAGATGGACAGGAAAGCAGATGATCAGCATGGCACTACCATCTGGTCTCAATCTTCTGCGCGTTGA---AAAGGACGGATCTCCTCTTTCAGAGAAGTTCTCTCCTCTGAACGATGGTGGCCTCCTCGTTCATGGCGGACAGCTATTGTACGGAATGTTTTCTAAAAAGACCGTTGGTGCGACCGGAGGCGGTGTTATTCATACCATCTTCAACGAGTACGGACCGTGGACAGCAGTGGCTTTCTTCAATGGTGCTCAAACCATTGTTAACTACTGGTTGCTTCACAATGGGTTCAGTATTGGTATTGGTGACACTATTCCTGACGAGGTCACTATCCAAAGGATTGAGAACTGTGTGCGTGTCAGGAAACAGGAGGTCGAAGCGATCACTGCCAGTGCCACCGAGAACACTCTGGAGCCTCTCCCTGGTATGAATGTTCGAGAAACATTCGAGAGCAAGGTCTCTCGGGCTCTTAACAATGCTCGTGATGAAGCTGGTAGCGAGACTGAGAAGAGCTTAAAAGACTTGAACAATGCCATTCAGATGGCCCGTTCTGGATCCAAGGGTTCAACTATTAATATTTCGCAGATGGTGCGTGGAAACGAACCGGGAGATTTATCTGAACATTGGTATCAAGGCTAGCACCTTGACGGGTGGTTTGAAGTATGCTCTTGCCACCGGTAACTGGGGAGAACAGAAGAAGGCCGCCAGCGCCAAGGCCGGTGTGTCGCAGGTGCTCAGTCGTTACACCTATTCTTCTACGTTGTCGCATCTTCGTCGAACAAATACTCCCATCGGTCGTGATGGAAAGATTGCCAAACCTCGTCAGCTACACAACACCCATTGGGGCCTGGTCTGCCCTGCAGAAACTCCTGAAGGTCAGGCTTGTGGTCTGGTCAAGAACCTAGCTCTTATGTGTTACATCACTGTCGGTACACCGAGCGAACCTATCATCGACTTCATGATCCAACGTAATATGGAAGTCCTCGAGGAATTCGAGCCTCAAGTGACACCTAATGCTACTAAGGTCTTCGTGAATGGTGTCTGGGTGGGTATCCATCGTGACCCGGCGCATCTTGTCAACACCATGCTTTCCTTGCGTCGCCGGAACATGATATCTCACGAAGTCAGTCTTATCCGAGATATTCGTGAACGTGAGTTCAAGATTTTCACCGATGCTGGTCGTGTCTGCCGACCACTCTTCGTCATTGACAATGACCCGAAGAGTGAGAACTGCGGCTCTCTGGTTCTCAACAAGGAGCACATTCGCAAGTTGGAGCAGGACAAAGATT---------TGCCACCCGACCTCGACCCCGAAGAACGCCGGGAGCGCTACTTCGGATGGGATGGGTTAGTCAAATCTGGAGTTGTTGAATACGTGGATGCCGAGGAGGAAGAAACGATCATGATCGTCATGTCACCGGAAGACTTGGATATATCGAAGCAGCTTCAGGCAGGTTATGCGTTACCCGAGGAGGAG---CACGATCCCAACAAACGTGTGCGGTCTATTCTTAGCCAGAAGGCACACACCTGGACACATTGCGATAGCCCTTGGGCAACATCTGAGGATCGACCTCATGAGCCCGAGGAGTGGCGACGACTCCTCCAGTTCGGTGACTACAAGGGAGCGAAGAATAGGATTCTAAGAGAAGCTCTCATCGGAGGCGTTAATCCTGGCACAAGGGTAGAAGTTCGTCTGCGAGCAATCCCCGCTTCCCTCCGAAATCGGCCACAACCTCTGTCCTTGTTCTC-GCTACTCCGACATGAGCACAAGCACACCGTCGTTAACATCAACATGCACCTAAATGCTAACGTGGAAGAACCTCTTAAGTCTAAGGAAGAGCTTATCGTTCAGTACGGCCCCCGCCGTCTCGTCGTGAACCCGGTCTTCTCCGCGGCAGACAACACGCCTAACAACGTGCACAAATACGACCGCTTCCTCCACCCTGGCCGCAGCGCTATGGCTACTTGGATCGGCCCTATGACCTGGGGCTCTGTCCCTGTCCTCGTCTTCAAGAACAAGACG---------GTTGACGACCCAGAGGTCCTCGATTCTGCGGACTCAAA------------TG---CCGCAGAAAACTTCCAGATCAATCGCCTGGAGCTCATTGGAACGGGCACAGTCGTGGCCCCTGATCCATCGCGTGTCGTTGCCAAGCGAGCCATCCACAAGGCCAAGGTCGGTGTCTTCAGCTGCCCCATCGACATCTCCCAAACCGAAACCAAGGGCACCGTGCTCCTCAAGAACGCACAGGAGATGCTCGACTTCACCAAGGGCGAAGAAGATCGTCTCGAATCCACCATCAAGGAACTCTACGACTCCGGTCTCCGCGTTGTCGTCGCCGGCGCTGCCGTCGGTGACCTCGCCCTGCACTACCTCAACCGCTTCAATATCCTTGTGATCAAGATTCTCTCCAAGTACGAGCTTCGGCGACTGTGTCGCGTTGTTGGCGCCACCCCTCTCGCCCGCCTAGGCGCCCCCATGCCCGACGAAATGGGTTCCGTTGACATTGTTGAGACAACTGAGATCGGCGGCGACCGTGTCACCGTCTTCCGCCAGGAAGATTCCACCGCTGTCACCCGCACCTCCACCATCGTCCTCCGCGGCGCCACCCAGAATCATCTCGATGACGTTGAGCGCGCCATTGATGACGGTGTCAACGCTGTCAAGGCCATTACCAAGGACGCGCGTCTCGTGCCCGGCGCTGGAGCTACGGAAGTCCAGCTTGTCGAGCGCATCTCCGCCTTCGCCGACCGAACCCCCGGTCTCCCGCAACATGCTATCCGCAAGTACGCCGAAGCCTTCGAGGTGATCCCTCGCACGCTCGCCGAATCCGCCGGTTTAGATGCCACAGAGGTTCTCTCGCGCCTATACACAGACTATCTCTGGTGAACACGGCCTGGATGGCTCCGGTGT----TTACAATGGCTCCTCTGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGAAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTTGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAACTCGGCACTGTGATGCGCTCGCTTGGCCAGAACCCCTCCGAGTCTGAACTGCAGGACATGATCAACGAGGTTGACGCCGATAACAATGGCACCATCGACTTCCCTGAGTTCCTCA Aspergillus_ochraceus TATCACCACAGCGAAACGGGCCGCTGATGGGTATCGTGCAGGACACACTCTGTGGTATATACAAGATTTGCCGTCGTGATGCGTTTTTGACCAAGGACCAAGTGATGAACATTATGATGTGGGTACCTGACTGGGATGGTGTCATTCCGCCTCCGGCAATCTTGAAGCCCAGGCCCAGATGGACTGGCAAGCAGATGATCAGCATGGCTCTTCCTCCTGGTCTCAACCTTCTGCGTGTTGA---TAAAGACAGCTCGCCTCTTTCAGAGAAGTTTTCACCTCTGAATGATGGTGGAGTCCTGATTCATGGTGGGCAGTTGCTGTATGGAATGCTTTCCAAGAAAACTGTTGGAGCCAGCGGTGGCGGTGTTATCCACACCATTTTCAATGAGTATGGACCAGGCACTGCCGTGTCCTTCTTCAACGGAGCTCAAACCATCGTCAACTACTGGTTGTTACACAATGGTTTCAGTATCGGTATTGGTGATACTATTCCGGACGCGCTCACGATCCAGAGAATTGAAAATTGTGTGCGTGTCAGGAAGCAAGAGGTCGATGAGATCACTGAGAGTGCCACCGCAAATACCCTTGAAGCGTTGCCAGGTATGAACGTGCGAGAAACTTTCGAGAGTAAGGTCTCGCGTGCTCTCAACAACGCCCGTGATGAAGCCGGTAGCGAAACAGAGAAGAGTTTGAAGGATTTGAACAATGCCATTCAAATGGCTCGATCTGGATCAAAGGGTTCAACCATCAATATCTCCCAGATGATGTGTGGAGACCAACCGCGAGATCTATCTGAACATCGGTATCAAGGCCAGTACCTTGACTGGCGGTCTGAAATACGCCCTTGCCACGGGTAACTGGGGTGAGCAGAAGAAGGCGGCCAGCTCGAAGGCCGGCGTGTCTCAGGTGCTGAGTCGCTACACCTACGCCTCCACGCTGTCTCATCTTCGTCGAACCAACACCCCCATTGGACGTGACGGAAAGATTGCCAAACCTCGCCAGCTCCATAACACCCACTGGGGTCTGGTCTGTCCCGCTGAAACCCCTGAAGGTCAGGCTTGTGGTCTGGTCAAGAACCTTGCTCTCATGTGCTACATCACGGTCGGTACGCCCAGCGAGCCGATCATCGACTTCATGATCCAGCGAAACATGGAGGTCCTGGAAGAATTCGAGCCTCAGGTCACCCCCAACGCGACCAAGGTGTTCGTCAACGGTGTCTGGGTCGGTATTCACCGGGATCCGGCGCACTTGGTTCACACGATGCAGGGGTTGCGTCACAAGAACCTGATCTCTCACGAAGTCAGTCTGATCCGGGACATCCGTGAGCGTGAGTTCAAGATCTTCACCGATGCTGGTCGTGTCTGTCGGCCGCTGTTCGTTGTCGACAACGACCCCAACAGTGAGAACGTCGGTTCGCTGGTGCTGAATAAGGACCATATCCGCCGACTGGAACAGGACAAGGAAC---------TGTCTCCGGACCTGGATCCCGAAGAGCGTCGTGAACGCTACTACGGATGGGAAGGTTTGGTGACCAGCGGTGTTGTCGAGTATGTCGATGCGGAGGAAGAAGAGACAATCATGATTGTCATGACGCCGGAGGATCTGGAGTTATCCAAGCACCTTCAGGCCGGTTACGCTCTGCCTGAAGAGGAG---AACGACCCCAACAAGCGGGTGCGCTCCGTCCTGAGTCAGAAGGCGCACACGTGGACACACTGCGAGAGTCTCTGGGAGACGTCAGAAGATCGCCCCCACGAGCCGGAGGACTGGCGCCGACTTCTCCAGATCCAGGACTACAAGGGATCGAAGAACCGAACGATCGCCGAGGCCCTGGTCGGCGGTGTCAACCCCGGTACCCGCGTGGATGTTCACCTGCGCGCTGTTCCCACCTCTCTCCGCAACAAGCCTCAGCCCTTATCTCTCTTCTC-GCTGCTGCGACACGAACACAAGCACACCGTCGTTAATGTCAACATGAACCTGAACACCAGCGTCGAAGAACCCTTGAAGGCCAAGGAGGAGCTGATCGTCCAGTGCGGACCTCGCCGTCTGGTCGTCAACCCCATCTTCTCCTCTAATGACAACACCCCCAACAATGTGCACAAGTTCGATCGCTACCTCCACCCGGGCCGCAGCGCCATCGCCAGCTGGATCGGCCCTCTCACCTGGGGCGCCGTGCCGGTCCTGGTCTTCAAGAACCAGACC---------GTCCAAGACCCGGAGGTCCTCGAC---GCCGCCG------------ACAACCAGCCCGACG------------TCAATCGCCTGGAGCTCATCGGCTCCGGCACCGTCGTCGCCCCCGATCAATCCCGCGTCATCGCGAAGCGAGCCATCCGCAAGGCCAAGGTCGGTGTATTCAGCTGCCCTATCGACATCTCCCAGACCGAGACCAAGGGTACCGTGCTCCTGAAGAACGCCCAGGAGATGCTTGACTTCACGAAGGGTGAGGAGGAGCGTCTGGAGGCCGCCATCAAGGAACTGTACGACTCGGGACTCCGCGTCGTCGTCTGCGGTTCTACCGTTGGCGATCTCGCCATGCACTACCTCAACCGCTTCAACATCCTCGTGATTAAGATCCTCTCCAAGTTCGAGCTCCGCCGACTCTGCCGTGTCGTTGGCGCCACCCCTCTTGCTCGTCTGGGTGCTCCCATGCCCGACGAGATGGGCAACGTCGACGTGGTCGAGACGACCGAGATCGGCGGTGACCGTGTCACCGTCTTCCGCCAGGAGGACCCCGATACCGTGACCCGGACCGCCACCATTGTCTTGCGTGGCGCTACCCAGAACCACCTGGACGACGTTGAGCGTGCCATCGACGACGGTGTCAACGCCGTCAAGGCCATCACCAAGGACCCCCGACTTGTGCCCGGTGCTGGTGCTTCCGAGATCCAGCTTGTGGAGAGAATCTCTGCCTTCGCCGACCGAACCCCTGGTCTGCCTCAGCACGCCATCCGCAAGTACGCCGAGGCTTTCGAAGTGATCCCACGCACTCTCGCCGAATCCGCCGGATTGGACGCCACCGAGGTCCTGTCTCGTCTCTACACAAAACATCTCTGGCGAGCACGGCCTTGACGGCGCCGGTGT----TTACAATGGCTCCTCCGACCTTCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGCTTCCGGTGGCAAGTATGTTCCCCGTGCCGTTCTGGTCGATCTTGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGTTGGGCACTGTTATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCTGAGTTGCAGGACATGATCAACGAGGTTGACGCCGACAACAATGGCACCATTGATTTCCCCGAGTTCCTGA Aspergillus_oryzae TATCCCCTCAGCGAAACGGACCTCTTATGGGTATCGTACAGGATACTCTCTGCGGTATCTACAAGATTTGTCGGCGTGATACATTCTTGACAAAGGAACAAGTTATGAACCTTATGATGTGGGTTCCTGACTGGGACGGCGTGATTCCCCCACCAGCAATCTTGAAGCCTAGGCCCAGATGGACTGGCAAGCAAATTATTAGCATGGCGCTTCCTTCGGGGCTCAATCTTCTCCGTGTGGA---TAAGGACAACTCAGCGCTCTCTGAGAAGTTTGCCCCTCTGAATGATGGTGGTCTTCTCATTCATGGTGGACAGTTGATGTATGGAATGTTTTCCAAGAAGACTGTTGGTGCCAGTGGTGGTGGTGTCATCCACACCATTTTCAATGAATATGGGCCAGGTACTGCTGTGGCCTTTTTCAATGGTGCACAGGCTATTGTTAACTACTGGCTACTTCACAATGGCTTCAGTATTGGTATTGGTGACACTATTCCAGACGCGGTTACTATACAAAGAATTGAGAACTGCGTCCGGGAACGAAAGAAGGAGGTTGAAACTATCACTGCAAGTGCTACGGACAATACCCTGGAGCCGTTGCCGGGTATGAATGTGCGAGAAACCTTTGAAAGTAAGGTTTCACGTGCACTTAACAATGCTCGTGACGAAGCTGGTAGTGAAACTGAGAAGAGCTTAAAGGATCTGAACAACGCCATCCAGATGGCTCGTTCTGGATCAAAGGGATCAACCATCAACATATCCCAGATGATGTGTTGAGACCAACAGAGAGATTTACCTCAATATTGGTATCAAGGCCAGTACACTGACTGGTGGCTTGAAGTACGCCCTTGCTACTGGTAATTGGGGCGAACAGAAGAAGGCCGCAAGTGCTAAGGCTGGCGTGTCGCAAGTGCTCAGTCGTTATACCTACGCTTCTACTTTGTCACATCTTCGCCGAACCAATACGCCTATTGGTCGTGATGGTAAAATTGCTAAACCCCGCCAGCTTCACAATACTCATTGGGGGTTGGTTTGTCCAGCAGAGACTCCTGAAGGTCAGGCCTGTGGTCTGGTCAAGAACTTGGCCCTCATGTGTTATGTCACTGTTGGTACACCCAGCGAACCTATCATTGACTTCATGATTCAGCGTAACATGGAAGTTCTTGAGGAGTTTGAGCCTCAGGTCACTCCCAACGCAACGAAGGTCTTCGTCAATGGAGTGTGGGTCGGTATCCATAGAGATCCCGCCCATCTTGTCAATACGATGCAGTCACTGCGGCGACGAAATATGATCTCCCACGAGGTCAGTTTGATTCGTGATATCCGTGAGCGGGAGTTCAAGATCTTCACCGATGCTGGACGTGTTTGCAGGCCGTTGTTCGTCATTGACAATGACCCGAAGAGCGAAAATTGCGGTGGTTTGGTGTTGAACAAAGAGCACATCCGCAAGTTGGAACAAGACAAAGAAT---------TACCACCCGACCTCGACCCTGAGGATCGTAGAGAACGTTACTTTGGATGGGATGGGTTAGTGAGATCGGGTGTGGTAGAGTATGTTGACGCCGAAGAAGAGGAGACGATCATGATTTCCATGACACCGGAAGACCTGGAAATTTCCAAACAGCTTCAGGCTGGCTACGCCCTTCCTGAAGAAGAGCT---CGATCCCAACAAGCGCGTCCGCTCTATACTGAGCCAGAAGGCACATACTTGGACACACTGTGACAGTCCTTGGGAGACAAGGGAAGACCGACCCCACGAACCAGAGGACTGGCGTCGTCTGCTTCAGATCATTGATTACAAGGGTACCAAGAACAGGACTGTCAGGGAGGCCCTTATCGGTGGTGTTAACCCTGGTATCCGCGTGGACGTACACCTTCGTGCCGTGTCAACGTCTCTTCGCAACAAGCCACAGCCGCTGTGCCTCTTCTC-CCTCCTCCGTCACGAGCACAAGAATACCGTTGTTAACGTGAACATGACTTTGACCTCTAACATTGAAGAGCCGCTGAAGTCCAAGGAAGAGCTCATTGTTCAGTGCGGACCTCGCCGCCTGGTCGTCAACCCTATCTTCTCCTCGAACGACAACACCCCAAACAACGTACACAAATTCGATCGTTTCCTCCACCCTGGCCGCAGTGCCATAGCAACATGGATTGGACCCCTTACCTGGGGCGCCGTCCCTGTTCTTGTTTTCAAGAACAAGACCGTCC---------AAGACCCTGAGGTCATGGACGGAGACGAGCAAC------------------------------CAGATGTCGAACAATTGGAACTCATCGCAACCGGCACAGTCGTGGCACCCGATACGTCCCGCGTTGTCGCCAAGCGCGCAATTACCAAGGCTAAGGTCGGCGTGTTCAGCTGCCCCATCGACATTTCTCAGACCGAAACCAAGGGCACTGTGTTGTTGAAGACCGCGAATGAGATGCTCAACTTCACCAAGGGTGAGGAGGAACGCCTCGAGACGGCCATTAAGGAGCTCTATGACTCCGGTGTTCGCGTCGTTGTGGCCGGTTCCACCGTTGGTGACCTGGCCATGCACTACCTCAACCGCTTCAACATCCTTGTGATCAAAATCCTCTCCAAGTTCGAACTCCGCAGACTTTGCCGTGTCGTCGGCGCCACTCCTCTTGCTCGTCTAGGAGCCCCTATGCCCGACGAGATGGGCAGCGTCGATGTCGTTGAGACCACCGAAATCGGCGGTGATCGTGTGACCGTCTTCCGTCAGGAGGAGGCCAACGCCGTGACTCGCACAGCTACCATTGTTCTGCGTGGAGCGACACAAAACCACTTGGACGATGTCGAGCGTGCCATCGATGATGGTGTGAACGCCGTCAAGGCCATTACCAAGGACCCCCGTCTGGTTCCCGGCGCAGGCGCTACTGAAATCCAGCTCGTAGAGAAGATTTCTGCATTCGCCGATCGGACCCCCGGATTGCCTCAACATGCCATTCGTAAGTACGCTGAGGCTTTCGAGGTCATTCCCCGCACCCTTGCGGAGTCTGCTGGTCTCGATGCCACCGAGGTTCTTTCTCGTCTTTACACAAACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGT----TTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGAAACAAGTATGTCCCTCGTGCCGTCCTCGTTGATCTTGAGCC-TGGTACCATGGACGACAAGGACGGTGATGGCCAGATCACCACCAAGGAGTTGGGCACTGTCATGCGCTCTCTGGGCCAAAACCCCTCTGAGTCGGAACTCCAGGACATGATTAACGAGGTTGACGCCGACAACAATGGCACCATTGACTTCCCTGAGTTCCTGA Aspergillus_penicillioides TGTCTCCCCAGCGCAATGGTCCTCTCATGGGTATTGTGCAAGATACCCTCTGCGGTATCTACAAAATCTGTCGCCGCGACACTTTCCTGACCAAAGACCAAGTGATGAACATCATGCTTTGGGTCCCTGACTGGGATGGAGTTATCCCTCCACCGGCTATCTTGAAGCCTAGACCAAGATGGACAGGAAAGCAGATGATTAGCATGGCGTTGCCCTCGGGTCTCAGCCTTCTGCGCGTGGA---CAAGGATAGCTCCCCGATTTCGGAGAAGTTTTCTCCTCTGAGCGACGGTGGTCTCCTTATCCACAGCGGTCAGCTGATGTATGGGTTGCTCTCCAAGAAGACTGTTGGTGCTAGTGGCGGTGGTGTCATCCATACAATTTTCAACGAGTATGGTCCAGATGCTGCCGTGGCTTTCTTTAACGGAGCGCAGGCCATCGTCAACTACTGGCTGTTGCATAACGGCTTTAGTATCGGTATTGGTGACACCATTCCCGACAGAACCACAATCCAGAGAATTGAAAATTGCGTCCGGAACCGAAAGAAGGAGGTCGAGTCGATCACCGCTAGCGCAACCGACAACACTCTTGAGGCGCTTCCTGGTATGAACGTGCGAGAGACCTTCGAGAGTAAAGTTTCACGTGCTCTTAACAACGCTCGTGATGAAGCCGGTACCGAGACTGAGAAGAGCTTGAAGGATCTCAACCATGCCATCCAGATGGCTCGTTCTGGGTCAAAGGGTTCGACTATTAACATTTCTCAGATGATGCGTGGAGACCAACCGTGAAATTTACTTGAACATTGGTATCAAGGCCAGCACGTTGACCGGTGGCTTGAAATACGCGCTTGCCACGGGTAACTGGGGTGAACAGAAGAAGGCGGCGAGTTCCAAAGCAGGTGTATCGCAAGTGCTCAGTCGATACACCTATGCTTCGACCTTGTCACATCTTCGTCGGACCAACACCCCGATTGGTCGTGATGGAAAGATTGCCAAACCGCGGCAGCTTCACAACACTCACTGGGGTTTGGTGTGTCCTGCAGAAACTCCAGAAGGTCAAGCATGTGGTTTGGTCAAGAACCTGGCACTCATGTGTTACATCACTGTTGGTACACCCAGCGAGCCTATTATCGATTTCATGATTCAGCGCAACATGGAGGTTCTGGAAGAATTCGAGCCTCAAGTGACTCCTAATGCCACCAAGGTGTTTGTCAATGGTGTTTGGGTTGGTATTCACCGGGATCCCGCTCACCTCGTCAACACCATGCTTACACTGCGTCAACGCAACATGATCTCACACGAGGTCAGTTTGATTCGGGATATCCGTGAGCGTGAATTCAAGATCTTCACCGACGCTGGTCGTGTATGTCGGCCGCTGTTTGTCATCGACAATGATCCCAAGAGCGATAACTGCGGCTCACTGGTGCTCAACAAAGACCATATTCGTAACCTGGAGCAGGACAAGGAAC---------TTCCACCTGACCTCGATCCCGAAGAGCGCAGGGAACGCTACTTTGGGTGGGACGGTCTTGTGAAGTCCGGAGTTGTGGAATATGTTGATGCGGAAGAAGAAGAGACGATCATGATTTCTATGACTCCAGAAGATTTAGAAATCTCCAAACAGCTCCAGGCTGGGTATGCGCTTCCGGAAGAAGAA------GATCCTGGTAAGCGTGTGCGGTCGATTCTAAGCCAAAAGGCCCACACCTGGACACACTGCGACAGTACCTGGGAGAACGGCCCAGACCGTGCTCACGAGCCGGAAGACTGGCGTCGTCTACTCCAATTTTCCGACTACAAGGGTTCCAAGAACAAGGCCGTCCGAGAAGCTTTAGCTGGTGGTGTCAGCCCCGGATCACGAGTGGATGTGCACCTCCGCGCAGTCCCATCTTCTTTGCGTAACCGACCCCAACCACTATCGCTCTTCTC-CTTGCTGCGTCACGAACACAAACACACCGTGGTCAACGTCAACATGACCCTGAGCTCCAACGTGGAAGAGCCCCTGAAATCCAAGGAAGAGCTCGTCGTCCAATGCGGCCCTCGCCGCGTGATCGTCAACCCCATCTTCTCCGTCGGCGACAACACCCCCAACAACGTCCACAAATTCGACCGCTACCTGCATCCCGGCCGCAGCGCCATCGCCACCTGGATTGGACCGCTCACCTTCGGCGCCGTCCCCGTCCTCATCTTCAAGAACAAACAAAACCAA---------GACCCCGAGGTCCTCGATACCACAGCCGACGGC------------GAAGTGCAGA------------TCGACAACCTCGAGCTCATCGGTACAGGCACCGTCGCAACACCAGACCAATCCCGCGTCGTTGCCAAGCGTGCCATCAGCAAGGCCAAGGTCGGTGTCTTCAGCTGTCCCATTGATGTCTCCCAGACCGAGACCAAGGGAACTGTGCTCTTGAAGAACGCGGAGGAGATGGTGAACTACAGTAAGGGTGAGGAGGAACGTCTCGAGGCTGCTATTAAGGAGCTGCATGACTCTGGGCTTCGCGTTGTGGTTGCCGGTTCCAGCGTCGGTGACTTGGCTATGCACTACCTCAACCGATTCAACATCCTTGTCGTCAAGATTCTCTCCAAGTTCGAACTGCGTCGCTTGTGCCGTGTCGTCGGTGCCACACCTCTCGCCCGTCTGGGTGCGCCCATGCCTGATGAGATGGGCACTGTTGACGTGGTTGAGACCACTGAAATTGGTGGAGACCGTGTCACTGTTTTCCGCCAGGAGGACGTGAACTCTCCCACTCGCACAGCAACCATCGTCCTCCGTGGTGCAACCCAAAACCACCTCGAGGATGTTGAGCGTGCCATCGACGACGGTGTCAACGTCGTCAAGGCCGTCACCAAAGACCCCCGTCTTGTTCCTGGCGCAGGCGCTACTGAAATCCAGCTCGTGGAGAGAATCTCTGCGTTCGCAGACAAGACCCCGGGGTTGCCCCAGCACGCCATCCGGAAGTTCGCAGAGGCCTTCGAGGTTATCCCGCGCACCCTCGCAGAGTCCGCTGGTCTGGACGCCACAGAAGTCCTCTCTCGTCTCTACACAGACCATCTCTGGTGAGCACGGCCTTGACGGCGCCGGTGT----TTACAATGGCTCCTCCGACCTCCAGCTGGAGCGGATGAACGTCTACTTCAACGAGGCTAGCGGCCAGAAGTACGTTCCCCGTGCCGTCCTGGTTGACCTCGAGCC-CGGTACCATGGATGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGTTGGGTACCGTTATGCGTTCGCTGGGCCAGAACCCCTCCGAGTCTGAGTTGCAGGACATGATTAACGAGGTCGATGCTGATAACAATGGCACAATTGACTTTCCCGAATTCCTTA Aspergillus_pulvinus TGTCTCCTCAACGAAACGGTCCGCTGATGGGTATTGTGCAAGATACTCTCTGCGGTATCTACAAGATCTGTCGACGTGATGTCTTCTTAACCAAGGAACAAGTCATGAACATCATGCTTTGGGTCCCTGACTGGGATGGTGTTATTCCTCCGCCGGCAATCTTGAAGCCTCGGCCAAGGTGGACTGGTAAGCAGATTATCAGTATGGCGCTTCCACCTGGTTTGAATCTCCTACGTGTGGA---TAAGGACGGCTCTCCAATTTCCGAGAAATTCTCACCTCTGAACGATGGTGGCCTTCTTGTTCATGGCGGCCAGTTATTGTACGGAATGTTCTCCAAGAAGACTGTTGGTGCCAGTGGTGGAGGTGTCATCCATACCATTTTCAACGAATATGGTCCCGATACTGCCGTGGCTTTCTTCAATGGCGCACAGGCGATTGTCAACTACTGGCTGTTGCACAATGGTTTCAGTATCGGTATTGGTGATACTATTCCTGATGCTCTCACGATCCAGAGAATTGAAAACTGCGTGCAGAACCGGAAGAAGGAGGTTGAGTCGATTACTGCAAGTGCCACCGACAATACACTTGAGGCGTTGCCTGGTATGAACGTTCGTGAGACTTTCGAGAGTAAAGTTTCCCGTGCCCTTAACAACGCTCGTGATGAGGCTGGTAGCGAGACTGAAAAGAGTTTGAAAGATCTCAACAACGCTATCCAGATGGCTCGTTCTGGTTCCAAGGGATCTACCATCAACATTTCTCAAATGATGTGTCGAGACCAATCGTGAGATTTACTTGAACATTGGTGTCAAGGCCACCACATTGACCGGAGGTCTGAAATACGCTCTTGCTACTGGTAACTGGGGAGAACAGAAGAAGGCAGCCAGCGCCAAGGCTGGTGTCTCTCAAGTGCTCAGTCGGTATACTTATGCGTCTACTTTGTCGCATCTTCGTCGTACCAACACGCCCATTGGTCGTGATGGTAAGATTGCCAAACCTCGACAGCTCCACAACACCCACTGGGGCTTGGTGTGTCCAGCTGAGACACCAGAAGGTCAGGCTTGTGGTCTTGTCAAGAACTTGGCGCTCATGTGCTACATTACGGTCGGTACGCCTAGCGAGCCTATTATCGATTTCATGATCCAGCGTAATATGGAGGTTCTTGAGGAGTTCGAACCTCAAGTGACACCGAACGCCACTAAGGTTTTTGTCAATGGTGTCTGGGTCGGTATTCACAGAGATCCTGCTCACCTTGTTAACACAATGTTCTCGCTGCGTCGACGAAACATGATCTCGCACGAAGTCAGTCTTATTCGGGACATTCGTGAGCGAGAGTTCAAGATTTTTACCGATGCTGGTCGTGTGTGTCGCCCACTGTACGTTGTTGACAATGACCCCAAGAGTGACAATTGCGGATCATTAGTGCTCAACAAGGAACACATTCGCAAGCTAGAGCAGGACAAGGACT---------TGCCTGCCGATCTGGATCCGGAAGATCGCCGCGAGCAGTACTTCGGATGGGATGGTCTCGTCAGATCAGGAGTCGTCGAGTACGTTGATGCAGAGGAAGAGGAGACGATTATGATTGTCATGACACCAGAAGATTTGGAGATTTCCAAACAACTTCAGGCCGGTTACGCCCTACCGGAGGAG------ACCGATCCCAACAAACGTGTTCGATCTATCCTGACTCAAAAGGCCCATACCTGGACACACTGCGACAGCCCGTGGGAGACATCTGAGGATCACGCACACGAGCCAGAGGATTGGCGACGACTTCTCCAGTTCACGGACCACAAAGGCTCCAAGAACAAGTCCATCAGAGAAGCTCTCATCGGTGGTGTTGAGCCAGGACTTCGTGTGGACGTGCACCTTCGTGCTGTCCCAGCATCGCTCCGCAGCCGTCCCCAACCGTTTTCGCTCTTCTC-TCTGCTTCGCCACGAGCACAAGCACACCGTCGTCAACGTTAACATGTACTTGAACTCTGACTACGGAAAGCCCCTCAAGTCTAAGGAGGAGCTCATCATCCAATGTGGTCCCCGTCGCATGATCGTCAACCCGATCTTCTCTGGTGATGGCAACACACCCAACAACGTACACAAATTCGACAGATTCCTGCACCCAGGCCGCAGCGCCATGGCTACCTGGATCGGTCCCCTGACATGGGGCGCCGTACCAGTTCTTGTTTTTAAGAACAAAC---AA------AATCACGATCCGGAAGAGATGGGCGACGATGGCGCC-------------GAAGGTCAACCGGAG--------CTTGACAACCTTGAGCTCATCGGAACAGGTACCGTAGCTGCCCCCGACCAGTCGCGTGTGGTCGCCAAACGAGCCATCCAAAAGGCCAAGGTTGGTGTCTTCAGCTGCCCCATCGACATTTCGCAGACCGAGACCAAGGGAACTGTGCTCCTGAAGAACGCACAGGAGATGCTTGACTTTACCAAGGGCGAGGAAGAGCGCCTCGAGGCCGCCATAAAGGAACTTTACGACTCCGGCGTCCGTGTCGTGGTCGCTGGTGCCAATGTCGGTGATTTGGCTCTCCACTACCTTAACCGCTTCAACATTCTTGTCGTCAAGATTCTCTCCAAGTTCGAACTCCGTCGTCTCTGCCGCGTTGTCGGTGCCACCCCTCTCGCCCGTCTGGGTGCCCCCATGCCCGACGAGATGGGCAGCGTCGATGTGGTTGAGACTACTGAGATTGGTGGCGACCGTGTGACCGTTTTCCGCCAGGAAGACAACAACAATGTGACCCGCACAGCTACCATTGTCTTGCGAGGAGCGACCCAGAACCACTTGGATGACGTTGAGCGTGCCATTGATGACGGTGTCAACGTTGTCAAGGCCATCACCAAGGACCCTCGCCTTGTGCCCGGTGCTGGTGCCGCCGAGATCCAGCTTGTGGAGAGAATCTCCGCATTTGCAGACAAGACCCCCGGTCTGCCCCAGCACGCCATCCGGAAGTTCGCAGAGGCTTTCGAGGTTATCCCCCGTACCCTTGCTGAGTCCGCTGGTCTGGATGCTACAGAAGTCCTTTCTCGTCTTTACACAAACCATCTCTGGCGAGCACGGCCTTGATGGCTCTGGTGT----TTACAATGGCACCTCCGACCTCCAGTTGGAGCGTATGAACGTTTACTTCAACGAGGCCGCCAACAACAAGTATGTTCCTCGTGCCGTCCTGGTCGACTTGGAGCC-CGGTACCATGGACGACAAGGATGGTGATGGTCAAATCACCACTAAGGAGTTGGGCACTGTCATGCGCTCGTTGGGCCAGAACCCCTCCGAGTCTGAATTGCAAGACATGATCAATGAGGTCGACGCCGACAACAATGGCACCATCGATTTCCCTGAATTCTTGA Aspergillus_restrictus TGTCGCCTCAGCGTAACGGTCCTCTGATGGGTATTGTGCAAGACACCCTCTGCGGTATCTACAAGATTTGCCGCAGGGACACTTTCCTGACCAAGGATCAGGTCATGAACCTCATGCTCTGGGTCCCTGACTGGGATGGTGTCATTCCGCCACCGGCTATTCTCAAGCCCAGGCCTAGATGGACTGGTAAGCAGATGATCAGTATGGCGCTACCTTCCGGTCTGAACCTTCTGCGTGTGGA---CAAGGATGGCTCTCCGATGGCAGAGAAGTTCTCTCCTCTGAGCGACGGCGGTCTCCTTGTTCACGGTGGTCAGCTGATGTACGGATTGTTCTCGAAGAAGACTGTTGGTGCTAGCGGTGGTGGTGTCATCCATACCATCTTCAACGAGTATGGCCCAGATGCTGCCGTGGGCTTCTTCAATGGAGCACAGGCCATCGTCAACTATTGGTTGTTGCACAACGGGTTCAGTATTGGTATCGGTGATACGATCCCTGACCCGTTAACCATTCAGAGAATCGAGAACTGTGTCCGTAACCGAAAGAAGGAGGTCGAGACAATCACGGCGAGCGCGACAGAGAACACCCTCGAAGCACTTCCTGGTATGAACGTCCGTGAAACGTTCGAGAGTAAGGTCTCGCGTGCTCTCAACAACGCCCGTGACGAGGCTGGTACCGAGACCGAGAAGAGTCTGAAGGACCACAACCACGCCATTCAGATGGCTCGCTCTGGATCCAAGGGTTCTACCATTAACATCTCCCAGATGTTGTGTTGAGACCAACCGCGAAATCTACTTGAACATTGGTATCAAGGCCAGCACATTGACCGGTGGATTGAAATACGCTCTTGCCACCGGTAACTGGGGTGAACAGAAGAAGGCGGCGAGTGCGAAGGCTGGTGTGTCGCAGGTGCTCAGCAGATACACCTATGCTTCGACCTTGTCCCATCTTCGTCGGACGAACACCCCGATTGGGCGTGACGGAAAGATTGCTAAGCCGCGACAGCTTCACAACACCCACTGGGGTCTGGTGTGTCCAGCAGAAACACCAGAAGGTCAAGCCTGTGGTCTGGTCAAAAACTTGGCGCTCATGTGCTACATTACTGTCGGTACACCAAGCGAGCCCATTATTGATTTCATGATCCAGCGCAATATGGAAGTCCTGGAAGAATTTGAGCCTCAAGTGACGCCAAATGCAACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTATTCACCGTGACCCCTCTCACCTTGTCAACACCATGTCTGCTCTCCGTCGGCGTAACATGATTTCGCATGAAGTCAGTTTGATTCGAGACATCCGTGAGCGGGAGTTCAAGATTTTCACTGATGCTGGTCGTGTTTGCCGGCCACTGTTCGTCATCGACAATGACCCCAACAGCGAGAACTGTGGCTCGCTGGTGCTCAACAAGGAGCATATTCGCAAGCTGGAACAAGACAAGGAGT---------TGCCACCTGATCTCGACCCCGAAGAACGCAGAGAGCGCTACTTCGGTTGGGATGGTCTTGTGAAGTCTGGTGTCGTTGAATATGTCGACGCTGAAGAAGAAGAGACGATCATGATTTCGATGACACCCGAGGATCTGGAGATCTCCAAACAGCTCCAGGCTGGTTATGCCCTCCCAGAGGAAGA------TGATCCAAACAAGCGTGTGCGGTCAATTCTGAGTCAGAAGGCACACACATGGACACACTGCGAGAGCACCTGGGAGACGGGCCCTGACCGAGCCCACGAACCCGAAGATTGGCGTCGTCTGCTCCAATTCGCCGACTACAGGGGCTCCAAGAACAAGGCCATCCGCGAAGCCCTCGCAGGTGGTGTCAACCCCGGTGCCCGAGTCGACGTGCATCTCCGAGCAGTGCCCGCATCGCTCCGCAACTGCCCCCAACCACTCTCCCTGTTCTC-TCTCCTACGCCATGAACACAAGCACACCGTGGTCAACGTCAACATGACCCTAGGCTCCAGCGTGGAGAAGCCGCTGAAGTCCAAGGAGGAGCTCATCATCCAATGCGGCCCGCGTCGTCTTGTCGTCAACCCTATCTTCTCTTCCAGCGACAACACCCCCAACAACGTCCATAAGTTCGACCGTTTCCTGCACCCCGGTCGCAGTGCAACAGCCACCTGGATTGGCCCACTTACCTTTGGCTCTGTGCCTGTGCTCATCTTCAAGAGCCAGGCCTCGCG---------TGACCCAGAGGTCCTCGACGCCGCTGACCACGGA------------TCCCCC---A------------CCGACAACCTCGATCTCATCGGTACCGGCACCGTCGTGTCACCGGACCAGTCACGCGTGGTTGCCAAGCGTGCCATCACCAAGGCCAAGGTTGGCGTTTTCAGCTGCCCCATCGATATCTCGCAGACCGAAACCAAGGGCACGGTGCTCTTGAAGAACGCGGAAGAAATGGTGAACTACAGCAAGGGTGAGGAGGAGCGGCTTGAGGCTGCCATCAAGGAATTGCACGACTCCGGCGTCCGTGTTGTCGTTGCCGGTGCCACTGTTGGTGATCTGGCTCTGCACTACCTCAACCGCTTCAACATTCTCGTGGTCAAGATCCTCTCCAAGTTCGAACTTCGTCGTCTGTGCCGTGTTGTCGGTGCTACACCTCTTGCCCGCCTGGGTGCCCCGATGCCGGATGAGATGGGCTCCATTGACGTGGTCGAGACCACTGAGATCGGTGGGGACCGTGTCACCGTTTTCCGCCAGGAAGACGTGAACTCTCCTACTCGTACCGCGACCATCGTTCTTCGAGGCGCAACACAGAACCACCTGGACGATGTCGAGCGTGCCATTGATGACGGTGTCAACGTCGTCAAGGCAATCACCAAGGACCCTCGTCTTGTTCCCGGTGCTGGCGCTACCGAGATCCAACTCGTGGAGCGTATTTCTGCATTTGCTGACAAGACCCCTGGACTGCCGCAACACGCCATTCGGAAATTCGCTGAAGCGTTCGAGGTTATCCCGCGCACACTTGCAGAGTCGGCCGGTCTGGACGCCACGGAGGTGCTCTCTCGTCTGTACACAAACCATCTCTGGTGAGCACGGTCTCGACGGCTCTGGTCA----CTACAATGGCTCCTCCGACCTGCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGCCAGCAACGACAAGTACGTTCCCCGTGCTGTCCTGGTTGACCTTGAGCC-TGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACTAAGGAGTTGGGCACTGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCGGAGCTGCAGGACATGATTAACGAGGTTGATGCTGACAACAATGGCACAATCGACTTCCCTGAATTCTTGA Aspergillus_robustus TGTCTCCCCAAAGAAACGGACCGTTGATGGGTATTGTACAAGATACTCTTTGCGGAGTTTACAAGCTTTGTCGTCGGGATGTATTCTTGACTAGGGATCAGGTGATGAATCTGATGATGTGGGTGCCTAGTTGGGATGGTGTTATCCCCCCGCCTGCTATCCTGAAGCCCAGGCCTAGATGGACCGGAAAGCAAATGATTAGCATGGCGCTCCCACCTGGTCTCAATCTACTGCGTGTCGA---CAAGGATAACTCACCCCTCTCAGAGAAGTTCTGCCCTCTCAATGACGGCGGCCTCCTTGTCCATGGCGGACAATTGCTCTATGGAATGTTTTCCAAGAAGACTGTTGGTGCAAGTGGCGGAGGTGTCATTCATACTATCTTTAACGAGTATGGAATGGATACTGCCGTTGCTTTCTTCAACGGTTGTCAGACTATTGTGAACTACTGGCTGCTTCACAATGGTTTCAGTATCGGTATCGGTGACACCATCCCGGATGCTCTGACAATTCAGAGAATCGAAAACTGCGTCCGAGTCAGGAAGCAGGAGGTAGAGTCGATCACTGCAAGCGCTACCGAGAACACACTTGAGGCTTTGCCCGGTATGAACGTGCGAGAAACCTTTGAGAGTAAGGTATCGCGTGCGCTCAACAATGCTCGTGATGAAGCTGGTAGCGAAACCGAGAAGAGTCTGAAGGATCTGAACAACGCCATCCAGATGGCGCGTTCCGGATCTAAGGGTTCAACCATTAACATCTCCCAGATGGTGTGTCGAGTCGAACAGAGAGATCTACCTAAACATTGGTATCAAGGCTAGCACCTTGACGGGAGGTCTCAAGTACGCCCTTGCTACGGGTAACTGGGGAGAGCAGAAGAAGGCCGCAAGCTCCAAGGCGGGTGTGTCGCAGGTGCTGAGTCGTTACACTTATGCTTCTACGCTGTCTCATCTTCGTCGAACCAATACCCCCATTGGTCGTGACGGAAAGATTGCTAAACCGCGCCAACTCCACAATACACATTGGGGTCTGGTCTGTCCTGCGGAAACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACCTGGCACTCATGTGTTACATTACCGTTGGTACCCCCAGCGAACCGATCATTGATTTCATGATTCAGCGAAACATGGAGGTCCTCGAAGAATTCGAGCCCCAGGTCACGCCGAATGCGACAAAGGTGTTTGTGAACGGTGTCTGGGTCGGAATCCACAGGAATCCTGCTCACCTGGTCAACACGATGTCTTCCCTGCGTCGACGAAATATGATTTCTCACGAAGTCAGTTTGATTCGGGATATCCGTGAGCGGGAGTTTAAGATCTTCACTGATGCTGGACGTGTCTGTCGGCCGCTCTTCGTCGTTGACAACGACCCCAAGAGTGAAAATTGCGGCTCGCTGGTACTTAGCAAGGAGCACATCCATAGCTTGGAGCAAGACAAGGAAC---------TGTCTCCCGACCTGAAGCCGGAAGAACGCGCGCAAGCCCTGTTTGGATGGGATGGACTTGTGAAGTCGGGAGTTGTTGAATACGTCGATGCGGAAGAAGAGGAGACTATTATGATCGTGATGACACCGGAAGACTTGGAGATTTCCAAGCAGCTCCAGGCCGGGTATGCCCTCCCCGAAGAAGAGATGCATGACCCCAACAAGCGTGTTCGTTCCATTTTGAGCCAGAAAGCTCACACGTGGACGCATTGCGACAGTATTTGGGAGACGTCAGAGGATCGTCCCCATGAGCCCGAGGACTGGCGCCGACTCCTCCAGTTCGGAGATTACAAGGGCTTCAAGAACAGGATGATCCGGGAAGCCCTTGCGGGTGGTGTCAACCCCGGTGTGCGCGTGGACGTCCACCTCCGCGCAGTCCCGGCCTCTCTTCGCAACAAGCCTCAGCCTATGTCTCTGTTCTC-GTTGCTCCGCCACGAACACAAGCACACCGTCGTCAACGTGAACATGAACCTGAACCTCAGCGCCGAGGAGCCCCTCAAGTCCAAGGAAGAGCTCGTTATCCAGTGTGGACCCCGCCGCATGGTCGTCAACCCCATCTTCTCTTCCAACGACAACACCCCCAACAACGTGCACAAGTTCGACCGGTTCCTACACCCCGGCCGCAGCGCCATCGCCTCCTGGATTGGCCCCCAGACATGGGGCGCCGTACCAATCCTCGTGTTCAAGAACCAGCCC---------GTCGAAGATCCCGAAGTCCTTGCC---GACGACAGCACA------GACAACAAGATCGAAC------------TCGACAACCTGCAGCTCATTGGATCCGGCACCGTCGTCGCCCCCGACCACGGCCGTGTGGTCGCCAAGCGCGCCATCCGCAAGGCCAAGGTCGGTGTCTTCAGCTGCCCCATTGATATTTCTCAGACCGAGACCAAGGGTACTGTGCTCCTGAAGAATGCGCAGGAGATGCTTGACTTCACAAAGGGCGAGGAGGAGCGCCTCGAGGCCGCCATCAAGGAGCTGTACGACTCCGGTCTCCGTGTCGTTGTTGCCGGCTCCAACGTCGGTGACCTGGCCATGCACTACCTCAACAGATTCAACATTCTCGTTGTCAAGATTCTGTCCAAGTTCGAGCTCCGCCGACTCTGCCGTGTCGTTGGTGCTACCCCTCTTGCTCGTCTCGGTGCCCCCATGCCCGACGAGATGGGCTCCATCGACGTTGTTGAGACCACTGAGATCGGTGGTGACCGTGTGACTGTTTTCCGTCAAGAAGATGCCGACACCGTGACCCGCACCGCAACCATTGTCCTCCGTGGCGCTACCCAGAACCACCTGGAGGATGTTGAGCGTGCCATCGATGATGGTGTCAACGCCGTCAAGGCCATCACCAAGGACCCCCGTCTTGTTCCTGGCGCAGGTGCCACTGAGATCCAGCTTGTGGAGAGAATCTCTGCTTTCGCTGACAAGACCCCCGGTCTGCCCCAGCACGCCATTCGCAAGTACGCCGAGGCTTTCGAGGTCATCCCCCGTACTCTGGCCGAGTCTGCTGGTCTGGACGCCACCGAAGTTCTGTCTCGTCTCTACACAGACCATCTCCGGTGAACACGGCCTTGACGGCGCTGGTGTGTAATTACAATGGCACCTCCGATCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGCTAGCGGTGGCAAGTATGTTCCCCGTGCTGTCCTCGTCGATCTTGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGTTGGGTACTGTCATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCTGAATTGCAGGACATGATCAACGAAGTTGACGCCGACAACAATGGCACCATTGATTTCCCTGAGTTCCTTA Aspergillus_sparsus TGTCACCGCAGCGAATCGGACCGCTCATGGGTATTGTTCAGGATACTCTTTGCGGAATCTATAAGATTTGTCGACGCGATGTCTTCTTGAATAAGGATCAAGTCATGAATCTGATGATGTGGGTTCCTGATTGGGATGGAGTGATCCCGCCCCCTGCTATTCTGAAACCCCGACCTAGGTGGACTGGAAAACAGATGATCAGCATGGCCCTACCTTCTGGCCTTAATCTTCTACGTGTTGA---GAAAGATGGCTCTCCACTTTCAGAAAAGTTCTCTCCTCTAAATGATGGCGGTCTGCTCATCCATGGTGGACAGTTGATGTACGGAATGTTTTCTAAGAAGACTGTGGGTGCTACCGGTGGAGGTGTTATTCATACCATCTTCAATGAATATGGTCCACCAACCGCAGTTGCTTTCTTCAATGGTGCCCAGACTATTGTGGGCTATTGGTTACTCCACAACGGCTTCAGTATCGGAATTGGCGATACAATTCCTGATGAGGTCACAATTCAAAGGATTGAGAATTGTGTGCGGGTCAGGAAGCAAGAGGTTGAGTCGATCACTGCTAGCGCTACTGAGAATACTCTCGAACCTTTACCTGGTATGAATGTACGAGAAACCTTTGAGAGCAAAGTTTCCCGTGCCCTAAACAACGCCCGTGACGAAGCTGGTAGCGAAACAGAAAAGAGTTTGAAAGATCTCAACAATGCCATTCAAATGGCGCGCTCAGGATCAAAGGGTTCAACCATCAATATTTCACAAATGATGTGTGGAGACAAACAGAGAGATTTATCTCAATATTGGTATCAAGGCAAGCACCTTGACGGGAGGTTTGAAATATGCTCTCGCCACCGGTAACTGGGGAGAGCAAAAGAAGGCGGCCAGTGCCAAAGCAGGTGTGTCGCAGGTGCTTAGTCGCTACACATACGCATCTACATTGTCTCATCTTCGTCGTACCAACACGCCAATCGGACGTGATGGAAAGATCGCCAAACCTCGCCAGCTCCACAATACACATTGGGGCTTGGTTTGTCCCGCAGAAACCCCTGAAGGTCAGGCTTGTGGTTTGGTCAAAAACTTGGCTCTCATGTGTTACATCACTGTTGGAACACCGAGCGAGCCTATCATTGATTTCATGATCCAGCGTAATATGGAAGTTCTCGAGGAATTCGAGCCTCAAGTGACCCCTAATGCCACCAAGGTTTTCGTGAATGGCGTCTGGGTTGGTATCCATCGTGATCCTGCCCACTTGGTTAACACCATGCTCTCTCTACGTCGGCGCAATATGATCTCTCATGAAGTCAGTCTTATCCGAGACATTCGTGAGCGAGAGTTCAAGATTTTCACTGATGCTGGTCGTGTCTGCCGACCACTCTTTGTAATTGATAATGACCCGAAGAGTGAAAACTGTGGCTCTCTAGTGCTCAATAAAGAACACATCCACAAGCTAGAGCAGGATAAAGAAC---------TGCCACCAGATCTAGACCCGGAGGACCGCCGGGAGCGTTACTTTGGATGGGATGGATTGGTGAAGTCTGGTGTTGTTGAGTATGTGGATGCGGAAGAAGAAGAGACCATCATGATTTCAATGACACCTGAAGACTTGGAAATTTCTAAGCAACTACAGGCAGGCTACGCCCTCCCTGAGGACGAGCTTCATGACCCCAATAAGCGCGTTCGGTCTATTCTGAGCCAAAAGGCCCATACTTGGACACACTGCGAAAGTCCGTGGGAAACCTCCGAGGACCGAGCCCATGAGCCCGAGGACTGGCGTCGACTTCTCCAATTCGGTGACTACAAGGGTTCCAAAAACAGGACTATCAGAGAGGCTCTCGTCGGGGGCGTTAACCCTGGAGCTCGAGTTGCTGTTCACCTCCGCGCTGTTCCCTCCTCCCTCCGCAACCGCCCACAGCCTTTGTCTCTATTTTC-ACTCCTCCGACACGAGCACAAAAACACCGTTGTCAATATCAACATGCATCTAAATGTCAATGTTGAAGAGCCCCTGAAGTCCAAAGAGGAGCTCATTGTCCAATACGGACCTCGCCGCCTGGTTGTAAAGCCTATTTTCTCTGCCGGAGACAACACGCCCAATAACGTACACAAGTTCGATCGATTCTTGCATCCTGGCCGCAGTGCCATCGCGACCTGGATTGGACCTATGACCTGGGGCTCCGTTCCCGTACTCGTTTTCAAGAATAAGACA---------ATTGATGATCCTGAAGTTCTTGAATCCGCAGACGCAAA------------CG---CCGCGTCGGACTTCAACATTGACCGTCTCGAACTCATTGGAACCGGCACCGTTGTAGCTCCCGACCCATCTCGCGTTGTCGCCAAGCGCGCCATCCGCAAGGCTAAGGTCGGTGTCTTTAGCTGCCCGATCGACATCTCCCAGACCGAGACCAAGGGTACCGTCCTCCTCAAGAACGCCCAGGAGATGCTAGACTTCACCAAGGGCGAAGAGGAACGCCTCGAGGCCGCCATCAAGGAGCTCTATGACTCAGGTCTACGTGTTGTCGTTGCCGGTTCCACCGTTGGTGACCTAGCCATGCACTACCTCAACCGCTTCAACATTCTCGTCATCAAGATCCTCTCTAAATTCGAACTGCGCCGTCTCTGCCGTGTCGTTGGCGCTACCCCTCTCGCCCGTCTCGGTGCCCCCATGCCCGACGAGATGGGTACAATCGACGTTGTCGAAACCACCGAGATCGGCGGTGACCGAGTGACTGTTTTCCGCCAGGAGGACCCCACCGCTGTCACCCGCACATCGACTATCGTCCTCCGTGGAGCCACCCAAAACCATCTCGACGATATCGAACGTGCCATCGACGACGGTGTCAACGCCGTCAAGGCCATCACCAAGGATCCCCGTCTCGTCCCCGGTGCTGGAGCAACCGAGGTCCAACTTGTCGAACGTATCTCCGCCTTCGCTGACAGGACCCCCGGTCTCCCCCAGTATGCCATTCGCAAGTACGCTGAGGCCTTTGAGGTCATCCCCCGAACCCTAGCCGAATCCGCCGGTTTAGACGCCACTGAGGTCCTCTCCCGTCTCTATACAAACCATCTCCGGCGAGCACGGCCTCGATGGCTCCGGCGT----TTACAATGGCTCCTCCGACCTCCAGTTGGAGCGCATGAACGTCTACTTCAATGAGGCTGGCGGAAACAAGTACGTTCCTCGTGCCGTTTTGGTCGATCTTGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTAGGCACTGTGATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCTGAACTGCAGGATATGATCAACGAAGTTGATGCTGATAACAATGGCACCATTGATTTCCCTGAGTTCCTTA Aspergillus_steynii TGTCACCTCAGCGAAACGGACCGCTGATGGGTATTGTGCAGGACACTCTTTGCGGTATCTATAAGGTTTGCCGTCGTGATGCATTTTTGACGAAGGACCAAGTGATGAACATTATGATGTGGGTGCCTGACTGGGATGGCGTTATTCCGCCCCCGGCAATTTTGAAGCCCAGGCCCAGATGGACTGGCAAGCAAATGATCAGCATGGCTCTTCCTCCGGGTCTCAACCTTCTGCGTGTTGA---TAAGGACAGCTCGCCCCTTTCGGAGAAGTTTTCTCCCCTGAATGATGGTGGTCTCCTGATCCATGGTGGGCAGTTGATGTACGGAATGTTTTCCAAGAAGACTGTTGGAGCCAGCGGTGGTGGTGTCATCCACACCATCTTCAATGAGTATGGACCAAAGACTGCTGTGGCCTTCTTCAACGGAGCTCAGACCATCGTCAACTACTGGTTGTTGCACAACGGTTTCAGTATCGGTATTGGTGACACTATTCCGGATGCCCTCACAATCCAGAGAATCGAAAACTGTGTGCGTGCCCGGAAGCAAGAGGTCGAGTCGATCACTGCAAGTGCCACCGACAATACTCTTGAAGCGTTGCCCGGTATGAACGTGCGAGAAACTTTCGAAAGTAAGGTCTCGCGTGCTCTCAACAACGCCCGTGATGAAGCCGGTAGCGAAACAGAGAAGAGTTTGAAGGATTTGAACAATGCCATCCAAATGGCTCGGTCCGGATCAAAGGGTTCAACCATCAACATTTCTCAGATGATGCGTGGAGACCAACCGGGAAATCTACCTGAACCTGGGCGTCAAGGCCAGCACCCTCACCGGAGGTCTGAAATATGCCCTCGCCACCGGAAACTGGGGCGAGCAGAAGAAGGCTGCCAGCGCAAAGGCGGGTGTGTCTCAGGTGCTGAGTCGTTACACCTACGCCTCCACGCTGTCCCATCTTCGTCGAACCAACACCCCCATCGGACGTGACGGAAAGATCGCCAAACCTCGCCAGCTCCATAACACCCACTGGGGTCTGGTTTGCCCTGCTGAAACTCCAGAAGGTCAGGCTTGTGGTCTGGTCAAGAACCTCGCCCTCATGTGTTACATCACTGTCGGTACGCCCGCCGAGCCGATCATCGATTTCATGGTCGGGCGTAATATGGAAGTCCTGGAAGAATTCGAACCGCAAGCCACCCCCAACGCGACCAAGATCTTCGTCAACGGAGTCTGGGTCGGTATCCACAGAGATCCGTCGCATCTGGTCCACACGATGCAGGTGTTGCGTCACAAGAGCTTGATCTCTCACGAAGTCAGTCTGATCCGGGACATCCGTGAGCGTGAATTCAAGATCTTCACCGATGCCGGACGTGTCTGCCGGCCGCTTTTCGTCGTCGACAATGACCCCAGTAGTGAGAATTGCGGTTCGCTGGTACTAAACAAGGACCACATCCGCCGATTGGAGGAGGATAAAGAACTCGTGAACATGCC------TCTGACTATTGATGAACGTCGTGAAAGGTTCTTCGGATGGGAGGGCTTGGTGGACAGCGGTGTTGTTGAGTATGTCGATGCGGAGGAAGAGGAGGCGATCATGATCGTCATGACGCCGGAGGATCTGGAGATATCCAAGCAGCTTCAGGCCGGTTTCTCTCTGCCCGAAGAGGAGATGAACGACCCCAACAAGCGAGTGCGCTCCATCTTGACCCAGAAGGCGCATACATGGACACACTGCGAGAGTCTCTGGGAGACGTCCGAAGACCGCCCCCACGAGCCCGAAGACTGGCGCCGTCTCCTCCAGATCCAGGACTACAAGGGCTCCAAGAACCGCACCATCGCCGAGGCCCTTGTCGGCGGCGTCAACCCCGGCACCCGCGTGGATGTCCACCTGCGCGCTGTCCCCGCTGCGCTCCGCTCCAAGGCCCAGCCCCTGTCCCTGTTCTC-GCTGCTGCGTCACGAGCACAAGCACACCGTTGTCAACGTCAACATGAACCTGAACACCAGCGTCGAGGAGCCCTTGAAGGCCAAGGAAGAGCTGATCGTCCAGTGCGGCCCGCGTCGGATGGTCGTGAACCCCATCTTCTCCTCCAACGACAACACCCCGAACAACGTGCACAAGTTCGACCGCTACCTGCACCCAGGCCGCAGCGCCATCGCCAGCTGGATCGGCCCTCTCACCTGGGGTGCCGTGCCGGTGCTCGTCTTCAAGAACAAGACC---------GTGCAAGACCCCGAGGTCCTCGAC---GCCTCCG------------ACTCCCAGCCCGACG------------TCACCCGTCTGGAGCTCATCGGCTCCGGCACCGTCGTCGCCCCCGATCAATCCCGCGTCGTCGCCAAGCGCGCCATCACCAAGGCCAAGGTCGGTGTTTTCAGCTGCCCTCTCGACATCTCCCAGACCGAGACCAAGGGTACCGTGCTCCTGAAGAACGCCCAGGAGATGCTCGACTTCACCAAGGGTGAAGAGGAGCGTCTGGAGGCCGCCATTAAGGAACTGTACGACTCGGGACTCCGCGTCGTCGTCTGCGGCTCCACCGTTGGTGATCTCGCCATGCACTACCTCAACCGCTTCAACATTCTCGTGATCAAGATTCTCTCCAAGTTCGAGCTCCGCCGACTCTGCCGTGTCGTCGGTGCCACCCCTCTGGCTCGTCTGGGTGCGCCCATGCCCGACGAGATGGGCAGCATCGACGTGGTCGAGACGACCGAGATCGGCGGTGACCGTGTCACCGTCTTCCGCCAGGAGGCCCCCGATACCGTGACCCGGACCGCCACCATCGTCCTGCGCGGCGCTACCCAGAACCACCTGGATGACGTCGAGCGTGCCATCGACGACGGTGTCAACGCCGTCAAGGCCATCACCAAGGATCCCCGTCTGGTGCCCGGTGCGGGCGCGACCGAGATCCAGCTCGTGGAGAGGATCTCTGCCTTCGCCGACCGAACCCCCGGTCTGCCTCAGCACGCCATCCGCAAGTACGCCGAAGCCTTCGAAGTGATCCCGCGCACACTTGCCGACTCCGCCGGACTGGACGCCACCGAGGTCCTTTCCCGTCTCTACACAAACCATCTCTGGCGAGCACGGCCTTGACGGCGCCGGTGT----TTACAATGGCTCCTCCGACCTTCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGCCACCGGTGGCAAGTATGTTCCCCGTGCCGTTCTCGTCGACCTTGAGCC-CGGTACCATGGACGACAAGGATGGTGATGGCCAGATCACCACCAAGGAGTTGGGCACTGTTATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCCGAGTTGCAGGACATGATCAACGAGGTTGACGCCGACAACAATGGCACCATTGATTTCCCCGAGTTCCTGA Aspergillus_sydowii TTTCTCCTCAGCGAAACGGCCCTCTTATGGGTATCGTGCAGGATACCCTCTGCGGTATCTACAAGATCTGTCGTCGTGACATTTTCCTCAGCAAGGAGCAGGTTATGAACACTATGATGTGGGTGCCTGATTGGGATGGTGTTATCCCCCCGCCTGCAATCTTGAAACCTAGACCTAGATGGACAGGAAAACAGATGATCAGCATGGCGCTTCCGTCTGGACTTAACCTTTTGCGGGTTGA---TAAAGATGGTTCTCCACTTTCTGAAAAGTTCTCTCCTCTTAACGATGGTGGGCTCCTTATCCATAGTGGACAGTTGATGTATGGAATGCTTTCCAAGAAAACTGTCGGTGCGAGTGGTGGTGGTGTCATCCACACTATCTTCAATGAATATGGGCCAGATACTGCCGTTGCTTTCTTCAACGGTGCCCAAGCAATTGTCGGCTACTGGCTACTTCACAACGGGTTCAGTATCGGTATCGGTGACACTATTCCTGACGAGCTCACGATTCAGCGTATTGAGAACTGTGTGCGCGTTCGGAAGCAGGAAGTCGAAGAAATCACCACCAGCGCAACTGACAACACACTTGAAGCCCTTCCTGGTATGAACGTGCGTGAAACCTTTGAGAGTAAGGTCTCCCGTGCGCTTAACAATGCGCGTGATGAAGCTGGTAGCGAGACCGAGAAGAGTTTGAAGGATTTGAACAACGCCATTCAAATGGCCCGTTCTGGTTCGAAGGGCTCAACGATCAACATCTCACAGATGGTGTGTGGAAACCAACCGTGAGATTTACCTCAACATTGGTATCAAGGCCAGCACCTTGAGCGGTGGTTTGAAATATGCGCTCGCTACCGGTAACTGGGGAGAACAGAAGAAGGCAGCCAGCGCCAAGGCTGGTGTGTCGCAAGTGCTCAGTCGCTATACATATGCATCTACATTGTCACATCTTCGGCGAACAAACACGCCCATCGGTCGTGACGGAAAGATTGCCAAACCTCGACAGCTACACAACACTCACTGGGGTCTGGTGTGTCCTGCAGAGACTCCTGAAGGTCAAGCTTGTGGTTTGGTCAAGAACTTGGCGCTCATGTGTTACATCACAGTCGGTACACCCAGCGAGCCTATCATCGATTTCATGATCCAGCGAAACATGGAAGTACTTGAGGAGTTTGAACCTCAAGTAACGCCGAATGCCACCAAGGTCTTTGTGAACGGTGTTTGGGTTGGTGTTCATCGGGATCCTGCTCACCTTGTCAACACCATGCTTTCCCTACGTCGGCGCAACATGATCTCCCACGAAGTTAGTCTTATTCGAGACATTCGTGAGCGAGAGTTCAAGATCTTTACCGATGCTGGTCGTGTCTGTCGACCGCTTTACGTCATTGATAACGATCCCAAGAGTGAAAACTGCGGTAATCTAGTCTTGAACAAGGAGCACATCCGCAAGCTAGAACAAGACAAGGAAC---------TCCCGCCAGACATGGACCCAGAAGACCGTCGGGAGCAATATTTCGGATGGGACGGTTTAGTCAAGTCAGGTGTTGTTGAGTATGTTGATGCCGAAGAAGAAGAAACAATCATGATCGTCATGACACCTGAGGATCTTGAAATTTCGAAGCAACTCCAGGCTGGCTACGCCTTGCCCGAAGAGGAG---CACGATATTAATAAACGTGTGCGGTCGGTTCTCAGCCAAAGGGCCCATACTTGGACGCACTGCGATAGCGCTTGGAACACAACAGAGGACCGACCACATGAACCCGAGGATTGGCGACGACTTCTCCAATTCGGTGACTACAAGGGCTCCAAGAACAAGATTCTAAGAGAGGCCCTAGTCGGCGGTGTGAGCCCAGGCAACCGAGTCGATGTCCACCTTCGTGCAGTCCCCGCCTCGCTCCGCAACAAACCCCAACCCTTATCTCTCTTCTC-CCTCCTTCGCCACGAACATAAGCACACCGTGGTCAACATCAACATGCACCTCAACGCAGCCGTCGAACAACCGCTCAAAGCTAAAGAAGAACTCATCGTGCAATACGGCCCGCGGCGCCTAGTTGTTAAGCCTGTCTTCTCCTCCGCAGACAATACGCCCAACAACGTCCACAAATTCGACCGCTTCCTCCACCCCGGCCGCAGCGCAATCGCCACTTGGATTGGACCACTTACGTGGGGCTCTGTCCCCGTCCTCGTCTTTAAGACTCGAAAGGCTTCAGAGGAAGAAGACCCAGAGGTGCTCGACTCCGCCGACGGACCG------GAACCAACTTCAGCCACAGACTTCTCAACATCCTCCCTTGACCTAATCGGCACGGGCACGGTCGTGGCCCCCGACCCATCACGCGTTGTCGCCAAACGCGCCATCCAGAAGGCGAAGGTCGGTGTATTCAGCTGCCCGATTGACATCTCCCAGACCGAGACCAAGGGCACCGTCCTCCTCAAGAACGCCCAAGACATGCTTGAGTTCACCAAGGGCGAGGAAGAGCGCCTCGAATCTGCCATCAAGGAACTCTACGACTCCGGCCTCCGCGTCGTCGTCGCTGGCGCCCAAGTCGGCGACCTAGCCCTCCACTACCTCAACCGCTTCAACATCTGCGTGGTCAAGATCCTCTCCAAGTTCGAGCTCCGCCGTCTCTGCCGCGTCGTCGGCGCTACGCCCCTCGCTCGCCTTGGCGCTCCCATGCCCGACGAAATGGGTTCTATCGACGTCGTCGAAACCACTGAAATCGGCGGCGACCGTGTCACCGTCTTCCGCCAGGAAGACTCCACCGCCGTCACCCGCACCTCGACCATCGTCCTCCGCGGCGCAACCCAGAACCACCTCGACGACGTCGAGCGTGCCATCGACGACGGCGTCAACGCCGTCAAGGCCATCACCAAGGACCCCCGCCTCGTCCCCGGCGCCGGTGCAACAGAAATCCAGCTCGTCGAGCGCATCTCCGCCTTCGCAGACCGGACACCGGGTCTCCCTCAGCACGCTATCCGCAAATACGCCGAGGCGTTCGAGGTCATCCCACGCACGCTCGCTGAATCCGCCGGTCTCGACGCAACCGAGGTTCTATCCCGTCTCTACACAGACCATCTCCGGTGAGCACGGCCTCGATGGCTCCGGTGT----TTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCC-TGGTACTATGGACGACAAGGATGGCGATGGCCAGATCACTACCAAGGAGCTCGGCACCGTGATGCGCTCGCTCGGCCAGAACCCCTCAGAGTCTGAGCTTCAGGACATGATCAACGAAGTCGACGCTGACAACAACGGCACCATTGATTTCCCAGAGTTCCTCA Aspergillus_terreus TTTCTCCCCAGCGAAACGGCCCGCTCATGGGTATTGTGCAAGATACTCTTTGTGGTATCTACAAGATCTGCCGGCGTGACATCTTCCTGACCAAGGACCAAGTCATGAACATGATGATGTGGGTTCCTGATTGGGATGGTGTTATCCCGCCACCAGCGATCTTGAAGCCTAGACCCAGATGGACTGGAAAGCAGATGATCAGCATGGCTCTGCCTTCAGGACTGAATCTCTTGCGCGTTGA---CAAGGATAACTCTGCCTTGTCGGAGAAGTTCTCACCTTTGAACGATGGTGGTCTCCTTATCCATGGTGGACAGTTGATGTATGGAATGTTTTCCAAGAAGACTGTCGGTGCCAGCGGTGGAGGTGTTATCCATACCATCTTCAACGAGTACGGACCCGGTACTGCGGTGGCATTCTTCAACGGCGCCCAGTCTATCGTGAATTATTGGCTGCTCCATAATGGCTTCAGTATCGGAATTGGTGATACTATTCCAGATGCTCTCACAATCCAGAGAATCGAGAACTGTGTGCGTGTCAGGAAGAAGGAGGTCGAAGCTATCACTGCCAGTGCTACTGAGAATACTCTTGAGCCTTTGCCTGGTATGAATGTTCGAGAGACCTTTGAGAGTAAGGTCTCTCGTGCTTTGAACAACGCTCGTGATGAAGCTGGTAGCGAGACGGAGAAGAGTTTGAAGGATCTTAACAACGCCATCCAGATGGCTCGGTCCGGTTCCAAGGGATCCACCATCAACATCTCACAGATGATGCGTGGAGACGAACAGAGAAATCTACTTGAACATTGGTATCAAGGCTAGCACCTTGACAGGAGGTCTGAAGTATGCTCTGGCTACCGGAAACTGGGGCGAGCAGAAGAAGGCCGCGAGTGCGAAGGCCGGTGTGTCGCAAGTGCTCAGTCGTTATACTTACGCCTCTACCTTGTCTCACCTTCGGCGAACGAATACGCCTATCGGCCGTGATGGCAAGATTGCCAAACCTCGTCAGCTTCACAACACCCACTGGGGTCTGGTGTGTCCGGCAGAGACTCCGGAAGGTCAGGCTTGTGGTCTGGTCAAGAACTTGGCGCTTATGTGCTACATTACTGTCGGTACCCCCAGTGAGCCGATCATCGATTTCATGATCCAGCGTAATATGGAGGTTTTGGAAGAGTTTGAGCCTCAGGTTACGCCGAATGCGACCAAGGTCTTCGTGAACGGTGTCTGGGTTGGTATCCACCGGGATCCTGCTCATCTGGTCAACACTATGTCCTCTCTGCGTCGCCGGAACATGATCTCGCACGAAGTCAGTTTGATCCGGGATATCCGTGAGCGGGAATTTAAAATCTTCACGGACGCTGGACGTGTGTGCCGACCACTTTTCGTTGTCGACAATGACCCGAAGAGTGAAAACTGTGGCTCTCTTGTTCTCAATAAAGAACACATTCGGAAATTGGAGCAAGACAAGGAGC---------TGCCTCCAGACCTGGACCCTGAAGAGCGCAGGGAACGCTACTTCGGATGGGACGGTCTGGTGAAGTCTGGCGTGGTGGAATATGTGGATGCTGAAGAAGAGGAGACCATCATGATTGTGATGACTCCTGAGGACTTGGAGATCTCCAAACAGCTTCAGGCCGGTTATGCGCTACCTGAGGAGGAACTGCACGATCCCAACAAGCGTGTTCGTTCGATCCTTAGTCAAAAGGCGCACACCTGGACTCACTGTGACAGCACCTGGGAGACGGCCGAGGACCGACCCCACGAACCAGAGGACTGGCGCCGCCTGCTCCAGTTCGCCGACTACAAGGGCTCCAAGAACAAGACGATCCGGGAAGCCCTGGTCGGCGGCGTCAGCCCCGGTACACGCGTCGATGTGCACCTCCGCGCGGTGCCTGCCTCTCTCCGCAATCGGCCCCAGCCCCTGTCGCTCTTCTC-GCTCCTCCGCCACGAACACAAGCACACCGTCGTCAACGTGAACATGCATCTGAACTCGAGCGTGGAGGAGCCACTCAAGTCGAAGGAGGAGCTGATCGTCCAGTGCGGCTACCGCCGTCTGGTCGTCAACCCCATCTTCTCCTCCAACGACAACACCCCCAACAACGTGCACAAGTTCGACCGCTTCCTACACCCGGGCCGCAGCGCCATCGCCACTTGGATCGGCCCGCTCACCTGGGGGGCCGTGCCCGTCCTCGTCTTCAAGCAGAAGACG---------GTGGAAGACCCTGAGGCCATGGACGCGGCCGACGAGACG------ACCGGCCCGCCCGACA------------CTGCCCGGCTCGAGCTCATTGGTAACGGCACCGTCGTCGCGCCCGACCAGGCCCGCGTCGTCGCCAAGCGCGCCATCCAGAAAGCCAAGGTGGGAGTTTTCTCCTGCCCCATCGACATCTCCCAGACCGAGACCAAGGGCACCGTGCTGCTGAAGAACGCCCAGGAGATGCTTGACTTCACCAAGGGTGAGGAGGACCGTCTCGAGGCCGCCATCAAGGAGCTCTACGATTCCGGTCTCCGGGTTGTCGTTGCCGGCTCGACCGTTGGCGACCTGGCTATGCACTACCTCAACCGCTTCAATATCCTCGTCATTAAGATCCTGTCCAAGTTCGAGCTGCGCCGACTCTGCCGCGTTGTGGGCGCCACTCCCCTCGCCCGTCTGGGTGCCCCCATGCCCGACGAGATGGGCACCATCGACGTTGTCGAGACCACCGAGATTGGAGGAGACCGCGTGACGGTGTTCCGTCAGGAGGATGACAACACGATCACCCGTACCGCTACGATTGTCCTGCGTGGCGCCACCCAGAACCACCTGGATGACGTTGAGCGAGCAATCGACGACGGCGTCAACGCCGTCAAGGCCATCACCAAGGACCCCCGCCTTGTTCCCGGCGCAGGCGCCACTGAAATCCAGCTGGTGGAGAGAATCTCTGCGTTCGCCGACCGCACCCCCGGATTGCCCCAGCACGCTATCCGCAAGTTCGCCGAGGCGTTTGAGGTCATCCCCCGGACGCTGGCCGAATCGGCCGGTCTGGATGCCACCGAGACGCTGTCTCGTCTGTATACAAACCATCTCTGGCGAGCACGGCCTTGATGGCTCCGGTGT----CTTCAATGGCTCCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGCCAGCGGAAACAAGTATGTTCCTCGTGCCGTCCTCGTTGACCTTGAGCC-CGGTACCATGGACGACAAGGATGGTGATGGCCAGATCACCACCAAGGAGCTGGGAACCGTCATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCGGAGCTCCAGGACATGATCAACGAGGTTGATGCTGACAACAACGGCACCATTGACTTCCCTGAGTTCCTCA Aspergillus_togoensis TGTCTCCCCAGCGAAACGGGCCGCTTATGGGTATCGTGCAGGATACTCTTTGCGGTGTTTACAAGTTCTGTAGACGTGATACTTTCTTGACAAAAGAGCAGGTGATGAACGTTATGATGTGGGTCCCAGATTGGGACGGTGTGATTCCCCCACCAGCGATATTAAAACCAAGGCCCAGATGGACCGGTAAGCAAATGATTAGTATGGCTCTCCCTTCGGGGCTCAATCTCTTGCGTGTGGA---CAAAGATAACTCGGCAATCTCGGAAAAATTCGCCCCTCTAAATGATGGCGGCCTTCTCATTCACGGTGGACAGTTGATGTACGGAATGTTTTCTAAGAAGACTGTTGGTGCCAGCGGTGGTGGTGTTATCCACACCATCTTCAATGAATATGGACCAGGTACTGCTGTGGCTTTCTTCAACGGTGCCCAGGCCATTATCAACTACTGGCTGCTCCACAATGGTTTCAGCATTGGTATTGGTGACACCATTCCAGACGCGCTCACAATACAAAGAATTGAAAACTGCGTTCGGGCACGGAAAAAGGAGGTTGAAAGTATTACTGCAAGCGCTACTGACAATACCTTGGAGCCGCTGCCCGGTATGAACGTGCGAGAGACCTTTGAAAGCAAGGTTTCTCGTGCGCTCAACAACGCTCGTGATGAAGCTGGTAGTGAAACCGAAAAGAGCTTGAAGGATCTGAACAATGCCATCCAAATGGCTCGTTCGGGATCAAAGGGATCAACCATCAACATCTCCCAGATGATGTGTTGAGACCAACAGAGAAATCTACCTCAATATTGGTATCAAGGCCAGCACACTAACTGGCGGCTTGAAGTATGCTCTTGCCACTGGTAATTGGGGTGAACAGAAGAAGGCCGCAAGTGCGAAGGCTGGTGTGTCGCAAGTGCTTAGTCGTTATACCTACGCTTCTACTTTGTCACATCTTCGCCGCACCAACACGCCTATTGGCCGTGACGGTAAAATTGCTAAGCCTCGCCAGCTTCATAATACCCATTGGGGTTTGGTTTGTCCCGCAGAAACTCCGGAAGGTCAAGCTTGTGGCTTAGTCAAGAATTTAGCCCTCATGTGCTACATCACTGTTGGTACACCGAGTGAGCCTATCATTGACTTCATGATTCAGCGTAACATGGAAGTCCTTGAAGAGTTCGAGCCTCAGGTTACACCTAACGCAACAAAGGTCTTCGTGAATGGTGTGTGGGTTGGTATCCACCGAGATCCTGCTCATCTTGTTAACACGATGCTGTCGCTGCGGCGTCGAAATATGATCTCTCACGAAGTCAGCTTGATTCGTGATATCCGTGAGCGGGAGTTCAAGATCTTTACAGATGCCGGACGTGTTTGTAGGCCATTGTTCGTTATTGACAACGACCCGAAGAGTGAAAACTGCGGCGGATTGGTCTTGAACAAGGAGCACATCCGCAAGTTGGAACAGGACAAAGAAT---------TACCTCCAGATCTTGATCCTGAAGAACGCAGAGAACGCTACTTCGGATGGGATGGATTGGTGAAGTCGGGTGTTGTGGAGTACGTTGATGCCGAAGAGGAAGAGACTATCATGATTGTAATGACACCAGAAGACTTGGATATTTCCAAACAGCTTCAGGCTGGTTATGCCCTTCCTGAAGAAGAGCTCCACGATCCTAACAAGCGTGTCCGCTCCATTCTGAGCCAGAAGGCGCATACTTGGACGCACTGCGACAGTCCCTGGGAGACGAAGGAGGACCGGCCTCACGAGCCAGAGGATTGGCGTCGACTGCTTCAGATCATCGATTACAAGGGCTCCAAGAACAGGACCGTCCGAGAAGCGCTTATCGGCGGTGTCAACCCTGGTATTCGCGTGGATGTCCATCTTCGCGCCGTGTCGGCTCTTCTCAGCAAGAAGCCCCAGCCGCTGTGCCTCTTCTC-CCTGCTCCGTCACGAACACAAGCACACCGTCGTCAACGTCAACATGACCCTGAACACGAGCATCGAGGAGCCCCTGAAGGCCAAGGAAGAACTCATCGTGCAATGCGGACCCCGCCGTCTGGTCGTCAACCCCATCTTCTCCTCGAACGGCAACACCCCGAATAACGTGCACAAGTTCGACCGCTTCCTGCACCCCGGCCGCAGCGCCATTGCCACCTGGATCGGTCCCCTTACCTGGGGCGCCGTCCCCGTCCTCGTCTTCAAGAGCAAGTCC---------GTCCAAGACCCCGAGGTCCTGGAC---GGAGACA---------------ACCAGCCCGATG------------TCGAGCAGCTGCAGCTCATCGCCACCGGCACCGTCGTGGCCCCCGACGCGTCCCGCGTGGTCGCCAAGCGAGCAATCACCAAGGCCAAGGTCGGCGTCTTCAGCTGCCCTATTGACATCTCTCAAACCGAAACCAAGGGCACCGTCCTGCTGAAGAGTGCGGATGAGATGCTCAACTTCACCAAGGGCGAGGAGGAACGCCTGGAGACCGCCATTAAGGAGCTCTATGACTCGGGTATTCGTGTCGTTGTTGCCGGTTCCACCATCGGTGACCTGGCAATGCATTACCTCAACCGCTTCAATATCCTTGTGATTAAGATTCTCTCCAAGTTCGAACTTCGCAGACTCTGCCGTGTCGTTGGCGCTACCCCTCTTGCCCGTCTGGGTGCCCCCATGCCCGACGAAATGGGTAGCATCGACGTCGTTGAGACTACCGAAATTGGCGGAGACCGTGTGACCGTCTTCCGTCAAGAGGAAGCTAACGCCGTAACTCGCACGGCCACCATCGTTTTACGTGGAGCGACGCAAAATCACTTGGATGACGTCGAGCGTGCCATCGATGATGGTGTGAACGCGGTTAAGGCCATCACCAAGGATCCCCGTCTGGTTCCCGGCGCAGGCGCTACCGAAATCCAGCTCGTGGAGAAGATTTCTGCATTCGCCGATCGGACCCCAGGCCTGCCCCAGCATGCCATCCGCAAGTACGCCGAGGCCTTCGAGGTCATTCCCCGTACCCTAGCGGAGTCTGCGGGCTTGGATGCCACCGAGGTTCTTTCTCGTCTTTACACAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGT----TTACAATGGCTCCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAAGCTAGCGGAAACAAGTATGTCCCTCGTGCCGTCCTCGTCGATCTTGAGCC-CGGTACCATGGACGATAAGGATGGTGATGGTCAGATCACCACTAAGGAGTTGGGCACCGTGATGCGCTCGCTGGGTCAGAACCCTTCGGAGTCAGAACTCCAGGACATGATTAACGAGGTCGACGCCGATAACAATGGCACCATCGACTTCCCTGAGTTCCTTA Aspergillus_versicolor TTTCTCCTCAGCGAAACGGCCCTCTTATGGGTATTGTGCAGGATACTCTCTGCGGTATCTACAAGATTTGCCGTCGTGACATTTTCCTCAGCAAGGAGCAGGTTATGAACACTATGATGTGGGTACCTGATTGGGATGGTGTTATTCCCCCGCCTGCGATCTTGAAGCCTAGACCCAGGTGGACAGGAAAACAGATGATCAGCATGGCGCTTCCATCTGGCCTTAACCTTCTGCGAGTTGA---TAAAGATGGTTCTCCACTTGCTGAGAAGTTCTCTCCTCTTAACGATGGTGGGCTCCTTATTCATAGTGGACAGTTGATGTATGGAATGCTTTCCAAGAAGACAGTCGGTGCGAGCGGTGGTGGTGTCATCCACACTATCTTCAATGAATATGGGTCAGATACTGCTGTCGCTTTCTTCAATGGTGCTCAAGCAATTGTCGGCTACTGGTTACTTCACAACGGGTTTAGCATTGGAATCGGTGACACTATTCCCGACGAGCTCACGATTCAGCGCATTGAGAACTGCGTGCGCGTTCGGAAGCAGGAAGTCGAGCAAATCACCACCAGCGCCACCGACAACACCCTCGAAGCCCTTCCTGGTATGAACGTGCGTGAAACATTTGAGAGTAAGGTCTCTCGTGCGCTTAACAATGCTCGTGATGAAGCTGGTAGCGAGACCGAGAAGAGTTTGAAGGATTTGAACAACGCCATTCAAATGGCTCGTTCCGGTTCGAAGGGTTCAACCATCAACATCTCACAGATGGTGTGTGGAAACCAACCGTGAGATTTACCTCAACATTGGTATCAAGGCCAGCACCTTGAGCGGTGGTTTGAAGTACGCTCTCGCTACTGGTAACTGGGGAGAACAGAAGAAAGCAGCCAGCGCCAAGGCTGGTGTGTCGCAAGTGCTCAGTCGCTACACCTATGCATCTACATTGTCACATCTTCGGCGAACAAACACGCCCATCGGTCGTGACGGAAAGATTGCCAAACCTCGACAACTACACAACACTCACTGGGGTCTGGTGTGTCCTGCAGAGACTCCTGAAGGTCAAGCTTGTGGTTTGGTCAAGAACTTGGCGCTCATGTGCTATATCACAGTCGGTACACCCAGCGAGCCTATCATTGATTTCATGATCCAGCGAAACATGGAAGTTCTTGAGGAGTTTGAACCTCAAGTGACGCCGAACGCTACCAAGGTCTTTGTGAACGGTGTCTGGGTTGGTGTTCATCGGGATCCTGCTCACCTTGTCAACACCATGCTTTCCCTACGCCGGCGGAACATGATCTCCCACGAAGTCAGTCTTATTCGAGACATTCGTGAGCGAGAGTTCAAGATCTTTACAGATGCGGGTCGTGTCTGTCGGCCACTTTACGTCATTGACAACGACCCCAAGAGTGAAAACTGCGGTAATCTAGTCCTGAACAAGGAGCACATTCGCAAGCTAGAGCAAGACAAGGATC---------TCCCACCGGACATGGACCCAGAGGACCGCCGGGAGCAATACTTCGGCTGGGACGGTTTAGTCAAGTCCGGTGTTGTTGAGTATGTGGACGCCGAAGAAGAGGAGACAATCATGATAGTCATGACACCAGAGGATCTAGAAATCTCGAAGCAAATCCAGGCAGGATACGCCTTACCCGAAGAGGAG---CACGATATTAATAAACGTGTGCGCTCGATTCTCAGCCAAAGGGCGCATACATGGACGCACTGCGATAGCGCTTGGAACACAACAGAGGACCGACCCCACGAACCCGAGGATTGGCGACGACTTCTCCAATTCGGTGACTATAAGGGCTCCAAGAACAGGATTCTAAGAGAGGCCCTTGTCGGCGGTGTTAGCCCTGGCAACCGAGTTGATGTCCACCTTCGTGCAGTCCCTGCCTCGCTCCGCAACAAACCCCAACCCTTATCTCTCTTCTC-TCTCCTTCGCCACGAACACAAGCACACCGTGGTCAACATCAACATGCACCTCAACGCTGCCGCCGAACAACCGCTCAAAGCCAAAGAAGAGCTCATCGTGCAATACGGCCCGCGACGCCTAATCGTTAAGCCCGTCTTCTCCTCCGCAGACAATACGCCCAACAACGTCCACAAATACGATCGCTTCCTCCACCCCGGCCGCAGCGCTATTGCCACTTGGATTGGGCCACTCACATGGGGCTCTGTCCCCGTCCTCGTCTTCAAGACTCGAAAGGCTTCAGAGGAGGAAGACCCAGAGATGCTCGACTCCGCTGACGGACCG------GAACCAACATCGGCCACAGACTTCACAACATCCACACTTGACCTAATCGGCACGGGCACGGTCGTGGCACCTGACCCATCACGCGTTGTCGCCAAGCGCGCCATCCAGAAGGCCAAGGTCGGTGTATTCAGCTGCCCGATCGACATCTCCCAGACCGAGACCAAGGGCACCGTCCTCCTCAAGAACGCCCAAGACATGCTTGATTTCACCAAGGGTGAGGAAGAGCGCCTCGAAGCTGCCATCAAAGAGCTCTACGACTCCGGCCTCCGCGTCGTCGTCGCTGGCGCCCAAGTCGGCGACCTAGCCCTCCACTACCTCAACCGCTTCAATATCTGCGTAGTCAAGATCCTCTCCAAGTTCGAGCTCCGCCGTCTCTGCCGCGTCGTCGGCGCCACGCCCCTCGCTCGCCTCGGTGCCCCCATGCCCGACGAAATGGGCTCTATCGACGTCGTCGAAACTACCGAAATCGGCGGCGACCGTGTCACCGTCTTCCGCCAGGAAGACTCCACTGCTGTCACCCGCACCTCGACCATCGTCCTCCGCGGCGCAACCCAGAACCACCTCGATGACGTCGAGCGCGCCATCGACGACGGTGTCAACGCCGTCAAGGCCATCACCAAGGACCCCCGCCTCGTCCCCGGCGCCGGCGCAACAGAAATCCAGCTCGTCGAGCGCATCTCCGCCTTCGCTGACCGGACACCGGGTCTCCCCCAGCACGCTATCCGCAAGTACGCCGAGGCATTCGAGGTCATCCCACGCACGCTCGCTGAGTCCGCCGGTCTCGACGCAACCGAGGTTCTATCCCGTCTCTACACAGACCATCTCCGGCGAGCACGGCCTTGATGGCTCCGGTGT----TTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGCAACAAGTACGTTCCCCGTGCCGTTCTCGTCGATCTCGAGCC-CGGTACTATGGACGACAAGGATGGCGATGGCCAGATCACTACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAAAACCCCTCGGAGTCTGAGCTTCAGGACATGATCAACGAAGTCGATGCTGACAACAACGGCACTATTGATTTCCCGGAGTTCCTCA Aspergillus_wentii TTTCGCCTCAACGAAATGGTCCACTCATGGGTATTGTGCAAGACACTCTTTGCGGTATCTATAAGCTTTGCCGGCGTGATGTTTTCCTTAGCAAGGACCAAGTCATGAACCTCATGCTCTGGGTCCCTGATTGGGATGGTGTTATTCCCCCGCCAGCTATTCTGAAGCCTAGGCCGAGATGGACTGGCAAGCAAATCATCAGTATGGTTCTGCCTACTGGTCTCAATCTCCTCCGTGTCGA---CAAGGATGGCGCACCTATCTCGGAGAAATTCTCTCCCATCGCCGATGGCGGTGTGCTCATTCACGGCGGACAGTTGATGTATGGAATGCTCTCTAAGAAGACTGTTGGTGCCAGTGGTGGTGGTGTGATTCATACTATTTTCAATGAGTATGGACCGCTCACTGCCATGGCCTTCTTCAATGGTGCACAGACCATTGTCAACTACTGGCTTCTACACAACGGTTTCAGTATTGGTATTGGTGACACCATCCCCGATGCTTACACCATCCAGCGAATCGAGAACTGTGTCCGCAACCGAAAGAAGGAGGTCGAGTCTATCACTGCTAGCGCAACTGATAACACGCTCGAGGCGCTTCCTGGTATGAACGTGCGAGAAACATTTGAGAGCAAGGTCTCTCGTGCTCTTAACAACGCCCGTGATGAAGCCGGAAGCGAGACCGAAAAGAGTTTGAAAGATCTCAACAATGCCATTCAAATGGCTCGCTCTGGTTCTAAGGGTTCTACCATCAACATTTCTCAAATGATGTGTTGAAACCAACAGAGAAATCTACTTGAACATTGGTATCAAGGCAAGCACATTGACCGGAGGTTTGAAATATGCTCTTGCTACCGGTAACTGGGGAGAACAGAAGAAGGCAGCTAGTGCCAAGGCTGGTGTGTCCCAAGTGCTCAGTCGTTACACCTACGCTTCTACATTATCACATCTTCGGCGAACCAACACGCCCATTGGACGTGACGGTAAAATCGCGAAGCCTCGTCAACTTCACAACACCCACTGGGGATTGGTTTGCCCAGCCGAAACTCCAGAAGGTCAAGCTTGTGGTCTCGTCAAGAATTTGGCGCTCATGTGTTACATCACCGTTGGTACACCTAGCGAGCCTATTATCGACTTCATGATCCAGCGTAACATGGAAGTCCTTGAGGAATTCGAGCCTCAAGTCACGCCAAATGCCACCAAGGTTTTCGTGAACGGTGTCTGGGTTGGAATCCACAGAGACCCTGCTCATCTTGTCAACACAATGTCCTCTCTGCGCCGCCGGAACATGATCTCACACGAAGTCAGTTTGATTCGGGATATCCGTGAGCGTGAGTTCAAGATCTTCACCGACGCTGGTCGTGTCTGTCGACCACTATATGTTGTCGACAATGACCCGAAGAGCGAAAATTGCGGATCGCTGGTGCTCAACAAGGAGCACATCCGCAAGCTAGAACAAGACAAGGATC---------TGCCCGCGGACATGGATCCGGAAGATCGCAGAGAGCAATACTTCGGATGGGACGGTCTCGTGAAGTCTGGAGTTGTGGAGTATGTCGACGCGGAGGAAGAAGAAACAATTATGATTGTGATGACACCGGAAGATCTCGAAATCTCCAAACAGCTTCAGGCCGGCTATGCACTGCCGGAGGAAGAGATGAACGACCCCAACAAGCGTGTCCGGTCAATCCTTACCCAGAAGGCACACACCTGGACGCACTGCGACAGCACCTGGGAGACATCGGAAGATCGCCCCCACGAACCGGAAGATTGGCGCCGACTGCTCCAATTCTCCGATTACAAGGGTTCCAAGAACAGAACCATCAACGAAGCTCTCGTTGGCGGTGTCACTCCCGGAACCCGTGTGAACGTTCACCTCCGCGCGGTGCCATCTGCCCTCCGCAACCGTCCCCAGCCCGCGTCGCTCTTCTC-CCTGCTTCGCCATGAACACAAGCACACCGTGGTCAACGTCAACATGGTGTTGAACTCCGACATCGAGGAGCCCCTCAAGGCCAAGGAAGAGCTCGTTGTCCAATGCGGACCACGCCGCCTGATTGTCAACCCCATCTTCTCCGACGGAGGCAACACCCCCAACAACGTGCACAAATACGACCGATACCTGCACCCCGGCCGCAGCGCCATCGCAAGCTGGATCGGCCCTCTCACATGGGGCGCCGTCCCGGTCCTTGTTTTCAAGAACATGC---CC------ACCAAGGACCCCGAAGTGCTCGCAGACGACGACG----------------AGAACCAACCACAG--------ACCGACAACCTCGAGCTCATTGGAACAGGCACCGTCGTTGCCCCCGACCAGGCGCGTGTCGTTGCCAAGCGTGCCATCAGCAAGGCCAAGGTCGGTGTCTTCAGCTGCCCCATCGATACCTCCCAGACCGAGACCAAGGGAACAGTCCTGTTGAAGAACGCCGATGAGATGCTTAACTTCACCAAGGGTGAGGAGGAGCGCCTTGAGGCCGCCATTAAGGAGCTCTACGATTCTGGAATCCGCGTCGTTGTTGCTGGTGCCACCGTCGGTGACCTGGCCATGCATTACCTCAACCGTTTTAACATCCTCGTCGTCAAGATTCTCTCCAAGTTCGAGCTCCGCCGACTCTGCCGTGTCGTTGGTGCCACCCCTCTCGCACGCCTGGGTGCCCCCATGCCCGACGAGATGGGTAGCGTTGACGTTGTCGAGACTACTGAGATTGGTGGTGACCGTGTTACCGTTTTCCGCCAGGAGGACAACAACACCGTGACGCGCACGGCCACTATTGTCCTGCGCGGAGCGACCCAGAACCACTTGGATGACGTTGAGCGTGCCATTGACGATGGAGTCAACGTTGTCAAGGCTGTTACCAAGGACCCCCGTCTTGTTCCCGGTGCTGGCGCTACTGAGATCCAGCTTGTTGAGAGAATCTCTGCTTTCGCAGACAAGACCCCTGGTCTGCCCCAACATGCCATTCGCAAGTACGCAGAGGCTTTCGAGGTCATCCCGCGCACTCTCGCCGAGTCCGCTGGTCTGGATGCCACCGAAGTTCTTTCTCGCCTTTACACAAACCATCTCTGGTGAGCACGGCCTTGACGGTGCTGGTGT----TTACAATGGCACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACGAGGCTAGCGGACACAAGTATGTTCCCCGTGCCGTTCTGGTCGACCTTGAGCC-CGGTACCATGGACGACAAGGATGGTGATGGACAAATCACCACCAAGGAGTTGGGCACCGTCATGCGCTCGCTCGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAACAATGGCACCATTGATTTCCCTGAATTCTTGA Aspergillus_zonatus TCTCTCCCCAGCGAAACGGTCCTCTGATGGGTATTGTCCAGGATACTCTCTGTGGTATCTACAAAATCTGTCGTCGTGATGTTTTCCTCTCCAAGGAGCAGGTGATGAATCTCCTGCTTTGGGTTCCTGATTGGGACGGTGTCATCCCTGCTCCCGCCATCTTGAAGCCCCGTCCCCGCTGGACCGGGAAACAATTGATCAGCATGGCCCTGCCATCTGGCTTGAACTTGTTGCGTGTCGA---AAAAGACAACTCTCCTCTCTCCGAGAAATTCGCTCCTCTCAATGATGGCGGTCTTCTTGTCCACGGAGGTCAGCTTATGTATGGCATGTTTTCCAAGAAAACCGTTGGTGCCACCGGCGGCGGTGTCATCCACACTATCTTCAACGAGTATGGACCTAGCACTGCCGTCTCTTTCTTCAACGGTGCCCAGACAATCGTCAACTACTGGCTGTTGCACCACGGTTTCAGTATTGGTATTGGTGACACCATCCCCGATGCTGTCACCATCCAAAAGATCGAGGAAGCCGTCAAGGCTCGCAAGCAGGAGGTTGAGTCGATCACGCTGAGCGCAACTGAAAACACCTTAGAAGCGCTGCCGGGTATGAATGTCCGTGAGACCTTTGAGAGTAAGGTGTCTCGTGCTCTCAACAATGCCCGTGATGAGGCTGGTAGCGCGACCGAGAAAAGTTTGAAGGATCTGAATAACGCCATCCAGATGGCTCGCTCGGGTTCGAAGGGTTCAACCATCAACATTTCCCAGATGTTGCGTGGAGACCAACCGCGAGATCTACTTGAACATCGGTATCAAGGCCAGCACACTGACTGGCGGTCTGAAATACTCTCTGGCCACCGGTAACTGGGGCGAGCAGAAGAAAGCTGCCAGCTCCAAGGCTGGTGTGTCCCAAGTCGTCAGTCGTTACACGTACGCCTCCACCCTATCCCATCTTCGTCGGACCAACACTCCCATCGGACGTGACGGAAAAATTGCAAAGCCTCGTCAGCTGCACAACACGCACTGGGGCTTGGTCTGCCCAGCAGAGACCCCCGAAGGTCAGGCTTGTGGTCTGGTCAAGAACTTGGCTCTCATGTGTTACATCACTGTCGGTACGCCTAGCGAGCCGATCATCGACTTCATGATCCAACGCAACATGGAAGTTTTGGAGGAATTTGAGCCCCAGGTTACCCCCAATGCGACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTATCCACCGGGACCCTGCTCACCTGGTGAATACCATGCAATCTCTGCGTCGGCGAAACATGATCTCCCACGAGGTCAGTTTGATCCGTGATATCCGTGAACGCGAGTTCAAAATCTTCACCGACGCGGGACGTGTGTGTCGCCCATTGTTCGTCATCGACAACGACCCAAAGAGCGAGAACTGCGGTTCTCTGGTTCTGAACAAGGAACACGTCCGCAAGTTGGAACAGGACAAGGAGC---------TCCCACCCGACCTGGACCCGGAAGATCGGAGAGAACGCTACTTTGGATGGGATGGTCTGGTGCGGTCCGGAGTCGTCGAGTATGTTGACGCCGAGGAAGAGGAAACCATCATGATTGTCATGACGCCCGAAGACCTTGAGATCTCGAAACAGTTGCAGGCGGGCTACGCTCTCCCCGAGGAGGAGATGAACGATCCAAACAAGCGTGTGCGCTCCATTCTGAGTCAACGGGCCCATACCTGGACCCATTGTGAAAGTCACTGGGAGACTGCCGAAGACCGTCCGCACGAGCCAGAGGACTGGCGCCGGTTGCTCCAGTTTGCTGATTATAAGGGTTCCAAGAACAGGACGCTTAGAGAAGCCTTGGTTGGGGGCGTCAATCCTGGTATCCGTGTTGACATTCATCTGCGCGCTGTTCCCTCGTCACTCCGCAGCCGTCCCCAACCCGTGGCCATCTTCTC-TCTCCTTCGCCACGAGCATAAGCACACCGTTGTCAACATCAATATGACTTTGAACTCCAGTGTCGAGGAGCCGCTAAAGTCAAAGGAGGAGGTCATCGTCCAGTGTGGACCTCGGCGTTTGGTCGTGAAGCCCATCTTCTCCGCGGGAGACAATACCCCCAACAACGTGCACAAATACGACCGCTACCTCCACCCTGGTCGCAGTGCGGTCGCCTCATGGATTGGCCCTCTGACCTGGGGTGCCGTTCCAGTCCTTATCTTCAAGAGACAGACTCAG------CCTCAAGATCCCGAAGTCCTCGACTCTGCAGATGGTAGTG---------ACGACGCTGCCGCCGCAGCCACTTCCGGTCAGCTCGAGCTGATCGGTACCGGTACTGTCGTTGCGCCCGACCAAGCGCGCGTCGTGGCCAAACGAGTCATCCGCAAGGCCAAGGTTGGCGTCTTCAGCTGCCCGATTGATACCTCCCAGACAGAGACCAAGGGCACCGTGCTGCTCAAGAACGCCCAGGAGATGCTCGACTTCACCAAGGGCGAGGAGGAGCGCCTCGAGATGGCCATCAAGGAGCTCTACGACTCTGGCCTCCGCGTCGTCGTTGCGGGCTCCACCATCGGCGAGTTGGCCCTGCACTACCTCAACCGCTTCAACATCCTGGTCATCAAGATCCTCTCCAAGTTCGAACTGCGCCGTCTCTGCCGTGTCGTTGGCGCTACCCCGCTGGCCCGTCTCGGAGCTCCCATGCCCGACGAGATGGGCAGCATCGATGTCGTCGAGACCACCGAGATCGGCGGCGACCGCGTCACCGTCTTCCGTCAGGAGGACGTCAACGCCGTCACCCGCACGGCCACCATCGTCCTCCGTGGCGCGACTCAGAACCATCTCGATGATGTTGAGAGGGCTATCGACGACGGTGTCAATGTCGTCAAGGCGATCACCAAGGACCCCCGTTTGGTGCCCGGCGCCGGCGCCACCGAGATCCAGCTCGTCGAACGCATCTCCGCCTTTGCCGACCGTACCCCCGGTCTGCCGCAGCATGCCATCCGCAAGTATGCCGAAGCCTTTGAGGTTATCCCCCGCACTTTAGCCGAATCTGCTGGCCTAGACGCCACCGAGGTCCTGTCTCGTCTCTACACAGAACATCTCTGGTGAACACGGTCTCGACGGATCCGGTGT----TTACAATGGCTCTTCCGACCTCCAACTGGAGCGCATCAACGTCTACTTCAACGAGGCTAGCGGCAACAAGTATGTTCCTCGTGCCGTCCTCGTCGATCTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGGCAAATCACCACTAAGGAGCTGGGTACGGTCATGCGCTCCCTCGGCCAGAACCCCTCGGAGTCCGAGCTTCAGGATATGATCAACGAGGTCGATGCCGACAACAATGGCACTATCGATTTCCCAGAGTTCCTTA Basipetospora_halophila TGTCTCCCCAGCGGAATGGTCCACTCATGGGCATTGTGCAGGATACCCTCTGCGGTATTTATAAGATTTGCCGGCGCGACACGTTCCTGACCAGAGAACAAGTGATGAATATCATGCTTTGGGTTCCTGATTGGGATGGTGTTCTTCCTCCACCGGCTATCGTGAAGCCTAGGCCAAGGTGGACCGGAAAGCAGATGATCAGCATGGCTCTTCCGTCTGGCCTCAATCTTCTCCGCGTTGA---CAAAGACAACTCTACTCTTTCTGAAAAGTTCTCTCCTCTCGGTGACGGTGGTCTGCTCATCCACGGTGGACAGTTGATGTATGGAATGTTCTCCAAGAAAACTGTTGGTGCTAGTGGTGGGGGTGTCGTCCATACAATCTTCAACGAATATGGGCCAGATAGCGCAGTCGCTTTCTTCAACGGCGCCCAGACTATTGTGAACTACTGGCTGCTGCACAACGGCTTCAGTATCGGAATTGGTGACACCATTCCTGATCCTTATACGATTCATAGAATCGAGGATTGCGTTCGCAACCGCAAGAAGGAGGTCGAGACTATTACAGAGAGCGCAACCGATAACACCCTCGAGGCACTGCCCGGTATGAATGTGCGAGAGACCTTTGAGAGTAAGGTCTCGCGTGCGCTCAACAACGCGCGTGACGAAGCCGGTGGTGAAACCGAGAAGAGCCTGAAGGATATCAACCACGCCATTCAAATGGCGCGTTCCGGATCAAAGGGCTCGACTATCAACATTTCTCAGATGGTGCGTGGAGAATGGTCGCGAGATCTATTTGAATATTGGTATCAAGGCTAGCACCTTGACTGGTGGCTTGAAGTACGCGCTCGCCACAGGAAACTGGGGCGAGCAGAAGAAGGCCGCAAGCTCCAAGGCTGGCGTGTCGCAGGTCCTGAGCCGTTACACCTACGCGTCTACGCTGTCACATCTTCGTCGGACCAACACGCCAATCGGTCGCGATGGGAAAATCGCGAAGCCGCGACAACTCCACAACACCCACTGGGGCTTGGTCTGTCCGTCAGAGACTCCGGAAGGTCAAGCATGTGGTCTTGTCAAGAACCTGGCGCTCATGTGCTACATTACCGTTGGTACACCCAGCGAACCGATCATCGATTTCATGATCCAGCGGAATATGGAGGTGCTTGAAGAGTTCGAGCCTCAAGTGACACCGAACGCGACCAAGGTGTTTGTGAACGGTGTCTGGGTAGGAATCCATCGCGACCCGTCTCACCTGGTCAACACCATGTCTTCTCTGCGGCGGCGCAACATGATTTCCCACGAGGTCAGCTTGATTAGGGATATCCGCGAGCGGGAATTCAAGATCTTCACCGACGCTGGTCGTGTATCACGGCCGCTGTTCGTGATTGATAACGACCCGAAGAGCGAGAATTCCGGCTCGTTGGTGCTCAACAAGGAACACATCCGCAAGCTGGAGCAGGATAAAGAGT---------TGCCTCCGGATTTGGATCCTGAGGAGCGCAGGGAACGGTACTTCGGATGGGACGGCCTTGTGAAGTCGGGAGTCGTCGAGTATGTCGATGCGGAGGAGGAAGAAACGATCATGATTGTAATGACGCCGGAGGATCTTGAGATCGCGAAACAGCTTCAGGCGGGATATGATCTCCCGGAGGAGGT------TGATCCGCATAAGCGGGTGCGGTCGATCCTCAGCCAAAGGGCACACACCTGGACGCACTGCGACAGCCCGTGGGAAACGTCAGAAGACCGTCCTTACGAGCCGGAGGACTGGCGTCGGCTGCTACAGTTCGCCGACTACAAGGGCTCCAAGAACAAAGCCGTCAGGGAAGCCCTGGTTGGCGGCGTCAACCCGGGACATCGCGTCGACGTCCACCTTCGCGCAGTGCCAGCGCCTCTTCGCAATCGTCCGCAGCCAGTGTGTCTTTTCTC-CCTCCTTCGCCACGAGCACAAACACACCGTCGTCAACATAAACATGACCCTGAACTCCGACGTCGAGGCCCCGCTCAAGTCCAAGGAAGAGCTCATCATCCAATACGGACCACGGCGGCTAGTGGTGAACCCGGTCTTCTCAACCAGCGGCGTCACACCCAACAACGTCCACAAATTCGACCGATACCTGCACCCGGGCCGCAGCGCGATCGCCAGCTGGATCGGGCCGATGACATGGGGCTCGGTGCCGGTGCTTGTGTTCAAGAACAAGC---AA------GTAGGCGACCCGGAAGTCCTGGACGGCGGCGATG---------------ACGACAAAGGCCCGACCACCACCAGCGAGCATCTGGACCTCATCGGCACGGGCACGGTGGTGGCGCCGGACCAGTCGCGCGTTGTGGCCAAGCGCGCGATCCAGAAGGCCAAGGTCGGCGTGTTTAGCTGCCCGATCGACATCTCTCAGACTGAGACCAAGGGGACAGTGCTGTTGAAGAACGCCCAGGAAATGCTCGACTACACCAAGGGTGAGGAGGAGCGCCTCGAGGCGGCTATTAAGGAGCTGTACGACTCGGGCGTCCGCGTCGTTGTCGCGGGTGCTACTGTCGGCGACCTGGCCCTCCACTTCCTCAACCGCTTCAACATCCTCGTGATTAAGATCCAGTCGAAGTTTGAGCTCCGTCGGCTCTGCCGGGTCGTTGGTGCCACTCCTCTGGCCCGCCTGGGTGCCCCGATGCCGGACGAGATGGGCAGTGTCGATGTGGTGGAGACCACAGAGATCGGTGGTGACCGTGTCACTGTCTTCCGGCAGGAGGACCCCAGCACGGTGACGCGCACGGCGACCATTGTCCTGCGCGGAGCCACCCAGAACCATCTAGAAGACGTCGAGCGTGCAATCGACGACGGCATCAATGCCATCAAGGCCATCACAAAGGATCCCCGCCTCGTTCCCGGAGCGGGCGCCACTGAGATCCAGCTCTTGGAACGGATCTCCGCCTTTGCCGACAAGACCCCTGGTTTGCCCCAGCATGCGATTCGGAAGTTCGCCGAGGCGTTCGAAGTGATCCCGCGCACCCTCGCGGAGTCTGCTGGCCTGGATGCTACTGAGGTGCTTTCTCGCCTGTACACAGACTATCGCTGGCGAGCATGGCCTGGACGGCTCTGGTGT----GTACAATGGCACCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGGAACAAGTATGTTCCTCGTGCCGTTCTGGTCGACCTTGAGCCTCGGTACCATGGATGACAAGGATGGCGATGGCCAAATCACGACCAAGGAGCTGGGAACGGTCATGCGCTCTTTAGGCCAGAACCCGTCCGAGTCCGAGCTGCAGGACATGATTAACGAGGTTGATGCCGACAACAATGGCACCATCGATTTCCCCGAATTCCTTA Byssochlamys_nivea TCTCCCCTCAGCGCAATGGGCCATTGATGGGTATCGTCCAGGATACTCTCTGTGGTATCTACAAGATCTGTCGACGTGACGTCTTCTTGACTAAGGAGCAAGTAATGAACGTTATGCTCTGGGTTCCCGACTGGGATGGAGTAATCCCTCCACCGGCAATTCTGAAGCCTCGTCCCAGATGGACTGGAAAGCAGATGATCAGCATGGTGCTTCCTCCGGGTCTGAATCTTTTGCGGGTCGA---TAAAGACAAGGCACCACTCTCTGAAAAGTTTTCTCCGTTGGCTGACGGCGGTATCCTTGTTCATGGTGGTCAGCTCATGTATGGCATGTTTTCCAAGAAGACGGTGGGTGCCAGTGGCGGTGGTGTGATCCACACCATCTTCAACGAGTATGGACATGAGACTGCTATGGCTTTCTTCAATGGTGCTCAGAGAGTAGTCAATTACTGGCTTCTTCACAACGGATTCAGTATCGGTATTGGTGACACTATCCCTGATCAGGTTACTATCCAGAGAATCGAGGAAGCTGTTCGCAAGCGTAAGGAAGAGGTCGATGCTATTACAGCCAGCGCTACAGATAACACTCTCGAGCCGCTGCCAGGTATGAATGTCCGTGAGACCTTTGAAAGTAAGGTCTCGCGTGCTCTCAACAACGCTCGTGATGAAGCCGGTAGCGAGACCGAAAAGAGCTTGAAGGACCTGAACAATGCCATTCAGATGGCTCGTTCTGGATCTAAGGGTTCTACTATCAACATCTCACAGATGCTGTGTTGAGACCAACCGTGAAATCTACCTCAACATTGGTGTCAAGGCCAGCACCCTGACTGGAGGTCTGAAGTATGCTTTGGCTACGGGTAACTGGGGAGAGCAGAAGAAGGCCGCGAGCTCTAAGGCTGGTGTCTCTCAAGTGCTCAGTCGTTATACCTACTCGTCTACACTATCCCATCTTCGTCGTACCAACACGCCTATCGGCCGTGACGGAAAGATCGCCAAACCCCGACAGCTTCACAATACCCATTGGGGATTGGTGTGCCCGGCTGAGACTCCTGAAGGTCAAGCTTGCGGTCTCGTCAAGAACCTGGCGCTTATGTGCTACATTACTGTCGGAACACCTAGCGAGCCGATTATTGACTTCATGATTCAGCGGAATATGGAGGTTCTGGAAGAGTTCGAGCCGCAAGTTACGCCTAACGCGACCAAGGTGTTCGTCAACGGAGTTTGGGTTGGTATCCACCGTGACCCGTCACACCTTGTCAGCACGGTCCAGTCGCTGCGTCGTCGCAACATGATCTCTCACGAGGTCAGCTTAGTTCGAGACATCCGTGACCGAGAATTCAAGATCTTTACAGATGCCGGTCGTGTCTGTCGTCCACTTTTCGTCATTGATAACGACCCGAAGAGCGAGAACTGCGGTTCGCTTGTCCTTAATAAGGAGCACATCCGCAAGCTGGAGCAGGACAAGGAGC---------TTCCACCAGATCTATCTCCTGAGGAACGAAGAGAGCGGTACTTCGGCTGGGACGGCCTGGTCAGGTCTGGTGTTGTGGAATACGTCGATGCGGAGGAAGAGGAGACGATTATGATTGTCATGACCCCGGAAGATCTGGAGATTTCGAAACAGCTCCAGGCTGGATATGCTCTTCCAGAGGACGAGGGTAACGATCCTAACAAGCGTGTCCGTTCCGTGCTGAGCCAGAAGGCGCACACCTGGACGCACTGTGACAGTCAGTGGGAGACCGCAGAGGACAGGCCCCATGAGCCGGAGGATTGGCGTCATCTCCTTCAATTTGCAGACTACAAGGGTTCCAGGAACAGGACTATCCGCGAGGCTCTTGTCGGTGGAGTGAGCCCTGGAATTCGTGTCGATGTGCACCTTCGAGCCGTGCCTTCGTCTCTTCGAAACCGTCCACAGCCCTTGTCTCTCTTCTC-GCTCCTGCGTCATGAGCACAAGCACACTGTGGTCAATATCAACATGACCCTGAACTCCTCGATCGAGGAGCCCTTGAAATCCAAGGAAGAGGTCATCATCCAATGCGGACCGCGCCGTCTGCTAGTGAAACCGATCTTCTCTGCTGCCGGAAACACGCCGAACAACGTACACAAATTCGACCGCTTCCTCCATCCCGGCCGGGCCGCCATCGCAACATACATCGGTCCTCTCGCCTGGGGCTCCGTGCCAGTCCTGATGTTCAAGAACCAAC---AA------GTCAAAGACCCCGAAATACTCGACTCCGCAGATG---------------GAAACG------CCCCAACCAT---CAACCGTCTCGAACTCATCGGCACCGGCACCGTCGTGGCCCCCGACCACTCCCGTGTCGTCGCCAAACGAGTCATCAAGAAGGCAAAGGTCGGTGTCTTCAGCTGCCCGATCGATATCTCGCAGACCGAGACCAAGGGTACTGTGCTCCTGAAGAATGCACAGGAGATGCTCGACTTCAGCAAGGGTGAGGAGCAGCGTCTCGAGGCCGCCATCAAGGAGCTGTACGACTCTGGTCTCCGTGTGGTTGTTGCTGGCAGCACTGTCGGTGAACTCGCCCTCCACTACCTTAACCGCTTCGGAATTCTCGTGATCAAGATCTTGTCGAAATATGAGCTTCGCCGACTTTGCCGCGTTGTCGGTGCCACTCCCCTCGCCCGTCTTGGTGCCCCTATGCCTGACGAGATGGGTTCTATTGACGTTGTCGAGACGACTGAGATCGGTGGTGACAGAGTCACTGTCTTTCGTCAGGAGGACTCTAACAATGTTACTCGCACGGCGACTATCGTCTTGCGCGGAGCTACCCAGAACCACCTTGACGACGTCGAGCGCGCCATTGACGATGGTGTCAACGTTGTGAAGGCCATCACCAAGGACCCGCGTCTTGTTCCCGGAGCTGGTGCCACTGAGCTGCAGCTTGTGGAGCGCATCTCTGCTTTTGCAGACAAGACCCCCGGTCTCCCACAACACGCTATCAGAAAGTACGCTGAAGCTTTCGAAGTCATCCCACGCACCCTGGCCGAATCCGCTGGACTGGATGCCACCGAGGTCCTCTCTCACTTGTACACAGACCATCTCCGGTGAGCACGGTCTCGACGGTGCTGGTGT----CTACAATGGCTCCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGCTGCCGGCAAGAAGTATGTTCCCCGTGCCGTCCTCGTCGACCTTGAGCC-TGGTACCATGGACGACAAGGATGGCGATGGTCAGATCACCACCAAGGAGCTGGGTACCGTCATGCGCTCCCTGGGTCAGAACCCGTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTCGACGCTGACAACAATGGCACCATCGACTTCCCTGAGTTCCTTA Byssochlamys_spectabilis TTTCGCCCCAGCGTAACGGTCCGTTGATGGGTATCGTCCAGGATACTCTTTGTGGTATCTACAAAATCTGTCGGCGTGATGTATTCTTAACTAAGGAGCAAGTCATGAACATTATGCTCTGGGTTCCCGACTGGGATGGAGTGATCCCTCCGCCAGCAATCCTGAAACCTCGTCCGAGGTGGACCGGAAAGCAGATGATCAGTATGGTGCTTCCTCCAGGTCTGAATCTTTTGCGTGTTGA---TAAGGACAAGGCACCACTATCTGAGAAGTTTTCGCCATTGGCTGACGGCGGTATCCTTGTGCATGGCGGTCAGCTCATGTACGGTATGTTCTCGAAGAAGACTGTGGGTGCAAGTGGTGGTGGTGTGATCCACACCATCTTCAACGAGTACGGGCATGAGGCAGCCATGGGTTTCTTCAACGGTGCTCAGAGAGTGGTTAATTACTGGCTTCTTCACAACGGATTCAGTATCGGTATTGGTGACACGATCCCTGATCAGCTTACTATTCAGAGAATCGAGGAAGCAGTTCGCAAGCGTAAGGAGGAAGTCGACGCCATCACCGCTAGTGCGACCGACAACACTCTAGAACCGTTGCCAGGTATGAATGTCCGTGAGACCTTTGAGAGCAAGGTCTCGCGTGCTCTCAACAACGCTCGTGACGAAGCCGGTAGCGAGACCGAAAAGAGTTTGAAGGATCTGAACAATGCCATTCAGATGGCTCGTTCCGGATCAAAAGGTTCCACAATCAACATCTCTCAGATGCTGCGTTGAGACCAACCGTGAAATCTATCTCAATATTGGTGTTAAGGCAAGCACCTTGACTGGAGGTCTGAAGTATGCTTTGGCCACAGGTAACTGGGGAGAGCAGAAGAAGGCTGCCAGCTCTAAGGCCGGTGTTTCTCAAGTGTTGAGTCGTTACACCTATGCGTCTACGCTTTCCCATCTTCGCCGCACCAATACGCCAATTGGTCGTGATGGAAAGATCGCCAAGCCTCGACAGCTTCACAACACCCACTGGGGATTGGTGTGTCCGGCTGAGACTCCTGAAGGTCAAGCTTGTGGTCTTGTCAAGAACCTGGCGCTTATGTGTTACATCACTGTCGGAACGCCTAGCGAGCCCATCATTGATTTCATGATTCAGCGAAACATGGAGGTTCTGGAAGAGTTCGAGCCGCAGGTGACGCCCAACGCGACAAAGGTGTTTGTCAACGGAGTGTGGGTTGGTATCCACCGTGATCCAACCCATCTCGTCAACACCGTCATGTCTCTGCGTCGCCGTAACATGATCTCCCACGAAGTCAGCTTGGTTCGCGATATCCGTGACCGAGAATTCAAGATCTTTACCGATGCTGGTCGTGTATGCCGACCGCTCTTCGTCATCGATAATGACCCGAAGAGCGAGAACTGCGGTTCTCTGGTCCTCAACAAAGAACACATCCGTAAACTTGAGCAGGACAAAGAGC---------TTCCGCCAGACCTTTCACCGGAGGAGCGCAGAGAACGGTACTTCGGATGGGATGGACTGGTTAGGTCTGGAGTTGTGGAGTACGTCGATGCAGAGGAAGAAGAGACCATCATGATCGTTATGACGCCTGAAGATCTAGAGATCTCTAAGCAGCTTCAGGCCGGATATGCTCTCCCTGAAGATGAGGGCAACGATCCCAACAAGCGCGTCCGGTCCGTCCTCAGTCAGAAAGCGCACACCTGGACACACTGTGATAGTCACTGGGAGACCTCAGAGGACAAGCCTCACGAACCGGAGGATTGGCGCCGCCTCCTTCAGATTTCAGACTACAAGGGTTCGAGAAACAGGAGCATTCGCGAGGCTCTTGTTGGAGGAGTCAACCCTGGTACTCGAGTAGACGTGCACCTCCGAGCTGTGCCTTCATCTCTTCGAAACCGCCCACAGCCCATGGCCCTATTTTC-GCTCCTGCGCCATGAGCACAAGCAGACCGTGGTCAACATCAACATGACCCTGAGCTCATCCGTCGAGGAGCCTCTGAAATCCAAGGAGGAGGTCATAATCCAGTGCGGACCCCGTCGTCTTCTTGTGAAGCCCGTCTACTCAGCTGCGGGCAACACCCCGAACAACGTGCACAAGTTCGACCGCTTCCTCCATCCCGGCCGCGCTGCCATCGCAACCTACATTGGCCCGCTGACCTGGGGTTCCGTGCCCGTCCTGATGTTCAAGAACCAGC---AA------GTCAAAGACCCTGAAGTCCTGGACTCCGATGATG---------------CAAACG------CCCCGACTAT---CAACCGTCTCGAGCTTATCGGCAACGGCACCGTCGTGGCCCCCGATCACTCCCGCGTCGTCGCCAAACGAGTCATCAAGAAGGCCAAGGTCGGTGTCTTCAGCTGCCCGATCGATACCTCTCAGACCGAGACCAAGGGAACTGTGCTCCTGAAGAATGCGCAGGAGATGCTTAACTTCAGCAAGGGCGAGGAGGAGCGTCTTGAGGCCGCTATCAAGGAGTTGTACGACTCCGGTCTCCGTGTGGTTGTTGCTGGCAGCACTGTCGGTGAACTCGCCCTCCACTACCTCAACCGCTTCGGAATCTTGGTCATTAAGATCTTGTCGAAATACGAGCTGCGCCGTCTCTGCCGCGTTGTCGGTGCTACCCCTCTCGCTCGTCTTGGTGCCCCTATGCCCGACGAGATGGGTTCCATCGATGTTGTGGAGACCACTGAGATCGGTGGTGACAGAGTTACTGTCTTCCGCCAGGAGGACTCTAACAATGTGACTCGCACAGCGACTATTGTCCTTCGTGGAGCGACCCAGAACCATCTCGACGACGTCGAGCGCGCCATTGATGATGGTGTCAACGTTGTCAAGGCCATCACCAAGGACCCGCGTCTTGTTCCTGGAGCTGGTGCCACCGAGCTGCAGCTGGTAGAGCGCATCTCTGCCTTCGCCGATAAGACCCCCGGACTTCCGCAGCACGCCATTAGAAAGTACGCTGAGGCTTTCGAAGTCATCCCCCGGACCCTGGCCGAGTCTGCTGGTCTGGATGCCACCGAGGTCCTTGCTAACCTATATACAGACCATCTCTGGCGAGCACGGCCTTGACGGTTCTGGTGT----CTACAATGGCACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGCTGCTGGCAAGAAGTATGTTCCTCGTGCCGTCCTCGTCGACCTTGAGCC-TGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTGGGAACTGTCATGCGCTCCCTTGGCCAGAACCCGTCTGAGTCTGAGCTGCAGGACATGATTAACGAGGTCGACGCTGACAACAATGGAACCATCGATTTCCCCGAGTTCCTGA Hamigera_avellanea TGTCTCCTCAGCGTAATGGTCCACTAATGGGTATTGTCCAAGACACGCTTTGTGGTATCTACAAAATCTGTCGGCGAGACACTTTCCTCACCAAAGAGCAAGTGATGAACATTATGCTCTGGGTACCTGACTGGGATGGAGTGATCCCGCCTCCGGCAATCTTGAAGCCGAGACCAAGATGGACCGGAAAGCAGATGATCAGCATGGCCCTTCCTTCCGGCTTGAACCTTCTACGTGTCGA---CAAGGATAGCTCGCCTCTTTCTGAGAAGTTTTCACCTCTGAACGACGGGGGTCTCCTTGTCCACGGTGGACAGTTGCTCTACGGAATGTTTTCTAAGAAGACAGTTGGCGCCAGCGGGGGTGGTGTCATTCACACCATCTTCAACGAATATGGTGCTGATACTGCCGTTCGCTTCTTCAACGGTGCTCAGACAATCGTCAACTATTGGTTGTTGCACAACGGATTCAGTATCGGTATTGGTGACACAATTCCTGATGCGGTCACAATCCAAAGGATCGAAGATGCGGTGCGGGTGCGAAAGCAGGAGGTTGAGGCGATCACTGCCAGTGCCACCGAGAACACTCTGGAGCCGTTGCCCGGTATGAATGTTCGCGAAACCTTTGAAAGTAAGGTCTCGCGTGCACTCAACAACGCCCGTGATGAAGCCGGTAGTGAGACGGAGAAGAGCTTGAAGGACCTGAACAATGCTATTCAGATGGCTCGTTCAGGATCCAAGGGTTCGACAATTAACATCTCACAGATGATGCGTCGAGACTAACCGTGAGATCTATCTGAACATCGGCATCAAGGCCAGCACATTGACGGGTGGTCTCAAATATGCTCTAGCCACCGGTAACTGGGGAGAACAGAAAAAAGCGGCAAGCTCCAAGGCCGGTGTGTCTCAGGTGCTCAGTCGTTACACTTATGCTTCGACCCTTTCCCACCTGCGTCGTACCAACACGCCTATTGGTCGTGATGGAAAAATTGCCAAACCTCGTCAGCTTCACAACACCCACTGGGGCCTGGTTTGTCCTGCAGAAACTCCCGAGGGTCAAGCTTGTGGTTTGGTCAAGAACTTGGCACTCATGTGTTACATCACTGTCGGTACCCCTAGTGAGCCTATCATCGATTTCATGATCCAGCGTAACATGGAGGTGCTCGAGGAATTCGAACCCCAGGTCACACCTAATGCTACCAAGGTCTTCGTCAATGGTGTTTGGGTTGGAATTCACCGGGATCCTGCTCACTTGGTCAACACTATGAACTCACTGCGTCGCCGCAATATGATCTCCCACGAGGTCAGCTTGATCCGTGACATCCGTGATCGTGAATTCAAGATTTTCACCGACGCTGGCCGTGTGTGCCGACCGTTGTTCGTGATTGATAACGACCCAAAGAGTGAAAACTGCGGTTCGCTAGTCTTGAACAAGGAGCATATTCGCAAATTGGAAGCAGACAAGGAGT---------TGCCACCAGATCTGGATCCCGAAGAGCGCAGAGAGCGCTACTTCGGATGGGATGGCCTCGTGAAGTCGGGTGTTGTCGAATACGTCGATGCGGAAGAGGAAGAGACAATCATGATCGTCATGACACCTGAGGATCTTGAGATCTCGAAACAACTGCAGGCCGGCTACACTCTG---GAGGATGAAACCAACGACCCCAACAAGCGTGTCCGATCCATTCTCAGTCAAAAGGCGCACACCTGGACGCATTGCGACAGCTCCTGGGAAACGGCAGAGGACCGCCCCCACGAACCCGAGGACTGGCGCCGCCTGCTCCAGTTCGCCGACTACAAGGGCTCCAAGAACCGGACCGTCAGGGAAGCCCTGGCCGGCGGCGTCAATCCCGGCACCCGTGTGGACGTCCACCTTCGCGCCGTGCCATCGACACTCCGCTCCCGTCCACAGCCATTGGCACTCTTCTC-CCTGCTCCGACACGAGCACAAGCACACCGTGGTCAACGTCAACCTGTCGCTGAAGTCAGGCATCGAGGAGCCCCTGCGGTCGAAGGAGGAAGTCATCGTCCAATGCGGCCCGCGCCGCCTGGTCGTCAACCCCATCTTCTCCGCCGCCGACAACACGCCGAACAACGTGCACAAGTTCGACCGATACCTGCACCCCGGCCGCAGCGCCATCGCCACCTGGATCGGTCCTCTCACGTGGGGCGCCGTCCCCGTCCTCGTCTACCAGAAGAAGAAGCAA------GTCCAGGACCCCGAAGTGCTGGAT------GCCG---------------CCGACGGATCCGC---------CCTCACCAAGCTCGAGCTCATCGGATCCGGCACCGTCGTGGCGCCCGACCAGGCCCGCGTCGTCGCCAAGCGCGTCATCCGCACGGCCAAGGTCGGTGTCTTCAGCTGCCCGATCGATATCTCTCAAACCGAGACCAAGGGCACAGTACTCTTGAAGAACGCCCAGGACATGCTTAACTTCACCAAGGGTGAGGAAGACCGTCTCGAGACCGCTATTAAGGAGCTGTACGACTCTGGTATCCGCGTTGTTGTCTCCGGTTCCACCATCGGCGAGTTGGCTCTCCATTATCTTAACCGCTTCAACATCCTTGTGATTAAGATCCTTTCCAAGTTCGAGCTCCGCCGTCTCTGCCGTGTCGTCGGTGCCACTCCTCTTGCCCGCTTGGGTGCTCCCATGCCCGATGAGATGGGCAGCATCGACGTGGTCGAGACCACTGAGATCGGTGGTGACCGTGTCACCGTCTTCCGTCAGGAGGACGCCAACACTGTGACCCGCACTGCCACCATTGTTCTGCGTGGAGCGACCCAGAACCACCTGGATGATGTTGAGCGTGCCATTGATGATGGTGTCAACGTCGTCAAGGCTATCACCAAGGACCCCCGCCTTGTTCCTGGCGCAGGCGCTACCGAGATCCAGCTCGTGGAACGAATCTCCGCTTTTGCAGACAAGACACCCGGATTGCCACAACACGCGATTCGCAAGTACGCAGAGGCCTTTGAGGTCATCCCCCGCACACTTGCCGAGTCCGCAGGCTTGGATGCCACCGAGGTTCTCTCGCGTCTCTACACAGACCATCTCTGGCGAGCACGGTCTTGATGGCTCCGGTGT----TTACAATGGCACCTCCGACCTCCAGTTGGAGCGTATGAACGTTTACTTCAACGAGGCCAGCGGTAACAAGTATGTCCCCCGTGCCGTCTTGGTCGATCTCGAGCC-TGGCACCATGGACGACAAGGATGGCGATGGGCAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTGGGCCAAAACCCTTCCGAGTCTGAGCTTCAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACTATCGATTTCCCAGAATTCCTCA Hamigera_striata TCTCGCCCCAGCGAAATGGTCCTCTGATGGGTATTGTCCAAGATACTCTCTGTGGTATCTATAAGATCTGCCGGCGTGACATCTTCCTTTCCAAGGAGCAAGTGATGAACATCATGCTTTGGGTTCCGGACTGGGATGGAGTCATCCCTCCCCCGGCCATTCTGAAGCCGAGACCAAGATGGACTGGAAAGCAGATGATCAGCATGGCTCTTCCCTCCGGCTTGAACCTCTTGCGTGTTGA---GAAAGATAACTCGCCCCTTTCGGAGAAATTTTCTCCTTTGAACGATGGTGGTCTTTTTATCCACGGTGGTCAGTTGATGTATGGAATGCTCTCCAAAAAGACAGTCGGCGCTAGCGGAGGAGGTGTTATCCACACTATCTTCAACGAGTATGGCCCGGATACAGCTGTCGCCTTCTTCAACGGCGCACAGACGATTGTCAACTACTGGTTGTTGCATAACGGCTTCAGTATTGGTATTGGTGACACCATTCCCGATGCGGTCACAATCCAGAGAATTGAAAATGCCGTCCGGGTGCGCAAGCAAGAAGTCGAGTCCATTACGGCTAGTGCTACGGAGAACACTCTCGAGCCTTTGCCTGGTATGAATGTGCGTGAAACCTTCGAGAGTAAAGTCTCGCGTGCACTCAACAATGCCCGTGATGAAGCTGGTAGCGAGACGGAGAAGAGTTTGAAGGATCTCAACAACGCTATCCAGATGGCTCGTTCCGGATCTAAGGGTTCGACTATCAATATTTCCCAGATGATGCGTTGAGACCAACCGCGAAATCTACCTCAATATTGGCATCAAGGCCAGCACATTGAGCGGAGGTTTGAAATATGCTCTTGCCACCGGTAACTGGGGAGAGCAGAAGAAAGCAGCAAGCGCCAAGGCCGGCGTGTCCCAGGTGCTGAGTCGGTATACATATGCTTCCACTCTTTCCCATCTTCGTCGTACAAACACGCCTATCGGTCGTGATGGTAAGATCGCCAAGCCTCGTCAGCTTCACAACACACATTGGGGTCTGGTTTGTCCGGCAGAAACTCCCGAAGGTCAGGCTTGTGGTCTGGTCAAGAACTTGGCGCTCATGTGCTACATCACTGTCGGTACACCTAGTGAGCCTATCATCGACTTCATGATTCAGCGTAACATGGAGGTGCTTGAGGAATTCGAGCCACAAGTTACACCCAACGCTACAAAGGTTTTCGTTAACGGAGTCTGGGTCGGTGTGCATCGTGACCCTGCTCATTTGGTCAACACCATGCACTCTCTGCGTCGACGGAACATGATCTCTCATGAGGTCAGCTTGATTCGGGATATTCGCGATCGTGAATTCAAGATCTTCACTGACGCTGGCCGTGTGTGTCGACCATTGTATGTCATTGACAACGACCCGAAGAGTGAGAACTGCGGCTCGCTGGTCCTGAACAAGGAGCACATTCGCAAATTGGAGCAAGACAAGGAGT---------TGCCACCCGATCTAGATCCAGAAGAGCGCAGAGAGCGTTACTTCGGATGGGATGGCCTTGTGAAGTCAGGAGTCGTCGAGTATGTTGATGCGGAAGAAGAGGAAACGATCATGATTGTCATGACACCCGAAGATCTTGAGATTTCGAAACAACTGCAGGCCGGCTATACTCT---CGAGGAGGAGAATAACGACCCCAACAAACGTGTGCGCTCAATTCTGAGTCAACAGGCGCACACTTGGACGCACTGCGACAGCGACTGGGAGACCGCGGAGGATCGCCCCTACGAACCCGAGGACTGGCGTCGACTCCTTCAATTTGTCGATTACAAAGGCTCCAAGAACAGATTCATCAGGGAAGCTCTAGTCGGCGGTGTCAACCCCGGCACCCGTGTGGAGGTCCATCTTCGCGCGGTACCATCAACGCTTCGCAGCCGTCCACAGCCATTGTCCCTCTTCTC-CCTGCTCAGACACGAGCACAAGCAGACCGTTGTCAACGTCAACATGTCCCTGAACTCCAGTATCGAAGAACCACTGAGATCAAAGGAAGAACTGATTGTCCAGTGCGGTCCCCGCCGGTTGGTCGTCAACCCCATCTTCTCCGCCGGCGACAACACCCCCAACAACGTCCACAAGTTCGACCGATTCCTTCACCCCGGCCGCAGTGCCATCGCAACATGGATCGGCCCTCTCACTTGGGGCTCAGTCCCCGTCCTCGTTTTCAAGAACAAAC---AG------GTCCAGGATCCTGAAGTTCTGGACTCAGCAGATG---------------GCCAACCTACCG------------TCACTCAAATCGAACTCATCGGCACCGGTACCATCGTCGCCCCCGACCAGTCTCGCGTCGTCGCCAAACGTGTCATCCGGAAGGCCAAGGTCGGTGTTTTCAGCTGCCCGCTCGATATCTCCCAGACCGAGACCAAGGGTACTGTGCTCTTGAAGAACGCGCAGGAGATGCTCGATTTCACCAAGGGCGAGGAGCAGCGTCTCGAGACCGCTATCAAGGAGCTCTACGACTCTGGCCTGCGCGTCGTTGTCGCCGGTTCCACCGTCGGCGAGTTGGCTCTACACTACCTCAACCGATTCAACATTCTCGTTATCAAGATCCTGTCGAAGTTCGAACTCCGCCGTCTCTGCCGTGTCGTCGGTGCTACTCCTCTCGCCCGCCTGGGAGCCCCCATGCCCGACGAGATGGGCAGCATTGACGTGGTCGAGACTACTGAGATTGGCGGTGACCGTGTCACCGTTTTCCGCCAAGAAGATGTCAACACCGTGACTCGCACGGCGACCATTGTCCTGCGCGGTGCGACTCAGAACCACCTCGATGATGTCGAGCGTGCCATCGATGATGGCGTGAACGTCGTCAAGGCTATCACCAAGGACCCCCGTCTTGTCCCCGGCGCAGGCGCTACCGAGATCCAGCTTGTGGAACGCATTACCGCGTTTGCAGACAAGACTCCCGGATTGCCGCAGTACGCGATCCGGAAGTACGCTGAGGCCTTTGAAGTCATCCCACGCACACTTGCTGAGTCCGCGGGATTGGATGCCACCGAGGTTCTTTCTCGTCTCTACACAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGT----TTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAGCGTTTACTTCAACGAGGCCAGCGGAAACAAGTATGTTCCTCGTGCCGTCTTGGTCGATCTTGAGCC-TGGCACCATGGATGACAAGGATGGTGATGGACAAATCACCACCAAGGAACTGGGTACCGTCATGCGCTCTCTCGGCCAGAACCCTTCTGAGTCTGAGCTTCAGGACATGATCAACGAGGTTGATGCCGACAACAACGGCACTATCGATTTCCCCGAATTTCTTA Monascus_purpureus TGTCCCCCCAACGGAATGGCCCGCTTATGGGTATTGTCCAGGATACTCTTTGCGGTATCTACAAGATCTGCCGGCGAGATATTTTCCTGACCAAAGAGCAAGTTATGAATATCATGCTTTGGGTCCCTGACTGGGATGGGGTTATTCCTCCACCGGCAATCCTGAAGCCCAGACCGAGATGGACCGGGAAACAAATGATCAGCATGGCCCTTCCATCAGGCCTGAACCTTCTTCGTGTGGA---GAAGGATAACTCCCCTCTATCCGAGAAGTTCTGTCCCTTGAATGACGGTGGCCTGCTTGTCCATAGCGGCCAGTTGATGTATGGAATGTTCTCTAAAAAGACGGTTGGTGCAAGTGGCGGTGGTGTTATCCATACAATCTACAACGAATATGGACCGGATACTACTGTCGCATTTTTCAATGGTGCCCAGACAATTGTCAATTATTGGCTACTGCATAATGGTTTCAGCATTGGTATCGGTGACACGATTCCTGACGCTTACACAATCCAGAGGATTGAACATGCTGTCCGTGTACGGAAGCAGGAGGTTGAGTCGATTACAGAAAGCGCGGCTGAGAACACATTGGAACCCTTGCCGGGTATGAATGTGCGAGAAACCTTTGAGAGTAAAGTCTCTCGTGCTCTCAACAATGCTCGTGATGAGGCAGGTAGCGAAACTGAGAAGAGTTTGAAGGATCTCAACAATGCCATTCAAATGGCTCGCTCGGGATCAAAGGGTTCAACAATTAACATCTCGCAGATGATGCGTGGAGACTAACCGTGAAATCTACCTGAATATCGGTATCAAGGCCAGCACATTGACTGGAGGTCTAAAGTATGCATTGGCTACGGGCAATTGGGGCGAACAGAAGAAAGCAGCTAGTTCCAAAGCTGGTGTTTCGCAGGTGCTCAGCCGTTATACATACTCTTCCACTCTTTCGCATCTTCGGCGCACCAATACGCCCATCGGTCGTGATGGGAAAATTGCGAAGCCTCGCCAGCTTCACAATACTCATTGGGGTCTGGTATGCCCAGCAGAGACGCCAGAAGGTCAAGCTTGTGGATTGGTCAAGAACTTGGCACTCATGTGCTACATCAGCGTCGGTACACCTAGCGAGCCTATTATCGAGTTCATGATTCAGCGCAATATGGAGGTCCTTGAGGAATTCGAGCCGCTGGGGACGCCAAACGCGACAAAGGTCTTTGTCAACGGAGTTTGGGTTGGAATTCATCGTGATCCTGCTCATCTTGTCAACACAATGCTTTCTCTGCGGCGGCGCGGCATGATTTCCCACGAGGTCAGCTTAATCAGAGACATTC{GT}GGAGAGAGAATTCAAGATCTTCACGGACGCTGGTCGTGTTTGCCGGCCTCTGTTCGTCGTTGATAATGACCCGAAAAGCGAGAACTGTGGTTCGCTAGTCTTGAACAAAGAGCATATCCGCAAGCTGGAGCAAGATAAGGAAT---------TGCCTCCGGATCTGGATCCGGAAGAGCGTCGAGAACGGTACTTTGGGTGGGATGGTCTCGTGAAATCGGGAGTCGTCGAATACGTAGATGCTGAGGAAGAGGAGACTATCATGATCGTTATGACCCCGGAGGACCTCGAGATCTCCAAACAACTTCAAGCTGGCTACACACTTCCCGATGAAAA------CGATCCCAATAAACGTGTGCGTTCTATTCTAAGCCAAAGGGCACATACCTGGACACATTGCGAAAGCAGTTGGGAGACATCAGAGGATCGACCCCATGAACCAGAGGATTGGCGTCGGCTCCTTCAGTTTGTTGATTACAAGGGCTCCAAGAGCAAAGCCATCCGGGAAGCCCTGGTCGGCGGTGCCAGCCCTGGGGCTCGTGTTAACGTCCATCTCCGGGCCGTACCATCATCCATGCGTAGTCGCCCACAGCCTCTATCGCTCTTCTC-GCTCCTTCGACACGAGCACAAACACACCGTCGTGAATGTCAGCATGTCTTTGACTTCCAATGTCGAAGAACCCTTGAAATCAAAGGAAGAACTCATTGTCCAATGTGGCCCGCGGCGTTTCGTCGTCAACCCACTCTTCTCCGCCGACGACGTTACCCCCAACAACGTCCACAAATTCAACCGCTTCCTGCACCCAGGCCGCAGCACCATCGCAACATGGATTGGCCCTCTGACATGGGGCGCCGTACCGGTCCTAGTCTTCAAGAACCAAC---CC------ATCCAGGACCCTGAAATTCTCGACTCAGCTGATA---------------ACCAACCAACTC------------AGAGTCGACTAGAACTGATCGGAACTGGCACCGTCGTCGCACCCGATCATTCTCGAGTTGTTGCAAAGCGTGTGATGCGGAAAGCCAAGGTCGGAGTGTTCAGCTGCCCGATCGATATCTCCCAGACTGAGACCAAGGGAACTGTGCTTCTGAAGAATGCGCAGGAGATGCTCGACTTCACCAAGGGTGAGGAGGAACGTCTTGAGGCTGCTGTCAAGGAGCTGTATGACTCTGGGCTTCGAGTTGTCGTTGCTGGCTCTACTGTCGGCGAGTTGGCCCAGCACTATCTCAATCGCTTTAACATCCTTGTCATCAAGATCCTCTCCAAGTTTGAGCTCCGTCGGCTCTGCCGGGTCGTGGGCGCCACTCCTCTTGCACGCCTGGGAGCCCCAATGCCTGATGAGATGGGCAGTATTGACGTGGTTGAGACCACTGAAATCGGCGGTGACCGCGTTACCGTTTTCCGTCAGGAGGACAGTAACACCATCACGCGGACTGCCACTATTGTCCTGCGGGGTGCAACCCAGAACCATCTAGACGATGTCGAACGCGCCATTGACGATGGTGTCAATGTCGTCAAGGCCATCACCAAGGACCCCCGTCTTGTTCCTGGTGCAGGCGCTACTGAGATTCAGCTTATCGAGCGTATTACGGCTTTTGCGGACAAGACCCCCGGATTGCCTCAACATGCCATCCGCAAGTACGCAGAGGCCTTCGAGGTGATCCCACGGACGCTGGCCGAGTCAGCGGGGTTGGATGCTACCGAGGTTCTTTCGCGCCTTTACACAGAACATCTCTGGTGAGCACGGCCTTGATGGCTCCGGTGTGTAACTACCATGGTACTTCCGACCTTCAGTTGGAGCGTATCAACGTTTACTTCAACGAGGCCAGTGGTCAGAAGTACGTTCCTCGTGCCGTCCTGGTCGACCTCGAGCC-CGGTACCATGGATGACAAGGATGGCGATGGCCAGATTACTACCAAAGAATTGGGAACCGTTATGCGCTCCCTCGGCCAGAATCCCTCCGAGTCTGAGTTGCAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACCATCGATTTCCCAGAATTCTTGA Penicilliopsis_clavariiformis TATCGCCTCAGCGCAATGGTCCTCTGATGGGTATCGTCCAGGACACTCTCTGTGGAATCTACAAGCTTTGTCGTCGTGACGTATTTCTCACAAAGGAGCAAGTGATGAATGTCATGCTCTGGGTTCCAGATTGGGACGGCGTCATTCCTCCGCCTGCCATCTTAAAACCTCGGCCCAGATGGACTGGTAAGCAGATGATCAGTATGGCTGTTCCGCCAGGCTTGAACCTTTTGCGTGTCGA---GAAAGACAACTCTCCTCAGTCCGAGAAATTTTCTCCCTTGAATGACGGGGGTCTCCTCGTTCACGGCGGCCAGCTAATGTATGGCATGTTCTCCAAGAAGAGTGTGGGCGCTAGTGGTGGAGGAGTCATTCATACAATCTTCAATGAGTATGGCCCAAGCACTGCCGTCTCCTTCTTCAATGGTGCCCAGACAATTGTGAACTATTGGTTGTTGCACAACGGGTTCAGCATCGGCATTGGTGATACAATCCCAGATGCTCTCACAATCCAAAGAATCGAAAATGCCGTCCGGATTCGTAAGCAAGAGGTGGAGACGATCACAGCAAGTGCCACAGAGAATACTTTGGAAGCGTTGCCCGGTATGAACGTCCGTGAAACATTTGAGAGTAAGGTTTCCCGTGCCCTCAACAATGCTCGTGATGAGGCTGGTGCTGCAACAGAAAAGAGTTTGAAGGATTTGAATAATGCCATTCAGATGGCTCGTTCAGGATCAAAGGGTTCGACTATCAACATTTCTCAGATGATGTGTCGAGACCAATCGCGAGATTTACTTGAATATTGGTATCAAGGCCAGCACTTTAACTGGTGGCTTGAAATACTCCCTGGCTACGGGTAACTGGGGCGAACAAAAGAAAGCAGCGAGTGCAAAGGCCGGTGTGTCCCAAGTTGTCAGTCGATATACCTATTCTTCAACGCTTTCACATCTTCGTCGTACAAACACGCCTATTGGTCGTGACGGAAAGATTGCCAAACCTCGCCAGCTACACAATACCCATTGGGGCTTGGTCTGTCCGGCAGAAACTCCCGAGGGTCAAGCCTGTGGTCTGGTCAAGAATCTTGCTCTCATGTGTTACATTACTGTGGGTACGCCTAGCGAGCCGATCATTGACTTTATGATTCAGCGCAACATGGAAGTTCTCGAGGAATTCGAGCCCCAGGTTACGCCTAATGCTACAAAGGTCTTCGTCAACGGTGTTTGGGTTGGTATCCACCGTGACCCTGCTCATTTGGTGAGCACCATGCAATCATTGCGTCGACGGAACATGATCTCGCACGAAGTCAGCTTGATTCGTGACATTCGTGACCGGGAATTTAAGATTTTCACCGACGCTGGCCGTGTGTGCCGTCCTCTGTTTGTCATTGACAACGACCTGAAGAGTGAAAATTGCGGATCGCTTGTCCTGAACAAGGAACACATTCGCAAGTTGGAGCAAGACAAGGAGT---------TACCTCCAGACCTCGACCCAGAAGAGCGTCGAGAACAGTACTTTGGATGGGATGGCCTTGTCAGATCTGGGGCTGTTGAATATGTCGATGCTGAGGAGGAAGAGACGATTATGATTGTGATGACGCCCGAAGACCTTGAGATCTCGAAACAGCTGCAAGCTGGCTACGCTCTTCCCGAGGATGAAACGAGCGATCCTAATAAACGTGTTCGATCAATTCTCACCCAAAAGGCACATACGTGGACGCACTGTGATAGTACCTGGGAGACAGCAGAGGACCGCGCTCACGAGCCGGAAGATTGGCGCCGGCTGCTTCAGTTTGCGGATTACAAGGGCTCCAAGAACAGGACCCTTCGAGAAGCCTTGGTTGGTGGGGTCAACCCTGGAACTCGGGTGGACATTCGTCTGCGTGCAGTTCCATCGTCACTTCGCAACCGCCCGCAACCTACATCACTTTTCTC-CCTCCTTCGACATGAGCACAAGCACACCGTTGTCAATATCAACATGACTTTGAGCTCTAGTGTTGAGGAGCCGCTCAAGTCAAAAGAAGAGATCATCATCCAATGTGGACCTCGCCGCCTGGTTGTCAATCCTGTCTTCTCTGCCGGAGATAACACTCCCAACAATGTCCATAAATTCGACCGTTTCCTCCATCCTGGTCGTAGTGCTATTGCTACGTGGATTGGACCACTTACATGGGGCGCCGTTCCAATTCTTGTCTTCAAGAACAAAA---AG------GCACAAGATCCCGAGGTCCTCGACACAGCGGATG---------------ACGAAACAACCGACCAGTTTACTATCGACCAGCTCGAACTTATCGGTACCGGCACTGTTGTTGCTCCCGACCAAACCCGCGTTGTCGCCAAGCGTGTCATTCGCAAGGCCAAGGTCGGTGTTTTCAGCTGCCCGATTGATATTTCGCAGACCGAGACCAAGGGGACTGTGCTTTTGAAGAACGCGCAGGAGATGTTGGATTTCACCAAGGGCGAGGAGGAGCGCCTCGAAACCGCCATCAAGGAGCTGTATGATTCCGGTCTCCGCGTTGTGGTTGCTGGCTCTTCCATCGGCGAGTTGGCTCTTCACTACTTGAACCGCTTCAACATCCTTGTGATCAAGATTCTGTCCAAATTTGAGCTGCGCCGTCTCTGCCGTGTGGTTGGCGCTACCCCGCTGGCCCGTTTGGGAGCCCCGATGCCCGACGAGATGGGTACGGTTGATGTGGTTGAGACTACTGAGATTGGCGGCGACCGTGTCACTGTCTTTCGACAGGACGATGCTAACAGCGTGACTCGTACGGCTACTATTGTCCTGCGCGGTGCTACTCAGAACCACCTTGACGATGTTGAGCGTGCCATTGACGACGGCGTCAATGTTGTCAAGGCGATCACCAAAGATCCGCGCCTTGTTCCTGGCGCTGGCGCGACCGAGATCCAGCTTGTGGAGCGGATCTCTGCTTTTGCTGACAGGACTCCCGGACTGCCACAGTACGCGATCCGGAAGTTCGCAGAGGCCTTTGAAGTGGTCCCTCGCACTCTTGCCGAGTCCGCCGGCTTAGACGCTACCGAGGTTCTCTCGCGCCTTTACACAAACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGT----TTACCATGGCTCCTCCGATCTCCAGTTGGAGCGTATGAATGTTTACTTCAACGAGGCCAGCGGTAACAAGTATGTTCCTCGTGCGGTCTTGGTCGATCTTGAGCC-CGGTACCATGGACGACAAGGATGGTGATGGACAAATCACCACCAAGGAGTTGGGCACCGTCATGCGCTCGCTCGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAACAATGGCACCATTGATTTCCCTGAATTCTTGA Penicillium_adametzii TATCTCCACAGCGTAATGGTCCTCTGATGGGTATTGTACAGGACAGTCTTTGCGGTATCTACAAGATTTGCCGTCGTGACATTTTCCTCACCAAAGATCAAGTCATGAACATTATGCTTTGGGTTCCTGATTGGGATGGTGTCATTCCACCTCCCGCGATCCTTAAGCCACGCCCTCGCTGGACTGGAAAGCAGATGATTAGTATGGCTTTCCCGTCTGGTCTGAACCTTCTGCGTATCGA---CAAGGATAGCTCCCCACTCTCCGAGAAATTTAGTCCTCTTAATGATGGTGGTGTGTTAATCCATGGCGGTCAGCTGATGTACGGTATGCTGTCGAAGAAGACCGTCGGTGCAAGTGGTGGAGGTGTTATCCATACCATTTTCAATGAGTATGGACCTGACCAAGCTGTGAACTTCTTCAATGGTGCGCAAAGAATTGTCAACTACTGGCTTTTGCACAATGGTTTCAGTATTGGTATCGGTGACACAATCCCCGATCGCAACACTATTGAGAAGATCGAGGAGGCTGTCCGTGAGCGCAAGAAGGAGGTGGAGCAGATTACTGCTAGCGCGACGGAGAATACTTTGGAGGCTTTGCCTGGTATGAACGTCCGTGAAACCTTTGAGAGTAAGGTCTCTCGAGCTCTCAACAACGCTCGTGACGAGGCTGGTGCTGCCACGGAGAAGAGTTTGAAGGATCTTAACAACGCCATCCAGATGGCTCGGTCCGGTTCCAAGGGTTCCACCATCAACATTTCCCAGATGCTGCGTCGAGACCAACAAACCCATTCAACTCAATATTGGTGTTAAGCATGCAACTATGACTGGTGGATTGAAGTACGCTTTGGCAACGGGTAACTGGGGCGAACAAAAGAAGGCGGCGAGCGCCAAGGCTGGTGTATCCCAAGTGCTGAGTCGTTATACTTATGCCTCGACTCTATCTCATCTGCGACGTACGAATACACCCATTGGGCGAGATGGTAAGATTGCCAAACCTCGTCAGTTGCATAACACACATTGGGGTTTGGTGTGTCCGGCCGAAACACCCGAAGGTCAAGCTTGTGGTCTTGTCAAGAACTTGGCGCTTATGTGCTACATCTCCGTCGGAACACCTAGCGAGCCGATCATTGATTTCATGATTCAACGTAACATGGAAGTTCTTGAGGAATTTGAGCCTCAGGTCACTCCAAATGCTACGAAGGTATTCGTCAATGGTGTCTGGGTTGGTATTCATCGTGATCCATCGCATCTGGTCAATACTATGCAATCGCTTCGCCGACGGAACTTGATTTCCAACGAAGTTAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACGGATGCTGGACGTGTTTGCCGACCACTCTTTGTCGTTGATAATGATCCTAAAAGCGAAAATGCCGGCTCCTTGGTTCTCAATAAAGAGCACATCCGCAAGCTGGAGCAGGACAAAGACT---------TACCACCTGAATTGGATCCGGAAGAACGCCGGGAGCGTTACTTCGGATGGGAGGGCTTGGTGAGATCCGGAGCAGTGGAGATTGTGGACGCCGAGGAAGAAGAAACTATTATGATTGTGATGACGCCAGAGGACCTGGAGATTTCAAAACAATTGCAGGCTGGCTATTCTCTGCC---AGACGACTCGGACGATCCCAACAAACGTGTTCGCTCAATCCTGAGCCAGCGTGCCCATACTTGGACCCATTGCGATAGTCCTTGGGAGACATCTGAGGACCGTCCCTATGAGCCTGAAGATTGGCGGAGACTCTTGCAGTTCGGCGACTACAAGGGCACCAAGAACCGGATCCTTCGTGAGGCGCTGGTCGGTGGAGTCAACCCCGGTATCCGTGTGGATGTCCATCTCCGTGCTGTACCAGCCCTGCTCCGTAACAAGCCTCAACCAGTCTCTCTTTTCTC-ACTGTTGCGTCATGAACATAAGCACACCGTTGTTAACATCAACATGACTCTAAGCTCCAGTGTTGAGAAGCCACTCAAGGCTAAGGAGGAGCTTATTGTCCAGTGCGGTCCCCGTCGTATGCTGGTGAACCCCATCTTCTCATCAGCCGACAACACCCCCAACAACGTGCACAAGTTCGACCGCTTCCTGCACCCAGGCCGCAGCGCCATCGCGACCTGGATCGGACCCATGACCTGGGGCGCTGTCCCTGTGCTGGTCTTCAGGAATAAACCCGCT------GAACAAGACCCAGAGGTCCTAGACTCAGCAGATGACA------------------AGCCAGAACCATTGTCTTTGGACCGACTTGACCTCATTGGTACTGGCACTGTGGTCGCACCTGACCCAGCTCGCGTTATTGCTAAGCGTGCCATTCGCAAGGCTAAGGTTGGCGTGTTCAGCTGCCCAATTGATGTCTCCCAAACCGAGACCAAGGGTACTGTTCTGCTGAAGAATGCCCAGGAAATGGTAGACTACACAAAGGGCGAGGAGGAACGTCTCGAGACTGCCATTAAGGAACTGTATGATTCTGGTCTGCGTGTGGTTGTTGCTGGTTCCACCGTTGGCGACCTGGCCCTTCACTACCTCAACCGCTTCAACATTCTGGTGGTCAAGATTCTCTCCAAGTTCGAGCTTCGTCGCCTGTGCCGGGTTGTTGGTGCCACTCCTCTGGCCCGTCTGGGTGCCCCCATGCCTGATGAGATGGGTCAAATCGATGTTGTCGAGACCACTGAAATTGGCGGTGACCGAGTCACTGTTTTCCGTCAAGAGGATGCCAACACTGTGACACGCACTGCCACCATTGTGCTCCGTGGTGCTACTCAGAACCATCTGGATGATGTTGAGCGCGCCATCGATGACGGTGTCAACGTTGTCAAGGCTATCACAAAGGACCCTCGTCTTGTTCCTGGTGCTGGAGCTACCGAGATTCAGCTCGTTGAGCGGATCTCCAACTTCGCTGATAAGACCCCCGGTCTGCCCCAGTACGCTATTCGCAAGTATGCCGAGGCCTTCGAAGTCATTCCTCGCACTCTCGCCGAATCCGCTGGTCTTGATGCCACCGAGGTTCTCTCCCGCCTTTACACAGAACATTGCCAGTGAGCACGGCCTCGATGGCGATGGCCA----CTTCACCGGTTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACCACGCCAGCGGTGACCGCTATGTTCCCCGTGCCGTCCTGGTCGACTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACTACCAAGGAGCTGGGCACTGTCATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGATATGATCAACGAGGTCGACGCCGATAATAACGGTACAATTGACTTCCCTGAGTTCCTTA Penicillium_arenicola TGTCTCCTCAGCGAAACGGTCCATTGATGGGTATCGTCCAGGATACCCTCTGCGGTATCTATAAGATCTGCAGACGTGATATTTTCTTGACTAAGGAGCAGGTCATGAACCTCATGCTTTGGGTGCCGGACTGGGATGGCGTAATTCCTCCACCAGCTATCTTGAAGCCGAGACCAAGATGGACTGGAAAGCAAATAATCAGCATGGCTCTGCCCTCTGGTTTGAACTTGTTGCGTGTTGA---TAAGGATGGTGCACCTCTTTCCGAGAAATTTTCGCCTTTGAATGACGGCGGTCTTCTTATCCATGGGGGTCAATTATTGTATGGCATGTTCTCCAAGAAGACTGTTGGTGCCAGCGGTGGTGGTGTTATTCATACAATCTTCAATGAGTGGGGCCCGTGGGCAGCTGTTGGTTTTTTCAATGGCGCTCAGACCATTGTCGGTTACTGGCTTTTGCACCATGGTTTCAGCATCGGTATTGGTGATACAATTCCCGATGCACTTACTATTCAACGTATTGAAAATGCTGTTCGTGCCCGAAAGCAGGAGGTCGAGTCTATCACAGCAAGTGCAACTGAGAACACACTCGAGGCCTTGCCCGGTATGAACGTCCGAGAAACTTTCGAAAGCAAGGTCTCGCGCGCCTTGAACAATGCTCGTGACGAAGCCGGTAGTGCAACAGAGAACAGTTTGAAGGATCTGAATAACGCCATTCAAATGGCTCGTTCAGGATCCAAGGGTTCGACTATTAACATTTCCCAGATGCTGTGTGGAATCTAACCGAGAGATCTACTTGAACATCGGTATCAAGGCTAGCACTCTGACTGGAGGTCTCAAGTACGCTCTTGCGACTGGTAACTGGGGTGAACAGAAGAAGGCCGCCAGCGCCAAGGCAGGTGTGTCTCAAGTGCTGAGTCGTTACACCTATGCATCTACGCTTTCGCATCTTCGTCGTACGAACACACCTATTGGTCGTGATGGAAAGATCGCAAAGCCCCGCCAGCTGCACAACACCCACTGGGGTTTGGTTTGTCCCGCAGAAACCCCTGAAGGACAGGCTTGCGGTCTTGTCAAGAACTTAGCACTCATGTGTTACGTCACCGTTGGTACTCCTAGTGAGCCAATTATTGACTTCATGATTCAACGCAACATGGAAGTCCTGGAAGAATTCGAGCCCCAAGTAACGCCGAATGCGACAAAGGTCTTTGTCAACGGTGTGTGGGTGGGAATTCATCGCGACCCTGCTCATCTTGTGAACACTATGCTCTCTCTTCGTCGACGAAACATGATCTCTCATGAGGTCAGCTTGATTCGAGATATCCGTGATCGGGAGTTCAAAATCTTCACTGACGCTGGACGTGTTTGTCGCCCATTGTATGTCATTGATAATGACCCCAAGAGCGAAAATTGCGGCTCGCTCGTTCTGAACAAGGAGCATGTCCGTAAACTGGAGGCAGATAAAGAGC---------TGCCGCCTGACATGGATGCGGAGGATCGCCGAGAACAATACTTCGGTTGGGACGGCCTGGTTAAATCCGGTGTGGTCGAATATGTCGATGCCGAGGAGGAGGAGACAATCATGATTGTTATGAGCCCCGAAGATTTGGAAATTTCGAAACAACTCCAGGCAGGCTACGCCCTCCCTGACGAAGAGGGTAGTGACCCGAACAAGCGAGTCCGTTCTATTCTGAGTCAGAGAGCGCATACCTGGACACACTGTGACAGCGCCTGGGATACCACCGAAGATCGCCCCCACGAGCCAGAGGAGTGGCGTAGATTGCTTCAGTTGGGCGACTACAAGGGCCTCAAGAACAGGATGGTTCGCGAGGCCTTGGTGGGCGGAGTCAACCCGGGAATCCGTGTCGACATTCACCTCCGTGCAGTGCCATCGGCTCTCCGCAGCCGTCCTCGGCCCATGGCCCTCTTCTC-CTTGCTCCGTCACGAGCACAAGCACACCGTTGTCAATGTAAACATATCATTGAACGCCAGTGTCGAAGCACCACTGAAATCCAAAGAGGAACTCATTATTCAGTGCGGTCCTCGTCGTTTGGTTGTCAGCCCTATCTTCTCCGCCGGTGACAACACCCCTAACAACGTGCACAAGTTCGATCGCTACTTGCACCCCGGCCGCAGTGCCATCGCCTCCTGGATTGGTCCTGTTACATGGGGTGCGGTGCCTGTCCTCGTCTTCAGGAACAAGC---AG------GTCCAGGATCCCGAGGTCCTCGACTCCATGGATG---------------ACAACGCTCCCAGCG---------TCAACCAGCTCGAGCTCATTGGAACCGGTACCATCGTTGCTTCCGACCAGGCCCGTGTCGTCGCCAAGCGTGTCATCAAAAAGGCCAAGGTCGGCGTTTTCAGCTGCCCCATCGATATCTCCCAGACCGAGACCAAGGGCACAGTGCTCCTTAAGAACGCCCAAGAGATGCTGGACTTCACTAAGGGTGAGGAGGAGCGCCTTGAGACTGCTATCAAGGAGCTTTACGATTCTGGTGTCCGTGTCGTTGTTGCCGGCGCCACCGTCGGTGAATTGGCCCTCCACTACCTCAACCGCTTCAATATCCTTATCATCAAGATCCTCTCCAAGTTCGAGCTCCGTCGTCTCTGCCGTGTTGTCGGTGCCACTCCTCTCGCTCGTCTTGGTGCCCCCATGCCCGATGAGATGGGAGCCGTTGATGTTGTCGAGACCACTGAGATCGGTGGTGACCGTGTCACTGTCTTCCGCCAGGAGGATGCCAATACTGTGACCCGTACAGCAACTATCGTTCTGCGCGGTGCTACTCAGAACCACCTCGACGATGTTGAGCGTGCTATTGACGATGGTGTCAATGTTGTTAAGGCCATTACCAAGGACCCACGTCTTGTTCCTGGCGCAGGCGCTACCGAGATCCAGCTCGTGGAACGTATCTCTGCGTTCGCAGACAGGACCCCCGGATTGCCCCAGCACGCAATCAGAAAGTTCGCTGAGGCATTCGAGGTTATCCCTCGCACACTCGCTGAGTCCGCTGGTTTGGATGCCACCGAGGTTCTTTCTCGCCTCTACACAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCTGGTGT----CTACAATGGCACCTCCGATCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGCCAGCGGAAACAAATATGTTCCTCGTGCCGTCTTGGTCGATCTCGAGCC-CGGCACCATGGATGACAAGGATGGTGATGGACAAATCACCACCAAGGAGTTGGGTACCGTCATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCTGAGCTCCAGGACATGATCAACGAGGTTGATGCCGACAACAACGGTACCATTGACTTCCCAGAGTTCCTTA Penicillium_canescens TTTCTCCCCAGCGTAACGGTCCCCTGATGGGTATTGTGCAGGACACTCTTTGTGGAATTTACAAGATCTGTCGTCGTGATACCTTCCTTACGAAGGCTCAGGTTATGAACCTTATGATGTGGGTTCCCGACTGGGATGGTGTGATTCCTCCCCCTGCTATCCTGAAGCCCCGACCCCGTTGGACAGGAAAGCAGATGATCAGCATGGCTTTCCCCTCTGGCCTGAACCTGCTGCGTGTTGA---CAAGGATGGTGCTGCTATGACGGAGAAGTTCAGCCCTCTCAATGATGGCGGTCTTCTGATCCACGGTGGACAGTTGATGTATGGTATGCTTTCTAAGAAGACTGTCGGTGCCAGCGGTGGTGGTGTCATTCACACCATTTTCAACGAGTACGGTCCCGACACTGCTGTCAACTTCTTCAACGGTGCTCAAACCATTGTCGGCTACTGGCTACTTCACAACGGTTTTAGTATCGGTATCGGTGACACTATTCCCGACCAACTGACTATCCAGAAGATCGAGGAGGCTGTCCGCAACCGAAAGCAAGAGGTCGAGACTATCACTGCTAGCGCCACTGAAAACACTCTGGAAGCTCTGCCTGGTATGAACGTCCGTGAGACATTCGAGAGCAAGGTTTCTCGTGCTCTGAACAACGCCCGTGATGAAGCTGGTGATGCCACCGAGAAGAGTTTGAAGGATCTGAACAACGCTATTCAAATGGCTCGCTCTGGTTCCAAGGGTTCCGCTATCAACATTTCCCAGATGCAGCGTCGAGACCAACCGTGAGATCTACCTCAACATTGGTATCAAGGCGGCCACACTCACAGGAGGTCTGAAGTATGCTCTTGCTACCGGTAACTGGGGCGAGCAGAAGAAGGCCGCCAGCGCCAAGGCTGGTGTGTCCCAGGTGCTGAGTCGTTACACTTTCGCATCTTCATTGTCCCATTTGCGACGTACCAACACACCCATTGGCAGAGATGGAAAGATTGCCAAACCACGTCAACTACACAACACCCATTGGGGTTTGGTCTGTCCAGCTGAGACACCTGAAGGTCAAGCTTGTGGTCTAGTCAAGAACTTGGCCCTCATGTGCTACATCACTGTTGGTACGCCGAGTGAGCCCATCATTGATTTCATGATTCAGCGAAATATGGAAGTTCTTGAGGAGTTCGAACCTCAGGTCACGCCAAATGCAACTAAGGTGTTTGTCAACGGTGTCTGGGTTGGTATTCACAGAGACCCTTCGCATCTTGTCGCTACAATGCAGAACCTTCGTCGACGAAACATGATCTCGCACGAGGTCAGTTTGATTCGTGACATCCGTGAGCGTGAATTCAAGATTTTCACCGACACCGGTCGTGTGTGCCGTCCCCTGTTCGTTATCGACAATGACCCCAAGAGTGAGAACTCTGGTGGGTTGATCCTCAACAAGGAGCATATTCGCAAGCTTGAGCAAGATAAGGACC---------TACCCGCCGATATGGATCCAGAGGAACGTCGCGAGCAGTACTTCGGATGGGATGGTCTAGTTCGCTCTGGTGCAGTTGAATATGTGGATGCTGAAGAAGAGGAGACTATCATGATTGTCATGACGCCCGAAGATCTTGAGATCTCCCGACAACTCCAGGCTGGTTACGCTCTGCCCGAGGACGAGACCAACGATCCCAACAAGCGCGTTCGCTCGATTCTCAGCCAGCGTGCCCACACTTGGACACATTGTGACAGTGCATGGGAGACATCCGAGGATCGTCCTTACGAGCCCGAAGACTGGCGCCGACTGCTGCAGTTTGCTGATTATAAGGGTTCCAAGAACCGCATCCTGAGAGAGGCTTTGGCAGGTGGTGTTAGTCCTGGTATCCGGGTCGATGTGCACCTTCGGGCAGTGCCTTCCATTCTGCGCAGCAAGCCCCAGCCGCTTTCGCTCTTCTC-GCTGCTCCGTCATGAACACAAGCAAACCGTGGTCAACATTAACATGACACTAAACTCTAGCTATGAAAAGCCCCTAAAGTCTAAGGAGCAGCTTGTCGTCCAGTGCGGTCCTCGCCGCATGATCGTCAACCCTATCTTCTCCGCAGCCGACAACACACCAAACAACGTCCACAAGTTCGACCGTTTCCTGCACCCTGGCCGCAGCGCTATCGCCTCCTGGATTGGGCCCGTTACCTGGGGCGCGGTCCCCGTCCTCGTCTTCAAGAACAAGCATGTT------GAG---------GACCCCGAAGAGATGGATACCGCAG------------ATGCCACAGATG---CTATTGACATGGACCGCCTTGAGTTGATCGGTACTGGTACCGTCGTTGCACCGGATCAGAAGCGTGTCGTTGCCAAGCGCGCTATTAGCCGCGCCAAGGTCGGTGTCTTCAGCTGCCCCCTCGATATCAGTCAGACCGAGACCAAGGGCACAGTCCTCTTGAAGAACGCCCAGGAGATGGTGGACTTCACCAAGGGTGAGGAGGAGCGTCTGGAGACTGCCATCAAGGAGCTCTACGACTCCGGTCTCCGCGTCGTTGTTGCCGGCTCCACTGTCGGCGACCTGGCCATGCACTACCTCAACCGTTTCAACATCTTGGTCATCAAGATTCTGTCCAAGTTCGAGCTCCGCCGTCTGTGCCGTGTTGTCGGTGCCACACCCCTCGCCCGTCTGGGTGCCCCCATGCCCGATGAGATGGGCCAAGTCGATGTTGTCGAGACCACCGAAATTGGCGGTGACCGTGTCACTGTGTTCCGCCAGGAAGACGCCAACGCCGTTACCCGCACAGCAACCATTGTCCTGCGCGGCGCCACCCAGAACCACCTGGAGGACGTCGAGCGTGCCATTGACGACGGTGTCAACGTCGTCAAGGCCATCACCAAGGACCCCCGCCTCGTCCCCGGTGCCGGTGCCACCGAGATCCAGCTCGTCGAGCGCATCTCCAACTTCGCCGACAAGACCCCCGGTCTGCCCCAGCACGCCATCCGCAAGTACGCCGAAGCCTTCGAGGTTGTTCCCCGCACACTCGCTGAGTCTGCCGGTCTCGATGCCACCGAGGTTCTCTCTCGCTTGTACACAAACCATTTCCGGTGAGCACGGTCTCGATGGCGATGGACA----GTACAATGGTACCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACCATGCCCACGGTGACAAGTACGTTCCCCGTGCCGTTCTCGTCGACTTGGAGCC-TGGTACAATGGACGACAAGGATGGCGATGGACAAATTACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGACATGATCAATGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCCGAGTTCTTGA Penicillium_catenatum TTTCTCCCCAGCGCAACGGTCCCCTCATGGGTATTGTACAGGACACTCTGTGTGGTATCTACAAGATCTGTCGTCGGGATATCTTCCTCACTAAGGACCAAGTCATGAACATTATGCTCTGGGTGCCTAACTGGGATGGTATCATTCCTCCTCCTGCCATCCTGAAGCCTCGTCCGCGTTGGACTGGAAAGCAAATGATCAGCATGGCTTTTCCGACTGGTCTCAACCTTCTGCGCATTGA---CAAAGACAGCTCGCCACTGTCCGAGAAATTCAGCCCTCTCAATGATGGTGGCCTGCTTATCCATGGTGGTCAGCTCCTGTATGGCATGCTGTCGAAGAAGACCGTCGGTGCCAGCGGTGGCGGTGTCATTCACACCATCTACAACGAGTACGGACCCGACACTGCAGTCAACTTCTTCAACGGCGCCCAAACTATTGTGAATTACTGGCTTCTGCACAATGGTTTCAGTATCGGTATCGGTGATACGATCCCTGATCAGAACACCATTGAGAAGATTGAGGAAGCTGTGCGCGAGCGCAAGAAAGAGGTCGAATCGATCACCGCCAGTGCCACCGAGAACACTTTGGAGGCTCTGCCCGGTATGAACGTTCGTGAGACTTTTGAGAGCAAGGTCTCTCGTGCTCTAAACAACGCCCGTGATGAGGCTGGTGCTGCCACTGAGAAGAGCTTGAAGGACCTGAACAATGCCATTCAGATGGCTCGCTCTGGTTCTAAGGGTTCTACCATCAACATTTCTCAGATGTTGCGTTGAAACCAACCGCGAAATTTACTTGAACATCGGTATCAAGGCAAGCACATTGACTGGTGGACTGAAGTATGCCCTGGCTACGGGTAACTGGGGTGAGCAAAAGAAGGCTGCCAGCTCCAAGGCCGGTGTGTCTCAAGTGTTGAGTCGCTACACCTACGCTTCCACCTTGTCCCATTTGCGACGTACCAATACTCCGATCGGCCGAGATGGCAAGATCGCCAAACCTCGCCAACTCCATAACACTCATTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGTCAGGCTTGTGGTCTGGTCAAGAACCTGGCACTGATGTGCTACATCACCGTTGGTACACCGAGCGAACCCATCATCGACTTCATGATTCAACGAAACATGGAAGTGCTCGAGGAGTTCGAGCCTCAGGTTACGCCCAATGCCACTAAGGTCTTCGTCAACGGTGTCTGGGTTGGTATTCATCGCGACCCGTCACACCTTGTCAACACCATGACATCACTTCGTCGGCGCAACATGATTTCTCACGAAGTCAGCTTGATTCGCGACATTCGCGATCGAGAATTCAAGATCTTCACTGATGCCGGTCGTGTATGTCGACCGCTGTTCACTGTGGACAATGATCCCAAGAGCGAAAACGCCGGATCGTTGGTGCTCAACAAGGAGCACATTCGCAAGCTTGAGCAGGACAAGGAAC---------TACCCCCAGACTTGGATCCAGAAGAACGCCGGGAGCGCTACTTCGGATGGGACGGTTTGGTACGGTCCGGAGCCGTTGAGTATGTGGACGCTGAAGAGGAAGAAACCATTATGATCGTGATGACCCCCGAGGACTTGGAAATTTCCAAGCAGCTCCAGGCCGGCTACGCGCTGCCCGAAGAGGAAACGAGCGACCCGAACAAGCGAGTGCGCTCCATTCTCAGCCAACGAGCACATACCTGGACACATTGTGACAGCCCTTGGGAAACTTCCGAAGATCGACCCTTCGAGCCCGAAGACTGGCGTCGATTGTTGCAGTTTGGCGACTACAAGGGGACCAAGAACAGGACCCTTCGGGAAGCTTTGGTTGGTGGTGTGAACCCTGGCATTCGTGTGGACGTCCATCTCCGAGCAGTACCATCCGTCCTGCGCCACAAACCCCAGCCTATTTCCCTCTTCTC-GCTGCTGCGTCACGAGCACAAGCACACTGTCGTCAACGTGAACATGACCCTAAACTCAAGCGTCGAGCAGCCTCTCAAGTCAAAGGAGGAGCTCATTGTGCAATGCGGTGCCCGCCGTATGGTGGTCAATCCGATCTTCTCGGCCGGCGACAACACCCCCAACAACGTGCACAAGTTCGACCGCTTCCTGCACCCTGGCCGTAGCGCCATCGCCACTTGGATCGGACCCATGACCTGGGGTGCCGTTCCTGTTCTTGTCTTTAAGAACAAGCGAGTC------GA---GGACCCGGAGATCCTCGACTCTGTGGACGCCA------------AGCAGGA------ACCACTTGCTATGGACCGTCTCGAACTGATTGGGACTGGCACAGTCGTCGCGCCTGATCCCAGCCGGGTGGTTGCCAAGCGCGCCATTCGCAAGGCCAAGGTCGGCGTTTTCAGCTGCCCGATTGATATCTCGCAAACCGAGACCAAGGGTACTGTCCTGCTGAAGAATGCACAGGAGATGGTTGATTTCACCAGGGGTGAGGAGGACCGCCTGGAGACTGCCATCAAGGAGCTGTATGACTCTGGTATGCGTGTACTTGTTGCCGGCTCTACTGTCGGCGACTTGGCGCTACACTACCTCAACCGCTTCAACATCCTAGTCATCAAGATCTTGTCCAAGTTCGAGCTTCGCCGCCTGTGCCGCGTGGTCGGCGCAACTCCCTTGGCCCGTCTGGGCGCTCCCATGCCCGATGAGATGGGCCAGGTTGACGTGGTTGAGACCACTGAGATCGGTGGAGACCGTGTCACCGTTTTCCGCCAAGAAGACGCCAACGCTGTCACACGCACATCGACCATTGTCCTCCGCGGCGCCACCCAGAACCACCTCGACGACGTCGAGCGTGCCATCGACGACGGTGTGAATGCCATCAAGGCCATTACCAAAGACCCCCGTCTCGTTCCCGGCGCCGGCGCCACCGAAATCCAGCTCGTCGAGCGCATCTCCAACTTCGCCGACAGGACTCCCGGCCTGCCTCAGCACGCCATCCGAAAGTACGCCGAGGCCTTCGAGGTAGTCCCTCGCACTTTGGCCGAGTCGGCCGGTCTCGATGCCACCGAGGTTCTGTCTCGTCTGTACCGAGACCATTGCTGGCGAGCACGGCCTCGATGGCGATGGCCA----CTACAATGGCGCCTCTGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACCACGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGACCTGGAGCC-CGGTACCATGGATGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCTCTGGGCCAGAACCCGTCCGAGTCCGAGCTGCAGGATATGATCAACGAGGTTGATGCCGACAACAACGGCACCATCGATTTCCCTGAGTTCCTTA Penicillium_charlesii TGTCTCCCCAGCGTAACGGCCCTCTGATGGGTATTGTGCAGGACAGTCTTTGCGGTATTTACAAGATGACTCGTCGTGATGTTTTCCTCACTAAGGATCAGGTCATGAACACCATGATGTGGGTTCCTGATTGGGATGGAGTAATTCCCCCTCCTGCCATTGTCAAGCCCCGTCCTCGCTGGACTGGCAAGCAGATGATCAGCATGGCATTCCCAAGTGGTCTCAATTTCCTTCGTGTCGA---TAAGGACGGCGCCCCACCGAGTGAGAAGTTCTCTCCCCTTAACGATGGTGGCTGTTTAATCCACGGCGGAGAGCTCCTCTACGGTATGCTTCTGAAGAAGGTCGTTGGTGCCACTGGTGGTGGTGTAATCCACGTCATTTTCAATGAATATGGACCTGATCAGACTGTCAACTTCTTTACTGCTGCCCAGCGCCTCACCAATTACTGGCTTCTCCACAATGGGTTCAGTATTGGCATTGGTGACACTATTCCTGACAAGGCAACTATCGAGAAGATTGAAGACGCTGTTCGCGAGCGCAAGAAGGAGGTCGAGGAGATCACTGCTAGCGCTACTGATAACACTCTCGAGGCTTTGCCTGGTATGAACGTCCGTGAAACGTTTGAGAGTAAGGTTTCACGCGCTTTGAACAATGCCCGTGATGAGGCCGGTGATGCTACGGAGAAGAGTCTGAAGGACATCAACAATGCCATTCAAATGGCCCGCTCTGGTTCCAAGGGCTCCACCATTAACATTTCTCAGATGCTGCGTTGAGAGTAACCGTGAGATCTACCTGAATATTGGTCTAAAGGCTAGCACTCTCACCGGTGGATTGAAATATGCTCTGGCTACAGGTAACTGGGGTGAGCAGAAGAAGGCTGCGAGTGCCAAGGCTGGTGTGTCTCAAGTGCTGAGTCGTTACACCTTCGCTTCATCCTTGTCCCATTTGCGAAGAACCAACACACCCATTGGACGAGATGGTAAAATCGCCAAACCCCGGCAACTTCACAACACCCATTGGGGTCTTGTTTGTCCTGCCGAGACGCCTGAAGGTCAAGCTTGTGGTCTTGTCAAAAACTTGGCACTCATGTGCTACATCACTGTTGGTACTCCCAGTGAACCTATTATTGACTTCATGATTCAACGTAACATGGAAGTCCTCGAAGAATTCGAGCCCCAAGTCACCCCGAATGCCACAAAGGTGTTTGTTAACGGTGTGTGGGTTGGTATTCATCGTGATCCTTCACACCTGGTCAATACTATGTCTTCCCTGCGTCGTCGCAACATGATTTCGCACGAAGTCAGTTTGATTAGAGATATCCGTGAGCGGGAATTCAAAATTTTTACTGATGCTGGACGTGTCTGCCGACCTCTCTTCGTGGTTGATAATGATCCAAAGAGTGAAAATGCCGGATCTTTGATTCTGAACAAGGAACATATCCACAAACTAGAACAGGATAAAGACT---------TGCCACCTGACCTCGATCCAGAAGAGCGTCGGGAACGTTACTTCGGATGGGATGGATTGGTGCGATCCGGAGCCGTGGAATACGTCGATGCCGAGGAAGAAGAGACGATCATGATTGTCATGACCCCCGAAGACTTGGAAATTTCCAAGCAGCTCCAGGCTGGATACGCTCTACCAGAGGACGAAACAAGTGATCCGAACAAGCGTGTGCGTTCGATTCTGAGCCAAAGAGCGCACACTTGGACTCACTGTGACAGCAACTGGGAGACTTCGGAAGACCGTCCCTTCGAACCCGAGGACTGGCGTCGACTACTCCAATTCGGCGACTACAAGGGCGCTAAGAACCGCATTCTCCGTGAGGCCCTGGTTGGTGGTGTGAACCCTGGTGTCCGAGTCGATGTGCACCTCCGCGCTGTCCCTACTGTGCTGCGCAACAAACGTCAGCCAACATCTCTCTTCTC-TCTTCTGCGCCACGAACACAAACACACCGTTGTTAACATCAACATGACCCTCAACTCGAGCTATGAGAAGCCTCTCAAGTCCAAGGAGGAAGTCATTATCCAATGTGGTGCTCGCCGCATGGTGGTGAAGCCTGTATTCTCTGCCAGCGACAACACGCCAAACAACGTCCATAAATTCGATCGCTTCCTGCACCCTGGCCGCAGTGCAATGGCCACTTGGATCGGTCCCATGACCTGGGGCGCGGTCCCCGTCCTCGTCTTCAAGAGCAAGCCCGCG------GAGACAGACCCGGAAGTCCTCGACTCCGCAGACATCA------------AGGAAGA------ACCATTGGCCATGGACCAACTAGAGCTGATTGGAACGGGAACTGTCGTCGCGCCCGACCCTGCCCGTGTTGTGGCTAAGCGTGCCATTAGCAAGGCCAAGGTTGGCGTGTTCAGCTGCCCCATTGACATCCAGCAGACCGAGACCAAGGGCACCGTGCTTCTGAAGAATGCTCAAGAGATGGTTGACTTCACCAAGGGTGAGGAGGACCGTCTGGAGACTGCCATCAAGGAGCTGTATGACTCTGGTCTCCGTGTCGTCGTTGCCGGTTCCACTGTCGGCGACCTGGCTCTGCATTACCTTAACCGCTTCAACATCCTCGTGATCAAGATCCTTTCCAAGTTCGAGCTTCGCCGACTCTGCCGCGTTGTTGGAGCCACGCCACTCGCCCGCTTGGGTGCCCCCATGCCTGATGAGATGGGTAGCGTTGACGTTGTCGAGACCACCGAGATTGGCGGAGACCGTGTTACTGTATTCCGACAAGAAGACGGCGCTGCCGTGACCCGTACTGCAACAATTGTGCTGCGTGGTGCCACTCAGAACCACCTGGAGGATGTCGAGCGCGCCATCGATGACGGCGTCAACGTCGTTAAGGCCATCACCAAGGACCCGCGTCTCGTGCCCGGCGCCGGAGCCACCGAGATCCAGCTCGTAGAGCGCATCTCCAACTTCGCCGACAAGACCCCCGGCCTTCCCCAACACGCCATCCGTAAATACGCCGAGGCCTTCGAGGTTGTCCCCCGTACGCTGGCCGATTCAGCCGGCCTCGATGCCACAGAGGTCCTGTCTCGCCTGTACACAGCAGATTGCTAGCGAGCACGGCCTCGACGGTGATGGACA----CTTCACCGGTGCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACCACGCTAGCGGTGACCGTTACGTTCCCCGTTCCGTCCTGGTTGACTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGACAAATCACCACCAAGGAGCTTGGCACTGTCATGCGCTCGCTTGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAAGTCGACGCCGACAACAACGGCACCATTGATTTCCCCGAATTCCTTA Penicillium_chrysogenum TTTCTCCGCAGCGTAACGGTCCTCTGATGGGTATTGTCCAGGATACACTCTGTGGTATCTACAAGATCTGTCGCCGTGACACCTTCCTCACCAAAGACCAAGTCATGAACCTCATGCTGTGGGTCCCTGACTGGGATGGTGCCATTCCCCCTCCTGCAATCATTAAGCCTCGCCCCCGTTGGACTGGAAAGCAGATGATAAGTATGGCTTTCCCCTCAGGTCTTAACCTTCTGCGTGTTGA---CAAGGACGGCTCGCCTTTGTCCGAGAAGTTCAGTCCTCTCAATGATGGAGGTCTCTTGATTCACGGTGGACAGCTGATGTATGGTATGCTTTCCAAGAAGACGGTCGGTGCCAGTGGTGGTGGTGTCATCCACACCATCTTCAACGAGTACGGCCCTGATACTTGCGTCAAATTCTTCACTGGTGCCCAAACAATCGTCGGGTATTGGTTGCTGCACAACGGTTTCAGTATTGGTATCGGTGACACCATTCCCGATCAACTTACTATCAACAAGATCGAGGAGGCTGTTCGGAACAGAAAACAGGAAGTCGAGGAGATTACGGCTAGTGCCACTGAGAACACATTGGAGGCACTTCCTGGTATGAATGTACGTGAGACATTCGAGAGCAAGGTCTCTCGTGCTCTCAACAACGCCCGTGATGAAGCTGGTGATGCCACCGAAAAGAGTCTTAAGGATCTGAACAACGCTATTCAAATGGCGCGCTCCGGTTCTAAGGGTTCAGCAATCAATATTTCGCAGATGATGCGTTGAGACCAATCGAGAAATTTATCTCAACATTGGTATCAAGGCTAGCACATTGACCGGTGGATTGAAGTATGCTCTTGCTACTGGTAACTGGGGCGAGCAGAAGAAGGCGGCTTCCGCCAAGGCTGGTGTGTCCCAGGTGCTGAGTCGTTACACATTTGCCTCCTCCTTGTCTCATCTGCGCCGGACAAACACCCCCATTGGCAGAGATGGAAAGATCGCCAAACCTCGCCAGCTCCACAATACTCATTGGGGTCTGGTCTGCCCGGCCGAGACACCTGAAGGTCAAGCTTGTGGTCTGGTCAAGAACCTTGCATTGATGTGCTACATCACTGTTGGTACACCTGCTGAACCTATCGTGGATTTCATGATTCAGCGGAACATGGAAGTTCTCGAGGAGTTCGAACCCCAAGTGACGCCTAATGCAACAAAGGTGTTTGTCAATGGTGTCTGGGTGGGTATTCACCGGGATCCTTCGCATCTTGTTACTACGATGCAGAATCTGCGTCGACGAAACATGATCTCCCATGAAGTCAGTTTGATTCGTGACATCCGTGAACGGGAGTTCAAGATCTTCACCGATACTGGACGTGTCTGCCGGCCACTCTTCGTTATTGATAATGATCCCAAGAGTGAAAACTCGGGCGGATTGGTCCTTAACAAGGAACACATTCGGAAGCTCGAGGCCGACAAAGACT---------TGCCAACAGACATGGCACCAGAGGAACGCCGCGAACAGTACTTCGGATGGGATGGCCTGGTGCGTTCAGGAGCAGTTGAGTATGTCGACGCTGAAGAAGAGGAAACTATCATGATTGTCATGACCCCTGAGGATCTTGAGATCTCTCGACAGCTCCAGGCTGGCTACGCTCTGCCAGATGACGAAACCAGCGACCCCAACAAGCGTGTTCGGTCGATTCTCAGCCAGCGTGCCCACACCTGGACGCACTGCGACAGCCACTGGGAAACATCCGAGGATCGTCCCTACGAGCCCGAGGATTGGCGCCGACTGCTGCAGTTTGCCGATGTCAAGGGTTCCAAGAACCGCATCATTCGAGAGGCTTTGGCCGGCGGCGTTAACCCTGGTGTCCGCGTGGATATTCACCTTCGCGCAGTTCCTTCCATTCTACGCAACAGCCCCAAGCCCACTTCGCTCTTCTC-TCTGCTCCGCCATGAGCACAAGCATACTGTGGTCAACGTTAGCATGACCCTGAACTCCAGTTATGAGAAGCCCCTTAAGGCTAAGGAGCAGCTCATCGTCCAGTGCGGTGCCCGCCGCATGGCCATCAACCCCATCTTCTCGTCGGCTGATAATACGCCAAACAACGTTCACAAATACGACCGATTCTTGCATCCTGGTCGTAGTTGCATCGCATCCTGGATAGGACCCATGACCTGGGGCTCAGTTCCTATCCTTGTCTTCAAACAGAAGCAAGCC------GAGGAGGAGGATGGTGATGAGGAGATGGAGACCG---------------ATGCCAAGGAGGTGCCAATTGCCCTGGACCAGCTCGAACTGATCGGTACTGGTACTGTTGTCGCACCCGATCAGAAGCGCGTGGTTGCCAAACGTGCCATCACCAAGGCCAAGGTCGGCGTTATCAGCTGCCCCATCGATATCAGCCAGACCGAGACCAAGGGCACAGTTCTCCTGAAGAATGCTCAGGAGATGATGGACTTCACCTCGGGTGAGGAGGATCGTCTGGAGATTGCTATTAAGGAGCTTTACGATTCCGGCCTCCGCGTGGTCGTTGCCGGGTCCACTGTTGGCGACTTGGCCATGCACTACCTCAACCGTTTCAATATCCTGGTCATTAAGATTCTGTCCAAGTTCGAGCTCCGCCGCCTGTGCCGCGTTGTCGGCGCCACACCTCTGGCTCGTCTGGGCGCCCCCATGCCCGATGAGATGGGCCAGATCGATGTTGTCGAGACGACCGAGATTGGCGGTGACCGAGTGACCGTCTTCCGCCAGGAGGATGTTAACGCCATCACCCGCACAGCAACCATTGTCTTGCGCGGTGCCACCCAGAACCACTTGGAGGACGTCGAGCGTGCCATCGACGACGGCGTCAACGTCGTCAAGGCCATCACCAAGGACCCCCGTCTCGTGCCCGGTGCCGGTGCAACGGAGATCGAGCTCGTCGAGCGCATCTCCAACTTCGCCGACCGAACCCCCGGTCTGCCCCAGTACGCCATCCGCAAGTTCGCCGAGGCCTTCGAGGTCGTTCCCCGCACACTCGCCGAGTCTGCCGGTCTTGATGCCACCGAGGTTCTCTCGCGTCTGTACACAAACCATCTCTGGCGAGCACGGTCTCGATGGCGATGGACA----GTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGGCAAATCACCACCAAGGAACTTGGCACAGTCATGCGCTCGCTGGGTCAGAACCCCTCCGAGTCCGAATTGCAGGATATGATCAACGAGGTTGATGCCGACAACAACGGCACTATTGACTTCCCCGAATTCCTTA Penicillium_cinnamopurpureum TGTCTCCTCAGCGCAACGGTCCTCTCATGGGTATCGTTCAAGACACCCTCTGCGGAATTTACAAGATTTGCCGCCGAGACACGTTCCTCACGAAGGACCACGTCATGAACATTATGCTTTGGGTGCCCAACTGGGACGGCATGATTCCTCCACCAGCCATTCTCAAGCCTCGTCCGCGCTGGACAGGAAAGCAAATCATCAGTATGGCCTTCCCTTCTGGTCTTAACCTGCTGCGCATCGA---CAAGGATAGCTCGCCACTCTCCGAGAAATTTAGTCCTCTTAATGATGGTGGTCTGCTGATCCACGGTGGGCAGCTTTTGTATGGCCTGCTCTCCAAGAAGGTCGTTGGTGCCAGTGGTGGTGGTGTTATCCACACCATTTTCAATGAATATGGCCCGGACACTGCAGTGAACTTTTTCAATGGAGCCCAGACCATTGTCAACTACTGGCTTCTGCACAATGGCTTCAGTATTGGTATCGGCGATACGATTCCTGATCGCCTGACCATTCAAAAGATTGAGGAGGCTGTCCGGGAGCGCAAGAAGGAGGTCGAGTCGATTACTGCCGAGGCTACAGAGAACAAACTGGAGCCTTTGCCCGGAATGAACGTGCGTGAAACGTTTGAGAGCAAGGTGTCTCGTGCTCTCAATAACGCCCGTGATGAAGCTGGTGCTGCCACCGAGAAGAGTTTGAAGGACTTGAACAACGCCATCCAGATGGCCCGCTCGGGCTCGAAGGGTTCCACGATCAACATTTCCCAGATGCTGTGTCGAAAACAACCGAGAGGTTTACCTCAACATCGGTCTGAAGTCTGCCACCCTCAGCAATGGCCTGAAGTATTCGCTGGCTACCGGTAACTGGGGTGAACAAAAGAAGGCGGCCAGCTCCAAGGCTGGTGTGTCTCAAGTGCTGAGTCGTTACACCTACGCCTCTACCTTGTCGCATCTTCGCCGTACCAACACGCCCATCGGCCGAGATGGTAAGATTGCCAAACCGCGTCAACTTCATAACACCCATTGGGGTCTTGTGTGTCCGGCCGAAACGCCTGAAGGACAGGCTTGTGGTCTGGTGAAGAACTTGGCCTTGATGTGCTACATCACCGTCGGTACACCCAGTGAGCCGATTATCGACTTTATGATTCAGCGAAACATGGAAGTTCTGGAGGAATTTGAGCCTCAGGTCACTCCGAACGCCACCAAGGTGTTTGTCAACGGTGTTTGGGTCGGTATCCACCGTGATCCGTCGCATCTCGTAAACACCATGGCTACGTTGCGCCGTCGGAACATGATTTCTCACGAAGTCAGCTTGATTCGCGACATTCGTGAGCGAGAGTTCAAGATCTTTACTGATACTGGGCGTGTTTGCCGACCGTTGTTCGTGGTTGACAATGACCCCAAGAGTGAGAATGCCGGGTCGTTGGTTCTGAACAAGGAGCACATTCGCAAACTGGAGCAGGATAAGGAGT---------TGCCGCCAGACTTGGATCCGGACGAACGCCGTGAACGCTACTTCGGATGGGACGGCCTCGTTCGATCTGGGGTCGTGGAATATGTGGATGCCGAGGAAGAGGAAACCATTATGATTGTGATGACCCCCGAGGACTTGGAGATCTCCAAGCAGCTCCAAGCCGGCTATGCCATGCC---GGAGGAGACGAGCGATCCCAACAAGCGAGTCCGGTCGATTCTCAGCCAACGGGCACATACCTGGACACACTGTGATAGCCAATGGGAAACTTCCGAGGATCGCCCCTTCGAGCCGGAGGATTGGCGACGACTGCTGCAATTTGGCGACTACAAGGGCACAAGGAACCGCACCCTCCGAGAAGCGTTGATTGGCGGAGTAAACCCGGGCATTCGTGTGGACGTTCGTCTTCGCGCTGTGCCGGCCTCGCTCCGCAGAAAGGCTCAGCCGCTCTCGCTCTTCTC-ACTGCTTCGCCATGAGCACAAGCACACCGTCGTAAACGTCAACATGACACTCAACTCCAGTGTTGAGCAGCCCCTCAAGTCGAAGGAAGAACTTGTTGTTCAGTGTGGCGCCCGCCGAATGGTGGTCAAGCCTGTTTTCTCGGCTGGTGACAACACGCCTAACAATGTGCACAAGTTTGACCGCTTCCTACACCCGGGCCGCAGTGCCATCGCCACATGGATTGGACCCATGACCTGGGGTGCTGTTCCGATCCTTGTCTTCAAGAACAAGCAGACG------GAGGCGGACCCAGAAGAACTCGAATCGGCGGATGCTG------------CCAAGGA------ACCCATTTCGTTGGACCGTCTGGAGTTGATTGCTACTGGTACCGTCGTTGCGCCGGATCCTGCCCGTGTGATCGCCAAGCGTGCAATCCGCAAGGCCAAGGTCGGCGTGTTCAGCTGCCCTATTGATGTTTCGCAGACTGAGACCAAGGGTACTGTTCTGCTGAAGAATGCCCAGGAGATGGTCGATTACACCAAGGGCGAGGAGGAGCGTCTGGAGACTGCCATCAAAGAGCTGTATGACTCTGGCCTCCGCGTGGTGGTTGCCGGCTCCACCGTCGGCGATCTCGCTATGCACTACCTCAACCGCTTCAACATCCTCGTTATCAAGATCCTGTCCAAGTTCGAGCTCCGCCGTTTGTGCCGTGTGGTGGGCGCTACCCCCTTGGCTCGTCTGGGCGCCCCCATGCCCGACGAGATGGGCAACGTGGATGTGGTCGAGACGACCGAGATTGGTGGTGACCGAGTGACTGTGTTCCGTCAAGAAGATGCTACCAATGTGACCCGCACGTCGACAATTGTCCTGCGTGGTGCTACACAGAACCATCTGGAGGACGTCGAGCGTGCTATCGACGATGGCGTGAACGTTGTCAAGGCCATCACCAAGGACCCTCGTCTTGTGCCGGGTGCTGGTGCCACCGAGATCCAGCTCGTCGAGCGTATCTCCAAGTTCGCGGACCGCACCCCCGGTCTGCCGCAACACGCTATCCGCAAGTACGCTGAGGCCTTCGAGGTGGTCCCTCGGACGCTCGCCGAATCTGCCGGTCTCGATGCCACTGAGGTTCTGTCCCGTCTCTACACAAAACATTGCTGCCGAGCACGGCCTCGACGGTGATGGACAGTAACTTCACCGGTGCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTACTTCAACCATGCTTCCGGTGACCGCTATGTTCCCCGTGCCGTCCTGGTCGACCTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGACAAATCACCACCAAAGAGCTCGGCACCGTGATGCGCTCGTTGGGTCAGAACCCCTCCGAGTCGGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAACAACGGCACCATTGACTTCCCCGAGTTTCTCA Penicillium_citreonigrum TGTCCCCCCAGCGCAACGGTCCTCTTATGGGTATTGTCCAGGACACCCTGTGCGGTATCTACAAGATTTGCCGTCGTGACGTCTTCCTCACCAAGGATCAGGTCATGAACATCATGCTCTGGGTGCCAGATTGGGATGGTGCCATTCCTCCTCCCGCCATTCTGAAGCCTCGTCCGCGCTGGACTGGAAAGCAGATGATCAGTATGGCTTTCCCCACTGGTCTCAACCTTCTGCGTATCGA---CAAGGACAGTTCGCCACTCTCTGAGAAATTTAGCCCACTCAATGACGGTGGCTTGCTGATCCACGGCGGCCAGCTCTTGTACGGCATGCTCTCGAAGAAGACCGTCGGTGCCAGCGGTGGTGGTGTTATCCACACCATTTTCAATGAGTATGGGCCGGACACCGCTGTGAACTTCTTCAACGGTGCCCAGAGAATCGTCAACTACTGGCTTCTGCACAACGGCTTCAGTATCGGTATCGGTGATACGATTCCCGATCGAAACACCATTGACAAAATTGAGGAGGCAGTCCGCGAGCGCAAGAGGGAGGTCGAACAGATCACCGCTAGCGCCACTGACAACACTCTGGAAGCCCTGCCTGGTATGAACGTCCGTGAAACCTTTGAGAGTAAAGTTTCTCGTGCTCTTAACAACGCTCGTGACGAGGCTGGTGCCGCCACCGAAAAGAGTCTGAAGGATTTGAACAATGCCATCCAGATGGCGCGCTCTGGTTCGAAGGGTTCCACCATCAACATTTCTCAGATGATGCGTTGAGACCAACCGGGAGATCTACTTGAACATGGGTATCAAGGCTGCTACTCTGACCAGTGGTTTGAAGTACGCCCTCGCAACGGGTAACTGGGGTGAGCAGAAGAAGGCGGCCAGTGCCAAGGCCGGTGTGTCTCAAGTGCTGAGTCGCTATACTTATGCCTCTACGCTATCTCATTTGCGCCGTACCAACACACCCATTGGCCGAGATGGTAAGATCGCCAAGCCTCGACAGCTTCACAATACTCACTGGGGTCTTGTGTGCCCTGCCGAAACGCCTGAAGGTCAGGCTTGTGGCCTGGTCAAAAACTTGGCGCTTATGTGTTATATCACCGTGGGTACTCCCAGCGAGCCCATCATCGATTTCATGATCCAGCGTAACATGGAGGTTCTCGAAGAATTCGAGCCTCAAGTTACACCCAACGCCACCAAGGTCTTCGTCAACGGTGTTTGGGTTGGTATCCATCGCGATCCATCCCATCTCGTCAATACCATGATGTCCTTGCGTCGGCGAAACATGATCTCTCATGAGGTCAGCTTGGTTCGTGATATTCGTGACCGAGAGTTCAAGATTTTCACGGATACTGGCCGTGTGTGTCGACCTCTGTTCACCGTTGATAACGACCCCAAGAGCGAGAACGCTGGATCGTTGATTCTGAACAAGGAGCACATTCGCAAGCTTGAGCAGGACAAGGAAT---------TGCCGCCCGACATGGATGCAGAAGACCGCCGGGAGCGCTATTTCGGATGGGATGGCTTGGTGAGGTCTGGAGCCGTGGAGTTGGTTGATGCCGAGGAAGAGGAGACCATTATGATTGTCATGACGCCCGAAGACTTGGAGATCTCCAAGCAGCTTCAGGCCGGCTATGCGCTGCCAGAAACTGACACGGACGACCCTAACAAGCGAGTCCGTTCCATCCTCAGTCAGCGGGCACACACCTGGACACATTGCGACAGTCCCTGGGAGACATCCGAGGACCGACCCTTCGAGCCGGAGGACTGGCGGCGGTTGTTGCAGTTCGGTGACTACAAGGGTATCAAGAACCGTGTTATTCGTGAAGCCCTTGTCGGTGGTGTTAACCCGGGTATCCGTGTGGATATCCACCTTCGTGCGGTGCCATCCGCTCTCCGCCACAAGGCCCAGCCGCTCTCCCTTTTCTC-CCTCTTGCGCCACGAGCACAAGAACACCGTGGTTAACGTCAACATGACCCTGAATGGCAGCGTCGAGAAGCCCCTCAAGGCCAAGGAGGAGCTCGTTGTGCAGTGCGGAGCCCGCCGCATGGTGGTCAAGCCTGTGTTCTCCGCCGCTGACAACACCCCCAACAACGTGCACAAGTTCGACCGTTACTTGCACCCAGGCCGCAGCGCTATCGCCACATGGATTGGACCCATGACCTGGGGCGCCGTCCCTGTCCTTGTCTTCAGAAACAAGCAAGCT------GAAGAGGATCCTGAGATCCTCGACTCCGCGGACACCA------------AGCAGGAGCAGGAGCCTCTCGACATGGACCGCCTGGAGCTGATTGGCACCGGCACTGTAGTTGCACCCGATCCCAAGCGTGTCATTGCCAAGCGTGCCATTCGCAGGGCCAAGGTCGGCGTGTTCAGCTGCCCCATTGACACCTCGCAGACCGAGACCAAGGGTACTGTTCTGCTGAAGAATGCCCAGGAGATGGTCGACTACACCAAGGGTGAGGAAGAGCGCTTGGAGACTGCCATCAAGGAGCTGTATGACTCCGGCCTTCGCGTGGTTGTTGCTGGCTCTACTGTCGGTGACCTTGCCATGCACTACCTCAACCGCTTCAACATCCTGGTCATCAAGATTCTGTCCAAGTTCGAGCTCCGCCGCCTCTGCCGCGTCGTCGGTGCTACCCCCCTGGCCCGCCTGGGTGCCCCCATGCCCGACGAGATGGGTCAAATCGATGTCGTTGAGACTACCGAGATCGGTGGTGACCGTGTCACCGTGTTCCGTCAAGAAGACGCCAACGCCGTGACACGCACCGCCACAATCGTTCTGCGCGGCGCTACCCAGAATCACCTGGAGGACGTCGAGCGTGCTATCGATGACGGCGTTAACGTCGTTAAGGCCATCACCAAGGACCCGCGCCTCGTGCCCGGCGCCGGAGCCACCGAGATCCAGCTTGTGGAGCGCATCTCCGCCTTCGCCGACAAGACCCCGGGTCTGCCCCAGTACGCCATCCGCAAGTACGCCGAGGCATTTGAAGTGATCCCGCGCACTCTCGCCGAGTCCGCCGGTCTGGACGCCACCGAGGTTCTCTCCCGCCTGTACACAAACCATTGCTGGTGAGCATGGCCTTGACGGCGATGGCCA----GTACGCTGGTGTCTCCGACCTCCAGCGCGAGCGCATGAACGTCTACTTCAACGAGGCCAGCAACGACAAGTACGTTCCCCGTGCCGTCCTGGTCGACTTGGAGCC-CGGTACCATGGATGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCCGAATTCCTCA Penicillium_citrinum TGTCCCCTCAGCGAAATGGTCCTCTTATGGGTATCGTGCAGGACACTCTTTGTGGTATTTATAAGATTTGCCGTCGTGACACTTTCCTTACAAGGGATCAAGTCATGAACCTCATGCTCTGGGTTCCCGACTGGGACGGTCTTATCCCCCCTCCGGCTATTCTGAAGCCTCGTCCTCGCTGGACCGGAAAACAGATGATCAGCATGGCTTTCCCTACTGGTCTCAATCTCCTCCGTATCGA---CAAGGACAGCTCACCGCTTTCCGAGAAGTTTAGCCCTCTGAACGATGGTGGTCTGCTGATCCACGGTGGACAGCTGCTGTATGGTATGCTCTCTAAGAAGACCGTGGGTGCCAGCGGTGGTGGTGTAATCCACACCATTTTCAACGAATATGGCTGTGATACTGCTGTGAACTTCTTCAATGGAGCTCAGACAATCGTTAATTACTGGTTGCTGCACCATGGATTCAGTATTGGTATCGGTGATACCATCCCCGATCACAATACCATTCAAAAGATTGAGGAAGCCGTTCGCGAGCGTAAGCAGGAAGTCGAATCGATCACTGCCAGCGCCACCGAGAACACCTTGGAGGCTCTGCCTGGTATGAACGTTCGTGAAACCTTCGAGAGCAAGGTCTCGCGTGCCTTGAACAACGCTCGTGATGAGGCTGGTGCCGCCACCGAAAAGAGTTTGAAGGATATCAACAACGCTATCCAGATGGCTCGATCCGGTTCTAAGGGTTCTACAATTAACATTTCCCAAATGCTGCGTTGAGACCAACCGTGAGATTTACTTGAACATTGGTCTGAAGGCTGCCACTCTGACTAGTGGTCTCAAATATGCGCTTGCTACAGGTAACTGGGGTGAGCAAAAGAAGGCAGCTAGCGCCAAGGCTGGTGTTTCTCAAGTGTTGAGTCGTTATACATTTGCTTCCTCGCTGTCTCACTTGCGCCGTACAAACACGCCCATTGGTCGTGATGGTAAGATTGCCAAACCTCGTCAGCTTCATAATACACACTGGGGTCTGGTTTGTCCAGCCGAAACCCCCGAAGGACAGGCTTGTGGTCTTGTCAAGAATCTGGCGCTCATGTGCTACATCACTGTCGGTACTCCTAGCGAGCCTATTATCGACTTCATGATCCAGCGAAATATGGAAGTTTTGGAAGAGTTCGAGCCCCAAGTCACACCGAATGCCACGAAGGTCTTTGTTAATGGTGTCTGGGTCGGTATCCACCGTGATCCGTCGCATCTGGTGAACACTATGCAATCGCTGCGTCGACGCAACATGATCTCTCACGAAGTCAGTTTGATTCGGGATATCCGCGAGCGAGAGTTCAAGATTTTCACCGATACTGGACGTGTCTGTCGTCCATTGTTCGTTGTTGACAATGATCCCAAGAGCGAAAATGCTGGATCTTTGATTCTCAACAAGGAACATATTCACAAGCTTGAACAAGATAAGGACT---------TGCCACTTGATATGGACGTGGAAGAGCGCCGGGAGCGTTACTTCGGATGGGATGGTCTGGTTCGATCAGGAGCTGTCGAATACGTCGATGCAGAAGAAGAGGAGACGATCATGATCGTCATGACACCGGAAGATCTCGAGATCTCCAAACAGCTTCAAGCTGGCTATGCACTGCCCGAGGAGGAGACTAATGATCCGAACAAGCGAGTTCGCTCAATTCTTAGCCAGCGCGCCCACACCTGGACTCACTGTGACAGTCCTTGGGAAAAGTCCGAGGATCGTCCGTTCGAGCCGGAAGACTGGCGACGCCTGCTGCAATTCGGCGATTACAAGGGCACAAAGAACCGTGTTCTTTGTGAGGCCCTGGCTGGTGGTGTGAACCCCGGTATCCGAGTCGATATTCACCTGCGTGCAGTGCCCACCGCTCTGCGCCAGAAAGCCCAGCCCTTCGCATTGTTCTC-CCTACTACGACACGAGCACAAGAACACAGTCGTCAACGTCAACCTGACCCTGAACTCCAGTGTCGAGAAACCTATCAAGTCTAAGGAGGAACTCATTGTACAAGTCGGTGCTCGCCGAATGGCTGTGAAGCCCATCTTCTCCGCTGGTGACAACACTCCCAACAACGTTCACAAATTCGACCGATTCCTGCACCCCGGCCGCAGCGCCATCGCGACTTGGATTGGACCCATGACCTGGGGTGCTGTTCCGATCCTTGTTTTCAAGAACAAGCAAGCC------GAGGCGGATCCGGAGGTCCTTGACACCGCTGATGTCG------------ACC------------CATTCAGCCTCGATCGACTTGAGCTCGTCGGTACCGGTACCGTCATTGCACCTGACCAAAACCGTGTTGTTGCCAAGCGTGCCATTCGCAAGGCCAAGGTCGGCGTTTTCAGCTGCCCCATTGATACTCAACAGACTGAGACTAAGGGTACTGTGCTACTCAAGAACGCCCAGGAGATGGTGGACTTCACCAAGGGCGAGGAGGAACGCCTGGAGACTGCCATCAAGGAGCTCTATGACTCTGGTCTCCGCGTCGTCGTTGCTGGCTCTACCGTCGGCGACCTTGCTATGCACTATCTCAACCGCTTTAACATTCTGGTCATCAAGATTCTCTCTAAGTTCGAGCTCCGCCGTCTGTGCCGCGTCGTCGGCGCTACCCCTCTGGCCCGTTTGGGCGCTCCCATGCCCGATGAGATGGGCACCGTTGACGTTGTCGAGACCACCGAGATCGGTGGTGACCGTGTCACCGTTTTCCGTCAAGAAGATGCCAGCTCCGCCACCCGCACATCCACAATCGTGCTGCGCGGTGCTACTCAGAATCACCTGGATGATGTCGAGCGTGCCATTGATGACGGCGTGAACGTCGTCAAAGCTATCACCAAGGACCCCCGTCTCGTCCCCGGTGCTGGTGCCACCGAAATTCAGCTCGTTGAGCGAATCTCTGCTTTCGCAGACAAGACCCCCGGTCTACCCCAGCACGCTATCCGCAAATTCGCCGAAGCCTTCGAGGTCGTTCCTCGCACCCTCGCCGAGTCTGCCGGTCTCGATGCCACCGATGTTCTCTCCCGCCTGTACACAAACCATTGCTGGCGAGCACGGCCTTGATGGCGATGGACA----CTACAACGGAACCTCCGATCTCCAGCTGGAGCGCATGAACGTCTACTTCACCCACGCTTCCGGTGACAAGTATGTTCCCCGTGCCGTCCTGGTCGACTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATTAACGAGGTTGACGCCGATAACAATGGCACCATTGATTTCCCCGAGTTCCTGA Penicillium_coffeae TTTCGCCCCAGCGTAACGGTCCCTTGATGGGTATTGTGCAAGACAGTCTTTGCGGTATCTACAAGATTACTCGCCGAGATGTCTTTCTTACTAAGGATCAGGTCATGAACATCATGATGTGGGTACCTGACTGGGATGGCGTTATTCCCCCACCTGCTATTCTCAAGCCTCGCCCTCGCTGGACTGGAAAGCAGATGGCTAGCATGGCGTTCCCTGGCGGACTCAATTTCCTCCGTGTTGA---CAAAGACAGCGCGCCAATCAGCGAGAAGTTTTCTCCTCTCAATGATGGTGGCTGTTTGATCCATGGTGGTGAGCTGCTGTATGGTGTGCTCTTGAAAAAGGTCGTGGGTGCTACTGGTGGTGGTGTCATTCATGTCATTTTCAATGAATATGGCCCCGACCAGACCGTCAACTTCTTCACTGCAGCTCAACGCATCACTAACTATTGGCTCCTTCACAATGGATTCAGTATTGGTATTGGTGACACAATTCCTGACAAGACAACCATTGAGAAAATTGAGGATGCTGTCCGTGAACGCAAGAAGGAGGTCGAAGAGATCACCGCTAGCGCTACTGACAATACGCTGGAGGCTTTGCCTGGTATGAACGTGCGTGAAACTTTCGAGAGCAAGGTCTCGCGTGCTTTGAACAATGCTCGTGATGAAGCTGGTGATGCCACAGAGAAGAGTCTGAAGGACATCAACAATGCCATCCAGATGGCTCGATCTGGTTCCAAGGGTTCCACCATTAACATTTCCCAGATGTTGTGTTGAGAGCAACCGTGAGATCTATCTGAACATTGGTCTCAAGGCCAGCACTCTCACCGGTGGTCTGAAGTACGCTCTGGCTACGGGTAACTGGGGTGAGCAAAAGAAGGCTGCGAGCGCTAAGGCTGGTGTGTCTCAAGTGCTGAGTCGTTATACCTTTGCCTCCAGTTTGTCGCATTTGCGAAGAACCAACACACCCATTGGACGAGATGGAAAAATCGCCAAACCCCGACAACTGCACAACACTCACTGGGGCCTCGTGTGTCCTGCTGAAACACCTGAAGGTCAGGCTTGTGGTCTCGTCAAGAACCTGGCACTGATGTGTTGTATCACCGTCGGTACTCCGAGTGAGCCCATCATCGATTTCATGATTCAACGTAACATGGAAGTACTCGAAGAATTCGAGCCTCAGGTCACTCCAAACGCCACCAAGGTATTCGTCAACGGTGTCTGGGTTGGTATTCACCGTGACCCCTCTCACCTGGTTAACACCATGGCTTCTCTGCGTCGTCGCAGCATGATTTCGCACGAAGTCAGCTTGATTCGTGACATCCGTGAGCGCGAGTTCAAGATTTTCACTGATGCTGGTCGAGTCTGCCGACCCCTCTTCGTGGTTGACAATGACCCCAAGAGTGAAAATGCTGGATCTTTGGTTCTTAATAAGGAGCACATTCACAAGCTGGAGCAAGACAAGGATC---------TGCCGCCAGATCTGGATTTGGATACCCGCCGGGAGCAATATTTCGGGTGGGAAGGATTGGTTCGATCCGGAGCCGTGGAATATGTGGATGCTGAAGAAGAGGAGACAATCATGATTGTCATGACTCCCGAAGATTTGGAAATCTCCAAACAGCTCCAGGCTGGATATGCCATGCCAGAGGATGAGACAGCCGATCCTAATAAGCGTGTCCGGTCGGTCTTGAGTCAAAAAGCGCACACTTGGACCCATTGTGATAGTAACTGGGAGACATCCGAAGACCGCCCCTTCGAGCCGGAAGATTGGCGCAGGCTTCTTCAGTTCGGTGACTACAAGGGTACCAAGAACCGCATTCTTCGCGAGGCTTTGGCCGGTGGTGTCAACCCCGGTGTGCGTGTAGACGTACACCTCCGTGCTGTCCCAGTTGTGCTTCAGAGCAAGCCTCAGCCAGTATCGTTGTTCTC-TCTCCTGCGTCACGAGCACAAGCACACTGTGGTCAACATCAACATGACACTCAACTCTAGTGTCGAGAAGCCCCTCAAGTCTAAGGAGGAGGTAATTGTTCAATGTGGTGCACGTCGCATGGTCGTCAAGCCTGTCTTCTCATCCGCCGACAACACCCCCAACAACGTCCACAAGTTTGACCGCTTCCTGCACCCTGGTCGCAGTGCTATTGCTACCTGGATTGGCCCCATGACCTGGGGAGCTGTTCCAGTCCTAGTCTTCAAGAACAAGCCAGCC------GAGGAGGACCCTGAAGTCCTCGAATCAGCAGACGCCA------------AAGAAGA------GCCATTATCCCTGGACCAACTTGAGCTCATTGGAACCGGTACTATTGTTGCACCAGACCCAGCTCGTGTTGTCGCCAAGCGTGCCATCAGCAAGGCCAAGGTCGGCGTGTTCAGCTGCCCCATTGATGTCCAGCAGACCGAGACCAAGGGTACAGTGCTGCTGAAGAACGCCCAGGAGATGGTCGACTTCACCAAGGGCGAAGAAGAGCGCCTCGAGACTGCCATCAAGGAGCTGTACGACTCCGGCCTCCGTGTCGTCGTTGCCGGTTCTACCGTCGGTGACCTGGCTCTGCACTACCTCAACCGCTTCAACATCCTCGTGATCAAGATTCTCTCCAAGTTCGAGCTCCGCCGCCTCTGCCGCGTGGTGGGCGCCACTCCTCTCGCCCGCCTGGGTGCCCCTATGCCCGACGAGATGGGTAACGTTGACGTGGTCGAGACAACCGAGATCGGTGGAGACCGTGTCACCGTATTCCGACAAGAAGACGGCTCTGCCGTCACCCGCACTGCTACCATTGTCCTGCGCGGCGCAACCCAGAACCACCTGGACGATGTCGAGCGCGCCATCGACGACGGCGTCAACGTCGTCAAGGCCATCACCAAGGACCCCCGTCTAGTACCCGGAGCCGGTGCTACCGAGATCCAGCTTGTCGAGCGCATCTCCAACTTCGCCGACAAGACCCCCGGCCTGCCCCAGCACGCCATCCGCAAATACGCTGAAGCCTTCGAAGTCATCCCCCGCACGCTCGCCGAGTCCGCCGGTCTCGACGCTACAGAGGTTCTCTCCCGCCTGTACACAGCAGATTGCTTCCGAGCACGGTCTCGACGGCGATGGCCA----CTTCACCGGTGCCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCACGCCAGCGGTGACCGCTACGTCCCCCGTTCCGTCCTTGTTGACTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTTGGTACCGTCATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGATTTCCCTGAGTTCCTTA Penicillium_cryptum TGTCTCCCCAGCGAAATGGTCCTCTCATGGGTATTGTGCAGGATACCCTCTGCGGCATCTACAAGATTTGCCGTCGCGACATTTTTCTTACCAAGGAGGAGGTCATGAACCTCATGCTTTGGGTTCCGGATTGGGATGGAGTTATTCCTCCCCCCGCTATCCTCAAACCTCGTCCAAGATGGACTGGAAAGCAGATGATTAGCATGGCTTTTCCGTCTGGTCTCAACCTTCTCCGCGTTGA---GAAAGACAACTCGCCCCTTTCTGAGAAATTTAGTCCTCTCAATGATGGTGGCCTCCTCATCCATGGTGGGCAGCTGATGTACGGGATGCTTTCCAAGGCGACTGTTGGCGCGAGTGGTGGTGGTGTTATCCACACCATTTTCAACGAGTACGGATCAGATACTGCTGTCAACTTCTTCAATGGAGCACAGACCATCGTCAACTACTGGCTATTGCATAACGGTTTCAGTATCGGTATCGGCGACACGATCCCGGACTCCCTCACTATACAGAAGATCGAGGACGCTGTTCGTGAGCGGAAGAAGGAGGTCGAGTCTATCACTGCCAGTGCTACTGAAAACACCCTGGAGCCGTTGCCTGGTATGAATGTGCGTGAAACCTTCGAGAGCAAGGTATCTCGTGCTCTCAACAATGCCCGTGACGAAGCTGGTGCCGCGACCGAGAAGAGTTTGAAAGACCTCAACAATGCGATCCAAATGGCGCGCTCCGGTTCGAAGGGCTCAACTATCAACATTTCTCAAATGATGCGTCGAGACCAACCGGGAGATCTACCTGAACATTGGTATCAAGCCGAGCACCTTGACTGGTGGGTTGAAGTATGCCCTGGCTACGGGTAACTGGGGCGAACAGAAGAAGGCAGCCAGCGCCAAGGCCGGTGTATCTCAGGTGCTCAGTCGGTACACCTACGCATCCACTCTGTCCCATCTGCGACGCACCAATACGCCCATCGGTCGAGATGGGAAGATCGCCAAACCGCGTCAGCTCCACAACACCCACTGGGGCTTGGTGTGTCCAGCCGAAACGCCTGAAGGTCAAGCTTGTGGTCTTGTCAAGAACTTAGCTTTGATGTGTTATATCACAGTCGGGACGCCCAGCGAGCCCATCATCGACTTCATGATTCAGCGCAATATGGAGGTTCTAGAAGAATTCGAGCCGCAAGTCACGCCCAACGCCACCAAAGTGTTTGTCAATGGGGTCTGGGTCGGTATCCACCGTGACTCGTCGCATCTCGTCAACACTATGTTCTCTTTACGCCGGCGGAACATGATCTCTCATGAGGTCAGCTTGATTCGCGACATCCGCGAGCGGGAATTCAAGATCTTCACCGACACGGGCCGTGTATGCCGTCCGCTGTTCGTCGTCGACAATGACCCCAAAAGCGAGAACGCCGGTTCACTGGTTCTGAACAAAGAACATATCCTCAAGCTGGAGCAAGACAAGGACT---------TACCTCCAGACCTGGACCCGAAGGAACGCCAGGAACGCTACTTTGGATGGGACGGCCTGGTGAGATCCGGGGCAGTGGAGTACGTGGATGCCGAGGAAGAGGAGACCATCATGATCGTGATGACGCCGGAGGATTTGGAAATTTCAAAGCAGCTGCAGGCAGGCTACGCGCTGCCAGAGGAGGGA---AACGATCCCAACAAGCGTGTCCGCTCGATCTTGAGTCAGCGGGCACACACCTGGACACACTGCGACAGCCCGTGGGAAAGATCCGAGGACCGTCCGTTCGAGCCGCAAGATTGGCGCCGACTGCTCCAGTTCGCCGATTACAAGGGGTCTAAGAACCGGATTCTCCGTGAAGCTTTGATCGGTGGCGTTAACCCTGGAATCCGTGTCGACGTGCATCTTCGGGCAGTGCCATCCTCGCTCCGCAACTGTCCCCAGCCGCTCTCACTCTTCTC-GCTACTACCACACGAACACAAGCACACCGTGGTCAACGTCAACATAACGTTGAACTCCAACGTCGAACAGCCCCTCAGATCCAAGGAGGAACTCGTCGTGCAGTGCGGCCCCCGACGCCTGGTCGTCAACCCTGTTTTCTCGGCAGGTGACAATACTCCAAACAATGTCCACAAGTTTGACCGATTCCTGCACCCAGGCCGTAGCGCCTTCGCAACTTGGATCGGGCCTATGACTTGGGGTGCGGTCCCGGTCCTCATCTTCAAGAACAAGCAACCT------GA---AGACCCGGAGATGCTGGACTCGACGGACATCA------------ACTCCCA---GGAGCCGCTCGCATTGGATCGCCTGGAGCTGATTGGCACCGGCACCATTGTGGCTCCTGACTCGAACCGCGTGATCGCCAAACGTGCCATGCGCAAGGCTAAGGTGGGCGTGTTCAGCTGCCCCATTGACATCAGCCAGACCGAGACCAAGGGCACGGTGCTCCTGAAGAACGCGCAGGAGATGATGGACTTCACCAAGGGCGAAGAGGAGCGACTAGAGGCGGCTGTCAAGGAGCTCTACGACTCGGGCCTCCGCGTTCTGGTCGCCGGTTCCACCGTCGGCGATCTGGCCATGCACTACCTCAACCGGTTTAACATCCTCGTCATCAAGATCCTGTCCAAGTTCGAGCTTCGCCGCCTGTGCCGGGTGGTTGGTGCGACGCCTTTGGCGCGTCTGGGCGCTCCCATGCCTGATGAAATGGGCAGCGTCGACGTGGTCGAGACTACGGAGATTGGCGGCGACCGAGTCACAGTCTTCCGCCAGGAAGACGCCAATGCCGTGACCCGTACGGCGACGATCGTGCTGCGCGGCGCCACGCAGAACCATCTGGACGACGTGGAGCGTGCCATTGACGACGGCGTGAATGTCGTCAAGGCCATTACCAAGGACCCGCGCCTGGTCCCCGGTGCCGGCGCCACTGAGATCCAACTTGTCGAGCGCATCTCCACCTTCGCCGACAAGACCCCAGGCTTGCCCCAGTACGCCATCCGCAAGTACGCCGAGGCGTTTGAGGTCGTCCCACGCACGCTGGCAGAGTCGGCTGGTCTCGATGCCACCGAGGTCCTTTCCCGCCTGTACACAAAATATCGCGGGCGAACATGGCCTCGATGGCGATGGCCA----CTACAATGGCGCCTCGGACTTGCAGCTGGAGCGCATGAACGTCTACTTCAACCATGCCTCTGGTGACCGCTACGTTCCCCGTGCCGTTCTGGTCGACCTCGAGCC-CGGCACCATGGACGACAAGGATGGCGATGGGCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGGTCGCTGGGCCAGAACCCGTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACCATCGATTTTCCCGAATTCCTCA Penicillium_dimorphosporum TGTCTCCTCAGCGCAATGGTCCTCTTATGGGTATTGTGCAAGATACTTTGTGTGGCATCTACAAGATTTGCCGTCGGGATATCTTCCTCACCAGGGACCAAGTCATGAACATCATGCTCTGGGTGCCTGACTGGGATGGTGTCATTCCTCCTCCCGCCATTCTGAAGCCTCGTCCGCGTTGGACCGGAAAGCAGATGATCAGCATGGCCTTCCCATCTGGTCTCAACCTTCTGCGCATTGA---CAAGGACAGCTCGCCACTTTCTGAGAAATTCAGCCCTCTTAATGATGGTGGCCTGCTGATTCATGGCGGTCAGCTATTGTATGGCATGCTCTCCAAGAAGACCGTCGGTGCCAGCGGTGGCGGTGTTATTCACACCATCTTCAATGAGTATGGGCCTGACACTGCAGTAAACTTCTTTAACGGTGCTCAGACAATTGTCAACTACTGGCTTCTGCACAATGGTTTCAGTATTGGTATTGGTGACACGATTCCCGATCAGAATACCATTGAGAAGATTGAGGAAGCTGTTCGCGAGCGCAAGAAGGAGGTCGAATCGATCACTGCCAGTGCCACTGAGAACACGCTGGAGCCCCTACCCGGTATGAACGTTCGTGAAACTTTCGAGAGCAAGGTCTCTCGTGCTCTGAACAACGCTCGTGATGAGGCTGGTGCTGCCACCGAAAAGAGTCTGAAGGACTTGAACAATGCCATTCAGATGGCTCGCTCTGGTTCCAAGGGCTCTACCATCAACATTTCTCAGATGTTGTGTTGAGACCAACCGCGAGATCTACTTGAACATCGGTATCAAGGCCAGCACATTGACGGGTGGTTTGAAATACGCCCTGGCAACGGGTAACTGGGGTGAGCAGAAGAAGGCTGCCAGCTCCAAGGCTGGTGTGTCTCAAGTGCTGAGTCGCTACACATATGCCTCCACCTTATCCCACTTGCGGCGCACCAACACCCCCATTGGCCGAGATGGCAAGATTGCCAAACCACGTCAACTTCACAACACTCATTGGGGTCTTGTGTGCCCTGCTGAAACTCCCGAAGGTCAGGCTTGTGGTCTTGTCAAGAACTTGGCACTGATGTGCTACATCACCGTCGGTACGCCGAGCGAACCCATCATCGATTTCATGATTCAACGGAACATGGAAGTGCTTGAGGAGTTCGAGCCTCAAGTCACACCCAACGCGACAAAGGTCTTCGTCAATGGTGTCTGGGTTGGTATCCATCGCGACCCGTCGCATCTCGTCAACACCATGACCTCTTTGCGTCGGCGCAACATGATTTCTCACGAGGTCAGCTTGATCCGTGACATTCGCGATCGAGAGTTCAAGATCTTCACTGATGCCGGCCGTGTGTGTCGACCGCTTTTCACTGTCGACAACGATCCAAAGAGTGAGAATGCTGGATCGCTGGTGCTCAACAAGGAGCACATCCGCAAGCTTGAGCAGGACAAGGAGT---------TGCCGCCAGACTTGGATCCGGAAGAACGCCGGGAGCGCTATTTCGGATGGGACGGTCTCGTGCGGTCAGGAGCGGTGGAATATGTGGACGCCGAGGAGGAGGAAACCATCATGATTGTGATGACCCCCGAAGACTTGGAGATTTCCAAGCAGCTCCAGGCTGGCTACGCGCTGCCAGAAGAGGAGACCAACGATCCCAACAAGCGAGTACGCTCCATTCTGAGCCAGCGGGCTCACACCTGGACACACTGCGACAGCCCTTGGGAAACCTCTGAAGATCGTCCCTTCGAGCCTGAAGACTGGCGTCGATTGTTACAGTTTGGCGACTACAAGGGGACCAAGAATAGAACCCTTAGGGAAGCTTTGGTTGGTGGTGTGAACCCTGGCATTCGCGTGGACGTCCATCTCCGTGCAGTGCCATCCAAATTGCGCCACAAGGCTCAGCCTATCTCCCTCTTCTC-GCTGCTGCGTCATGAGCACAAGCACACCGTGGTCAACGTCAACATGACCCTGAACTCGAGCGTCGAGCAGCCCCTCAAGTCCAAAGAGGAGCTCATTGTTCAGTGCGGTGCTCGCCGTATGGTGGTCAAACCCATCTTCTCGGCCGGAGACAACACCCCGAACAACGTGCACAAGTTCGATCGTTTCTTGCATCCTGGCCGCAGCGCCATCGCCACTTGGATCGGACCTATGACATGGGGTGCCGTCCCAGTCCTTGTCTTCAAGAACAAGCAATTA------GA---GGACCCCGAGATCCTCGATTCTGCGGACGCCA------------AGCCGGA------ATCCCTCGCTATGGACCGCCTGGAGCTGATCGGAACTGGAACGGTCGTTGCACCTGATCCCAACCGTGTGGTTGCCAAGCGCGCCATTCGCAGGGCCAAGGTCGGTGTGTTCAGCTGCCCGATTGACATTTCGCAAACCGAAACCAAGGGCACTGTCCTGCTGAAGAACGCACAGGAGATGGTGGACTTCACCAAGGGTGAGGAGGAGCGCTTGGAGACTGCCATCAAGGAGCTTTATGACTCCGGTCTGCGTGTGGTTGTCGCCGGCTCTACTGTCGGTGACCTGGCCCTGCACTACCTCAACCGCTTCAACATCTTGGTCATCAAGATTCTGTCCAAGTTCGAGCTCCGCCGCCTCTGCCGCGTGGTCGGCGCAACCCCATTGGCCCGTCTGGGCGCTCCCATGCCCGACGAGATGGGCCAGATTGACGTGGTCGAGACCACTGAGATTGGCGGTGACCGTGTCACCGTTTTCCGTCAAGAAGACGCCAACGCCGTCACACGCACATCGACCATTGTCCTGCGCGGTGCCACCCAGAACCACCTTGACGACATCGAGCGTGCCATCGACGATGGCGTGAATGCCGTCAAGGCTATCACCAAGGACCCCCGTCTCGTGCCCGGCGCCGGTGCCACCGAGATCCAGCTCGTGGAGCGCATCTCCAACTTCGCCGACAGGACCCCCGGCCTGCCTCAATACGCCATCCGGAAGTACGCCGAGGCCTTTGAGGTTATCCCGCGCACTCTGGCCGAGTCCGCCGGTCTCGATGCCACCGAAGTCCTGTCCCGTCTGTACACAGACCATTGCTGGCGAGCACGGCCTTGACGGTGATGGCCA----CTACAATGGCGCTTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACCACGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGACCTGGAGCC-CGGTACCATGGATGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTCTGGGCCAGAACCCGTCCGAGTCTGAGCTGCAGGATATGATCAACGAGGTTGATGCCGACAACAATGGCACCATCGATTTCCCTGAGTTCCTTA Penicillium_euglaucum TGTCTCCCCAGCGTAACGGCCCTCTCATGGGTATCGTGCAGGACACTCTGTGCGGCATTTACAAGATTTGTCGTCGGGACACTTTCCTTACAAAGGAACAAGTGATGAATATCTTGCTTTGGGTTCCCAACTGGGACGGCACTATGCCTCCACCTGCTATTTTGAAGCCTCGTCCTCGCTGGACCGGAAAGCAATTGATTAGCATGGCCTTCCCCGCAGGGCTCAACCTGATGCGTGTCGA---TAAGGACGGCTCCCCACGCTCCGAGAAATTTAGTCCTCTTAATGATGGCGGATTGCTGATTCATGGCGGCCAGCTGTTGTACGGCATGCTTTCTAAGAAAACAGTCGGTGCAAGTGGCGGCGGTGTTATCCACACCATCTTCAACGAGTGGGGCTGTGATGAGGCGGTGCGATTTTTCAATGGTGCGCAGACTATTGTCAACTACTGGCTACTACACCACGGATTCAGTATCGGCATCGGTGACACGATTCCTGATCTTAACACCATTGAGAAAATTGAGGAAGCTGTTCGTGAGCGCAAAAACGAGGTCGAAGAGATCACTGCCAGTGCTACGGCGAACACTCTTGAGGCCTTGCCTGGTATGAACGTCCGTGAGACATTTGAGAGCAAGGTTTCTCGTGCGCTCAACAATGCCCGTGATGAGGCTGGTGCTGCAACCGAGAAGAGTTTGAAGGATTTGAATAACGCTATCCAAATGGCTCGATCTGGCTCCAAGGGATCTACTATCAACATTTCCCAAATGCTGCGTCGATAACAACCGCGGGATCTACCTGAACATCGGCCTCAAGGCGGCCACCTTGACTGGCGGTCTGAAGTATGCTCTTGCCACCGGTAACTGGGGTGAGCAAAAGAAGGCAGCCAGCGCCAAGGCTGGTGTGTCCCAGGTACTGTCTCGATACACCTTCGCGTCCTCGTTGTCTCACCTGCGTCGAACCAACACGCCCATCGGCCGTGATGGTAAAATTGCCAAACCCCGTCAGCTCCACAATACCCACTGGGGTTTGGTCTGCCCTGCCGAAACACCTGAAGGGCAGGCTTGCGGTCTCGTCAAGAACTTGGCACTCATGTGCTACATCACTGTTGGTACTCCTGGTGAGCCAATCGTTGACTTTATGATTCAGCGAAACATGGACGTTTTGGAGGAGTTCGAACCTCAGGTTTCGCCGAATGCGACCAAGGTCTTCGTGAATGGTGTCTGGGTTGGCGTTCACCGCGATCCAAATCATCTGGTCAACACCATGCTGTCTCTGCGTCGGCGCAACATGATTTCCCATGAAGTCAGCTTGATTCGGGATATCCGTGAGCGCGAGTTCAAGATCTTCACTGATACTGGACGTGTCTGTCGCCCCCTGTTCGTGGTCGACAATGACTCCAAGAGCGCAAACCCGGGATCCCTGGTCCTCAACAAGGATCATATCCGCAAGCTGGAGGCGGACAAGGAGC---------TGCCACCCGATCTGGACGTCGAAGAGCGCCGAAAGCTTTATTTCGGATGGGAGGGTCTGGTTCGATCCGGCGCTGTTGAATATGTCGACGCAGAGGAGGAAGAATCCCTAATGATTGTGATGACTCCCGAAGACTTGGAGATCCACAAGCAGGCTTCAGCTGGGTATGCGATTCCCGAGGAGGAAAACCCTGACCCGAACAAGCGAGTCCGCTCGACTCTGACCCAGCGCGCCCACACCTGGACACACTGTGACAGCAACTGGGAAACCTCTGAAGATCGCCCATTCGAGCCCGAGGACTGGCGACGTCTCCTGCAATTCGGAGACTACAAAGGTACTAAGAACCGCATCATTCGTGAGGCTCTCGCTGGTGGTGTGAACCCTGGTGTTCGAGTTGACGTGCATCTGCGCTCCGTGCCGTCTTCTCTCCGTCATAAAGCTCAACCAGCTGCGCTGTTCTC-GCTGCTGAGACACGAGCACAAGCATACTGTGGTCAATGTCAACATGACCCTCAGCTCTAGCGTCGAGAAGCCTCTCAAGTCGAAAGAAGAGCTTGTCATCCAGGTTGGTGCCCGCCGGATGGTGGTCAAGCCTATTTTCTCTTCTGCCGACAATACTCCCAACAACGTTCATAAGTTCGATCGCTTCCTGCACCCTGGTCGCAGTGCCATCGCCTCATGGATCGGCCCCATGACCTGGGGTGCCGTTCCTATCCTCGTCTTCAAAGGCAAGCAAACC------GAGGCTGATCCGGAGGTTCTGGACTCGGCTGATGCCA------------ACC------------CGCTCGCACTGGACCGACTGGAGTTGATCGGTACCGGTACTGTGGTCGCTCCCGACCCCAGCCGTGTAGTTGCTAAGCGTGCTATCCGCAAGGCCAAGGTCGGCGTGTTCAGCTGCCCCATTGATACCCAGCAGACCGAGACCAAGGGCACCGTTCTGCTGAAGAATGCCCAGGAGATGGTTGACTTCACCAAGGGCGAGGAAGAGCGTCTGGAGACCGCCATCAAGGAACTGTACGACTCCGGTCTCCGCGTCGTGGTCGCCGGTTCCACCGTCGGCGAGCTGGCCATGCATTACCTCAACCGCTTCAACATCCTGGTCATCAAGATTCTCTCCAAGTTCGAACTCCGCCGTCTGTGCCGTGTCGTCGGCGCGACCCCTCTGGCCCGTCTGGGTGCCCCCATGCCCGATGAGATGGGTACCGTCGATGTCGTCGAGACCACCGAGATCGGCGGTGACCGTGTCACCGTCTTCCGTCAAGAAGATGCCAACTCCGCCACCCGCACATCCACAATTGTCCTGCGCGGCGCCACCCAGAACCACCTGGACGACGTCGAGCGTGCCATCGACGACGGCGTCAACGTCGTCAAGGCCATCACCAAGGACCCCCGCCTCGTGCCCGGCGCCGGCGCCACCGAGATCCAGCTCGTCGAGCGCATCTCCAACTTCGCCGACAAGACCCCCGGCCTGCCGCAGCACGCCATCCGCAAGTTCGCCGAGGCCTTCGAGGTCGTCCCGCGCACCCTGGCCGAATCCGCCGGTCTCGACGCCACCGAGGTCCTGTCCCGCCTGTACACAAACCATTGCCGGTGAGCACGGTCTCGATGGCGATGGCCA----CTACAACGGTTCTTCCGACCTCCAGCTGGAGCGTATGAACGTTTACTTCACCCACGCTTCCGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGACCTGGAGCC-CGGTACCATGGACGACAAAGATGGAGATGGCCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATTGATTTCCCCGAGTTCCTCA Penicillium_expansum TTTCTCCGCAGCGTAACGGTCCTCTGATGGGTATTGTGCAGGATACCCTCTGCGGTATCTATAAGATTTGCCGTCGTGACACCTTCCTCACCAAGGACCAAGTCATGAACCTCATGCTGTGGGTCCCTGACTGGGATGGTGCCATTCCACCTCCCGCAATTATTAAGCCCCGCCCCCGTTGGACTGGAAAGCAGATGATCAGTATGGCTTTCCCCTCAGGTCTCAACCTTCTGCGTGTTGA---CAAGGACGGCTCGCCTTTGGCTGAGAAGTTCAGTCCTCTCAGCGATGGAGGCCTCTTGATTCACGGCGGACAGCTGATGTATGGTATGCTTTCCAAGAAGACGGTCGGTGCCAGTGGTGGTGGTGTCATTCACACCATCTTCAACGAGTACGGCCCTGACACTTGTGTCAAATTCTTCAGTGGTGCTCAAACCATTGTTGGGTACTGGTTGCTGCACAACGGTTTCAGTATTGGTATCGGTGACACCATTCCTGATCAACATACTATCAACAAGATCGAGGAGGCCGTTCGTAACAGAAAACAGGAAGTCGAGGAGATTACGGCTAGTGCCACCGAGAACACATTGGAGGCCCTTCCTGGTATGAATGTGCGTGAGACCTTCGAGAGCAAGGTCTCTCGTGCTTTGAACAATGCCCGTGATGAAGCCGGTGATGCCACAGAAAAGAGTCTCAAGGATCTGAACAATGCCATTCAAATGGCGCGGTCCGGTTCTAAGGGTTCCGCAATCAATATTTCGCAGATGATGCGTTGAGACCAATCGTGAAATCTATCTCAACATTGGTATCAAGGCTAGTACATTGACCGGTGGATTGAAGTATGCTCTTGCTACTGGTAACTGGGGCGAGCAGAAGAAGGCGGCTTCCGCCAAGGCTGGTGTGTCCCAGGTGCTGAGTCGTTACACATTCTCTTCCTCCTTGTCCCACTTGCGCCGAACGAACACACCAATTGGCAGAGATGGCAAGATTGCCAAGCCCCGCCAACTCCATAATACTCACTGGGGCCTGGTCTGCCCGGCTGAGACACCCGAAGGTCAAGCTTGTGGTCTCGTCAAGAACCTGGCATTGATGTGCTACATCACTGTTGGTACACCTGCTGAACCCATCGTGGACTTCATGATTCAGCGCAACATGGAAGTTCTCGAGGAGTTTGAACCGCAAGTGACACCTAACGCGACAAAGGTGTTTGTTAATGGTGTCTGGGTGGGTATTCACCGGGACCCTTCGCATCTTGTTACTACGATGCAGAATCTGCGTCGACGAAACATGATCTCCCACGAAGTCAGTTTGATTCGTGACATTCGTGAACGGGAGTTCAAAATCTTCACCGATACTGGACGTGTCTGCCGGCCACTGTTCGTTATCGATAATGACCCTAAGAGTGAGAACTCGGGTGGATTGGTTCTCAACAAGGAACACATTCGGAAGCTCGAGGCCGACAAAGACT---------TGCCACCAGACTTGGGCCCAGAAGAACGTCGTGAACAATACTTTGGATGGGATGGTCTGGTGCGTTCTGGAGCAGTTGAGTATGTTGATGCTGAAGAAGAGGAAACAATCATGATTGTCATGACCCCTGAGGATCTCGAGATCTCGAGACAGCTTCAGGCAGGTTACGCTCTGCCAGAAGACGAAACCAGCGACCCCAACAAGCGTGTTCGGTCGATTCTCAGCCAGCGCGCCCACACCTGGACGCACTGCGACAGTCACTGGGAAACTTCCGAGGATCGTCCCTACGAGCCCGAGGATTGGCGCCGACTGCTGCAGTTTGCTGATGTCAAGGGCCTCAAGAACCGCATCATTCGAGAGGCTTTGGCCGGTGGTGTTAACCCTGGTACCCGCGTGGATATCCGCCTTCGCGCAGTTCCTTCCATTCTCCGCAACA---CCAAGCCCTTTTCGCTCTTCTC-TCTGCTCCGCCACGAGCACAAGCAGACTGTGGTCAATGTCAGCATGACCCTGAACTCCAGCGTGGAGAAGCCTCTTAAGGCTAAGGAGCAGCTCATCGTCCAGTGCGGTGCCCGCCGCATGGTCGTCAACCCCATCTTCTCCTCGGCTGATAACACGCCGAACAACGTTCACAAATACGACCGATACTTGCACCCTGGTCGTAGTGCCATCGCGTCCTGGATTGGACCCATGACCTGGGGTTCAGTTCCTATCCTTGTCTTCAAACAGAAGCAAGCT------GAGCAGGAGGACGGCGACGACGAGATGGAGACCGCCG------------ATGCCAAGGAGGAGCCCATTGCCCTGGATCAACTGGAACTGATCGGTACCGGTACCGTCGTTGCACCCGATCAGAAGCGTGTGGTTGCCAAGCGTGCCATCAGCAAGGCCAAGGTCGGCGTTTTCAGCTGCCCCATCGATATCAGCCAGACCGAGACCAAGGGCACAGTTCTCCTGAAGAACGCCAAGGAGATGATGGACTTCACTGCGGGTGAGGAGGATCGTCTGGAGATTGCCATTAAGGAGCTCTACGACTCCGGCCTCCGTGTGGTCGTTGCCGGCTCCACTGTTGGCGACTTGGCCATGCACTACCTCAACCGTTTCAATATCCTGGTTATTAAGATTCTGTCTAAGTTCGAGCTCCGCCGCTTGTGCCGCGTTGTCGGTGCCACACCCCTGGCTCGCCTAGGTGCCCCCATGCCCGATGAGATGGGCCAGATCGATGTTGTCGAGACCACCGAGATTGGTGGTGACCGAGTGACCGTCTTCCGTCAGGAGGATGCCAACGCCATCACCCGCACAGCAACCATTGTCCTGCGCGGCGCCACCCAGAACCACCTGGAGGACGTCGAGCGTGCCATCGACGACGGCGTCAACGTTGTCAAGGCCATCACCAAGGACCCCCGTCTCGTGCCCGGTGCCGGTGCTACGGAGATCCAGCTCGTGGAGCGCATCTCCAACTTCGCCGACCGAACCCCCGGTCTGCCCCAGTACGCCATCCGCAAGTTCGCCGAGGCCTTCGAGGTCGTCCCCCGCACACTCGCCGAGTCTGCCGGTCTCGATGCCACCGAGGTTCTCTCGCGTCTGTACACAAACCATCTCTGGCGAGCACGGTCTCGATGGTGATGGACA----GTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTCGTCGATTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGACAAATTACCACCAAGGAGCTTGGCACCGTCATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCTGAGTTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCTGAATTCCTCA Penicillium_glabrum TTTCCCCCCAGCGCAATGGTCCTCTCATGGGTATTGTCCAGGACAGTCTCTGCGGTATCTACAAGCTTTGCCGTCGTGATATCTTCCTTTCCAAGGATCAGGTCATGAACGTCATGCTCTGGGTCCCTGAATGGGATGGTGTCATTCCTCCTCCCGCAATCCTAAAGCCTCGTCCGCGTTGGACCGGAAAGCAGATTATCAGTATGGCTTTCCCCTCTGGTCTTAACCTTCTTCGTATCGA---CAAGGACAGCCAGCCACTCTCCGAGAAATTTAGTCCTCTTAATGATGGTGGTCTGCTGATCCATGGCGGACAGCTGCTGTATGGTATGCTCTCGAAAAAGACCGTTGGCGCAAGTGGTGGTGGTGTTATCCATACCATTTTCAATGAGTACGGACCTGACCAGGCTGTTCACTTCTTCAACGGTGCCCAGAGAATTGTCAACTACTGGCTTCTCCACCATGGTTTCAGTATCGGTATTGGTGACACGATTCCCGATCGTCGCACCATTGAGAAGATTGAGGCGGCGGTCCGTGAGCGGAAGAATGAAGTCGAGCAGATTACTGCTAGTGCTACAGAGAACACTCTCGAGGCATTACCTGGTATGAATGTTCGTGAGACATTTGAGAGTAAAGTTTCTCGTGCTCTCAACAACGCCCGTGATGAAGCTGGTGCTGCTACCGAGCAGAGTCTGAAGGATTTGAACAACGCTATTCAGATGGCTCGTTCCGGTTCCAAGGGTTCCACCATCAACATTTCCCAGATGTTGCGTTGAGACTAATCGCGAGGTTTTCCTCAACGTGGGTCTGAAGGCTGCTACACTTACTGGTGGATTGAAGTACGCCCTCGCTACCGGTAACTGGGGTGAGCAGAAGAAGGCTGCCAGCGCCAAGGCCGGTGTGTCCCAGGTGCTGAGTCGTTATACATACGCATCCACGTTGTCCCATTTGCGCCGTACCAATACGCCTATTGGACGAGATGGTAAAATTGCTAAGCCTCGTCAGCTCCACAACACTCACTGGGGTCTTGTGTGCCCAGCTGAAACACCCGAAGGTCAAGCTTGTGGTCTGGTCAAGAACTTGGCGCTCATGTGCTATATCACTGTCGGTACACCCAGTGAGCCGATCATTGATTTCATGATCCAACGAAATATGGAGGTCCTCGAAGAATTCGAGCCCCAAGTCACACCTAATGCCACTAAAGTGTTCGTTAACGGTGTGTGGGTTGGTATTCACCGTGACCCGTCGCATCTTGTCAATACCATGGCGTCTCTTCGTCGGCGAAACATGATTTCACACGAAGTCAGCTTGATTCGTGACATCCGTGAGCGGGAGTTTAAGATTTTCACTGATACTGGACGTGTCTGTCGACCGCTCTTCGTTGTCGACAATGACCCCAAGAGTGAGAATGCTGGATCACTGATCCTCAACAAGGAGCACATTCGATCCCTGGAGCAGGATAAGGATT---------TGCCACCAGACCTGGACCCAGAAGAACGCCGGGAACGTTTCTTTGGATGGGAAGGATTGGTGCGATCCGGTGCCGTGGAATACGTGGATGCGGAGGAAGAAGAGACCATTATGATTGTGATGACGCCTGAAGATTTGGAGATTTCCAAACAACTCCAGGCTGGTTACGCCTTGCCGGAGGATGA---CAGCGATCCCAACAAGCGAGTCCGCTCGGTTTTGAGCCAGCGGGCACACACCTGGACTCATTGTGACAGCCCTTGGGAGACGTCCGAGGATCGTCCCTTCGAGCCCGAGGACTGGCGCAGACTCTTGCAGTTTGGCGACTACAAGGGCACCAAGAACCGTATCCTGCGGGAGACTCTCATCGGCGGTGTCAACCCCGGTATCCGTGTGGATGTCCACCTCCGCGCTGTGCCATCGCACCTCCGCAACAAGCCCCAGCCCGTCTCACTCTTCTC-ACTGCTGCGTCATGAGCACAAGCACACTGTGGTCAACATCAACATGACCTTGAGCGGAAGACTCGAGGAGCCCATTAAGGCTAAGGAGGAGCTTATCGTCCAGTGTGGTCCCCGCCGTATGGTTGTGAACCCCATTTTCTCGTCCGCGGACAACACTCCCAACAATGTGCACAAGTTCGACCGCTTCATGCACCCCGGCCGCAGTGCCATCGCCACCTGGATCGGACCCATGACTTGGGGTGCCGTCCCAGTGCTTGTATTCAAGGCCCAACCGGCC------GAGGAAGACCCCGAGGTCCTCGACTCCGCAGACGACA------------CCGAGCAGCAGGAGCCTCTGTCCCTGGACCGCCTCGAGCTCATTGCTACCGGCACAGTCATCCCACCCGACCCAGCACGTGTTGTTGCCAAGCGTGCTATCAAGAGGGCCAAGGTCGGCGTGTTCAGCTGCCCCATTGACGTCTCTCAAACCGAGACCAAGGGAACGGTTCTGCTGAAGAACGCCCAGGAGATGATGGATTACACCAAGGGCGAGGAGGAGCGTCTGGAGACTGCCATCAAGGAGCTGTACGACTCTGGTCTGCGTGTCGTTGTTGCTGGTTCCACCGTCGGCGAGCTGGCCCTTCACTACCTCAACCGTTTCAACATCTTGGTCATCAAGATTCTGTCCAAGTTCGAGCTTCGCCGCCTGTGCCGTGTGGTTGGTGCTACTCCCCTGGCCCGCCTGGGTGCCCCCATGCCCGATGAGATGGGTCAAGTCGATGTCATCGAGACCATTGAGATTGGCGGTGACCGCGTCACTGTCTTCCGTCAAGAGGATGCCAACGCCGTGACTCGCACTTCCACCATTGTGCTCCGCGGTGCTACCCAGAACCACCTCGAGGACGTCGAGCGCGCCATTGATGATGGAGTGAACGTTGTCAAGGCCATCACCAAGGACCCGCGTCTGGTTCCCGGTGCTGGTGCCACTGAGATCCAGCTCGTTGAGCGGATCTCCAACTTTGCTGACAAGACTCCTGGTTTGCCCCAGCACGCCATCCGCAAGTACGCCGAGGCCTTCGAGGTCATCCCCCGCACTCTCGCCGAATCTGCCGGTCTGGATGCCACCGAGGTTCTCTCCCGCCTGTACACAAACCATTGCTGGCGAGCACGGACTTGATGGTGATGGACA----CGTCAACGAGGCTTCCGACCTCCAGTTGGAGCGCATGAACGTCTACTTCAACGAGGCCAGCAGCAACCGTTACGTTCCCCGTGCCGTCCTTGTCGACTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGACAAATCACCACCAAGGAGTTGGGCACCGTCATGCGCTCGCTCGGCCAGAACCCCTCTGAGTCTGAGTTGCAGGACATGATCAATGAGGTCGATGCCGACAACAACGGCACCATTGACTTCCCTGAGTTCCTCA Penicillium_griseofulvum TTTCTCCGCAGCGTAACGGCCCTCTGATGGGTATTGTCCAGGATACCCTTTGCGGTATCTACAAGATCTGTCGTCGTGACTCCTTCCTCACCAAGGAGCAAGTCATGAACCTCATGCTGTGGGTCCCTGACTGGGATGGTGCCATTCCACCCCCCGCAATTTTCAAGCCTCGCCCCCGTTGGACGGGTAAGCAGATTATCAGCATGGCATTCCCCTCTGGTCTCAACCTTCTGCGAGTTGA---CAAGGACGGCTCGCCTTTGGCTGAGAAGTTCAGTCCCCTGAACGATGGAGGTCTCTTGATTCACGGCGGACAGTTGATGTATGGTATGCTCTCCAAGAAAACGGTCGGTGCCAGTGGTGGTGGTGTCATTCACACCATCTTCAACGAGTACGGTCCTGACACCTGTGTCAAATTCTTCACTGGAGCCCAAACCATCGTTGGGTACTGGTTGCTGCACCACGGTTTCAGTATCGGTATTGGTGACACCATTCCTGATCAAAACACTATCAACAAGATCGAGGAAGCTGTTCGGAACAGAAAACAGGAAGTCGAGGAAATTACGGCTAGTGCCACCGAAAACACACTGGAAGCTCTTCCTGGTATGAATGTGCGTGAAACATTCGAGAGCAAGGTCTCTCGTGCTTTGAACAACGCTCGTGACGAAGCTGGTGATGCCACAGAAAAGAGTCTCAAGGATCTGAACAACGCTATTCAAATGGCGCGGTCCGGTTCTAAGGGTTCGGCAATCAATATTTCGCAGATGATGTGTTGAGACCAATCGCGAAATTTATCTTAACATTGGTATCAAGGCCAGCACATTGACCGGTGGATTGAAGTATGCTCTTGCTACTGGTAACTGGGGAGAGCAGAAGAAGGCGGCTTCCGCCAAGGCTGGTGTGTCCCAGGTGCTGAGTCGTTACACATTTGCCTCTTCATTGTCTCATCTGCGCCGCACGAACACCCCCATTGGCAGAGATGGAAAGATTGCCAAACCCCGTCAACTCCATAATACTCACTGGGGTCTGGTCTGCCCGGCTGAGACTCCCGAAGGCCAAGCTTGTGGTCTGGTCAAGAACTTGGCATTGATGTGCTACATCACTGTCGGTACACCTGCAGAGCCTATCGTGGACTTCATGATTCAGCGCAACATGGAAGTCCTCGAGGAGTTCGAACCCCAAGTGACGCCCAATGCGACAAAGGTGTTTGTTAATGGTGTCTGGGTGGGTATTCACCGGGACCCTTCGCATCTCGTCACTACGATGCAGAACCTGCGTCGACGAAACATGATCTCACACGAAGTCAGTTTGATTCGTGACATCCGTGAACGGGAATTCAAAATTTTCACGGATACTGGACGTGTCTGCCGGCCACTCTTCGTCATCGATAATGATCCCAAGAGTGAAAACTCGGGTGGATTGGTCCTTAATAAGGAACACATTCGGAAGCTCGAGGCCGACAAAGACT---------TGCCAGTAGACTTGGCCCCAGAAGAACGTCGCGAACAATACTTCGGATGGGATGGTCTGGTGCGTTCTGGAGCAGTCGAGTATGTCGATGCCGAAGAAGAGGAAACCATCATGATTGTCATGACCCCCGAGGATCTTGAGATCTCTCGACAGCTTCAGGCCGGCTACGCTCTGCCAGATGATGAAGCCGGCGACCCCAATAAACGTGTTCGATCGATTCTCAGCCAGCGCGCCCACACCTGGACGCACTGTGATAGCCACTGGGAAACATCCGAGGATCGTCCCTACGAGCCCGAGGATTGGCGCCGACTCCTGCAGTTTGCTGATGTCAGAGGTTCCAAGAACCGCATCATGCGAGAGGCTTTGGTCGGTGGCGTTAACCCTGGTGTCCGCGTGGATATTCACCTTCGTGCAGTTCCTTCCGTTTTGCGCAACGGCCCCAAGCCCCTTTCACTCTTCTC-TCTGCTCCGCCACGAGCACAAGCATACTGTGGTCAACGTCAGCATGACCCTCAACTCCAGCTTCGAGAAGCCTCTCAAGGCTAAGGAGCAACTCGTCGTCCAGTGCGGTGCCCGCCGCATGGTCGTCAACCCCATCTTCTCCTCGGCTGATAACACGCCGAACAACGTTCACAAATACGACCGATTCTTGCATCCTGGTCGTAGTGCCATCGCATCCTGGATTGGACCCATGACATGGGGCTCAGTTCCTATCCTCGTCTTCAAACAGAAGCAAGCT------GAGGAGGAGGATGGTGACGAACAGATGGATACCG---------------ATGCCAAGGATGAGTCGATTGCTCTGGACCAACTCGAGCTTATCGGCACCGGCACTGTTGTCGCACCTGATCAGAAGCGCGTGGTTGCCAAACGTGCCATCACCAGGGCCAAGGTCGGCGTTTTCAGCTGCCCCATCGATATCAGCCAGACCGAGACCAAGGGCACAGTTCTCCTTAAGAACGCTAAGGAAATGATGGACTTCACCGCGGGCGAGGAGGATCGTCTTGAGACTGCCATTAAGGAGCTCTACGATTCCGGTCTCCGTGTGGTCGTTGCCGGCTCCACCGTTGGCGACTTGGCCATGCACTACCTCAACCGTTTCAATATCCTGGTCATTAAGATTCTGTCTAAATTCGAGCTCCGCCGCTTGTGCCGCGTTGTCGGTGCCACACCTCTGGCTCGCCTGGGTGCCCCCATGCCCGATGAGATGGGCCAAATTGACATTGTCGAGACCACCGAAATTGGCGGTGACCGAGTGACTGTCTTCCGTCAGGAGGATGCCAACGCTATCACCCGCACAGCAACCATTGTCCTGCGCGGTGCCACCCAGAACCACCTGGAGGACGTCGAGCGTGCCATTGATGACGGCGTCAACGTCGTCAAGGCCATCACCAAGGACCCCCGTCTCGTGCCCGGTGCCGGTGCTACAGAGATCCAGCTCGTTGAGCGCATCTCCAACTTCGCCGACCGAACCCCTGGTCTTCCCCAGTACGCCATTCGCAAATTCGCCGAGGCCTTCGAGGTCGTTCCCCGTACACTTGCCGAGTCTGCCGGTCTCGATGCCACCGAGGTTCTGTCGCGTCTGTACACAAACCATTTCCGGCGAGCACGGTCTCGATGGTGATGGACA----GTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGCTAGCGGTGATAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGACAAATCACCACCAAGGAGCTTGGTACCGTCATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCCGAACTGCAGGATATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCCGAATTCCTGA Penicillium_griseolum TGTCTCCTCAGCGCAATGGTCCTCTCATGGGTATTGTCCAGGACAGTCTCTGCGGTATCTACAAGATTTGCCGCCGTGATATCTTCCTCACCAAGGATCAGGTCATGAACACCATGCTCTGGGTGCCTGACTGGGATGGTGTCATTCCTCCTCCCGCTATCCTGAAGCCTCGTCCGCGCTGGACCGGAAAGCAGATAATCAGTATGGCTTTCCCGTCTGGTCTCAACCTTCTGCGTATCGA---CAAGGACAGCTCCCCACTCTCCGAGAAATTTAGTCCTCTTAATGACGGTGGCCTTCTTATCCATGGTGGGCAGCTGTTGTACGGCATGCTCTCGAAGAAGACCGTCGGTGCAAGCGGTGGCGGTGTTATTCACACCATTTTCAACGAGTACGGGCCAGACACTGCCGTCAACTTCTTCAATGGTGCTCAAACAATTGTCAACTACTGGCTCTTGCACAATGGATTCAGCATCGGTATCGGTGATACGATTCCCGATAGGCTCACCATTGAGAAGATTGAGGAGGCTGTCCGTGAGCGCAAGAAGGAGGTCGAGGCGATCACCGCCAGTGCTACGGAGAACACTTTGGAGCCCTTGCCCGGTATGAACGTGCGTGAAACTTTTGAGAGCAAAGTCTCTCGTGCTCTCAACAACGCCCGTGACGAAGCTGGTGCCGCAACCGAGAAGAGTTTGAAGGACTTGAACAATGCCATTCAGATGGCCCGTTCCGGTTCCAAGGGTTCCACCATCAACATCTCCCAGATGCTGCGTGGAGACCAACCGCGAGATCTACCTCAACATTGGTCTCAAGGCCAGCACGCTTACTGGTGGATTGAAATACGCCCTGGCAACGGGTAACTGGGGTGAGCAGAAGAAGGCGGCAAGCGCCAAGGCCGGTGTGTCCCAAGTGTTGAGTCGTTACACCTATGCCTCCACCTTATCCCATCTGCGCCGCACCAATACACCCATTGGACGAGATGGTAAAATCGCGAAACCTCGTCAGCTCCACAACACTCATTGGGGTCTTGTGTGCCCGGCCGAAACGCCTGAAGGTCAAGCTTGTGGTCTCGTCAAGAACTTGGCGCTTATGTGCTACATCACTGTCGGTACACCCAGTGAACCGATCATTGATTTCATGATCCAGCGGAACATGGAGGTCCTTGAAGAGTTCGAGCCTCAAGTGACACCCAACGCCACCAAGGTGTTTGTCAACGGGGTCTGGGTTGGTATCCACCGTGACCCGTCGCACCTTGTCAATACCATGTCGTCTCTTCGTCGGCGGAACATGATTTCTCATGAAGTCAGCTTGATTCGTGACATTCGTGAACGAGAGTTCAAGATTTTCACTGATGCTGGACGTGTCTGCCGACCTCTTTTCGTGGTCGACAATGACCCGAAGAGTGAGAATGCCGGGTCATTGGTTCTCAACAAGGAGCACATTCGCAAGCTGGAGCAGGATAAGGACT---------TGCCACTAGACCTGGATCCGGAAGAACGCCGGGAGCGTTATTTCGGATGGGATGGATTGGTGAGGTCTGGAGCCGTGGAGTATGTGGATGCAGAGGAAGAAGAAACAATTATGATTGTGATGACGCCCGAAGACCTGGAGATTTCCAAACAGCTCCAGGCCGGTTACGCGTTGCCGGAAGATGAGACCAGTGACCCCAACAAGCGTGTCCGCTCGATTCTGAGCCAGCGGGCGCACACCTGGACGCACTGCGACAGCCCTTGGGAAACATCCGAGGACCGCCCCTACGAACCGGAAGACTGGCGGAGACTGCTGCAATTTGGTGACTACAAGGGCTCCAAGAACCGCATTCTTCGAGAGGCCTTGGTTGGTGGCGTGAACCCAGGCATTCGCGTGGACGTCCATCTCCGTGCAGTGCCAGCCTCGCTCCGCAGCAAGGCCCAGCCAGTTTCGCTCTTCTC-GCTGTTGCGCCATGAACACAAGCACACTGTGGTCAACATCAACATGACCCTGAACTCTAGTGTCGAAAAGCCCCTCAAATCCAAGGAGGAACTCATTGTGCAGTGCGGTGCGCGCCGAATGGTTGTTAACCCCATCTTTTCGGCCGGCGACAACACCCCCAACAACGTCCACAAGTTCGACCGCTTCCTGCACCCAGGACGCAGCGCCATTGCCACTTGGATTGGTCCCATGACTTGGGGTGCCGTTCCGGTGCTCGTCTTCAAGAACAAGCAGGTG------GAGGAAGACCCGGAGATTCTCGACTCGGCAGATGCCA------------AGCAGGA------ACCGCTGGCCCTGGACCGACTGGAGCTGATCGGTACTGGCACAGTGGTTGCACCCGACCCAGCCCGTGTGATTGCCAAACGTGCCATTCGCAAGGCCAAGGTCGGCGTGTTCAGCTGCCCGATTGACATCTCGCAAACCGAGACCAAGGGCACCGTCCTACTGAAGAATGCCCAGGAGATGATGGACTTCACCAAGGGTGAAGAGGACCGTCTGGAGACTGCCATCAAAGAGCTGTATGACTCCGGCCTTCGTGTGGTCGTTGCCGGTTCCACCGTCGGCGAGCTGGCCCTGCACTACCTCAACCGCTTCAACATCCTGGTGATCAAGATCCTGTCCAAGTTTGAGCTTCGCCGCCTGTGCCGGGTGGTGGGCGCGACCCCCCTGGCCCGTCTGGGTGCCCCCATGCCCGACGAGATGGGCACCGTCGACGTGGTCGAGACGACCGAGATCGGTGGTGACCGAGTCACCGTTTTCCGTCAAGAAGACGCCAATGCCGTGACGCGCACATCGACCATCGTGCTGCGCGGCGCCACGCAGAACCACCTGGACGACGTCGAGCGCGCCATCGACGACGGCGTCAACGTCGTCAAGGCCATCACCAAGGACCCGCGCCTCGTGCCCGGCGCCGGTGCCACCGAGATCCAGCTCGTGGAGCGGATCTCCCACTTCGCCGACAAGACCCCCGGTCTGCCGCAGTACGCCATCCGCAAGTTCGCCGAGGCCTTTGAGGTCATCCCGCGCACCCTCGCCGAGTCCGCCGGCCTCGACGCCACCGAGGTTCTCTCCCGCCTGTACACAAACCATTGCTGGTGAGCACGGCCTTGACGGCGATGGCCA----CTACAATGGCGCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTACTTCAACCATGCCAGCGGTGACCGCTACGTTCCCCGTGCCGTCCTGGTCGACTTGGAGCC-CGGTACCATGGATGACAAGGATGGCGATGGCCAGATCACTACCAAGGAGCTGGGCACCGTCATGCGCTCTCTCGGCCAGAACCCGTCCGAGTCTGAGCTGCAGGATATGATCAACGAGGTCGATGCCGACAACAACGGCACCATTGACTTCCCCGAGTTCCTCA Penicillium_herquei TGTCTCCTCAGCGAAATGGTCCTCTGATGGGTATTGTCCAGGACAGTCTGTGTGGTATCTACAAGATCACCCGTCGTGATGTTTTTCTTTCCAAGGATCAAGTCATGAACATTATGCTCTGGGTTCCTGAGTGGGATGGTGTAATCCCCCCTCCCGCGATTCTCAAGCCTCGTCCTCGTTGGACCGGAAAGCAGATGATCAGTATGGCTTTCCCATCTGGTTTGAACCTGTTGCGTATCGA---CAAGGATAGTTCTCCTCTCTCTGAGAAGTTTAGCCCTCTTCATGACGGCGGCCTGTTGATCCACGGTGGACAACTCATGTACGGTATGCTCTCGAAGAAGACCGTCGGTGCAAGTGGTGGTGGTGTGATCCACACTATTTTCAACGAATATGGTTGTGACCAAGCTGTCCATTTCTTCAACGGAGCTCAAAGAATTGTCAACTACTGGCTTCTACACCATGGTTTCAGTATCGGTATCGGTGATACGATTCCTGATCGCCGTACCATTGAAAAGATTGAGGAGGCTGTACGAGAGCGCAAGCAGGAGGTCGAGCAGATTACCGCTAGTGCTACTGAGAACACCCTGGAGGCTCTGCCTGGTATGAACGTCCGTGAAACCTTCGAAAGCAAGGTCTCTCGTGCTCTTAACAACGCTCGTGACGAGGCTGGTGCTGCTACCGAGAAGAGTTTGAAGGATTTGAACAACGCCATTCAGATGGCTCGCTCTGGTTCTAAGGGATCTACCATCAACATTTCCCAGATGTTGTGTTGAGACTGAGCGCGAAATGTACCTCAACATGGGTATCAAGGCTGCTACTCTCACCGGTGGTTTGAAGTATGCTCTGGCCACAGGAAACTGGGGAGAGCAGAAGAAGGCCGCCAGCGCCAAGGCTGGAGTCTCCCAAGTGCTGAGTCGATACACCTTTGCCTCCTCATTATCTCATTTGCGACGTACCAATACCCCCATTGGACGAGATGGTAAGATTGCCAAACCTCGCCAGCTTCATAACACTCACTGGGGTCTTGTGTGCCCGGCCGAAACACCCGAAGGACAAGCTTGCGGTCTTGTCAAGAACTTGGCACTCATGTGCTACATCACTGTCGGAACGCCCAGTGAGCCGATCATTGATTTCATGATTCAGCGTAATATGGAGGTCCTCGAAGAATTTGAGCCCCAAGTCACACCCAATGCTACCAAGGTGTTCGTCAACGGTGTGTGGGTCGGTATCCACCGTGATCCTTCACATCTCGTCAGCACTATGCAGTCTCTTCGACGACGAAATATGATTTCGAACGAAGTTAGTCTGATTCGTGATATCCGTGAACGGGAGTTCAAGATCTTCACCGATGCGGGTCGTGTGTGCCGACCGCTCTTTGTGGTCGATAATGACCCTAAGAGTGAAAATGCAGGATCTTTGGTTCTCAACAAGGACCACATCCGTAAACTGGAACAGGATAAAGACC---------TGCCAGCTGATCTGGACATGGAAGAACGCCGGGAGCGCTACTTCGGATGGGAAGGCTTGGTCAGATCCGGTGCCATCGAGATTGTGGATGCAGAGGAAGAGGAAACTATTATGATTGTGATGACGCCTGAAGACTTGGAGATTTCCAAACAACTCCAGGCAGGCTACGCTTTGCCAGAGGATGAGACAAGCGACCCCAACAAGCGTGTTCGCTCGATTCTTAGCCAGCGTGCTCACACCTGGACTCACTGCGATTCTCCCTGGGAGACATCCGAAGATCGCCCCTTCGAGCCTGAGGACTGGCGCAGACTGCTGCAGTTTGGTGACTACAAGGGTACCAAGAACCGTGTCATCCGCGAGGCTCTTGTCGGTGGTGTTAACCCTGGTATCCGTGTTGATGTCCACCTTCGTGCTGTTCCTGCCCACCTCCGCAACAAGCCTCAGCCTGTTTCACTCTTCTC-GCTGCTCCGCCATGAGCACAAGCACACCGTTGTGAACATCAACATGACCCTGAGCTCATACGTTGAGAAGCCTCTCAAGGCCAAGGAGGAGATTATTGTTCAGTGTGGACCTCGCCGTATTGTGGTCAACCCTATCTTCTCATCCTCTGACAACACCCCCAACAACGTGCACAAGTTCGATCGCTTCCTGCACCCAGGCCGTAGCGCCATCGCATCCTGGATTGGTCCCATGACCTGGGGTGCTGTCCCCGTGCTTGTCTTCAAGAACAAGCCCGTA------GAGCAAGACCCTGAGATCCTCGACTCAGCGGATGAGA------------------AGGAGGAGCCTCTGTCCTTGGACCGACTCGACCTCATCGCTACTGGCACAGTCGTTGCCCCCGACCCAGCCCGTGTTATCGCCAAGCGTGCTATTCGCAGAGCCAAGGTCGGCGTGTTCAGCTGCCCCATTGATATCTCTCAGACCGAGACCAAGGGTACTGTTCTGCTGAAAAACGCCCAGGAGATGATGGACTACACCAAGGGCGAGGAGGAGCGTCTGGAGACTGCCATCAAGGAGCTGTACGACTCCGGTCTGCGTGTCGTTGTTGCTGGTTCCACTGTTGGCGACCTGGCCCTCCACTACCTGAACCGCTTCAACATCCTGGTTATCAAGATTCTCTCCAAGTTCGAGCTCCGCCGTCTGTGCCGCGTTGTCGGTGCTACTCCTCTGGCCCGTCTGGGTGCTCCCATGCCCGACGAGATGGGTCAAGTCGACATTGTCGAGACCACCGAGATCGGTGGTGACCGTGTCACCGTTTTCCGTCAGGAGGACGCCAACGCTGTCACCCGCACATCCACCATTGTTCTCCGTGGTGCTACCCAGAACCACCTGGATGATGTTGAGCGCGCCATCGATGACGGTGTCAACGTCGTCAAGGCCATCACCAAGGACCCCCGTCTCGTCCCCGGAGCCGGAGCCACCGAGATCCAGCTCGTGGAGCGTATCTCCAACTTCGCCGACAAGACCCCCGGTCTGCCCCAGTACGCCATTCGCAAGTTCGCCGAGGCCTTCGAGGTTGTGCCCCGCACACTCGCCGAGTCTGCCGGTCTCGACGCCACCGAGGTTCTCTCCCGCCTGTACACAGAACATTGCTTCCGAGCATGGCCTCGATGGCGAAGGACA----CTTCACCGGTTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACCACGCCAGCGGTGACCGTTACGTTCCCCGTGCCGTCCTTGTCGACTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTGGGTACCGTCATGCGTTCCCTCGGCCAGAACCCTTCCGAGTCTGAGCTGCAGGACATGATTAACGAGGTTGACGCTGACAACAACGGCACCATTGATTTCCCTGAGTTTCTTA Penicillium_hirayamae TGTCCCCCCAGCGTAATGGTCCGTTGATGGGTATTGTTCAAGATTCTCTCTGCGGTATCTATAAAATCTGCCGTCGTGATATCTTCCTTACTAAGGATCAAGTCATGAATATCATGCTTTGGGTGCCCGATTGGGATGGTGTCATTCCCCCTCCTGCGATCCTGAAGCCTCGTCCACGCTGGACTGGAAAACAGATGATCAGTATGGCTTTCCCGACTGGTTTGAACCTGCTGCGTATCGA---CAAGGATAGCTCCCCACTCTCGGAGAAATTTAGTCCTCTTAATGATGGTGGTCTGCTGATCCACGGCGGCCAGCTGTTGTACGGTATGCTGTCTAAGAAGACGGTCGGTGCAAGTGGTGGTGGTGTCATCCACACCATTTTCAATGAGTATGGACCCGATCAAGCTGTGAATTTCTTCAACGGCGCACAGCGAATTGTCAACTACTGGCTTCTACACAATGGTTTCAGTATTGGTATTGGTGATACAATTCCTGATCGCAACACTATTGAGAAGATTGAAGAGGCCGTGCGTGAGCGCAAGCAGGAGGTCGAACAGATCACAGCTAGTGCTACTGAGAACACGCTGGAGGCTCTGCCCGGTATGAACGTTCGTGAGACATTCGAGAGTAAGGTCTCTCGTGCTTTGAACAATGCTCGTGATGAGGCTGGTGCTGCCACCGAGAAGAGCTTAAAGGATCTTAACAACGCCATTCAGATGGCTCGATCCGGCTCCAAGGGATCTACTATCAACATCTCCCAGATGCTGTGTTGAGACTGGTCGCGAAATTTACCTTAATGTTGGTCTCAAGGCTGCTACCCTCACTGGTGGACTGAAATACGCTTTGGCAACCGGTAACTGGGGAGAGCAAAAGAAGGCCGCGAGCGCAAAGGCTGGTGTGTCTCAAGTGTTGAGTCGTTACACCTACGCCTCTACTCTATCCCACCTCCGGCGTACCAATACCCCCATTGGACGAGATGGTAAGATTGCCAAACCTCGTCAGCTCCATAATACTCACTGGGGTCTTGTGTGCCCGGCCGAAACGCCTGAAGGACAAGCCTGTGGACTTGTCAAGAATTTGGCTCTCATGTGTTATATCACCGTCGGAACACCCAGTGAACCGATCATCGATTTCATGATCCAGCGTAACATGGAGGTCCTCGAAGAGTTTGAGCCGCAGGTCACACCGAATGCCACCAAGGTGTTTGTTAACGGCGTGTGGGTTGGTATTCATCGCGATCCATCACATCTCGTCAACACTATGCAGAGTCTCCGTCGACGAAACATGATTTCGAACGAAGTCAGTTTGATTCGTGACATCCGTGAACGGGAGTTCAAGATCTTTACTGATGCTGGACGTGTCTGCCGACCGCTCTTCGTTATCGATAATGATCCCAAGAGTGAAAATGCGGGATCATTGGTTCTCAACAAGGAGCACATTCGTAAGCTGGAGCAGGACAAGGACT---------TGCCAGCCGATATGGATCTGGAAGAACGCCGGGAGCGCTACTTCGGATGGGAGGGATTGGTGAGATCAGGCGCTGTGGAAATTGTAGATGCGGAGGAAGAAGAAACCATCATGATCGTGATGACACCTGAAGATCTGGAGATCTCCAACCAGCTGCAAGCTGGCTATGCTTTGCCAGAGGATGAGACAAACGACCCCAATAAGCGTGTCCGCTCAATTCTGAGCCAGCGCGCTCATACTTGGACTCACTGTGATAGTCCCTGGGAGACATCTGAGGACCGTCCCTTCGAGCCTGAAGACTGGCGGCGACTGTTGCAATTCGGTGATTACAAGGGCACCAAGAACCGTGTCATTCGAGAGGCCCTGGTCGGTGGCGTGAATCCCGGCATTCGCGTTGATGTCCACCTTCGCGCAGTGCCAGCCTTGCTTCGCAACAAACCCTTACCCGTTTCGCTGTTCTC-CCTTCTGCGCCATGAACATAAGCATACCGTCGTCAATATCAACATGTCACTGAATTCGAGCGTTGAGAAGCCGATCAAGGCTAAGGAAGAGCTTATCGTGCAGTGTGGACCCCGCCGCTTGGTCGTGAACCCTATTTTCTCATCCGCCGACAACACCCCTAACAACGTCCACAAGTTCGATCGCTTCTTGCACCCAGGCCGTAGCGCCATCGCCAGCTGGATTGGACCCATGACCTGGGGTGCTGTTCCGGTGCTCGTTTTCAAGAACAAGCCCGCC------GAACAGGACCCAGAAATCCTTGATTCGGCAGATGACA------------------AGCAGGAGCCTCTGGCTATGGATCGACTTGACCTCATTGCTACTGGCACAGTGGTCGCACCTGATCCAGCTCGCGTTGTTGCCAAACGTGCTATTCGCAAGGCCAAGGTTGGCGTGTTCAGCTGCCCGATTGATATCTCCCAGACCGAGACCAAGGGTACCGTTCTGCTGAAGAACGCCCAGGAGATGGTGGACTACACCAAGGGCGAGGAGGACCGTTTGGAGACTGCTATCAAGGAGCTGTATGATTCGGGTCTGCGTGTGGTTGTTGCCGGTTCCACTGTCGGCGACTTGGCCCTTCACTACCTCAACCGTTTCAACATTCTGGTAATTAAGATTCTCTCCAAGTTCGAGCTCCGCCGCCTGTGCCGAGTCGTCGGAGCGACTCCTCTGGCTCGTCTCGGTGCCCCCATGCCTGATGAGATGGGTCAAGTTGACGTTGTCGAGACCACTGAGATTGGCGGTGATCGAGTCACCGTTTTCCGCCAAGAGGATGCCAATGCCGTGACACGCACATCGACCATCGTGCTCCGTGGCGCTACCCAGAACCACCTGGATGACGTTGAGCGCGCCATTGATGATGGCGTCAACGTCGTCAAGGCCATCACGAAGGACCCGCGCCTTGTGCCTGGTGCTGGAGCCACTGAGATCCAGCTCGTGGAGCGCATCTCCAACTTCGCTGACAGGACTCCCGGTCTGCCTCAGCACGCCATCCGCAAGTTCGCCGAGGCCTTTGAAGTCGTCCCTCGCACACTCGCTGAGTCTGCTGGTCTTGACGCCACTGAGGTCCTCTCCCGCCTTTACACAGAACATTGCTAGTGAGCATGGCCTTGATGGCGAGGGCCA----CTTTACTGGCCAGTCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACCACGCCAGCGGTGACCGTTACGTTCCCCGTGCCGTCCTGGTCGACTTGGAGCC-TGGTACCATGGACGACAAGGACGGCGATGGCCAAATCACTACCAAGGAGCTGGGCACTGTCATGCGCTCCCTCGGCCAAAACCCCTCCGAGTCTGAGCTTCAGGATATGATTAACGAGGTCGATGCCGACAACAACGGTACCATTGACTTCCCTGAGTTCCTGA Penicillium_idahoense TGTCTCCTCAACGCAATGGACCTCTCATGGGTATTGTGCAAGATACTCTATGCGGTATCTACAAGATTTGCCGTCGTGACACCTTCCTTACTAGGGACCAGGTCATGAACATTATGCTCTGGGTTCCTAATTGGGACGGGATGATCCCCCCTCCGGCAATCCTCAAACCTCGCCCGCGCTGGACCGGGAAGCAGATCATCAGTATGGCCTTCCCATCTGGCCTCAACCTTCTGCGCATCGA---CAAGGACAGCTCGCCGCTCTCCGAGAAATTTAGTCCTCTTAATGACGGTGGCCTGTTGATCCACGGTGGACAGCTGTTGTACGGCTTGCTCTCCAAGAAGACCGTCGGTGCAAGTGGTGGTGGTGTCATCCACACAATTTTCAATGAGTATGGCCCCGACGCTGCTGTGAGCTTCTTCAATGGTGCCCAGACCATTGTCAACTACTGGCTTCTGCACCATGGTTTCAGTATCGGTATCGGTGACACGATTCCTGATCGCCTGACCATTCAAAAGATTGAGGACGCTGTTCGCGAGCGCAAGCAGGAAGTCGAGTCTATCACTGCCAGCGCTACAGATAACACTCTGGAGCCATTGCCTGGTATGAACGTGCGTGAGACTTTCGAGAGTAAGGTCTCTCGTGCCCTGAACAACGCTCGTGATGAAGCTGGTGCTGCCACCGAGGAGAGTTTGAAGGATTTGAACAACGCCATTCAAATGGCGCGCTCAGGCTCCAAGGGATCGACGATCAATATTTCTCAAATGCTGCGTTGAGAGCAACAAAGAAGTTTATCTCAACATCGGTTTGAAAGCTTCCACGCTCAGCAATGGCTTGAAGTACTCGCTGGCTACCGGTAATTGGGGCGAGCAAAAGAAGGCGGCCAGTTCCAAGGCTGGTGTGTCTCAAGTGCTGAGTCGTTACACTTATGCTTCCACGTTGTCGCATCTTCGTCGCACCAACACTCCCATTGGCCGAGATGGTAAGATCGCCAAACCACGTCAACTGCACAATACCCATTGGGGTCTGGTTTGCCCGGCCGAAACCCCTGAAGGTCAGGCTTGTGGTCTGGTCAAAAACTTGGCTCTCATGTGCTACATCACTGTCGGTACACCAAGTGAGCCCATCATTGACTTCATGATTCAGCGGAATATGGAAGTTCTTGAGGAATTCGAACCTCAAGTCACCCCTAATGCTACCAAGGTGTTTGTCAACGGTGTCTGGGTCGGCATTCACCGAGATCCATCGCATCTGGTTAATACCATGACTGCCCTGCGTCGGCGGAACATGATCTCTCACGAGGTCAGCTTGATTCGTGATATTCGCGAACGAGAATTCAAGATTTTCACGGATACTGGCCGTGTTTGCCGACCATTGTTCGTGGTCGACAATGATGCGAAGAGCGACCATGCTGGGTCGTTGGTTCTGAACAAAGAGCACATCCGCAAGCTGGAGCAGGACAAGGACT---------TGCCAGCAACCATGGATCCAGATCAGCGCCGGGAACGTTACTTCGGGTGGGACGGGCTGGTGCGATCTGGAGTCGTGGAGTATGTGGACGCCGAGGAAGAAGAAACAATCATGATTGTGATGACTCCCGAGGATCTCGAGATTTCCAAGCAGCTCCAGGCCGGCTACGCCCTGCCGGATGATGAGAAGAGCGACCCTAACAAGCGAGTTCGCTCGATCTTGAGCCAACGGGCGCACACCTGGACGCACTGCGATAGTCAGTGGGAGACGTCTGAGGATCGTCCCTTTGAGCCGGAAGACTGGCGGCGGCTCTTGCAGTTCGGCGACTACAAGGGAACGAAGAACCGTACTATTCGGGAAGCCTTGGTTGGTGGAGTGAACCCAGGTATTCGCGTGGACGTTCATCTCCGCGCTGTGCCAGCCTCGCTCCGCGGCAAGGCGCAGCCGCTTTCCTTGTTCTC-GCTTCTCCGCCATGAGCACAAGCACACCGTGGTCAACGTCAGCATGACCTTGAACTCTAGTGTTGAGCAACCCCTCAAGGCCAAGGAGGAGCTCGTTATCCAGTGTGGCGCTCGCCGAACAGTTGTCAATCCTGTCTTCTCGGCTGGTGACAACACGCCCAACAACGTGCACAAGTTCGACCGCTTCCTGCACCCCGGCCGCAGTGCTATTGCCACCTGGATTGGTCCAATGACCTGGGGCGCCGTTCCCATTCTTGTCTTCAAGAACAAGAAGACT------GAGGAGGACCCAGAGGTGCTCGACTCGGCGGATGCCG------------CTAAGGA------GCCAATTGCTCTGGATCGATTGGAACTGATTGGCACCGGCACTGTAATCGCCCCCGACCCTGCCCGTGTGATTGCCAAACGCGCCATCCGTAAGGCCAAGGTTGGCGTTTTCAGCTGCCCCATTGATGTCTCGCAGACTGAGACCAAGGGCACTGTTCTGCTGAAGAATGCCCAGGAGATGGTTGACTACACCAAGGGCGAGGAGGAGCGTCTTGAGACTGCTATTAAGGAGCTCTACGACTCTGGCCTCCGGGTGGTGGTTGCTGGCTCTACCGTCGGCGATCTCGCCATGCACTATCTCAACCGCTTCAACATCCTTGTTATCAAGATCCTGTCCAAGTTCGAGCTCCGCCGCTTGTGCCGCGTGGTCGGTGCTACCCCTCTGGCCCGTCTGGGCGCCCCCATGCCCGACGAGATGGGCAATGTCGATGTGGTTGAGACCACCGAGATTGGCGGTGACCGAGTAACCGTGTTCCGTCAAGAAGACGCTACCAACGTGACACGCACGTCGACCATTGTTCTGCGCGGTGCCACACAGAACCACCTGGAGGACGTCGAGCGTGCTATCGATGACGGCGTGAACGCCATCAAGGCCGTGACCAAGGACCCTCGCCTCGTGCCCGGTGCCGGTGCCACTGAGATTCAGCTCGTCCAGCGCATCTCCGACTTCGCGGACCGCACCCCCGGTCTGCCTCAACACGCCATCCGCAAGTACGCCGAGGCCTTCGAGGTGGTGCCTCGCACACTCGCCGAGTCCGCCGGTCTCGACGCCACCGAGGTTCTGTCTCGTCTCTACACAAAATATTGCTGGGGAGCACGGCCTCGACGGCGATGGCCA----CTTCACCGGTGATTCCGACCTCCAGCTTGAGCGCATGAACGTCTATTTCAACCATGCTTCTGGTGACCGCTACGTTCCCCGTGCCGTCCTGGTCGATCTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGACAAATCACCACCAAGGAGCTTGGTACCGTGATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCGGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCCGAGTTCCTCA Penicillium_janthinellum TCTCTCCTCAGCGTAACGGTCCACTCATGGGTATTGTGCAGGATACTCTGTGCGGTATCTACAAGATTTGCCGTCGTGACATCTTCCTCACCAAGGATCAGGTTATGAACCTTATGCTCTGGGTCCCCGACTGGGATGGCGTTATCCCTCCTCCCGCCATCATGAAGCCCCGTCCTCGCTGGACCGGCAAGCAGATGATCAGTATGGCCTTCCCCTCTGGGCTCAACCTTGTCCGTGTCGA---CAAGGATAGTGCGCCGCTGTCCGAGAAATTTAGCCCTCTCAATGACGGCGGTCTGCTCATTCAAGGTGGACAGTTGATGTATGGCATGCTTTCCAAGAAGACCGTTGGTGCCAGCGGTGGTGGTGTGATTCACACCATCTTCAACGAATATGGCCCTGACATCTGCGTTAACTTCTTCAATGGTGCCCAAACAATCGTCAACTATTGGCTGCTGCACCATGGTTTCAGTATCGGTATCGGTGATACGATTCCCGATCGTAAGACCATTGAAAAGATCGAGGAGGCCGTCAGGGAACGCAAGCAAGAGGTCATGGAGATCACTGCCAGTGCTACAGACAACACTCTGGAAGCCCTACCTGGTATGAATGTCCGTGAAACTTTCGAGAGCAAGGTTTCCCGCGCCTTGAATAATGCTCGTGATGAGGCTGGTGCCGCTACTGAGAAGGGATTGAAGGACCTGAACAACGCTATTCAGATGGCTCGTTCTGGTTCCAAGGGCTCTACTATCAACATTTCCCAGATGTTGCGTGGAGACCAACAAGGAGCCCAATCTCCGCATTGGTCTGAAGGCGGCTACCCTGACTGGTGGCCTGAAGTATGCTCTGGCTACGGGTAACTGGGGTGAGCAGAAGAAGGCTGCTAGCTCCAAGGCTGGTGTGTCCCAGGTGCTGAGTCGCTACACCTTTGCTTCCAGTTTGTCCCATCTTCGCCGTACCAACACACCTATTGGACGAGACGGCAAGATCGCCAAACCACGTCAACTTCACAACACCCACTGGGGTCTTGTGTGCCCTGCCGAGACTCCTGAAGGTCAAGCTTGTGGCCTGGTCAAGAACTTGGCACTGATGTGTTACATCACGGTCGGTACACCCAGCGAGCCCATCGTTGACTTCATGATTCAACGAAACATGGAAGTTTTGGAAGAGTTTGAACCACAAGTCACACCCAATGCTACAAAGGTGTTCGTGAACGGTGTCTGGGTCGGTATCCACCGTGACCCCACCCATCTAGTCAACACCATGCAGTCCCTTCGACGGCGCAACATGATTTCTCACGAGGTCAGCTTGATTCGGGACATCCGTGACCGAGAGTTCAAGATTTTCACAGATGCTGGACGTGTCTGCCGACCCTTGTTCGTTGTTGACAACGATCCCAAGAGTGAAAACGCTGGATCACTGGTCCTCAACAAGGAGCACATTCGCCTGTTGGAGCTGGACAAGGATC---------TGCAGCGTGAACTGCCCCCTGAGCAGCTTCGAGAGCAAGGTTTCGGATGGGACGGCTTGGTCCGATCAGGTGTTGTCGAGTACGTGGATGCTGAGGAAGAAGAGACGATCATGATCGTCATGACTCCGGAGGATTTGGAGATCTCCAAGCACCTCCAGGCCGGCTACTCTTTGCCCGAAGATGATAAGAACGATCCCAACAAGCGTGTGCGT---ACCGTGACCCAACGTGCGCATACCTGGACGCATTGCGACAGCCCGTGGGAGACGTCCGAAGACCGTCCATACGAGCCTGAAGACTGGCGCCGACTATTGCAATTCGGTGACTACAAAGGCACCAAGAACCGCATCATTCGCGAAGCCCTTGTTGGCGGTGTCAACCCTGGAGTGCGTGTGGACGTGCATCTCCGTGCAGTCCCTGCCTCGCTCCGCCACAAGGCCCAGCCTCTTGCCCTGTTCTC-TCTTCTGCGTCACGAGCACAAGCACACCGTGGTCAACGTCAACATGACCTTGAGTTCCAGTGTCGAGAAGCCGATCAAGTCCAAGGAAGAGCTCATCGTGCAGATCGGCGCCCGCCGCTTGGTCGTCAACCCTGTCTTCTCCGCCGGCGACAACACCCCGAACAACGTCCACAAGTTCGACCGTTTCCTCCACCCTGGCCGCAGTGCCGTCGCAACCTGGATCGGTCCCATGACCTGGGGCGCCGTCCCGGTTCTCGTCTTTAGGAAGAAGCAAGAG------GAGGAAGACCCCGAGGTCCTCGACTCAGCCGATACCC------------AGCCGGA------GACGATGTCTATGGACCGCCTGGAGCTCATTGGTACCGGCACGGTCATTGCACCGGACCCGAACCGTGTCATTGCCAAGCGTGCAATCCGCAACGCCAAGGTCGGCGTGTTCAGCTGCCCCATTGATATCTCCCAGACCGAGACCAAGGGCACAGTTCTCCTGAAGAATGCCCAGGAGATGGTTGACTTCACCAAGGGCGAAGAGGACCGTCTCGAGACCGCCATCAAGGAGCTATATGACTCTGGCCTCCGTGTGGTCGTTGCCGGCTCTACCGTCGGCGACCTGGCCATGCACTACCTCAACCGCTTCAACATCCTTGTCATCAAGATTCTCTCCAAGTTCGAGCTCCGCCGTCTGTGCCGCGTCGTCGGTGCCACCCCCCTCGCCCGCCTGGGCGCCCCCATGCCCGACGAGATGGGCCAGATCGATGTGGTCGAGACGACTGAGATTGGCGGTGACCGCGTCACCGTCTTCCGGCAAGAGGCCGCCAACGCCGTGACCCGCACATCGACGATCGTGCTCCGCGGCGCAACCCAGAACCACCTGGATGACATCGAGCGCGCCATTGACGATGGCGTCAACGTCGTCAAGGCCATCACTAAGGACCCTCGCCTGGTGCCTGGTGCCGGTGCTACTGAGATCCAGCTCGTCGAGCGCATCTCCAACTTCGCCGACAAGACCCCCGGCCTGCCGCAGCACGCCATCCGCAAGTATGCCGAGGCCTTCGAGGTGATCCCCCGCACTCTGGCCGAGTCCGCCGGCCTCGACGCCACCGAGGTTCTCTCCCGCCTGTACACAGACCATTGCTGGTGAGCACGGCCTTGACGGCGATGGCCA----CTACAACGGTACCTCCGACCTCCAGCTCGAGCGCCTGAACGTCTACTTCACCCACGCTAGCGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTGGAGCC-CGGTACCATGGACGACAAGGATGGTGATGGCCAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCGCTCGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACCATCGACTTCCCTGAGTTCCTCA Penicillium_javanicum TGTCGCCTCAGCGTAACGGTCCCCTTATGGGTATTGTACAGGATACTCTGTGCGGTATCTATAAGATCTGCCGTCGTGACATCTTCCTCACCAAGGATCAGGTCATGAACCTTATGCTCTGGGTTCCCGACTGGGATGGTGTCATCCCTCCCCCTGCGATCATGAAGCCTCGTCCTCGCTGGACCGGCAAGCAGATGATTAGTATGGCTTTCCCCTCTGGGCTCAACCTCGTTCGTGTCGA---CAAGGATAGTGCGCCTCTCTCCGAGAAATTCAGCCCTCTCAATGACGGTGGTCTGCTCATCCAAGGTGGACAGTTGATGTACGGTATGCTTTCCAAGAAGACCGTTGGTGCCAGCGGTGGTGGTGTGATTCACACCATCTTCAACGAGTATGGTTGTGACACCGCAGTCAATTTCTTCAATGGTGCCCAAACCATTGTCAACTATTGGCTGCTGCACCATGGTTTCAGTATCGGTATCGGCGATACGATCCCCGATCGTAAGACCATTGAAAAGATCGAGGAGGCTGTCAGGGAACGCAAGCAAGAGGTCATGGAGATTACTGCCAGTGCTACAGATAACACCTTGGAAGCGCTGCCTGGTATGAATGTCCGTGAAACTTTCGAGAGCAAGGTCTCCCGCGCTTTGAACAACGCTCGTGACGAGGCCGGTGCGGCCACTGAGAAGGGATTGAAGGATCTGAACAACGCTATTCAGATGGCTCGCTCTGGTTCTAAGGGTTCGACTATCAACATCTCCCAGATGTTGCGTGGAGACCAACAAGGAGCCTAACCTGCGCATTGGTCTGAAGGCTGCTACCCTGACTGGTGGTTTGAAATATGCCCTGGCGACGGGTAACTGGGGTGAGCAGAAGAAGGCTGCCAGCTCCAAGGCTGGTGTGTCCCAGGTGCTGAGTCGGTACACATTCGCGTCCAGCTTGTCCCATCTACGCCGTACCAATACTCCTATCGGCCGAGATGGCAAGATCGCTAAGCCGCGTCAACTTCACAATACTCACTGGGGTCTTGTGTGCCCCGCCGAGACTCCCGAAGGTCAAGCTTGTGGTCTTGTAAAGAACTTGGCACTGATGTGCTACATCACTGTCGGTACACCCAGCGAGCCCATCGTTGATTTCATGATTCAACGAAACATGGAAGTCCTCGAGGAGTTTGAACCACAAGTCACGCCTAATGCCACCAAGGTGTTCGTGAACGGTGTCTGGGTCGGTATCCACCGTGACCCAACACATCTCGTCAACACCATGCAGTCCCTCCGTCGGCGCAACATGATCTCCCACGAGGTCAGCTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATTTTCACAGATGCTGGACGTGTCTGCCGACCCCTGTTCGTTGTTGACAACGATCCCAAGAGTGAGAACGCTGGGTCATTGGTTCTGAACAAGGAGCACATTCGCCTGCTGGAGCTGGACAAGGACC---------TACAACGTGAACTGCCCCCTGAGCAGCTCCGAGAGCAAGGTTTCGGATGGGATGGTTTGGTCAGATCTGGTGTTGTGGAATACGTGGATGCTGAGGAAGAAGAAACGATTATGATCGTTATGACTCCCGAGGACTTGGAGATCTCCAAGCACCTCCAGGCTGGCTACTCCCTGCCCGAGGATGACAAGAACGACCCCAACAAGCGTGTGCGT---ACCGTGACTCAACGGGCTCATACCTGGACGCATTGCGACAGCCCGTGGGAGACGTCCGAAGACCGTCCATTCGAGCCTGAAGATTGGCGCCGACTTTTGCAATTCGGTGACTACAAGGGCACCAAGAATCGCGTTATTCGCGAAGCCCTTGTTGGTGGTGTCAACCCGGGTGTGCGCGTGGACGTGCATCTTCGTGCAGTCCCTGCCTCGCTCCGCCACAAGGCTCAGCCTCTTTCCTTGTTCTC-TCTCTTGCGTCACGAGCACAAGCACACCGTGGTCAACGTCAACATGACCTTGAGTTCCAGCGTCGAGAAGCCTGTCAAGTCCAAGGAGGAGCTCATTGTGCAGATCGGCGCCCGCCGCATAGTTGTCAACCCTGTATTCTCCGCCGGCGACAACACCCCGAACAATGTCCACAAGTTCGATCGCTTCCTCCACCCCGGCCACAGTGCCGTCGCTACCTGGATTGGTCCTATGACCTGGGGCGCTGTTCCGGTTCTTGTCTTCAGGAAGAAACAAGAG------GAGGAAGACCCAGAGGTCCTCGAATCAGCAGATGCCC------------AGCCGGA------GGCGCTTTCTCTGAATCGTCTGGAGCTTATTGGTACTGGCACGGTCATCGCACCAGACCCCAACCGTGTGATTGCCAAGCGTGCAATTCGCAAGGCCAAGGTCGGCGTTTTCAGCTGCCCCATTGACATTTCGCAGACCGAGACCAAGGGAACTGTTCTGCTGAAGAACGCCCAAGAGATGGTTGACTACACCAAGGGCGAGGAGGAGCGCTTGGAGGCTGCCATTAAGGAGCTGTACGACTCCGGTCTCCGCGTGGTTGTTGCTGGTTCTACCGTCGGCGATCTTGCCATGCACTACCTCAACCGCTTCAACATTCTTGTCATCAAGATTCTGTCCAAGTTTGAGCTCCGCCGCTTGTGCCGTGTCGTCGGTGCTACCCCTCTGGCCCGCTTGGGTGCTCCCATGCCCGATGAGATGGGTCAAGTCGACGTTGTCGAGACTACTGAAATTGGTGGTGACCGTGTTACCGTTTTCCGTCAAGAAGACGCCAATGCTGTCACTCGCACCGCCACCATTGTTCTGCGTGGTGCCACCCAGAACCACCTCGAGGACGTCGAGCGTGCCATCGATGACGGCGTGAACGTCGTCAAGGCCATCACCAAGGATCCCCGCCTTGTTCCCGGTGCCGGAGCCACCGAGATCCAGCTCGTGGAGCGTATCTCCGCCTTCGCCGATAAGACCCCCGGTCTGCCCCAGTACGCCATTCGCAAGTACGCCGAGGCCTTTGAGGTCATCCCCCGCACTCTCGCCGAGTCCGCCGGTCTCGATGCCACCGAGGTTCTCTCCCGCCTGTACACAGACCATTGCTGGTGAGCACGGCCTGGACGGCGATGGCCA----CTACAATGGTACCTCCGACCTCCAGCTGGAGCGCCTGAACGTCTACTTCACCCACGCCGGCGGTGACAAGTACGTTCCCCGTGCCGTTCTAGTCGATCTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAGAACCCCTCTGAGTCCGAGTTGCAGGATATGATCAACGAGGTCGATGCTGACAACAACGGCACCATCGACTTCCCTGAGTTCCTCA Penicillium_lagena TGTCCCCTCATCGGAATGGTCCCCTCATGGGTATTGTGCAGGATACCCTCTGCGGTGTCTACAAGATCTGCCGCCGCGATACGTTCCTTTCCAAGGAGCAGGTCATGAACATCATGCTGTGGGTTCCGGATTGGGATGGTGTCATCCCTCCACCCGCTATTCTGAAGCCGCGTCCGCGGTGGACTGGAAAGCAGATGATCAGCATGGCATTCCCGTCTGGTCTCAACTTGCTGCGTGTCGA---AAAGGACAACTCTCCCCTCTCCGAGAAGTTCAGTCCGCTTACTGACGGTGGCCTCCTTATCCACGGTGGCCAGCTGATGTACGGAATGCTTTCCAAGAAGACCGTCGGCGCGAGCGGCGGAGGTGTCATCCACACCATCTTCAATGAGTATGGACCGGACACTGCTGTCAACTTCTTCAACGGCACACAGACGATCGTCAACTACTGGCTGTTGCACAACGGTTTCAGTATCGGTATCGGCGATACGATCCCTGACTACAACACGATCCAAAAGATCGAGGAGGCTGTGCGTGAGCGGAAGAAGGAAGTCGAGTCGATCACTGCCAGTGCGACTGAAAACACCTTGGAGGCTCTGCCTGGTATGAACGTACGTGAGACTTTCGAGAGCAAGGTCTCGCGTGCTCTGAACAATGCCCGTGACGAAGCTGGTGCTGCGACCGAGAAGAGTTTGAAAGATCTCAACAATGGTATCCAGATGGCGCGCTCCGGTTCCAAGGGGTCCACCATCAACATCTCCCAGATGGTGTGTTGAGACGAACCGTGAAATCTACTTGAATATCGGTATCAAGGCCAGCACATTGACCGGCGGTCTGAAGTATGCTCTTGCGACCGGCAACTGGGGAGAGCAGAAGAAGGCTGCCAGCGCCAAAGCCGGTGTGTCCCAGGTGCTCAGTCGCTACACTTATGCGTCTACTTTGTCACATTTGCGCCGCACCAATACCCCCATCGGCCGAGACGGCAAGATCGCCAAACCGCGTCAGCTCCACAATACTCACTGGGGTTTGGTGTGTCCCGCCGAAACGCCCGAAGGTCAGGCTTGTGGTCTTGTCAAGAATTTGGCACTCATGTGCTACATCACTGTTGGTACGCCTAGCGAGCCAATCATCGACTTCATGATTCAACGCAACATGGAAGTCTTGGAAGAATTCGAGCCCCAAGTGACGCCCAACGCTACCAAGGTGTTTGTTAATGGTGTCTGGGTTGGTATCCACCGCGATCCGTCACATCTCGTCAACACCATGTTGTCGCTGCGCCGACGGAACATGATCTCCCACGAAGTCAGCTTGATTCGGGATATTCGTGAGCGCGAATTCAAGATTTTCACCGACACTGGTCGTGTGTGCCGCCCACTTTTTGTCATTGACAACGACCCCAAGAGTGAAAATGCCGGATCGCTGGTCTTGAACAAGGAGCACATCCGGAAGCTGGAGCAAGACAAGGATT---------TGCCACCTGATATGGATCCAGAAGACCGCCGGGAGCGCTACTTCGGTTGGGATGGCCTGGTGCGGTCGGGTGTGGTGGAGTATGTGGACGCCGAGGAAGAAGAGACGATCATGATCGTGATGACACCCGAGGATCTTGAGATCTCCAAGCAACTTCAGGCAGGCTACGCCCTGCCCGAAGAAGAAACCAACGACCCCAATAAGCGTGTCCGCTCGATCCTGAGCCAGCGGGCGCACACATGGACACACTGCGACAGCCCATGGGAACTATCCGAAGACCGTCCGTTTGAGCCGGAGGACTGGCGTCGATTGCTCCAGCTCGGTGACTACAAGGGCGCCAAGAACAGAATTCTTCGTGAAACTCTGATCGGTGGCGTCAACCCGGGCATTCGCGTGGATGTGCATCTCAAGTCAGTGCCGTCGTCTCTTCGCAACAAACCGCAACCAATGGCGCTCTTCTC-CCTTCTCCGACACGAGCACAAGCACACCGTGGTCAACATCAACATGACTCTCAACGGGAGCGTCGAGCAGCCCCTCAAGTCCAAGGAGGAATTGATTGTGCAGGTCGGCCCCCGTCGACTGGTCGTCAACCCCATCTTCTCGGCCGGCGACAACACACCCAACAATGTGCACAAGTTTGACCGTTTCCTGCACCCCGGCCGCAGCGCCATCGCAACCTGGATCGGGCCCATGACTTGGGGCGCAGTGCCCGTCCTCGTTTTTAAGAGCAAGAAACCC------GA---AGACCCCGAGGTCCTCGACATGGCAGACGCCA------------ACCCCCA---GGATCTGTTGTCTCTGGATCAGCTGGAGCTGATCGGTACCGGAACCGTTGTGGCACCAGACCACGGCCGTGTGGTTGCGAAGCGCGCCATCCGCAAGGCCAAGGTCGGCGTTTTCAGCTGCCCAATTGATATCGGCCAGACCGAGACCAAGGGCACGGTGCTCTTGAAGAATGCACAGGAAATGGTGGACTACACCAAGGGCGAGGAGGACCGTCTAGAGACGGCCGTCAAGGAGCTCTACGATTCCGGCCTTCGGGTGGTCGTGGCTGGTTCTTCAGTCGGCGACCTGGCCCTGCACTACCTCAACAAATTTAACATCCTGGTGATCAAGATCCTGTCCAAGTTTGAGCTCCGCCGCTTGTGCCGAGTGGTGGGTGCTACCCCCCTCGCCCGTCTTGGTGCACCCATGCCCGACGAGATGGGCAGCGTTGACGTGGTCGAGACGACCGAGATTGGTGGTGACCGAGTTACCGTTTTCCGTCAAGAGGAGGCCAACGCCGTGACGCGCACAGCCACCATTGTGCTGCGCGGTGCCACCCAGAACCACCTGGATGACATTGAGCGTGCCATTGACGACGGCGTGAACGTCGTCAAGGCCATCACCAAGGACCCGCGTCTGGTCCCCGGAGCCGGCGCCACGGAGATCCAACTGGTTGACCGGATCTCCAACTTTGCCGACAAGACTCCCGGTCTGCCGCAGTACGCCATCCGCAAGTATGCCGAGGCCTTCGAGGTCATCCCGCGCACGCTTGCCGAATCCGCCGGCCTTGATGCCACGGAGGTTCTCTCCCGCCTGTACACAGAACATTTCTGGCGAGCACGGCCTCGATGGCGATGGCCA----CTACAATGGTGCCTCCGACCTGCAGCTGGAGCGCATGAACGTCTACTTCAACCATGCCTCCGGTGACCGCTACGTTCCCCGTGCCGTCCTGGTCGATCTGGAGCC-TGGCACCATGGATGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCGCTCGGCCAGAATCCGTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTGGATGCCGATAACAACGGCACCATCGACTTCCCCGAATTCCTCA Penicillium_lanosum TCTCTCCCCAGCGTAACGGCCCTCTGATGGGTATCGTGCAGGACACCCTTTGTGGTATCTACAAGATTTGTCGTCGTGACACTTTCCTCACCAAGGACCAAGTTATGAACCTTATGCTCTGGGTCCCTGACTGGGATGGTGCAATCCCTCCGCCAGCTATTCTGAAGCCCCGGCCCCGCTGGACCGGAAAGCAGATGATCAGCATGGCCTTCCCCTCCGGTTTGAACCTTCTGCGTGTTGA---TAAAGATGGTTCGCCATTGGCCGAGAAGTTCAGTCCTCTCAGCGATGGCGGTCTCCTGATCCACGGTGGACAACTCATGTACGGCATGCTTTCCAAGAAGACTGTCGGTGCCAGTGGTGGCGGTGTTATCCACACCATTTTCAACGAGTATGGCCCCGACACTTGTGTCAAATTCTTCAACGGTGCTCAGGCCATCGTCGGTTACTGGCTGCTTCACAACGGTTTCAGTATCGGTATTGGTGACACCATTCCTGACCAATTGACCATCAACAAAATTGAGGAAGCCGTCCGAAACCGAAAGCAGGAGGTTGAGACGATCACTGCCAGCGCCACTGAGAACACACTGGAGGCTCTCCCTGGTATGAACGTCCGTGAGACATTCGAGAGCAAGGTTTCTCGCGCTCTGAATAACGCTCGTGACGAGGCTGGTGATGCCACCGAGAAGAGTTTGAAGGATTTGAACAACGCTATTCAAATGGCCCGTTCCGGTTCCAAGGGTTCCGCAATCAACATTTCCCAGATGTTGTGTTGACGAGGGTCGCGAAATTTATCTCAACGTTGGTCTCAAGGCTGCGACTCTTACCGGTGGTTTGAAATACGCTCTTGCCACTGGTAACTGGGGTGAGCAGAAGAAGGCAGCTAGTGCCAAGGCTGGTGTGTCCCAGGTGCTGAGTCGTTACACTTTCGCCTCGTCTCTGTCCCATCTTCGCCGCACGAACACACCAATTGGTAGAGATGGAAAGATCGCCAAGCCCCGTCAACTCCATAACACCCATTGGGGTCTGGTCTGCCCGGCTGAGACTCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGGCACTGATGTGTTACATTACTGTCGGCACACCGGCTGAGCCCATCATCGATTTCATGATTCAGCGAAACATGGAAGTGTTGGAGGAGTTCGAGCCTCAAGTTACGCCCAACGCGACGAAGGTGTTTGTCAACGGTGTCTGGGTTGGTATTCACCGTGATCCCTCGCATCTTGTCAATACTATGCAGAACTTGCGTCGTCGAAACATGATTTCCCACGAAGTCAGTCTTATTCGTGACATTCGTGAACGTGAGTTCAAGATTTTCACCGATACTGGACGTGTGTGCCGACCGCTCTTCGTTATCGACAACGATCCTAAGAGTGAAAACTCCGGTGGATTGATCCTTAACAAGGAGCACATTCGCAAACTTGAGCAAGACAAGGATT---------TGCCTCTCGACATGACTCCGGAAGAGCGCCGTGAACAATACTTCGGTTGGGATGGTTTGGTACGATCCGGTGCCGTTGAGTATGTCGATGCTGAGGAAGAGGAGACAATCATGATTGTCATGACCCCAGAGGACTTGGAAATCTCCAGACAACTCCAAGCTGGATACGCTTTGCCAGAGGAAGAGACCAGTGACCCCAACAAGCGTGTTCGCTCGATTCTCAGCCAGCGCGCACACACCTGGACGCATTGCGACAGCAACTGGGAAACATCCGAGGATCGTCCCTACGAGCCCGAGGACTGGCGCCGCCTCCTCCAGTTTGCTGATCACAGGGGCTCCAAGAACCGCATCATCAGAGAGGCCCTGGTTGGCGGTGTGAACCCTGGTACCCGCGTGGATATTCACCTCCGCGCAGTGCCCTCTATCCTGCGCAACAGCCCCAAGCCTCTTGCGCTCTTCTC-TCTCCTTCGCCACGAGCACAAGCAGACCGTGGTCAATGTTAGCATGACACTCAACTCTAGCGTGGAGAAGCCTCTCCGCGCTAAAGAGCAACTCATTGTCCAGTGCGGTGCTCGCCGCATGGTCGTCAACCCTATCTTCTCATCGGCCGATAACACGCCTAACAATGTGCACAAGTACGACCGTTTCCTCCACCCCGGTCGCAGCGCAATTGCATCCTGGATTGGACCCATGACCTGGGGTTCCGTCCCAGTCCTTATCTTCAAGAGCAAGCAAACC------GAGGTTGAGGATGACGACGAGGAGATGGAAACCG---------------AGGCCAAGGAGGAGCCGATCGCCATGGACCAACTGGAGCTCATCGGTACCGGTACCGTTGTTGCACCCGACCAGAAGCGCGTGATTGCCAAGCGTGCCATCAGCAGAGCCAAGGTCGGCGTGTTCAGCTGCCCCATCGATATCAGCCAGACCGAGACCAAGGGCACAGTTCTCCTGAAGAACGCCCAGGAGATGGTTGACTTCACCAAGGGTGAGGAGGAGCGTCTGGAGGCTGCCATCAAGGAGCTCTACGACTCCGGCCTCCGTGTCCTTGTTGCTGGCTCCACCGTCGGCGACCTGGCCATGCACTACCTCAACCGTTTCAACATCCTGGTCGTCAAGGTTCTGTCCAAGTTCGAACTCCGCCGCCTGTGCCGTGTTGTCGGCGCCACACCTTTGGCCCGCCTGGGTGCCCCCATGCCCGATGAGATGGGCCAGATCGACGTCGTCGAGACCACCGAGATCGGTGGTGACCGTGTCACCGTCTTCCGCCAGGAGGACACCAACGCCGTTACCCGCACAGCAACCATTGTCCTGCGCGGTGCTACCCAAAACCACCTGGAGGATGTCGAGCGCGCCATCGATGACGGCGTGAACGTCGTCAAGGCCATCACCAAGGACCCCCGTCTGGTGCCCGGTGCCGGTGCCACCGAGATCCAGCTCGTCGAGCGCATCTCCAACTTTGCCGACCGTACCCCCGGTCTTCCCCAGCATGCTATTCGCAAGTACGCCGAGGCCTTCGAGGTCGTTCCCCGCACACTCGCCGAGTCTGCCGGTCTCGATGCTACCGAGGTTCTCTCGCGTCTGTACACAAACTATCTCCGGTGAGCACGGTCTCGATGGCGATGGACA----GTACAATGGTACCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACCATGCTAGCGGTGACAAATACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCCGAACTGCAGGACATGATCAACGAGGTTGACGCCGACAACAATGGCACCATCGACTTCCCCGAATTCTTGA Penicillium_lapidosum TCTCTCCTCAGCGCAACGGTCCTCTCATGGGTATCGTCCAAGATACTCTTTGCGGTATCTACAAGATTTCCCGTCGTGATGTCTTCCTCTCCAAGGACCAGGTCATGAACATCATGCTCTGGGTCCCAGACTGGGATGGTGCCATCCCTCCTCCCGCCATTCTGAAGCCTCGCCCCCGCTGGACCGGAAAGCAGATGATCAGTATGGCGTTCCCTGCTGGTCTCAACCTTCTGAATATCGA---AAAGGACAACTCGCCCCTCTCCGTGAAGTTCAGCCCCGTTAATGACGAGGGCCTACTTATTCACGGTGGCCAGCTCTTGTATGGTATGCTCGTGAAGAAGACCGTCGGTGCCAGCGGTGGTGGCGTCATCCACATCATATTTAACGAATATGGACCGGACGCTGCTGTGGCCTTCTTCAACGGTGCCCAGAGAATTGTCAACTACTGGCTTCTGCATAATGGTTTCAGTATCGGTATTGGTGATACGATTCCCGATCGGAAAACTATTGACAAGATCGAGGAGGCTGTCCGTGAGCGCAAGCGAGAAGTCGAAGAGATCACTGCTAGCGCCACTGACAATACACTCGAGGCATTGCCTGGTATGAACGTCCGTGAAACCTTTGAGAGCAAGGTTTCCAGAGCCCTCAACAACGCCCGTGACGAAGCCGGTGCCGCTACCGAGAAGTCTTTGAAGGATTTGAACAATGCTATCCAGATGGCGCGTTCTGGTTCCAAGGGTTCCACTATCAACATTTCCCAGATGATGCGTTGAGACCAACAGGGAGATCTACTTGAACATGGGTATTAAGGCCGCTACCCTGACCAGTGGTCTGAAGTACGCCCTAGCAACGGGTAACTGGGGTGAGCAGAAGAAGGCGGCCAGCGCCAAGGCCGGTGTTTCTCAAGTGCTGAGTCGATACACTTATGCCTCGACTTTGTCTCATTTACGCCGTACAAATACACCCATTGGCAGAGATGGAAAGATCGCCAAGCCGCGACAGCTTCACAACACCCACTGGGGTCTTGTGTGCCCTGCCGAGACTCCTGAAGGTCAAGCATGTGGTCTCGTCAAGAACCTGGCGCTCATGTGCTACATTACTGTGGGCACGCCTAGCGAGCCTATCATTGACTTCATGATCCAGCGAAATATGGAGGTCCTCGAAGAATTTGAGCCTCAAGTTACACCCAACGCCACCAAGGTCTTCGTCAATGGTGTTTGGGTTGGCATTCATCGCGACCCGACGCATCTTGTCACTACCATGATGTCCCTACGCCGGCGCAACATGATCTCTCACGAGGTCAGCTTGGTCCGTGACATTCGTGACCGGGAGTTCAAGATTTTCACGGATACTGGTCGTGTGTGTCGACCTCTTTTCACTATTGACAACGACCCCAAGAGCGAGAATGCTGGATCGTTGATTCTCAACAAGGAGCACATCCGAAAGCTCGAGCAGGACAAAGAAT---------TGCCGGCAGATATGGATGCGGAAGACCGCCGGGAGCGTTACTTCGGATGGGAGGGCTTGGTGCGTTCCGGAGCCGTGGAACTGGTGGATGCCGAGGAAGAAGAGACGATCATGATCGTCATGACGCCTGAAGACCTGGAAATTTCTAAGCAGCTCCAGGCCGGGTACGCGCTGCCAGAGACTGATTCGGATGACCCCAACAAGCGAGTCCGATCCATCCTCAGTCAACGGGCACACACTTGGACACATTGCGATAGTCCTTGGGAAACTTCTGAGGACAGACCCTTCGAGCCGGAAGACTGGCGCCGGTTGTTGCAATTCGGTGACTACAAGAGCATCAAGAATCGCGTGGTTCGCGAGGCTCTTATCGGTGGTGTCAACCCTGGTACTCGGGTCGATATCCATCTTCGTGCGGTGCCCTCTGCTCTCCGCCACAAGGCCCAGCCGCTCTCCCTATTCTC-ACTCCTACGCCACGAGCACAAGAACACCGTGGTCAACGTCAACATGAGCTTGAATGGAAGCGTCGAGAAGCCCCTCAAGGCCAAGGAAGAGCTTGTTGTGCAGTGCGGTGCCCGCCGCATGGTGGTCAAGCCCGTGTTCTCCTCTGCTGACAACACCCCCAACAACGTGCACAAGTTCGACCGTTATTTGCACCCCGGTCGCAGCGCCATCGCCACATGGATTGGACCCATGACCTGGGGCGCTGTCCCTATTCTTGTCTTCCGCAACAAGCAGACG------GAAGAGGACCCCGAGATGCTCGACTCCGCAGACGACA------------AGCCTGTGCAGGAGCCCATCGATATCAACCGCCTGGAGCTGATCGGCACCGGTACTGTCGTTGCTCCCGACCCCAAGCGCGTCATTGCTAAGCGTGCCATCCGTAAGGCCAAGGTCGGCGTGTTCAGCTGCCCCATTGACATCTCGCAGACCGAGACCAAGGGCACTGTTCTCTTGAAGAATGCCCAGGAGATGGTTGACTTCACCAAGGGTGAAGAGGACCGCCTCGAGACCGCCATCAAGGAGCTGTATGACTCCGGCCTCCGCGTGGTTGTTGCTGGCTCTACCGTTGGCGACCTGGCCATGCACTACCTCAACCGCTTCAACATCCTTGTCATCAAGATTCTCTCCAAGTTCGAGCTCCGCCGTCTGTGCCGGGTCGTCGGTGCCACCCCCCTCGCCCGTCTGGGCGCTCCCATGCCCGACGAGATGGGCCAGATCGACGTGGTCGAGACGACCGAGATTGGCGGTGACCGCGTCACCGTTTTCCGGCAAGAAGACGCCAATGCCGTGACTCGCACATCGACGATTGTGCTCCGCGGCGCAACCCAGAACCACCTGGATGATATTGAGCGCGCTATCGACGATGGTGTGAACGTCGTCAAGGCCATCACCAAGGACCCTCGCCTCGTGCCCGGCGCCGGTGCCACTGAGATCCAGCTCGTCGAGCGCATCTCCAACTTCGCCGACAGGACCCCCGGCCTGCCGCAGCACGCCATCCGCAAGTACGCCGAGGCCTTCGAGGTGATCCCCCGCACTTTGGCCGAGTCTGCCGGTCTTGACGCCACCGAGGTTCTCTCCCGCCTGTACACAAACCATTGCTGGTGAGCATGGCCTTGATGGCGATGGCCA----GTACGCTGGTGTTTCCGACCTCCAGCGCGAGCGCATGAACGTCTACTTCAACGAGGCTAGCAACGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCC-TGGTACCATGGACGACAAGGATGGTGATGGCCAGATCACTACCAAGGAGCTGGGTACTGTCATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCCGAGTTCCTCA Penicillium_lassenii TGTCTCCCCAGCGCAACGGCCCTCTCATGGGTATCGTGCAGGATACTCTTTGCGGCATTTACAAAGTCTGCCGTCGTGATACTTTCCTGACCAAAGATCAAGTCATGAATCTTATGCTTTGGGTTCCTGATTGGGATGGCGTTATCCCCCCTCCTGCTATTCTGAAGCCCCGTCCACGCTGGACCGGAAAGCAGATGATCAGCATGGCTTTCCCCTCTGGTCTCAATCTTTTGCGCGTCGA---AAAGGACGGCTCTCCCATTTCTGAGAAGTTCAGTCCACTTAATGATGGCGGTCTGCTCATCCATGGTGGCCAGCTGATGTACGGCATGCTCTCCAAGAAGACCGTCGGCGCCAGCGGCGGAGGTGTCATCCACATCATCTTCAATGAGTATGGTGCGGATACCGCAGTCAATTTCTTCAACGGTGCCCAGACTATCGTCAACTACTGGCTGTTGCACAACGGCTTCAGTATTGGTATTGGTGACACCATTCCCGATTATCATACCATTCAAAAGATCGAGGAGGCTGTCCGCGAGCGGAAGAAGGAGGTCGAGTCGATCACTGCCAGTGCCACGGAGAACACCCTGGAGGCGTTGCCTGGTATGAATGTGCGTGAGACTTTCGAGAGCAAGGTGTCCCGTGCCCTCAACAACGCTCGTGATGAAGCAGGTGCCGCGACCGAGAAGAGTTTGAAAGACATCAACAATGCCATTCAAATGGCACGCTCTGGTTCCAAGGGCTCTACTATCAATATTTCCCAGATGGTGCGTCGAGACAAACCGGGAAATCTACCTGAACATCGGTATCAAGGCCAGCACGCTTACTGGCGGATTGAAGTACGCCCTTGCCACGGGCAACTGGGGTGAGCAGAAGAAGGCCGCTAGTGCCAAGGCTGGTGTCTCCCAGGTGCTGAGTCGTTATACCTACGCGTCTACGCTGTCCCATCTTCGCCGCACCAACACCCCGATTGGTCGCGACGGGAAGATCGCCAAACCACGCCAGCTTCACAACACTCATTGGGGTCTGGTGTGTCCGGCCGAAACACCCGAAGGTCAAGCTTGTGGTCTTGTCAAGAACTTGGCATTGATGTGCTACATTACTGTTGGTACACCCAGCGAGCCCATCATTGACTTCATGATTCAGCGAAACATGGAAGTCCTCGAAGAATTCGAACCACAGGTTACACCCAACGCCACCAAGGTGTTTGTCAATGGTGTGTGGGTCGGTATTCATCGCGATCCGTCCCATCTTGTGAATACTATGCAGTCTCTGCGCCGACGGAATATGATCTCCCACGAGGTCAGCTTGATTCGGGACATTCGTGAGCGGGAGTTCAAGATCTTTACCGATGCTGGACGCGTCTGCCGACCTCTGTTTGTCGTTGACAACGACCCCAAGAGTGAAAATCCCGGTTCGCTGGTACTCCACAAGGAGCATGTCCGCAAACTGGAACAGGACAAGGACC---------TACCGCCAAACTTGGACCCAGAAGAGCGCCGAGAGCGCTACTTCGGTTGGGACGGGTTGGTGAGGTCGGGTGCAGTGGAGTACGTGGATGCTGAAGAGGAGGAAACGATCATGATCGTCATGACGCCCGAGGATCTGGAGATTTGGAAGCAGCTCCAGGCCGGATACTCTCTCCCGGTGGAAGAGACCAACGATCCCAACAAGCGTGTTCGCTCAATTTTGAGCCAGCGGGCTCACACGTGGACTCATTGTGATAGCCCGTGGGAGACGTCCGAAGACCGACCGTACGAGCCGGAGGACTGGCGTCGATTGCTGCAGTTTGGCGACTACAAGGGGACCAAGAATCGGATTCTTCGCGAGGCTCTGGTTGGCGGTGTCAACCCGGGCGTTCGTGTGGAAGTACATCTTCGAGCTGTGCCGTCCGCACTCCGAACCAAGCCCCAGCCCCTTTCGCTCTTTTC-TCTGCTCCGACATGAGCACAAGCAGACCGTGGTGAACGTCAACATGACTCTGAACTCCAGCGTTGAGAAGCCGCTTAAGTCCAAGGAAGAGCTGATCGTGCAATGCGGACCTCGCCGACTGGTCGTCAACCCTGTCTTCTCTGCGGGCGACAATACCCCGAACAACGTCCACAAGTTCGACCGCTTCCTGCACGCGGGCCGCAGCGCCATGGCCACGTGGATTGGGCCTATGACATGGGGCGCGGTGCCGATCCTCGTCTTCAAGAACAAGCAAGTT------GA---CGACCCGGAGGTACTGGAGTCCGCCGATGCTA------------AGCC------GGAGCCGATCACCACTGACCAGCTGGAGCTGATTGGCACTGGCACTGTTGTTGCGGCTGACCACGGCCGCGTGATTGCGAAGCGCGCGATACGGAAGGCCAAGGTCGGCGTGTTCAGCTGCCCCCTTGACATCAGCCAAACCGAGACCAAGGGCACTGTTCTTCTGAAGAACGCACAGGAGATGGTCGACTTCACCAAGGGTGAGGAGGAGCGCCTGGAGACCGCCATCAAGGAGCTGTACGACTCCGGCCTCCGCGTTGTCGTGGCGGGCGCCACCGTCGGCGACCTCGCCCTGCACTACCTGAACCGGTTCAACATCATGGTGATCAAGATCCTGTCGAAGTTTGAGCTGCGCCGTCTGTGCCGGGTGGTGGGAGCCACGCCGCTCGCTCGCCTGGGCGCCCCCATGCCGGATGAGATGGGGATGATCGACGTGGTTGAGACGACGGAGATTGGCGGCGACCGCGTCACCGTTTTCCGGCAGGAGGAAGCCAACGCCGTGACGCGCACTGCGACGATCGTACTGCGCGGTGCCACGCAGAACCACCTCGAAGACGTGGAGCGTGCCATTGACGACGGCGTGAATGTCGTCAAGGCCATTACCAAGGACCCGCGCCTGGTACCGGGCGCCGGCGCCACCGAGATCCAACTCGTCGAGCGCATCTCCAACTTCGCCGACAAGACGCCCGGTCTGCCGCAGCACGCCATCCGCAAATACGCCGAGGCCTTCGAGGTTATCCCGCGCACGCTGGCCGAGTCTTCGGGCCTGGATGCCACCGAGGTGCTCTCCCGTCTGTACACAGCAAATCTCGAGCGAGCATGGCCTCGACGGTGATGGCCA----ATACAATGGCACCTCCGACTTGCAGCTGGAGCGCATGAACGTTTACTTCAACCATGCCTCTGGTGACAAGTACGTTCCTCGTGCCGTTCTGGTTGACCTGGAGCC-CGGTACTATGGATGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCGGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATTGACTTCCCCGAATTCCTCA Penicillium_macrosclerotiorum TTTCGCCTCAGCGTAACGGTCCTCTTATGGGTATTGTGCAGGATACTCTGTGCGGTATCTACAAGATTTGCCGTCGTGATATCTTTCTCAACAGAGACATGGTCATGAATATGATGCTCTGGGTTCCCAACTGGGATGGTGTTATTCCTCCTCCTGCAATTCTGAAGCCTCGTCCTCGTTGGACTGGTAAGCAGATTATCAGTCTGGCTTTCCCCACTGGTCTCAACCTCCTGCGTATCGA---TAAGGATAGCTCACCTCTATCTGAGAAGTTCAGTCCTCTCAACGACGGTGGGCTACTTATCCACGGTGGACAGCTGCTGTATGGTATGCTTTCGAAAAAGACAGTCGGTGCCAGCGGTGGTGGTGTGATTCACACCATTTTCAATGAGTATGGATGTGACACTGCTGTCAGCTTTTTCAACGGTGCTCAGCGAATTGTCAACTATTGGCTTCTGCACAATGGTTTCAGTATCGGTATTGGTGACACGATTCCTGACCAGAATACGATCCAGAAAATCGAGGAGGCTGTTCGTGAGCGAAAGAAGGAGGTCGAGACTATCACTGCCAGCGCCACTGAGAACACTCTGGAGGCACTTCCTGGTATGAACGTCCGTGAGACCTTCGAGAGCAAGGTGTCTCGTGCCCTTAACAACGCTCGTGATGAGGCTGGTGCCGCGACTGAAAAGAGTTTGAAGGATCTGAACAACGCTATTCAGATGGCTCGCTCTGGTTCCAAGGGTTCCACTATCAACATTTCTCAGATGGCGTGTTGAGTCTAATAACGAAATTTATCTCAATGTTGGCCTCAAGTCCATCACCCTGACTGGTGGTCTGAAGTATGCCTTGGCAACGGGTAACTGGGGTGAACAGAAGAAGGCCGCTAGCGCCAAGGCTGGTGTGTCTCAAGTGCTCAGTCGTTATACCTATGCCTCTACCTTATCTCACTTGCGCCGTACCAATACGCCCATTGGCCGAGATGGCAAGATTGCCAAGCCGCGCCAACTTCATAATACTCACTGGGGCCTGGTGTGTCCTGCTGAAACTCCTGAAGGTCAAGCTTGTGGTCTCGTCAAGAATTTGGCACTCATGTGCTATATTACTGTCGGTACACCCAGTGAGCCCATCATCGATTTCATGATCAACCGCAACATGGAAGTCCTCGAAGAATTTGAGCCTCAAGTCACACCGAATGCTACCAAGGTGTTTGTGAACGGTGTCTGGGTTGGTATCCACCGTGATCCTTCCCACCTCGTCAGCACCATGCAATCTTTGCGTCGACGAAACCTGATTTCTCCTGAGGTCAGTCTGATTCGTGATATTCGTGAGCGAGAATTCAAGATTTTCACCGACGCCGGACGAGTGTGTCGCCCCTTGTTCGTGGTGGATAATGATCCTAAGAGCCGGAATGCTGGATCATTGGTTCTCAACAAGGACCACATTCGCAGTCTAGAACAAGACAAGGATT---------TGCCGCCAGACCTAGACCCAGAAGAACGCCGGGAACGCTATTTCGGATGGGAAGGACTGGTGAGATCAGGAGCTGTGGAAATTGTGGATGCGGAGGAAGAGGAAACGATTATGATTGTGATGACACCCGAAGACTTGGAAATCTCCAAGCAACTTCAAGCTGGCTATGCGCTGCCAGAGGAGGAGACCAATGATCCCAACAAGCGAGTCCGCTCCATTCTGAGCCAACGGGCACACACCTGGACGCACTGCGAGAGTACATGGGAAACCTCTGAGGACCGCCCATTTGAGCCGGAAGACTGGCGACGATTGTTGCAATTTGGTGACTACAAGGGAACCAAGAACCGAATTACCCGTGAAGCACTGGTCGGCGGAGTCAACCCTGGTATTCGTGTCAATGTCCACCTTCGTGCTGTGCCCACCTCGCTCCGCCACAAGGCCCAGCCAGTTTCCCTCTTCTC-GCTACTGCGCCACGAGCACAAGCACACTGTGGTCAATGTCAACATCACCCTGAACTCTAGCGTTGAGCATCCTCTGAAGTCCAAGGAGGAGCTTGTCATTCAGTGTGGTGCTCGCCGCATGGTGGTCAACCCCATCTTTTCTGCTGGCGACAAGACGCCAAATAATGTTCACAAGTTTGACCGCTTTCTTCATCCAGGCCGCAGCGCCATTGCCTCTTGGATCGGACCTATGACTTGGGGCGCGGTCCCTGTGCTCGTTTTCAAGCAGAGACAAGCA------GAACAAGATCCTGAGATCCTTGACTCAGCAGATG---------------AGGACAAGCAGGAGCCCCTTGCCATGGACCGCCTCCAGCTCATTGGCACTGGTACTGTGGTTGCACCCGATCCTCGCCGTGTTATTGCAAAGCGCGCCATCCGCCGGGCCAAGGTTGGTGTGTTCAGCTGCCCTATCGACACCTCGCAGACCGAGACCAAGGGCACTGTTCTGCTGAAGAATGCCCAGGAGATGGTTGACTTCACCAAGGGTGAGGAAGAGCGCCTCGAGGCCGCCATCAAGGAGCTGTATGACTCCGGCCTCCGTGTGGTTGTTGCCGGTTCCACCATCGGCGATCTGGCCATGCACTATCTCAACCGTTTCAACATTCTGGTTATCAAGATTCTGTCCAAATTCGAGCTCCGCCGCCTGTGCCGCGTTGTCGGTGCTACTCCCCTCGCCCGCCTAGGTGCCCCCATGCCCGACGAGATGGGCCAGATCGACGTCGTCGAGACAACCGAGATTGGTGGTGACCGTGTTACCGTGTTCCGTCAAGAAGACGCCAATGCTGTCACCCGCACATCCACCATTGTGCTCCGTGGCGCTACCCAGAACCACCTGGATGACGTGGAGCGCGCCATTGATGACGGTGTGAACGTCGTCAAGGCCATCACCAAGGACCCGCGTCTCGTCCCCGGCGCCGGCGCCACCGAGATTCAGCTCGTCGAGCGCATCTCCAACTTCGCTGACAAGACCCCCGGCCTGCCGCAGCACGCCATTCGCAAGTACGCCGAGGCCTTTGAAGTGGTTCCGCGTACGCTGGCCGAGTCCGCCGGCCTGGATGCCACTGAGGTTCTCTCTCGCCTGTACACAGACCATTGCTGGTGAGCACGGCCTTGATGGCGATGGCCA----CTACAATGGCACCTCCGACCTCCAGCTGGAGCGTATGAACGTTTACTTCACCCACGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTCCTGGTCGATTTGGAGCC-CGGTACTATGGACGACAAAGACGGCGATGGCCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCTCTCGGTCAGAACCCCTCCGAGTCGGAGCTGCAGGATATGATCAATGAGGTCGATGCTGACAACAACGGGACTATTGACTTCCCCGAGTTTCTCA Penicillium_malachiteum TGTCCCCTCAGCGCAATGGTCCTCTGATGGGTATTGTCCAGGACAGTCTGTGCGGTATCTACAAGTTAACTCGTCGTGATGTTTTTCTTTCCAAGGACCAAGTCATGAACATTATGCTCTGGGTTCCTGAATGGGATGGTGTAATCCCCCCTCCCGCGATTCTCAAGCCTCGTCCTCGTTGGACCGGAAAGCAGATGATCAGTATGGCTTTCCCGTCTGGGTTGAACCTATTGCGTATCGA---CAAGGATAGTTCGCCTCTCTCTGAGAAGTTTAGCCCTCTCAATGACGGCGGCCTGTTGATCCATGGTGGACAACTCATGTACGGCATGCTCTCGAAGAAGACCGTCGGTGCAAGTGGTGGTGGTGTGATCCATACTATTTTCAACGAATATGGCTGTGACCAAGCTGTCCATTTCTTCAACGGAGCTCAAAGAATTGTCAACTACTGGCTTCTACACCATGGTTTCAGTATCGGTATCGGTGATACGATTCCCGATCGCCGTACCATTGAAAAGATTGAGGAGGCCGTACGAGAGCGCAAGCAAGAGGTCGAGCAGATTACAGCTAGTGCCACTGAGAACACCCTGGAGGCTCTGCCTGGTATGAACGTCCGTGAAACCTTCGAAAGCAAGGTCTCTCGTGCTCTTAACAACGCTCGTGATGAGGCCGGTTCTGCTACTGAGAAGAGTTTGAAGGATTTGAACAACGCCATTCAGATGGCTCGGTCTGGTTCTAAGGGATCTACCATCAATATTTCCCAGATGCTGTGTTGAGACCGAGCGCGAAATGTACCTCAACATGGGTATCAAGGCTGCCACTCTCACTGGTGGTTTGAAGTATGCTCTGGCGACAGGAAACTGGGGAGAGCAAAAGAAGGCGGCAAGTGCCAAGGCTGGAGTCTCCCAAGTGCTCAGTCGATACACCTTTGCCTCCTCACTATCCCATTTGCGACGTACCAATACCCCCATTGGACGAGATGGTAAGATCGCCAAACCTCGTCAGCTTCATAACACTCACTGGGGTCTGGTGTGTCCTGCCGAAACACCCGAAGGACAGGCTTGCGGTCTTGTCAAGAACTTGGCACTCATGTGCTATATCACTGTCGGAACACCCAGTGAGCCGATCATTGATTTCATGATTCAGCGTAATATGGAAGTCCTCGAAGAATTTGAGCCCCAAGTCACGCCCAATGCTACCAAGGTGTTTGTCAACGGTGTGTGGGTTGGTATCCACCGGGACCCTTCACATCTTGTCACCACTATGCAGTCTCTTCGACGACGAAACATGATTTCGAACGAAGTTAGTTTGATTCGTGACATTCGTGAGCGGGAGTTCAAGATCTTCACCGATGCTGGGCGTGTCTGTCGACCGCTCTTTGTGGTTGATAATGACCCTAAGAGTGAAAATGCAGGATCTTTGGTTCTCAACAAGGACCATATCCGTAAACTGGAACAGGATAAAGACC---------TGCCAGCTGATCTGGACATGGAAGAACGCCGGGAGCGCTACTTTGGATGGGAAGGCTTGGTCAGATCCGGTGCCATTGAGATTGTCGATGCGGAGGAAGAGGAAACTATTATGATTGTGATGACACCTGAAGACTTGGAGATTTCCAAACAACTACAGGCAGGCTACGCTTTGCCAGAGGACGAGACAGCCGACCCCAACAAGCGTGTTCGCTCAATTCTCAGCCAGCGCGCTCACACTTGGACTCACTGCGATAGTCCCTGGGAGACATCTGAGGATCGCCCCTTCGAGCCTGAGGATTGGCGGAGACTGCTGCAGTTTGGTGACTACAAGGGTACCAAGAACCGTGTCACCCGTGAGGCTCTTGTCGGCGGTGTTAACCCGGGTATCCGCGTTGATGTCCACCTTCGTGCTGTTCCTGCCTTGCTCCGCAACAAGCCCCAGCCCGTTTCACTCTTCTC-GCTGCTCCGCCATGAGCACAAGCACACCGTTGTTAACATCAACATGACTATGAGCTCATACGTCGAGAAGCCTCTCAGGGCCAAGGAGGAGATTATCGTTCAGTGTGGACCTCGCCGTATGGTGGTCAACCCTATCTTCTCATCTTCTGACAACACTCCCAACAACGTGCACAAGTTCGATCGCTTCCTGCATCCAGGCCGTAGCGCCATCGCATCCTGGATTGGACCCATGACCTGGGGTGCTGTCCCTGTGCTTGTCTTCAAGAACAAGCCCGTC------GAGCAAGACCCTGAGGTCCTCGACTCAGCGGACGACA------------------AGGAACAGCCTTTGTCCTTGGACCGACTCGATCTTATCGCTACTGGCACAGTCGTTGCCCCCGACCCAGCCCGTGTTATTGCCAAGCGTGCTATTCGCAGAGCCAAGGTCGGCGTGTTCAGCTGCCCCATTGATATCTCTCAAACCGAGACCAAGGGTACTGTTCTGCTGAAGAACGCCCAGGAGATGATGGACTACACCAAGGGCGAGGAGGAGCGTCTGGAGACTGCCATCAAGGAGCTGTACGACTCCGGTCTCCGTGTTGTTGTTGCTGGTTCCACTGTTGGCGACCTGGCCCTCCACTACCTGAACCGCTTTAACATCCTGGTTATCAAGATTCTCTCCAAGTTCGAGCTCCGCCGTCTGTGCCGTGTCGTCGGTGCTACCCCTCTGGCCCGTCTGGGTGCTCCCATGCCCGACGAGATGGGTCAAGTCGACATTGTCGAGACCACTGAGATCGGTGGTGACCGTGTCACTGTCTTCCGTCAGGAGGACGCCAACGCCGTGACCCGCACATCCACCATTGTTCTCCGTGGTGCTACCCAGAACCACTTGGATGATGTTGAGCGCGCCATCGATGACGGTGTTAACGTCGTCAAGGCAATCACCAAGGACCCCCGTCTCGTCCCCGGAGCCGGAGCCACCGAGATCCAGCTCGTGGAGCGTATCTCCAACTTTGCCGACAAGACCCCCGGTCTGCCCCAGTACGCCATCCGCAAGTTCGCCGAGGCCTTCGAGGTTGTGCCCCGCACACTCGCCGAGTCTGCCGGTCTCGACGCTACCGAGGTTCTCTCCCGTCTGTACACAGAACATTGCTTCTGAGCACGGCCTTGACGGCGATGGACA----CTTCACCGGTTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACCACGCCAGCAATGACCGCTACGTTCCCCGTGCCGTCCTTGTCGACTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACTAAGGAGCTGGGTACCGTTATGCGTTCCCTCGGCCAGAACCCTTCCGAGTCTGAGCTGCAGGACATGATTAACGAGGTTGACGCTGACAACAACGGCACCATTGATTTCCCTGAGTTCCTTA Penicillium_megasporum TCTCTCCTCAGCGGAACGGTCCTTTGATGGGCATCGTTCAAGATACTCTCTGCGGTATCTACAAGATCTGTCGGCGTGACACTTTCCTTACAAAGGAGCAAGTGATGAACATCATGCTCTGGGTACCTGACTGGGATGGTGTCATTCCTCCTCCGGCCATCTTGAAACCTCGACCAAGATGGACTGGTAAGCAGATGATCAGTATGGCTCTTCCCTCTGGCCTGAACCTCCTACGTGTCGA---GAAGGATAACTCTCCTCTTTCTGAAAAATTCTCTCCTTTGGCTGACGGTGGTCTCCTAATTCATGGGGGACAGTTGATGTATGGAATGTTCTCCAAGAAGACAGTCGGTGCTAGCGGTGGAGGTGTCATCCATACCATCTTCAACGAGTATGGACCAACCACTGCCGTCGCTTTCTTCAACGGTGCACAGACCATTGTTAACTACTGGCTGTTGCATAACGGTTTCAGTATTGGTATCGGTGATACGATCCCTGATGCTGTCACAATCCAGGGGATCGAGAATGCCGTCCGGGTGCGAAAGCAGGAGGTCGAGTCCATCACAGCAAGTGCCACGGAGAACACTCTCGAGCCATTGCCCGGTATGAATGTGCGTGAAACCTTTGAAAGTAAGGTCTCGCGGGCGCTCAACAACGCCCGTGATGAAGCTGGTAGCGCGACGGAGAAGAGCTTGAAGGATCTGAACAACGCTATTCAGATGGCCCGTTCGGGATCAAAGGGTTCGACCATTAACATTTCGCAAATGATGTGTGGAGACCAACCGTGAGATCTACTTGAACATTGGTATCAAGGCCAGCACCTTGACCGGAGGTCTGAAATATGCTCTGGCCACTGGTAACTGGGGAGAGCAAAAGAAAGCCGCCAGCGCCAAGGCCGGTGTGTCACAGGTGCTCAGTCGTTACACCTATGCTTCTACGCTTTCCCATCTTCGCCGTACCAATACGCCTATCGGTCGTGATGGAAAGATTGCCAAGCCTCGCCAGCTTCACAACACCCATTGGGGTCTGGTTTGCCCGGCGGAAACTCCGGAAGGTCAAGCTTGTGGTCTGGTCAAGAACTTAGCGCTGATGTGCTACATCACTGTCGGTACACCTAGTGAGCCAATCATCGATTTCATGATCCAGCGTAACATGGAGGTGCTTGAGGAATTCGAGCCCCAGGTCACCCCGAATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTCGGTATTCACCGCGATCCTGCCCACCTGGTCAACACCATGCAGTCTCTGCGCCGGCGCAACATGATTTCTCACGAGGTTAGCTTGATTCGTGACATCCGTGATCGTGAATTCAAGATCTTCACCGACGCTGGCCGTGTGTGCCGACCGTTGTATGTTATTGACAATGACCCGAAGAGTGAGAACTGTGGTTCGCTCGTCCTGAACAAGGAGCACATCCGCAAGTTAGAAGCTGACAAGGAGT---------TACCGCCTGATTTGGATCCCGAAGACCGTAGGGAGCGCTACTTCGGATGGGATGGTCTTGTAAGGTCTGGAGTTGTTGAATATGTCGATGCCGAGGAAGAAGAGACGATCATGATTGTCATGACACCCGAGGATCTTGAGATTTCCAAGCAACTGCAGGCCGGTTACGCTCTTCCCGAGGAAGAAACCAACGACCCCAACAAGCGTGTGCGTTCCATTTTGAGTCAAAAGGCGCACACCTGGACCCATTGTGACAGTACCTGGGAGACAGCGGAAGACCGTCCTTTCGAACCAGAGGACTGGCGCCGGCTGCTCCAGTTCGCTGATTACAAGGGCTCCAAGAATCGTATTGTCAACGAAGCTCTGGTTGGCGGTGTCAATCCTGGCATCTGTGTGGATGTACACCTCCGCGCCGTTCCTTCATCTCTTCGCAACCACCCTCAGCCGTTGTCTCTCTTCTC-CCTGCTTCGCCACGAACACAAGCACACCGTTGTCAACGTCAACATGTCCTTGAATTCGGGCATCGAGGAACCGCTGAAGTCGAAGGAAGAGGTGATTGTTCAGTGCGGCCCGCGTCGTCTGGTCGTCAAGCCCATCTTCTCCGCGGGCGACAACACCCTCAATAGCGTGCACAAGTTTGACCGGTTCCTTCATCCCGGCCGCAGCGCCATCGCCACTTGGATCGGTCCTATGACATGGGGCGCTGTGCCGGTTCTTGTCTTC---AAGAACAAGCCA------GTTCAGGACCCTGAGGTCCTTGAT---GATGATG---------------GAAACGCATCTGC---GCCCACCTTCAACCAGCTTGAGCTCATCGCCACCGGCACCATCGTTGCCCCTGATCAAGCGCGCGTCGTCGCCAAGCGTGTCATCCGCAAGGCCAAGGTCGGTGTCTTCAGCTGCCCGATCGATATTTCCCAGACCGAGACCAAGGGTACCGTGCTCTTAAAGAATGCTCAGGAGATGCTTGACTTCACCAAAGACGAGGAAGAGCGTCTTGAGATCGCTGTCAAGGAGCTCTACGACTCTGGTATCCGCGTTGTCGTCGCCGGCGCCAACATCGGCGAGTTGGCGCTTCATTATCTTAACCGCTTCAACATCCTCGTGATCAAGATTCTTTCAAAGTTTGAACTCCGTCGCCTCTGTCGTGTCGTGGGCGCCACTCCTCTTGCTCGTCTGGGAGCCCCTATGCCAGACGAGATGGGCAGCATTGATGTGGTCGAGACCACCGAAATCGGTGGTGATCGTGTCACCGTCTTCCGCCAGGAGGATTCGAACAATGTGACTCGCACTGCCACCATCGTTTTGCGTGGTGCAACTCAGAATCACCTGGATGACGTTGAGCGTGCCATTGACGATGGTGTCAACGTCGTCAAGGCGATCACCAAAGACCCCCGTCTTGTCCCTGGCGCAGGCGCTACCGAGATCCAGCTCGTAGAACGAATCACTGCGTTTGCAGACAAGACCCCCGGATTGCCCCAACACGCCATCCGCAAGTACGCAGAGGCTTTCGAGGTGATCCCCCGTACGCTGGCCGAGTCCGCAGGCCTCGACGCGACAGAGGTTCTATCTCGTCTCTATACAGACTATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGT----CTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGTAACAAGTATGTCCCCCGTGCCGTGTTGGTCGACCTTGAGCC-TGGCACCATGGACGACAAGGATGGCGATGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCTCTGGGCCAGAACCCTTCCGAGTCTGAGCTGCAGGATATGATCAACGAGGTTGATGCTGATAACAATGGCACCATTGATTTCCCAGAGTTCCTTA Penicillium_ochrosalmoneum TGTCTCCTCAGCGTAACGGTCCACTCATGGGTATTGTGCAGGATACTCTCTGTGGTATCTACAAGATTTGCCGTCGGGATATCTTCCTCACCAAGGACCAGGTCATGAACATCATGCTCTGGGTGCCTGACTGGGATGGTGTAATTCCCCCTCCCGCTATCCTGAAGCCCCGTCCACGCTGGACTGGGAAGCAGATGATCAGTATGGCTTTCCCTACCGGTCTTAATCTTCTGCGCATCGA---TAAAGACAGCTCGCCACTTTCCGAGAAATTTAGCCCTCTTAATGACGGTGGCTTGCTGATCCATGGTGGTCAGCTGTTGTACGGCATGTTGTCCAAGAAGACCGTTGGTGCAAGCGGCGGTGGTGTAATTCACACCATTTTCAACGAGTATGGACCAGATACTGCCGTCAACTTCTTCACCGGCGCTCAAACAATCGTCAACTACTGGCTTCTCCACAACGGTTTCAGTATCGGTATCGGTGACACGATTCCGGATGCAGTGACCATTCAGAAGATCGAGGAGGCTGTTCGTGAGCGCAAGAAGGAAGTCGAGTCAATTACTGCCAGTGCTACAGAGAACACCTTGGAGGCCTTGCCTGGTATGAACGTTCGTGAAACTTTCGAGAGCAAGGTTTCCCGTGCTCTTAACAACGCTCGTGATGAAGCTGGTGCTGCCACCGAGAAGAGTTTGAAGGACTTGAACAACGCCATTCAGATGGCCCGGTCCGGTTCTAAGGGCTCTACCATCAACATCTCCCAGATGATGCGTTGAGACCAACCGCGAGATTTATCTCAATATCGGTATCAAGGCTGCCACAATTACTGGCGGTCTCAAATACGCCTTGGCCACGGGTAACTGGGGCGAGCAGAAGAAGGCCGCCAGCTCCAAGGCTGGTGTGTCTCAGGTCCTGAGTCGTTACACCTATGCCTCCACGTTGTCGCATTTGCGCCGTACCAACACGCCAATTGGCCGTGATGGCAAGATTGCCAAACCGCGTCAACTTCACAACACCCATTGGGGTCTTGTGTGTCCAGCTGAAACGCCTGAAGGTCAGGCTTGTGGTCTCGTCAAGAACTTGGCGCTTATGTGCTACATCACTGTCGGCACACCTAGTGAACCTATTATCGACTTCATGATTCAGCGTAACATGGAGGTCCTTGAAGAGTTCGAGCCTCAAGTTACACCCAACGCCACCAAGGTGTTTGTCAACGGCGTTTGGGTTGGTATCCACCGTGACCCGTCACATCTCGTCAACACTATGTCTTCCCTGCGTCGACGTAACATGATCTCGCACGAAGTCAGCTTGATTCGTGACATTCGTGAACGAGAATTCAAGATCTTTACGGATGCTGGCCGCGTGTGCCGACCCTTGTTTGTTGTCGACAACGACCCCAAGAGTGAGAATGCTGGTTCCTTGGTTCTAAACAAGGAACATATTCGCAAGCTGGAGCAGGACAAGGAGC---------TGCCTCCTGACTTAGATCCAGAAGAGCGCCGGGAGCGCTATTTCGGATGGGATGGCTTGGTAAGGTCTGGTGCGGTGGAATATGTGGATGCAGAGGAGGAGGAAACCATTATGATTGTGATGACGCCGGAAGATCTGGAGATCTCTAAACAACTTCAGGCTGGCTATGCGCTGCCAGAAGAGGAGACCAACGATCCCAACAAGCGTGTCCGCTCGATTCTGAGCCAGCGGGCGCACACCTGGACACACTGCGACAGTCCCTGGGAGACTTCAGAGGATCGTCCTTTTGAGCCAGAGGACTGGCGCCGACTGTTGCAATTCGGGGACTATAAGGGAACCAAAAACCGTATTCTTCGCGAGGCCTTGGTTGGTGGAGTGAACCCGGGCATTCGCGTGGACATTCATCTCCGAGCCGTGCCAGCCTCACTCCGCAACAAGCCCCAGCCGCTTTCGCTGTTCTC-GCTGCTACGCCATGAGCACAAGCACACCGTGGTCAATATTAACATGACCTTGAACTCAAGCGTTGAGAAGCCCCTCAAGGCCAAGGAAGAGCTCATTGTCCAGTGCGGTGCCCGCCGTATGGTGGTCAACCCCATATTCTCTTCCGCCGACAACACTCCTAACAATGTTCACAAATTCGACCGTTTCCTGCACCCGGGACGTAGCGCCATTGCCACCTGGATCGGGCCCATGACCTGGGGTGCTGTCCCGGTCCTCATTTTCAAGAGCAAGCAAGCG------GAAGAGGACCCCGAGGTTCTCGACTCGGCAGATGTCC------------AGCAAGA------ACCATTGGATTTGGATCGATTGGAGCTGATCGGTACTGGCACTGTTGTTGCCCCCGACCCGGCCCGTGTGATTGCCAAACGTGCCATTCGCAAAGCGAAGGTTGGCGTGTTTAGCTGCCCGATTGACATCTCGCAAACCGAGACCAAGGGTACCGTTCTGCTGAAGAATGCCCAGGAGATGGTTGACTACACTAAGGGTGAGGAGCAGCGTCTGGAGGCTGCCATCAAGGAGCTCTATGACTCTGGCCTCCGGGTTGTCGTCGCCGGTTCCACCGTTGGTGACCTGGCATTGCACTACCTCAACCGCTTCAACATTATGGTGATCAAGATTCTGTCCAAGTTCGAGCTCCGCCGCCTGTGCCGGGTGGTCGGCGCTACCCCTTTGGCCCGTCTGGGCGCCCCCATGCCTGATGAGATGGGCACCGTTGACGTGGTTGAGACTACCGAGATTGGCGGTGACCGCGTCACTGTCTTCCGTCAAGAAGACGCTAATGCTGTGACACGCACTGCGACAATCGTGCTGCGCGGTGCCACTCAAAACCACCTTGACGATGTCGAGCGTGCCATTGATGACGGCGTAAATGTCGTCAAGGCGATCACCAAGGACCCGCGCCTGGTCCCCGGTGCCGGTGCCACCGAGATCCAGCTTGTGGAGCGCATCTCCAACTTTGCCGACAAGACCCCCGGCTTGCCCCAGCACGCGATCCGCAAGTACGCCGAGGCATTCGAAGTGATCCCGCGCACACTCGCCGAATCCGCCGGCCTGGACGCTACCGAGGTACTCTCCCGCCTGTACACAGAACATTGCTGCTGAGCACGGCCTGAACGGTGATGGCCA----CTACAATGGCTCCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACCACGCTAGCGGTGACCGCTACGTTCCCCGTGCCGTCCTGGTCGACCTGGAGCC-CGGTACCATGGATGACAAGGATGGCGATGGCCAGATCACCACCAAAGAGCTGGGCACTGTCATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGATATGATCAATGAGGTCGATGCCGACAACAACGGCACCATTGACTTCCCCGAATTCCTCA Penicillium_olsonii TCTCCCCCCAGCGTAACGGTCCCCTCATGGGTATTGTCCAGGACACCCTGTGTGGTATCTACAAGATTTGCCGTCGTGACAGCTTCCTTACCAAGGATCAAGTCATGAACCTCATGCTCTGGGTTCCCGACTGGGATGGTGCTATCCCTCCACCTGCTATCCTCAAGCCCCGACCCCGTTGGACCGGAAAGCAGATCATCAGTATGGCTTTCCCCTCTGGACTCAACCTTCTACGTGTTGA---CAAGGATGGATCGCCAATGGCCGAGAAGTTCAGCCCTCTGAACGACGGTGGTCTCTTGATTCACGGTGGACAGTTGATGTACGGTATGCTCTCCAAGAAGACTGTCGGTGCCAGTGGTGGTGGTGTTATTCACACTATCTTCAACGAATATGGCCCCGATACCTGTGTTAAGTTCTTCAATGGTGCCCAGGCCATTGTCGGTTACTGGCTATTGCACCACGGTTTCAGTATCGGTATTGGAGACACCATTCCCGATCAGATGACCATCAATAAGATTGAGGAAGCTGTCCGCAACCGAAAGCAGGAAGTCGAGCAGATTACCGCTAGCGCCACTGAGAACACTCTCGAGGCTCTCCCCGGTATGAACGTTCGTGAGACATTTGAGAGCAAGGTTTCTCGTGCTCTTAACAACGCCCGTGATGAGGCTGGTGACGCTACCGAAAAGAGTCTGAAGGATTTGAACAACGCCATCCAGATGGCCCGTTCTGGTTCCAAGGGTTCGGCGATTAACATTTCCCAGATGTTGTGTCGACAGCAGTCGCGAGATTTACCTGAACGTTGGTCTCAAGGCCGCAACACTCACCGGTGGCTTGAAGTACGCTCTTGCCACTGGTAACTGGGGTGAGCAGAAGAAGGCAGCCAGTGCAAAGGCTGGTGTGTCCCAGGTGCTCAGTCGTTATACTTTCGCCTCCTCGTTGTCTCACCTTCGCCGAACGAACACGCCCATCGGTAGAGATGGAAAGATCGCTAAGCCACGTCAGCTTCACAATACCCATTGGGGTCTGGTTTGCCCGGCCGAGACACCAGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGGCACTGATGTGCTACATCACCGTTGGAACACCGGCAGAGCCTATCATTGATTTCATGATCCAGCGTAACATGGAAGTTTTGGAGGAGTTCGAGCCTCAAGTTACACCAAACGCGACCAAGGTATTCGTCAACGGTGTCTGGGTTGGTATCCACCGTGATCCCTCGCATTTGGTCAACACCATGCAAAATTTGCGTCGCCGAAACATGATTTCCCACGAGGTCAGTCTCATCCGAGATATCCGTGAGCGTGAGTTCAAGATCTTCACCGACACCGGTCGTGTTTGCCGACCGCTCTTCGTTATCGACAATGACCCAAAGAGTGAGAACTCTGGTGGGTTGATTCTGAACAAGGAACACATCCGCAAACTCGAACAAGACAAGGACT---------TGCCCCTCGACATGACCCCCGAACAACGTCGCGAACAATACTTCGGATGGGATGGTTTGGTTCGATCTGGTGCTGTTGAGTATGTCGACGCAGAAGAAGAGGAGACAATCATGATTGTGATGACTCCCGAAGATCTGGAAATATCCAGGCAGCTTCAAGCTGGTTATGCCTTGCCCGAGGATGAGACCAACGACCCCAACAAGCGTGTTCGGTCAATTCTTAGCCAGCGTGCACACACCTGGACGCATTGCGACAGCAACTGGGAAACCTCCGAGGATCGCCCCTACGAGCCCGAGGACTGGCGCCGTCTGTTGCAGTTCGCTGACCACAGAGGCTCCAAGAACCGCATTATCCGAGAGGCTCTGGTCGGTGGCGTGAACCCCGGCACTCGCGTGGATATCCATCTCCGCGCTGTCCCCTCCGTCCTGCGCAACGGCCCCAAGCCTCTTGCGCTCTTCTC-TCTTCTCCGTCATGAGCACAAGCACACTGTAGTCAATGTCAGCATGACCCTCAACTCCACCGTGGAGAAGCCTCTGAAGGCTAAGGAGCAGCTCATCGTCCAATGCGGTGCTCGTCGCATGGTTGTCAACCCCATCTTCTCTTCCGCAGACAACACCCCCAACAACGTGCACAAGTACGACCGATTCCTCCATCCCGGTCGCAGTGCCATTGCATCCTGGATTGGCCCCATGACCTGGGGTTCTGTCCCCATTCTCATCTTCAAGAACAAGCAGGCT------GAGACAGAGGATGACGACGAAGAGATGGAAACCG---------------ATGCCAAGGAGGAGCCAATTGCCACAGACGACCTGGAGCTCATCGGCACTGGTACCGTTGTTGCCCCCGACCAGAAGCGCGTCGTTGCCAAGCGTGCCATCAGCAAGGCCAAGGTCGGAGTGTTCAGCTGCCCCATCGATATCAGTCAGACCGAGACCAAGGGCACAGTTCTCCTGAAGAACGCCCAGGAAATGATGGATTTCACAAAGGGTGAGGAGGAGCGTCTTGAGACTGCCATCAAGGAGCTCTACGACTCCGGTCTCCGCGTCCTTGTTGCTGGCTCCAGTGTCGGCGATCTGGCCATGCACTACTTGAACCGTTTCAACATCCTCGTCGTCAAGGTTCTGTCCAAGTTCGAGCTCCGCCGCCTGTGCCGTGTCGTCGGCGCCACACCCTTGGCCCGTCTGGGTGCCCCCATGCCCGACGAGATGGGTCAGATCGACGTCGTCGAGACCTCCGAGATTGGTGGTGACCGTGTCACCGTCTTCCGCCAGGAAGACACCAACGCCGTTACCCGCACAGCCACCATTGTCCTGCGTGGTGCTACTCAAAACCACCTGGAGGATGTTGAGCGCGCTATCGATGACGGTGTGAATGCCGTCAAGGCCATCACCAAGGACCCCCGCATGGTCCCCGGTGCCGGTGCCACGGAGATCCAGCTTGTTGAGCGTCTGACCAACTTCGCTGACCGAACTCCCGGCCTTCCCCAACACGCGATCCGCAAGTACGCCGAGGCCTTCGAGGTCGTTCCCCGTACACTCGCCGAGTCTGCCGGTCTCGATGCCACCGAGGTCCTCTCGCGTCTCTACACAAACCATCTCTGGCGAGCACGGTCTCGATGGCGATGGACA----GTACAATGGAACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGCTAGTGGCGAAAAATATGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCGCTGGGTCAGAACCCCTCCGAGTCCGAGCTGCAGGATATGATCAACGAGGTTGATGCCGACAACAACGGCACCATCGACTTCCCCGAATTCCTGA Penicillium_paradoxum TTTCTCCACAGCGTAACGGTCCTCTGATGGGTATCGTCCAGGATACTTTGGCCGGAATTTATAAGATCTGTCGTCGTGACACGTTCCTCACCAAGGATCAAGTCATGAATCTGATGCTCTGGGTTCCTGACTGGGACGGTGCCATTCCTCCTCCTGCTATCTTGAAGCCTCGCCCTCGTTGGACTGGAAAACAGATGATCAGTATGGCCTTCCCCTCTGGTCTGAACCTTCTGCGTGTCGA---TAAGGACGGTTCGCCCATGGCCGAGAAGTTCAGTCCTCTTAACGATGGAGGTCTTCTGATCCACGGTGGTCAGCTTATGTACGGCATGCTTTCCAAGAAGACCGTTGGTGCTAGTGGTGGTGGTGTCATCCACACCATCTTCAACGAGTATGGTCCTGATACTTGCGTGAGATTCTTCAGTGGAGCCCAAACCATCGTTGGTTACTGGCTGTTGCACAATGGTTTCAGTATCGGTATCGGTGATACGATTCCCGATCAACAGACCATTAACAAGATTGAGGAGGCTGTCCGGAACCGGAAGCAGGAAGTCGAGGAAATTACTGCCAGTGCCACTGAAAATACCCTGGAGGCCCTTCCTGGTATGAACGTTCGTGAGACCTTCGAGAGTAAGGTATCCCGTGCTCTGAACAATGCTCGTGATGAAGCCGGTGATGCCACCGAGAAGAGTTTGAAGGATTTGAACAATGCTATTCAAATGGCGCGTTCCGGTTCCAAGGGTTCCGCTATCAATATTTCGCAGATGATGTGTTGAGACTAACCGTGAAATTTATCTCAACATCGGTATCAAGGCCAGCACGTTGACTGGTGGATTGAAATATGCCCTTGCTACTGGTAACTGGGGTGAGCAGAAGAAGGCTGCTTCCGCTAAGGCTGGTGTGTCTCAGGTGCTGAGTCGTTACACATTTGCCTCATCTCTATCTCACCTTCGCCGAACAAATACCCCCATTGGAAGAGATGGAAAGATTGCCAAGCCTCGCCAGCTTCATAACACTCATTGGGGTTTGGTCTGCCCTGCTGAAACACCCGAAGGTCAAGCTTGTGGTTTGGTCAAGAACTTGGCACTGATGTGCTATATCACTGTCGGTACACCTGCCGACCCCATCGTTGATTTCATGATTCAGCGCAACATGGAAGTTCTCGAGGAGTTCGAACCCCAAGTGACTCCCAACGCGACCAAGGTTTTCGTCAATGGTGTCTGGGTCGGTATTCATCGGGATCCTTCGCACCTTGTCACTACCATGCAAAATCTTCGTCGACGCAACATGATCTCTCACGAAGTTAGTTTGATTCGTGACATTCGTGAACGAGAGTTCAAGATTTTCACTGATACTGGACGTGTTTGCCGACCTCTGTTCGTTATTGACAACGATCCCAAGAGCGAGAACTCTGGTGGATTGGTCCTCAACAAAGAGCACATCCGAAAGCTCGAGGCCGACAAGGATC---------TCCCTGTGGATTTGGCCCCAGAAGAACGTCGGGATAATTACTTTGGATGGGATGGTCTAGTGCGCTCTGGTGCAGTAGAGTACGTCGACGCAGAAGAGGAGGAGACAATTATGATCGTCATGACTCCCGAAGATCTCGAAATCTCCCGACAACTTCAGGCCGGTTATGCTCTGCCAGAAGATGAAACAGCAGACCCCAATAAGCGTGTTCGGTCGATTCTCAGCCAGCGCGCGCACACCTGGACCCACTGTGACAGCCACTGGGAAACATCCGAGGATCGTCCTTATGAGCCCGAGGATTGGCGCCGACTGCTGCAATTTGCCGATCACCGTGGTTCCAAGAACCGCATCATGAGAGAGGCTCTCGTGGGCGGTGTTAACCCCGGTACTCGAGTGGATATCCACCTTCGCGCAGTCCCCTCCATTCTGCGCAACAGCAGCAAGCCGATTTCACTCTTCTC-TCTGCTCCGCCACGAGCACAAGCAGACTGTAGTCAACGTCAGCATGACCCTGAGCTCCAGCGTGGAGAAGCCTCTCAGGGCTAAGGAGCAACTTGTCGTCCAGTGTGGTGCCCGCCGCATGATCGTCAACCCCATCTTCTCCTCGGCTGATAACACACCGAACAACGTTCACAAATACGACCGTTTCTTGCACCCCGGTCGTAGCGCTATCGCATCCTGGATTGGACCCATGACCTGGGGCTCTGTTCCCATCCTCGTCTTCAAGAGCAAGCAAGCC------GAGGAGGAGGACGGCGACGAGGCAATGGATACCGCCG------------AAGCCAAGGACGAGCCGATTGCCCTTGACCAGCTCGAGCTGATCGGTACCGGTACCGTTGTTGCACCCGATCAGAAGCGCGTGGTTGCCAAGCGTGCCATCAGCAAGGCCAAGGTTGGTGTTGTCAGCTGTCCCATCGATATCAGCCAGACCGAGACCAAGGGCACAGTTCTGCTGAAGAACGCCCAGGAGATGATGGACTTCACCACAGGCGAGGAGGATCGTTTGGAGACTGCTATTAAGGAGCTCTACGACTCCGGCCTCCGTGTGGTTGTTGCTGGCTCCACTGTTGGTGATCTGGCCATGCACTACCTTAACCGTTTCAACATTCTGGTTATCAAGATTCTTTCTAAGTTCGAGCTCCGTCGCTTGTGCCGCGTTGTCGGTGCCACACCTTTGGCCCGTCTGGGTGCCCCCATGCCCGATGAGATGGGACAGATCGACGTGGTCGAGACAACCGAGATTGGCGGTGACCGAGTCACTGTCTTCCGTCAGGAGGATTCCAACGCCATCACCCGCACAGCTACCATTGTCTTGCGCGGTGCCACTCAGAACCACCTGGAGGATGTCGAGCGTGCCATCGATGACGGTGTCAATGTCGTCAAGGCCATCACCAAGGACCCCCGTCTCGTGCCCGGTGCCGGTGCCACGGAGATCCAACTTGTCGAGCGCATTTCCAACTTTGCTGACCGAACTCCCGGTCTGCCCCAGCACGCCATCCGCAAGTTCGCTGAGGCCTTCGAGGTCGTCCCCCGCACACTCGCCGAGTCTGCTGGTCTCGATGCCACCGAAGTGCTCTCGCGTCTGTACACAAACCATCTCTGGCGAGCACGGTCTCGATGGCGATGGCCA----GTACAATGGTACATCTGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACCATGCCAGTGGTGACAAGTACGTTCCCCGTGCCGTCCTGGTCGATTTGGAGCC-CGGCACCATGGACGACAAGGATGGCGATGGACAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGATATGATCAACGAGGTTGATGCCGACAACAATGGCACCATCGACTTCCCCGAGTTCCTCA Penicillium_ramusculum TGTCTCCCCAACGCAATGGACCTCTTATGGGTATTGTACAGGATACTCTATGCGGTATCTACAAGATCTGTCGCCGAGACATTTTCCTTACAAAGGACCAAGTCATGAACATCATGCTCTGGGTTCCCGATTGGGATGGTGTCATCCCCCCTCCTGCCATTCTCAAGCCCCGTCCGCGATGGACCGGAAAGCAGATGATCAGCATGGCTTTCCCATCTGGTCTGAACCTTCTGCGTATTGA---CAAGGACAGCTCTCCCCTCACCGAGAAATTCAGCCCTCTCAATGACGGTGGTTTGCTCATTCATGGTGGTCAATTACTGTACGGTATGCTTTCAAAGAAGACTGTCGGCGCAAGTGGTGGTGGCGTTGTCCACACCATTTTCAATGAATACGGCCCGGACACTGCTGTCAACTTCTTCAACGGTGCCCAGACCATTGTCAATTACTGGCTTCTACACAATGGGTTCAGTATCGGAATCGGTGACACAATCCCTGATCAGTTAACCATTCAGAAGATCGAAGAGGCTGTCCGCGAGCGCAAGAAGGAGGTAGAGGCTATCACCGCCAGTGCCACCGAGAACACTCTTGAACCTCTACCCGGTATGAACGTGCGTGAGACTTTTGAGAGCAAGGTCTCTCGTGCTCTCAACAATGCTCGTGATGAGGCTGGTGCTGCCACTGAGAAGAGTTTGAAGGACTTGAACAACGCTATCCAGATGGCCCGTTCTGGTTCTAAGGGATCTACTATCAACATTTCCCAGATGATGCGTTGAGACTAATCGAGAAATTTACCTCAACATTGGTATTAAGGCTAGCACACTTTCTGGTGGTCTGAAATACGCTCTGGCAACTGGTAACTGGGGCGAACAGAAGAAGGCAGCCAGCTCAAAGGCCGGTGTGTCCCAGGTGTTGAGTCGGTATACATATGCTTCCACCTTGTCCCATCTGCGGCGTACCAATACTCCCATTGGACGTGATGGAAAGATTGCTAAACCTCGGCAACTTCACAACACGCACTGGGGACTTGTATGTCCGGCCGAAACACCTGAAGGTCAAGCTTGTGGCCTTGTCAAAAATCTGGCACTCATGTGCTACATCACCGTGGGTACACCGAGTGAGCCAATCATCGATTTCATGATCCAGCGAAACATGGAAGTCCTTGAAGAGTTCGAACCACAAGTTACGCCCAATGCTACCAAGGTGTTTGTCAATGGTGTTTGGGTTGGCATTCATCGTGATCCGTCCCACCTCGTTAACACCATGACTTCGCTGCGTCGGCGCAACATGATCTCTCATGAGGTCAGCTTGATTCGTGATATTCGAGAGCGAGAATTCAAGATCTTCACTGATGCCGGTCGTGTGTGCCGACCTCTGTTCGTCGTTGACAATGACCCGAAGAGCGAGAATGCCGGGTCATTGGTTCTGAACAAAGAACACATTCGCAAGCTTGAGCAGGACAAGGATT---------TGTCGCCAGATTTGGATCCGGAAGAACGCCGGGCGCGTTATTTTGGATGGGATGGGTTGGTGAGATCGGGCGCCGTAGAGTATGTGGATGCTGAAGAGGAGGAAACCATCATGATTGTGATGACGCCCGAAGACCTGGAGATTTCGAAACAGCTCCAGGCTGGCTATGCCCTGCCAGAAGAGGAGACCAGTGATCCCAACAAGCGTGTTCGCTCAATCCTAAGCCAGCGTGCTCACACCTGGACGCATTGCGATAGCCCATGGGAGACCTCCGAGGACCGGCCCTTCGAACCGGAAGACTGGCGTCGGTTGCTCCAGATCGGTGACTATAAAGGAACCAAGAACCGAGTTATTCGTGAAGCTTTGGTCGGTGGTGTGAACCCAGGTATCCGCGTGGACGTCCACCTCCGTGCCGTCCCAGCTTCGCTCCGCAGCAAGGCCCAACCTCTCTCATTGTTCTC-GCTGCTCCGTCATGAGCACAAGAATACTGTGGTAAATGTCAATATGACCCTCAACTCCAGTGTCGAGCAGCCTCTCAAATCCAAGGAGGAGCTCATTGTCCAGTGCGGTGCCCGCCGGATGGTCGTTAAGCCGATCTTCTCTGCTAGTGACAACACCCCCAACAATGTGCACAAATTCGATCGTTTCCTCCATCCTGGTCGCAGCGCTATGGCCACATGGATTGGACCCATGACTTGGGGTGCTGTGCCTGTGCTTGTGTTTAAGAACAAACAAACA------GAGCCAGACCCAGAGATCCTTGACTCTGCAGATGCCA------------GCCAGGA------ACTGCTGGCTTTAGACCGTCTAGAGCTGATTGGTACCGGCACCATTGTTGCTCCTGACCCAGCTCGCGTGGTCGCTAAGCGCGCCATTCGCAAGGCCAAGGTCGGCGTTTTCAGCTGCCCCATTGACATCTCGCAAACCGAGACTAAGGGCACTGTTCTGCTGAAGAATGCTCAGGAGATGGTGGACTTCACCAAGGGCGAGGAGGAGCGCCTCGAGGCTGCCATCAAGGAACTCTACGACTCCGGTCTCCGTGTGCTCGTTGCTGGTTCTACCGTCGGCGATCTCGCCCTGCACTACCTTAACCGCTTTAACATCCTTGTCATCAAGATCCTGTCTAAGTTCGAGCTCCGCCGTCTGTGCCGCGTGGTTGGCGCTACTCCCCTGGCTCGTTTGGGTGCTCCCATGCCTGATGAGATGGGTACCGTTGACGTGGTTGAGACTACTGAGATTGGCGGGGACCGTGTCACTGTTTTCCGTCAAGAAGATACCAACGCCGTGACACGTACGGCGACGATCGTTCTCCGCGGGGCCACTCAGAACCACCTGGACGATGTCGAGCGCGCCATCGACGACGGCGTGAATGTCGTCAAGGCTATCACTAAAGACCCGCGCCTGGTGCCTGGTGCCGGTGCTACCGAGATTCAGCTCGTGGAGCGTATCTCAAACTTCGCCGATAAGACCCCCGGTCTCCCACAGCACGCTATCCGTAAGTACGCCGAAGCTTTCGAGGTCATCCCTCGCACGTTGGCCGAGTCTGCCGGCCTAGACGCCACCGAGGTCCTTTCTCGCCTGTACACAAAACATCTCTGCTGAGCATGGCCTCGATGGCGATGGCCA----CTACAATGGTTCCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACCACGCTACCGGTGACCGTTACGTTCCCCGTGCTGTTCTGGTCGACCTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATTACCACCAAGGAGCTGGGCACCGTCATGCGCTCACTCGGCCAGAACCCCTCTGAGTCTGAGCTGCAGGACATGATTAACGAGGTGGATGCTGACAACAACGGCACCATTGACTTCCCCGAGTTCCTCA Penicillium_restrictum TGTCCCCCCAGCGCAATGGTCCTCTCATGGGTATCGTCCAGGATACCCTGTGCGGTATCTACAAGATTTGCCGTCGTGACGTCTTCCTCACCAAGGATCAGGTCATGAACATCATGCTCTGGGTGCCAGACTGGGATGGTGCCATTCCTCCCCCCGCCATTCTGAAGCCTCGCCCACGCTGGACTGGAAAGCAGATGATTAGTATGGCCTTCCCCTCTGGTCTTAACCTTCTGCGTATCGA---CAAGGATAGCTCGCCACTTTCCGAGAAATTTAGCCCACTTAATGACGGTGGCTTGCTGATTCACGGCGGTCAGCTCTTGTACGGCATGCTGTCCAAGAAGACCGTCGGTGCTAGTGGTGGTGGTGTCATCCACACCATCTTCAACGAGTATGGACCGGACACCGCTGTGAACTTTTTCAACGGTGCCCAGAGAATCGTCAACTACTGGCTTTTGCACAATGGCTTCAGTATCGGTATCGGTGATACGATCCCCGATCGAAACACCATTGACAAGATCGAGGAGGCAGTCCGTGAGCGCAAGAAGGAGGTCGAGCAGATCACTGCTAGCGCTACTGACAACACTCTGGAGGCCCTGCCTGGTATGAACGTTCGTGAAACCTTCGAGAGTAAGGTCTCCCGTGCTCTCAACAACGCTCGTGACGAGGCTGGTGCCGCCACCGAGAAGAGTCTGAAGGATTTGAACAACGCAATTCAAATGGCGCGCTCTGGTTCGAAGGGTTCCACTATCAACATTTCTCAGATGATGCGTTGAGACCAACCGGGAGATCTACCTGAACATGGGTATCAAGGCTGCCACACTGACTAGTGGTTTGAAGTACGCCCTCGCAACGGGTAACTGGGGCGAGCAGAAGAAGGCGGCCAGCGCCAAGGCCGGTGTGTCTCAAGTTCTGAGTCGATACACTTATGCCTCAACACTATCTCATTTGCGCCGCACCAACACACCCATTGGTCGAGATGGAAAGATCGCTAAGCCGCGACAGCTTCACAACACTCACTGGGGTCTTGTGTGTCCTGCCGAAACGCCTGAAGGTCAGGCTTGTGGTCTTGTCAAGAACTTGGCGCTTATGTGCTATATCACCGTGGGTACACCCAGTGAGCCCATCATCGATTTCATGATCCAGCGTAACATGGAGGTTCTCGAAGAGTTCGAGCCTCAAGTTACACCCAACGCCACCAAGGTTTTTGTTAACGGTGTTTGGGTTGGTATTCATCGCGACCCGTCGCATCTCGTCAACACCATGATGTCTTTGCGTCGGCGAAACATGATTTCCCATGAAGTCAGCTTGGTTCGCGATATTCGTGACCGAGAGTTTAAGATTTTCACGGATACTGGCCGTGTGTGTCGACCTTTGTTCACTATTGACAACGACCCCAAGAGCGAGAATGCTGGATCGTTGGTTCTCAACAAGGAACACATTCGCAAGCTCGAGCAAGACAAGGAAT---------TGCCGCCAGACCTGGATGCGGAAGACCGCCGGGAGCGCTATTTCGGATGGGATGGCTTGGTGAGATCTGGAGCTGTGGAGTTGGTGGATGCCGAGGAAGAGGAAACCATTATGATCGTCATGACGCCCGAAGATTTGGAGATCTCCAAGCAGCTCCAGGCCGGCTACGCGCTGCCTGAGACTGACACGGATGATCCCAACAAGCGAGTCCGTTCCATCCTCAGCCAGCGGGCACACACCTGGACACATTGCGACAGCCCTTGGGAGACGTCCGAGGACCGACCCTTCGAGCCGGAAGACTGGCGGCGGTTGTTGCAATTCGGTGACTACAAGGGCATCAAGAACCGCGTTATTCGTGAAGCCCTTATCGGTGGTGTGAACCCTGGTGTTCGCGTGGATATTCACCTTCGTGCGGTGCCATCTCGTCTTCGCCGCAAAGCTCAGCCACTGTCGCTGTTCTC-GCTCCTGCGTCACGAGCACAAGCACACTGTGGTCAACGTCAACATGACTCTTAACGGCAGCGTCGAGAAGCCCCTCAAGTCCAAGGAGGAGCTCGTTGTGCAGTGCGGTGCCCGCCGCATGGTGGTCAAGCCTGTGTTCTCGGCCGCTGACAACACCCCCAACAACGTGCACAAGTTCGACCGCTACCTGCACCCAGGCCGCAGCGCCATCGCCACATGGATCGGACCTATGACATGGGGCGCCGTCCCGGTCCTTGTGTTCAGGAACAAGCAAGCG------GAAAAGGACCCCGAGATCCTCGACTCCGCAGACGCCA------------AGCAGGA------GCCTCTCGATATGAACCGCCTGGAGCTGATCGGTACCGGAACTGTGGTTGCACCCGATCCCAAGCGTGTCATTGCCAAGCGTGCCATTCGCAAGGCCAAGGTCGGCGTGTTCAGCTGCCCCATTGACACCTCGCAGACCGAGACCAAGGGAACCGTTCTGCTGAAGAACGCTAAGGAGATGGTTGACTACACCAAGGGTGAGGAGGACCGCTTGGAGACTGCCATCAAGGAACTGTATGACTCCGGCCTTCGCGTGGTCGTTGCTGGTTCCACCGTCGGCGACCTTGCCATGCACTACCTTAACCGCTTCAACATCCTGGTCATCAAGATCCTGTCCAAATTCGAGCTCCGTCGCTTGTGCCGCGTTGTCGGTGCTACCCCACTGGCCCGCCTGGGTGCCCCCATGCCCGACGAGATGGGTCAAATCGACGTGGTTGAGACTACCGAGATCGGTGGTGACCGTGTCACCGTTTTCCGTCAAGAAGATGCCAACGCTGTGACGCGTACCGCCACAATTGTGCTGCGTGGCGCCACCCAGAATCACCTGGAGGATGTCGAGCGTGCCATCGATGATGGCGTGAACGTCGTCAAGGCCATCACCAAGGACCCGCGCCTTGTGCCCGGTGCCGGCGCTACCGAGATCCAGCTCGTGGAGCGTATCTCTGCCTTCGCCGACAAGACCCCCGGTCTTCCCCAGTACGCCATCCGCAAGTACGCCGAGGCATTCGAAGTGATCCCGCGCACTCTCGCCGAGTCCGCCGGTCTCGATGCCACTGAGGTTCTCTCTCGCCTGTACACAAACCATTGCTGGTGAGCATGGTCTTGATGGCGATGGCCA----GTACGCTGGTGTCTCCGACCTCCAGCGCGAGCGCATGAACGTCTACTTCAACGAGGCCAGCAACGACAAGTACGTTCCCCGTGCCGTCCTGGTCGACTTGGAGCC-CGGTACCATGGATGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTGGGTACTGTCATGCGCTCTCTGGGCCAGAACCCGTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAACAACGGCACCATTGACTTCCCCGAGTTCCTTA Penicillium_shearii TGTCTCCTCAGCGTAACGGTCCTCTGATGGGTATCGTGCAAGACACTCTGTGTGGTATTTACAAGATTTGCCGTCGTGATACTTTCCTCACCAAGGATCAAGTCATGAACGTAATGCTCTGGGTCCCTGACTGGGATGGAATCATTCCCCCTCCCGCTATCCTCAAGCCTCGTCCTCGTTGGACTGGAAAGCAGATGATCAGTATGGCCTTCCCGACCGGTCTCAACCTTCTACGAATTGA---TAAGGACAGTTCGCCACTATCTGAGAAGTTTAGCCCGCTTCATGATGGCGGCTTGCTGATTCACGGTGGTCAGCTTTTGTATGGCATGCTTTCCAAGAAGACAGTCGGTGCAAGTGGTGGTGGTGTGATTCATACCATTTTCAATGAGTATGGCTGTGATACTGCGGTTAACTTCTTTAACGGTGCTCAGACCATCGTTAACTACTGGCTGCTGCATCACGGATTCAGTATCGGTATTGGTGATACGATTCCTGATCAAAATACTATCAACAAGATCGAAGAGGCTGTTCGAGAGCGCAAGCAAGAAGTCGAGTCCATCACTGCTAGTGCTACGGAGAACACTTTGGAGGCCCTGCCGGGTATGAACGTTCGTGAAACCTTTGAGAGTAAGGTCTCGCGTGCTCTAAACAACGCCCGTGACGAGGCTGGTGCCGCTACGGAAAAGAGTTTGAAAGATATCAACAACGCTATTCAGATGGCTCGGTCCGGTTCCAAGGGATCCACAATCAATATCTCCCAAATGCTGCGTTGAGACGAACCGTGAGATCTACCTGAACATTGGTCTGAAGGCAGCCACCTTGACCGGTGGTCTGAAGTATGCCCTTGCTACCGGTAACTGGGGTGAACAAAAGAAGGCAGCTAGCGCTAAGGCCGGTGTGTCTCAAGTGCTGAGTCGTTACACATTCGCTTCTTCGCTTTCGCATTTGCGCCGTACCAACACGCCTATCGGTCGTGATGGTAAGATTGCTAAACCGCGTCAGCTTCACAACACCCACTGGGGCCTGGTGTGTCCTGCCGAAACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGGCGCTCATGTGTTATATTACGGTTGGTACCCCTAGTGAGCCAATTATCGACTTCATGATCCAGCGAAACATGGAAGTCTTGGAGGAGTTCGAGCCTCAAGTCACACCAAATGCCACGAAGGTGTTTGTCAACGGTGTATGGGTTGGTATACACCGCGACCCCTCGCATCTGGTTAACACTATGCAATCTCTTCGTCGACGCAATATGATCTCGCACGAAGTCAGTTTGATTCGAGATATCCGTGAGCGAGAGTTTAAAATTTTCACCGACACTGGACGTGTCTGCCGTCCATTGTTCGTTGTCGATAATGACCCTAAGAGTGACAATGCTGGGTCTCTGATCCTTAATAAGGAGCATATACATAAGCTCGAGCAAGACAAGGACC---------TGCCTCTTGACTTGGACGTGGAAGAGCGCCGGGAGCGTTACTTCGGATGGGAGGGTTTGGTCCGGTCAGGAGCAGTTGAATATGTTGACGCTGAAGAGGAAGAGACTATTATGATTGTGATGACGCCTGAAGACTTGGAGATTTCTAAGCAGCTCCAAGCAGGCTATGCACTGCCCGAGGAAGAGACCAATGACCCGAACAAGCGAGTCCGCTCGATTCTGAGCCAGCGTGCTCACACATGGACCCACTGTGACAGTTCTTGGGAGACCTCCGAAGATCGTCCCTTTGAGCCCGAAGACTGGCGCCGCCTGCTCCAATTCGGTGACTACAAAGGCACAAAGAACCGAGTTCTTCGCGAAGCTCTTGCTGGTGGTGTGAACCCTGGTATCCGAGTCGATGTTCACCTGCGTGCAGTTCCTGCCTCCCTGCGTCAGAAGGCCCAGCCCCTTTCGCTGTTCTC-CCTTCTGCGACACGAACACAAGAACACTGTTGTCAACGTCAACATGACCCTCAACTCCAGTGTCGAGCAACCTATCAGGTCGAAGGAGGAACTCATCGTTCAGGTCGGTCCCCGCCGAATGGTGGTCAAGCCGATCTTCTCTGCTGCAGATAACACCCCCAACAATGTGCACAAGTTCGATCGATTTCTGCATCCCGGCCGCAGTGCCATGGCTACATGGATTGGGCCCATGACCTGGGGTGCCGTCCCCATTCTTGTCTTCAAGAACAAGCAAGCT------GAGGCGGATCCCGAGATCCTTGACTCTGCAGATGCCA------------GCC------------CGCTCAGCCTTGATCGACTGGAGCTGATCGGTACTGGTACTGTGGTTGCCCCCGACCAGAAACGTGTGGTTGCCAAGCGTGCCATTCGCAAGGCCAAGGTCGGCGTATTCAGCTGCCCCATTGATGTTCAGCAGACCGAGACCAAGGGTACCGTTCTGCTCAAGAACGCTCAGGAGATGGTGGACTTCACCAAGGGCGAGGAGGAGCGCCTGGAGACCGCTATCAAGGAGCTTTATGACTCCGGTCTCCGCGTCGTCGTTGCTGGTTCCACCGTCGGCGATCTCGCTATGCACTACCTCAACCGTTTTAACATCCTGGTCATCAAGATTCTCTCCAAGTTCGAGCTCCGCCGTCTGTGCCGTGTTGTCGGCGCTACCCCCCTTGCCCGCCTGGGTGCTCCCATGCCTGATGAGATGGGCACCGTTGACGTGGTTGAAACCACTGAGATTGGTGGTGACCGTGTCACCGTTTTCCGTCAAGAAGATGCCAACTCCGCCACCCGCACATCCACAATCGTGCTGCGCGGTGCCACCCAGAACCACCTGGACGACGTCGAGCGTGCCATCGATGACGGCGTGAACGTCGTCAAGGCTATTACTAAGGACCCCCGTCTCGTACCCGGTGCCGGTGCCACCGAGATCCAGCTCGTCGAGCGCATCTCCGCTTACGCTGACAAGACTCCCGGTCTGCCCCAGCACGCTATCCGCAAGTTCGCCGAGGCCTTCGAGGTCGTTCCGCGTACCCTCGCCGAGTCCGCCGGTCTCGATGCCACTGAGGTTCTCTCCCGCCTGTACACAAAACATTGCCGGTGAGCACGGCCTTGATGGCGATGGCCA----CTACAACGGTACTTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCACCCACGCTTCCGGTGACAAGTATGTTCCCCGTGCCGTTCTGGTCGATCTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTCGGTACTGTCATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCCGAACTGCAGGATATGATCAACGAGGTCGATGCCGATAACAACGGCACCATTGATTTCCCCGAATTCCTGA Penicillium_simplicissimum TGTCTCCTCAGCGCAACGGCCCTCTCATGGGTATTGTGCAGGACACTTTGTGCGGTATCTACAAGATCTGTCGTCGTGATATCTTCCTCACCAAGGATCAGGTCATGAACCTTATGCTCTGGGTTCCTGACTGGGATGGTGTCATTCCTCCTCCTGCGATCATGAAGCCTCGTCCCCGCTGGACCGGCAAACAGATGATCAGCATGGCTTTCCCCTCTGGACTTAACCTTGTCCGTGTTGA---CAAGGATAGCGCGCCGCTCTCCGAAAAATTCAGCCCTCTCAATGATGGTGGCCTGCTCATTCAAGGTGGACAGTTAATGTACGGTATGCTTTCCAAGAAGACCGTCGGTGCCAGTGGTGGTGGTGTTATTCACACCATCTTCAACGAGTATGGATGTGACACCGCAGTCAATTTCTTCAATGGTGCCCAAACCATTGTCAACTACTGGCTGCTGCATCATGGTTTCAGTATCGGTATCGGTGATACGATTCCCGATCGCAAGACTATCGAAAAGATTGAGGAAGCTGTCCGGGAGCGAAAGCAGGAGGTCCAGGAGATTACTGCCAGTGCTACAGATAATACCCTGGAAGCGCTGCCCGGTATGAATGTCCGTGAAACCTTCGAGAGCAAGGTCTCTCGTGCTCTGAACAACGCTCGTGATGAGGCTGGTGCTGCCACCGAGAAGGGTTTGAAGGATCTGAACAACGCTATCCAGATGGCTCGTTCTGGTTCCAAGGGTTCGACCATTAACATCTCCCAAATGATGTGTGGAGACTAACAAGGAGCCTAACCTCCGCATTGGTCTGAAGGCTGCCACCCTGACTGGTGGTTTGAAGTATGCCCTGGCGACTGGTAACTGGGGTGAGCAGAAGAAGGCTGCCAGCTCCAAGGCTGGTGTGTCCCAGGTGCTGAGTCGATACACCTTTGCTTCCAGTTTGTCCCATCTACGTCGTACCAACACACCCATTGGTCGAGATGGCAAGATCGCCAAACCGCGTCAACTTCACAACACACATTGGGGTCTCGTGTGTCCAGCTGAGACTCCTGAAGGTCAAGCTTGTGGTCTCGTCAAGAATTTGGCACTGATGTGCTACATCACCGTTGGTACGCCTAGTGAGCCTATCGTTGATTTCATGATTCAGCGGAACATGGAAGTTCTTGAAGAGTTCGAACCCCAGGTCACGCCTAATGCCACCAAGGTGTTCGTGAACGGTGTCTGGGTCGGTATCCACCGTGACCCCACACATCTAGTCAACACTATGCAGTCTCTCCGTCGGCGCAACATGATCTCCCATGAGGTCAGCTTGATTCGCGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTGTGCCGACCCTTGTTCGTCGTCGACAACGACCCCAAGAGTGAAAACGCCGGGTCCTTGGTGCTCAATAAGGAGCACATTCGCCTGCTGGAGCTGGACAAGGATC---------TTCAACGAGAACTGCCTCCAGAACAGCTCCGGGAGCAAGGCTTCGGATGGGAGGGTTTGGTCAGATCGGGCGTTGTGGAATACGTGGATGCTGAGGAAGAAGAGACGATTATGATCGTCATGACCCCTGAAGACTTGGAGATTTCCAAGCACCTCCAAGCTGGTTACGCTCTGCCGGAAGATGACAAGAACGACCCCAACAAGCGAGTGCGC---ACCGTGAGTCAACGCGCGCATACCTGGACGCATTGCGACAGCCCGTGGGAGACTTCCGAAGATCGTCCATATGAGCCTGAAGATTGGCGCCGACTCCTGCAATTCGGCGACTACAAGGGCACCAAGAACCGCATCATCCGCGAAGCCCTTGTTGGCGGTGTCAACCCCGGCGTGCGTGTGGAGGTGCATCTCCGTGCTGTCCCTTCTCTGCTCCGTCACAAGGCTCAGCCTCTAGCTCTGTTCTC-TCTCTTGCGCCACGAGCACAAGCACACCGTGGTCAACGTCAACATGACATTGAGCTCCAGCATTGAGAAGCCTGTCAAGTCCAAGGAGGAGATTGTCGTGCAGATTGGCGCTCGCCGCATGGTTGTCAACCCCGTTTTCTCCGCCGGCGACAACACCCCCAACAACGTTCACAAGTTCGACCGTTTCCTCCACCCCGGCCGCAGCGCGGTTGCTACCTGCATTGGACCCATGACCTGGGGCGCCGTCCCGGTTCTCGTCTTCAGGAAGAAGCAGGTG------GAGGAAGACCCAGAGGTCCTCGAATCAGCCGATGCCC------------ACCCCGA------GGCGCTTTGTATGGATCGCCTAGAGCTTATTGGTACCGGCACGGTCATCGCTCCCGACCCGAACCGTGTCATTGCCAAGCGGGCAATCCGCAAGGCCAAGGTCGGCGTGTTCAGCTGCCCCATTGACATCTCCCAGACCGAGACCAAGGGCACTGTTCTCCTGAAGAATGCTCAGGAGATGGTTGACTTCACCAAGGGTGAGGAGGACCGCCTCGAGACCGCCATCAAGGAGCTGTACGACTCCGGTCTCCGCGTGGTTGTTGCCGGTTCCACCGTTGGTGACCTGGCCATGCACTACCTCAACCGCTTCAACATCCTCGTGATCAAGATTCTCTCCAAGTTCGAGCTCCGCCGTCTGTGCCGTGTCGTCGGTGCCACCCCCCTCGCCCGCCTGGGCGCCCCCATGCCCGACGAGATGGGCCAGATCGACGTGGTCGAGACGACCGAGATTGGCGGTGACCGTGTCACCGTTTTCCGTCAAGAAGATGCCAACGCCGTGACCCGCACATCGACGATTGTGCTCCGCGGCGCCACCCAAAACCACCTGGATGACATTGAGCGCGCGATCGACGATGGCGTGAACGTCGTCAAGGCCATCACCAAGGATCCTCGCCTGGTGCCCGGTGCCGGTGCCACCGAGATCCAGCTCGTCGAGCGCATCTCCAACTTTGCCGACAAGACCCCCGGTCTGCCCCAGCACGCTATCCGCAAGTACGCCGAGGCCTTCGAAGTGATCCCCCGCACCCTGGCCGAGTCCGCCGGTCTCGACGCCACCGAGGTTCTCTCCCGCCTGTACACAGACCATTGCTGGTGAGCACGGTCTTGACGGCGATGGCCA----CTACAACGGTTCCTCCGACCTCCAGCTGGAGCGCCTGAACGTCTACTTCACCCACGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATCTCGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCGCTCGGCCAGAACCCGTCCGAGTCCGAGCTGCAGGATATGATCAACGAGGTCGATGCCGACAACAACGGCACCATCGACTTCCCCGAGTTCCTCA Penicillium_stolkiae TCTCTCCCCAGCGGAACGGTCCTCTCATGGGTATCGTGCAGGATACACTGTGCGGTATCTACAAGATCTGCCGTCGTGATATCTTCCTCACCAAGGATCAAGTCATGAACGTCATGCTCTGGGTCCCTGACTGGGATGGTGTCATTCCCCCTCCCGCGATTTTGAAGCCTCGTCCTCGCTGGACTGGCAAGCAGATGATCAGCATGGCTTTTCCCACTGGTCTCAACCTTCTGCGTATCGA---CAAGGACAGCTCGCCACTATCCGAGAAATTTAGCCCTCTTAATGACGGTGGCCTGCTCATCCAGGGGGGACAGTTGCTGTATGGTATGCTCTCCAAGAAGACTGTCGGTGCCAGTGGTGGTGGTGTGATCCACACGATTTTCAACGAGTATGGGTGTGACACTGCGGTCAACTTCTTCAATGGTGCCCAGACCATCGTCAACTACTGGCTGCTGCACCATGGGTTTAGTATCGGTATCGGTGATACGATTCCCGATCACAACACCATCCAGAAGATTGAGGAGGCCGTCCGCGCCCGCAAGCAGGAGGTCGAGACGATCACTGCCAGTGCCACAGAGAACACTCTGGAAGCTCTGCCTGGTATGAACGTTCGTGAAACATTCGAGAGCAAGGTTTCCCGCGCCCTGAACAATGCTCGTGATGAGGCCGGTGCCGCGACCGAGAAGAGTTTGAAGGATTTGAACAACGCTATTCAGATGGCCCGTTCTGGTTCTAAGGGTTCGACTATCAACATCTCCCAAATGTTGTGTGGAGACCAACCGGGAGATTTATCTCAATATTGGTCTGAAAGCCAGCACTCTGACTGGTGGCTTGAAATATGCCCTGGCGACAGGTAACTGGGGTGAGCAGAAGAAGGCTGCCAGCTCCAAGGCCGGTGTTTCCCAGGTGCTGAGTCGCTATACCTACGCTTCCACCTTGTCCCATTTGCGCCGTACCAATACGCCTATTGGCCGAGATGGAAAGATTGCTAAACCGCGTCAACTTCACAACACTCACTGGGGGCTTGTGTGCCCAGCCGAGACACCTGAAGGCCAAGCTTGTGGTCTTGTCAAGAACTTGGCCCTCATGTGCTATATCACTGTCGGTACACCCAGTGAACCGATCATTGATTTCATGATCCAGCGCAACATGGAAGTCCTTGAGGAATTCGAACCTCAAGTCACGCCCAATGCCACCAAGGTGTTTGTGAACGGTGTCTGGGTTGGTATTCACCGTGACCCTTCACATCTTGTCAACACTATGCAGTCTCTCCGTCGGCGCAACATGATCTCCCACGAGGTCAGCTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTGTGCCGGCCCCTCTTTGTTGTTGACAATGACCCCAAGAGTGAGAATGCTGGCTCATTGGTCCTTAACAAGGAGCACATCCGCCTGCTGGAGCAGGACAAGGATC---------TATCGCGTGACTTGGATCCGGAAGAGTACCGGGAGCGTGGATTCGGATGGGAGGGCTTGGTGAGATCGGGGGCTGTGGAATATGTGGACGCGGAGGAGGAAGAGACGATTATGATTGTGATGACCCCGGAAGACTTGGAGATTTCCAAGCAACTTCAAGCTGGCTACGCTCTACCAGAAGATGAAACCAACGACCCGAACAAGCGAGTTCGTTCGATTCTGAGCCAGCGGGCGCACACCTGGACGCACTGCGACAGTCCCTGGGAGACATCTGAAGACCGCCCATACGAGCCCGAGGACTGGCGTCGACTCCTGCAGTTCGGTGATTACAAGGGCACCAAAAATCGCATCCTTCGCGAAGCTCTTGTTGGCGGTGTCAACCCCGGAATCCGAGTGGACGTGCATCTCCGTGCAGTTCCTGCCTTGCTCCGCCACAAAGCCCAGCCTCTCTCCCTGTTCTC-GCTCCTACGTCACGAGCACAAGCACACCGTGGTCAATATCAACATGACCCTGAGCTCCAGCGTGGAGCAGCCTCTCAAGTCCAAGGAGGAGGTCATCGTGCAGATCGGCGCCCGTCGCATGGTTGTGAACCCTGTCTTCTCCGCCAGCGACAACACCCCGAACAATGTCCACAAGTACGATCGCTTCCTTCACCCAGGCCGCAGCGCCATGGCCACCTGGATTGGACCTATGACCTGGGGCGCTGTTCCGGTCCTCGTCTTCAAACCCAAGCAAGCG------GAGGAAGACCCAGAGATCCTCGACTCGGCAGATGCGA------------AGCAGGA------GCCACTGGCTATGGACCGGTTGGAGCTTATTGGTACTGGCACTGTTGTCGCGCCAGACCCCAACCGTGTGGTTGCCAAGCGTGCAATCCGTAAGGCCAAGGTTGGCGTGTTCAGCTGCCCCATTGACATCTCGCAGACTGAGACCAAGGGTACTGTTCTGCTGCACAATGCCAAGGAGATGATGGACTTCACCAAGGGCGAGGAGGACCGCCTCGAGATTGCCATTAAGGAGCTGTATGACTCCGGCCTCCGCGTTGTAGTTGCCGGTTCTACTGTCGGCGACCTCGCCTTGCACTACCTCAACCGCTTCAACATCCTTGTGATCAAGATTCTTTCCAAGTTCGAGCTCCGCCGCCTGTGCCGCGTCGTCGGTGCTACCCCCCTCGCCCGCCTGGGCGCCCCCATGCCCGACGAGATGGGCCAGATCGACGTGGTCGAGACGACTGAGATTGGCGGCGACCGCGTCACCGTGTTCCGGCAAGAAGACGCCAACGCTGTGACCCGTACATCGACGATTGTGCTGCGTGGCGCAACCCAGAACCATCTGGACGATGTGGAGCGCGCGATCGACGACGGCGTGAACGTCGTCAAGGCGATTACCAAGGACCCGCGCCTGGTGCCCGGTGCCGGCGCTACCGAGATCCAGCTCGTCGAGCGCATCTCCAACTTCGCCGACAAGACCCCCGGCCTGCCGCAGTATGCCATCCGAAAGTACGCTGAGGCCTTCGAAGTGATCCCTCGCACTCTGGCCGAGTCCGCCGGCCTCGACGCCACCGAGGTCCTCTCCCGCCTGTACACAAACCATTGCTGGCGAGCACGGCCTTGATGGCGATGGCCA----ATACAATGGCACCTCCGACCTCCAGCTGGAGCGGATGAGCGTCTACTTCACCCACGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTTTGGTCGATCTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACCACCAAGGAGCTAGGTACAGTGATGCGCTCGCTCGGCCAGAACCCCTCCGAGTCGGAGCTGCAGGATATGATCAACGAGGTTGATGCCGACAACAACGGCACCATTGACTTTCCCGAGTTCCTTA Penicillium_thiersii TGTCTCCTCAGCGCAATGGACCTCTGATGGGTATCGTCCAAGACAGTCTCTGCGGCATCTATAAGATTTGCCGTCGTGATATCTTCCTCTCCAAGGACCAAGTCATGAACATAATGCTTTGGGTACCTGATTGGGATGGTGTCATTCCTCCTCCTGCGATCCTTAAACCACGTCCGCGTTGGACTGGAAAGCAGATGATCAGTATGGCTTTCCCATCTGGTCTGAACCTTCTGCGTATCGA---CAAGGATAGTTCGCCGCTCTCCGAGAAATTTAGTCCTCTTAATGACGGTGGCCTGCTGATCCACGGTGGACAGCTCTTGTACGGTATGCTTTCAAAGAAGACCGTTGGTGCAAGCGGTGGTGGTGTTATCCATACCATTTTCAATGAGTATGGATGCGACCAGGCTGTCAATTTCTTCAACGGGGCCCAAAGAATAGTCAACTACTGGTTGTTGCATAATGGTTTCAGTATCGGTATTGGTGATACAATCCCCGATCGCAACACTATCGAGAAGATTGAGGAAGCTGTGCGTGAGCGCAAGAAGGAGGTCGAACAGATTACTGCCAGCGCTACGGAGAACACTTTGGAGGCTTTGCCTGGTATGAACGTCCGTGAGACCTTCGAAAGTAAAGTTTCGCGTGCTCTCAACAATGCTCGTGATGAAGCCGGTGCTGCCACCGAGAAGAGTTTGAAGGACTTGAACAATGCTATTCAGATGGCTCGTTCTGGATCTAAGGGTTCTACTATCAATATTTCCCAGATGCTGTGTGGATACCGGCACGTCGATGAGCCTTCCAACTGGCGTTAAGGGTTCTACAATGTCTGCTGGACTGAAGTACGCTTTAGCCACTGGTAACTGGGGAGAGCAGAAGAAGGCTGCGAGCGCAAAGGCTGGTGTGTCTCAGGTGCTTAGTCGTTACACTTATGCCTCTACCTTATCCCATCTCCGCCGAACAAACACACCCATTGGACGAGATGGTAAGATCGCAAAGCCTCGTCAACTTCATAATACACATTGGGGTCTAGTGTGTCCCGCCGAGACACCCGAAGGTCAGGCTTGTGGTCTCGTCAAGAACTTGGCGCTCATGTGCTACATCACCGTTGGTACACCCAGTGAGCCTATCATTGATTTCATGATCCAGCGTAATATGGAGGTTCTTGAGGAATTTGAGCCTCAACTTACCCCCAATGCTACCAAGGTGTTTGTTAATGGTGTCTGGGTTGGCATTCATCGCGATCCATCGCACCTTGTCAACACTATGGCGTCTCTTCGTCGACGAAACATGATCTCCCACGAGGTCAGCTTGATTCGTGACATTCGAGAGCGGGAGTTCAAGATCTTTACTGATACTGGACGTGTCTGTCGACCGCTTTTCGTTGTTGACAATGATCCAAAGAGTGAGAATGCTGGATCGTTAGTTCTAAATAAGGAGCACATTCGTAAGCTGGAGCAGGATAAGGACC---------TACCACCAAACTTGGATCCGGAAGAACGCCGAGAACGCTACTTCGGATGGGATGGACTGGTGCGATCTGGAGCTGTGGAATATGTCGATGCAGAAGAGGAGGAAACCATCATGATCGTGATGACGCCCGAAGACTTGGAGATTTCTAAGCAACTTCAGGCCGGTTACGCTCTACCAGATGATGAGACCGACGACCCCAACAGGCGGGTTCGCTCAATCCTGAGTCAGCGAGCACACACTTGGACTCACTGTGACAGTCCATGGGAGACATCCGAGGACCGTCCTTATGAGCCTGAAGACTGGCGGAGACTCCTGCAATTTGGTGACTACAAGGGAACAAAGAACAGAATCATTCGTGAGGCTCTGGTCGGCGGTGTCAGCCCCGGTATCCGCGTGGATGTTCATCTCCGCGCAGTGCCTGTGTCTCTCCGTAACAAACCACAGCCCGTCTCTCTCTTCTC-TCTACTCCGTCATGAGCACAAAAACACTGTTGTGAACATCAACCTCACTTTGAGCTCAAGTGTAGAAAAGCCTATCAAGGCCAAGGAAGAGCTTATTGTCCAGTGTGGTGCACGCAGGATGGTAGTTAACCCTATCTTCTCGTCTGCCGACAACACCCCTAACAACGTGCACAAGTTCGACCGCTTCCTGCACCCTGGTCGCAGTGCAATCGCGACTTGGATTGGACCTATGACATGGGGTGCCGTTCCGGTACTAGTCTTCAAGCCCAAGCAGGTC------GAGGAAGACCCTGAGATCCTTGACTCGGCAGATGACA------------------AGCAAGAGCCTTTGGCCCTGGATAATCTGGAGCTTATCGGCACTGGCACAGTAGTCGCACCCGACCCAGCTCGTGTCATTGCCAAGCGTGCCATCAAGAAGGCCAAGGTCGGTGTGTTCAGCTGCCCGATTGACATTTCCCAAACCGAGACCAAGGGTACTGTTCTACTGAAGAATGCCCAGGAGATGATGGATTACACCAAGGGCGAGGAGGACCGTCTAGAGACTGCTATCAAGGAGCTTTACGATTCTGGTCTGCGTGTGGTAGTTGCTGGTTCCACTGTCGGCGACCTGGCCCTTCACTACCTCAACCGCTTCAACATCTTGGTTATCAAGATTCTGTCCAAGTTCGAGCTCCGTCGCTTGTGCCGGGTGGTAGGCGCAACTCCCCTGGCTCGCCTGGGTGCCCCCATGCCCGACGAGATGGGTCAAGTCGACATCGTCGAGACTACCGAGATTGGCGGTGACCGAGTCACTGTTTTCCGTCAAGAGGACGCTAACGCTGTGACTCGCACTTCGACTATTGTTCTCCGCGGTGCCACTCAGAACCATCTCGATGATGTTGAGCGTGCTATCGATGACGGTGTCAACGTTGTTAAGGCCATCACTAAGGACCCCCGTCTGGTACCCGGTGCTGGTGCCACCGAGATCCAGCTCGTCGAGCGGATCTCCAATTTCGCTGACAAGACCCCCGGTCTGCCCCAGCACGCTATCCGCAAGTACGCTGAAGCCTTCGAAGTCATTCCTCGCACGCTCGCCGAGTCCGCTGGTTTGGACGCTACCGAGGTTCTTTCCCGCCTGTACACAAACCATTGCTGGTGAGCACGGCCTCGATGGCGATGGCCA----CTTCACCGGTTCTTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACCACGCCAGCGGTGACCGCTACGTTCCCCGTGCCGTTCTGGTCGATCTCGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGACAAATCACCACCAAGGAGCTGGGTACTGTCATGCGCTCCCTCGGCCAGAACCCCTCTGAGTCTGAGCTGCAGGACATGATTAATGAGGTCGACGCTGACAACAACGGCACCATTGACTTCCCTGAATTCCTCA Penicillium_tularense TCTCTCCTCAGCGTAACGGTCCTTTGATGGGTATCGTGCAGGACACCCTTTGTGGTATCTACAAAATCTGCCGTCGCGACAGTTTCCTCTCGAAGGACCAAGTTATGAATCTTATGCTGTGGGTCCCTGATTGGGATGGTGCCATTCCCGCACCCGCTATTTTGAAGCCCCGGCCTCGTTGGACTGGAAAGCAGATCATTAGTATGGCCTTCCCATCTGGTCTGAATCTCCTGCGTGTTGA---TAAAGATGGCTCGCCAATGGCCGAGAAGTTCAGCCCGCTCAATGATGGCGGTCTTTTGATTCACGGCGGAGAGCTCATGTACGGCATGTTGTCCAAGAAAACCGTCGGTGCCAGTGGTGGCGGTGTTATCCATACCATCTTTAACGAGTATGGCCCTGACACTTGTGTCAAATTCTTCAACGGCGCCCAGGCCATCGTCGGCTACTGGTTGCTCCACCACGGTTTCAGTATTGGTATTGGTGACACAATTCCCGATCAATTGACCATCAATAAAATTGAGGAAGCCGTCCGCAACCGAAAGCAGGAAGTCGAGTCAATCACTGCCAGCGCTACTGAGAACACGCTTGAGGCTCTTCCCGGTATGAACGTCCGTGAAACGTTCGAGAGCAAAGTCTCTCGCGCTCTCAACAACGCTCGTGACGAAGCTGGTGATGCCACCGAAAAGAGTTTGAAGGATTTGAACAATGCTATTCAGATGGCTCGGTCCGGTTCCAAGGGTTCCGCCATCAACATTTCACAGATGTTGCGTTGACAGCGGCCGCGAGATTTATCTCAACGTTGGTCTCAAGGCCGCAACACTCACCGGTGGCTTGAAATACGCTCTTGCCACTGGTAACTGGGGTGAGCAGAAGAAGGCAGCCAGCGCCAAAGCTGGTGTGTCCCAGGTGCTGAGTCGTTATACTTTCGCCTCGTCGTTGTCTCATCTTCGTCGTACGAACACGCCTATTGGTAGAGACGGAAAGATCGCCAAGCCGCGTCAGCTCCACAACACCCACTGGGGTCTGGTTTGCCCGGCTGAGACCCCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGGCGTTGATGTGTTACATCACCGTCGGTACGCCGGCAGAGCCCATTATTGACTTCATGATCCAGCGAAACATGGAAGTTCTGGAGGAGTTTGAGCCCCAAGTTACTCCAAATGCAACCAAGGTGTTCGTCAATGGTGTCTGGGTTGGTATTCACCGTGATCCCTCGCATCTTGTCAACACCATGCAAAACCTGCGTCGCCGAAACATGATCTCTCACGAAGTCAGTCTCATCCGTGATATCCGTGAACGTGAGTTCAAGATTTTCACCGATACTGGTCGTGTCTGCCGACCACTTTTTGTTATCGACAACGATCCCAAGAGTGAGAACTCTGGTGGATTGATCCTCAACAAAGAGCATATCCGCAAGCTGGAACAAGACAAGGACT---------TGCCCGTCGATATGACTCCGGAACAACGTCGGGAACAATACTTTGGTTGGGATGGCTTGGTACGATCTGGCGCCGTGGAATACGTCGATGCTGAAGAAGAGGAGACTATAATGATCGTCATGACCCCTGAAGACTTGGAAATTTCCAGACAGCTTCAAGCTGGTTACGCCTTGCCAGAGGAAGAAACCAGTGACCCCAACAAGCGTGTTCGCTCAGTTCTCAGCCAACGCGCACACACTTGGACACATTGCGACAGCCACTGGGAAACATCCGAGGATCGACCCCACGAACCTGAGGACTGGCGCCGGCTTTTGCAGTTTGCAGATCACCGAGGCTCCAAGAACCGCATCATCAAAGAGGCTTTGATTGGTGGTGTTAACCCTGGCACCCGCGTGGATATCCACCTCCGCGCCGTGCCCTCTATCCTGCGCAATGGCCCTAAGCCGCTTGCGCTCTTTTC-TCTCCTCCGCCACGAACACAAGCACACTGTGGTCAACGTCAGTATGACCCTGAACTCCAGCGTGGAGAAGCCTCTTAAGGCCAAGGAGCAACTCATCGTCCAGTGTGGTGCTCGTCGCATGGCCGTCAACCCCATCTTCTCCTCCGCAGACAACACGCCTAACAACGTGCACAAATACGACCGATTCCTCCACCCCGGTCGAAGCGCCATCGCGTCTTGGGTTGGACCCATGACCTGGGGCTCTGTCCCGATCCTCATCTTCAAGAACAAACGAGCC------GAGAAGGAGGATGACGATGAAGAGATGGAAACCG---------------ATGCCACCAACCAGTCGGTTGCCATGGACGATCTGGAGCTTGTTGGTACCGGTACCGTTGTTGCACCTGACCAGAAGCGCGTGGTTGCTAAGCGTGCCATCAGCAAGGCCAAGGTGGGAGTGTTCAGCTGCCCCATCGATATCAGCCAAACCGAGACCAAGGGCACAGTTCTCCTGAAGAACGCCCAGGAAATGATGGACTTCACCAAGGGTGAGGAGGAGCGTCTGGAGACTGCCATCAAGGAGCTCTACGACTCCGGCCTTCGCGTCCTTGTTGCTGGCTCCACTGTCGGCGACCTGGCCATGCACTACCTCAACCGTTTCGGCATCCTGGTCATAAAGGTCCTGTCCAAGTTCGAGCTCCGCCGTCTGTGCCGTGTCGTTGGCGCCACACCTTTGGCTCGCCTGGGTGCTCCCATGCCCGATGAGATGGGTCAGATCGACGTTGTCGAGACCACCGAGATCGGTGGTGACCGCATCACTGTCTTCCGCCAGGAGGACGCCAACGCCGTTACTCGCACAGCCACCATTGTCCTGCGCGGTGCCACGCAAAACCACCTGGAGGATGTTGAGCGCGCCATCGATGACGGCGTGAACGTCGTCAAGGCCATCACCAAGGACCCACGCTTGGTCCCCGGTGCCGGTGCCACCGAGATCCAGCTCGTGGAGCGTCTGACCAACTTCGCCGACCGGACCCCCGGTCTTCCCCAACACGCCATCCGCAAGTACGCCGAGGCCTTTGAGGTTATCCCCCGCACACTCGCCGAGTCTGCCGGTCTCGATGCTACCGAAGTTCTCTCGCGTCTGTACACAAACCATCTCTCAAGAGCACGGTCTCGATGCCGATGGACA----GTACAATGGTACCTCCGACCTCCAACGCGAGCGTATGAATGTCTACTTCAACCATGCCAATGGCGACAAGTATGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGACGGACAAATCACCACCAAGGAACTGGGCACCGTCATGCGCTCCCTAGGTCAGAACCCCTCCGAGTCCGAACTGCAGGACATGATCAACGAGGTGGACGCCGACAACAACGGCACCATTGACTTCCCCGAATTCCTGA Polypaecilum_insolitum TGTCTCCACAGCGAAATGGTCCCCTCATGGGTATTGTGCAAGATACCCTTTGTGGTATCTACAAGATTTGTCGGCGTGACGTTTTCCTATCCAGAGAACAAGTGATGAATATCATGCTCTGGGTTCCAGACTGGGATGGTGTTCTGCCACCGCCAGCTATTGTGAAGCCTCGGCCGCGATGGACCGGGAAGCAGATGATTAGCATGGCGCTTCCATCGGGTCTGAACCTCCTTCGTGTCGA---CAAGGACAATTCGGCTCTCTCCGAGAAGTTTTCCCCTCTTAACGATGGCGGATTGCTCATACACAGTGGACAGGTGATGTATGGAATGTTCTCTAAGAAGACTGTTGGCGCTAGTGGTGGTGGCGTTGTCCATACCATTTACAATGAGTATGGACCAGATGCTGCTGTCGCTTTCTTCAACGGCGCTCAGACCATTGTCAACTACTGGTTGTTACATCATGGGTTCAGTATTGGCATTGGCGACACGATTCCGGATCCGTCCACGATTCAGAGAATCGAGAATTGTGTTCGCAACCGCAAACAGGAAGTCGAATCTATAACCGCGAGTGCGACTGATAACACTCTCGAGGCGTTACCCGGTATGAATGTGCGAGAAACTTTCGAAAGCAAGGTCTCGCGTGCCCTCAACAATGCCCGTGATGAAGCTGGTGGCGAAACCGAGAAGAGCTTGAAGGATCTTAACAACGCCATCCAGATGGCACGTTCTGGATCCAAGGGATCGACTATTAACATTTCCCAGATGGTGTGTTGAGAGTGGCAAGGATATTTATATGAATATTGGTGTAAAGGCCAGCACGTTGAGCTCGGGCTTGAAGTATGCTCTTGCCACAGGAAACTGGGGTGAGCAGAAGAAGGCAGCAAGCTCGAAGGCTGGTGTGTCGCAAGTACTCAGTCGATACACCTACGCGTCTACATTGTCACATCTTCGCCGGACCAACACGCCCATCGGCCGTGACGGAAAGATCGCGAAGCCACGCCAGCTTCACAACACGCACTGGGGCTTGGTCTGTCCGTCCGAAACTCCGGAAGGTCAAGCCTGCGGTCTCGTGAAGAATCTGGCGCTCATGTGCTACATCACCGTTGGTACGCCCAGCGAGCCGATCATCGACTTCATGATCCAGCGCAACATGGAGGTACTCGAGGAGTTCGAGCCCCAGGTGACGCCGAATGCAACAAAGGTGTTTGTGAACGGTGTCTGGGTAGGAATCCACCGTGATCCGTCTCATCTTGTTAACACCATGCTGTCGCTGCGCCGGCGGAACATGATTTCGCACGAGGTCAGTTTGATTCGGGACATCCGAGAGCGGGAGTTCAAGATCTTCACGGATGCCGGCCGTGTATCACGACCGCTGTTCGTTATCGACAACGACCCGAAGAGCGAGAACTCCGGCTCGTTAGTCCTTAATAAAGAGCATATCCGTAAATTGGAGGAAGATAAGGAAT---------TGCCGCCCGACCTGGACCCCGAAGAGCGGAGAGAGCGCTATTTCGGATGGGATGGTCTTGTCAAATCTGGAGTTGTCGAATATGTCGATGCTGAGGAAGAGGAGACGATCATGATCGTGATGACCCCTGAAGACCTCGAGATCTCCAAGCAGCTTCAGGCCGGATATGCTCTTCCCGTGGAGACG------GATCCGCACAAGCGAGTCCGGTCGATTCTCACGCAAAGGGCACATACGTGGACGCACTGCGAGAGTCGGTGGGAGACATCCGAGGACCGCCCACACGAACCTGAAGATTGGCGTCGACTGCTTCAAATTGCTGATTATAAGGGCTCCAAAAACAAGGCTATCAGAGAAGCACTGGTTGGAGGTGTCGACCCTGGAAACCGTGTCGACGTTCACCTTCGGGCAGTACCAGCATCCCTTCGCAATCGGCCACAGCCAGTGTCCCTTTTCTC-CCTCCTCCGCCATGAGCACAAACAGACAGTTGTCAACATAAGCATGTACCTCCACTCTGACGTCGAGGCACCCCTGAAGTCTAAGGAAGAGCTTCTCATCCAATGCGGACCACGCCGTCTGGTCGTGAACCCTATCTTTTCCGCCGGAGGCGTGACTCCAAACAACGTCCACAAATTCGACCGCTTCCTCCACCCCGGCCGGAGTGCCATCGCATCCTGGATCGGGCCTATGACCTGGGGTTCAGTGCCTGCCCTCGTCTTCAAAAACAAGC---AA------GTCCAAGACCCCGAAGTGATGGACTCAGCCGACG---------------AAAACTCCGAGAACAAACCGACCATCGACCAACTGCAGCTGATCGGAACCGGAACCGTCGTCGCGCCTGACCAGTCTCGAGTCGTCGCCAAGCGAGCTATCCAGAAGGCCAAGGTGGGCGTGTTTAGCTGCCCAATTGATGTTAGCCAGACCGAGACCAAGGGAACAGTGCTTTTGAAGAACGCGCAGGAGATGCTCGACTACACTAAGGGAGAGGAGGAACGTCTTGAGGCGGCTATCAAGGAACTCTACGATTCGGGGATTCGTGTGGTCGTTGCGGGTGCGACTGTCGGTGACCTAGCTCTCCACTACCTTAACCGCTTCAATATTCTTGTGATTAAGATCTTGTCGAAGTTCGAGCTCCGCCGACTCTGCCGTGTCGTCGGTGCTACGCCTCTTGCTCGTTTGGGGGCACCTATGCCGGACGAGATGGGTAGCGTGGATGTGGTCGAGACCACGGAAATTGGCGGAGACCGAGTCACCGTGTTCCGTCAAGAAGACCCCAACACTGTCACACGCACAGCTACCATCGTCCTGCGTGGAGCGACCCAGAACCACCTGGAGGACGTCGAGCGTGCTATTGACGACGGGGTTAACGCTATCAAAGCGATCACCAAGGACCCGCGTCTCGTTCCTGGCGCTGGAGCCACTGAGATCCAGCTCTTAGAACGAATCTCGGCGTTTGCGGACAAGACGCCTGGGCTACCCCAGCATGCGATTCGGAAGTTCGCCGAGGCGTTCGAAGTGATTCCTCGTACGCTTGCCGAGTCTGCCGGGTTAGATGCCACGGAGGTGCTTTCTCGCCTGTACACAGACTATTTCTGGCGAGCACGGCCTTGACGGCTCCGGCGT----CTACAATGGCTCCTCCGATCTCCAGCTGGAACGGATGAACGTTTACTTCAACGAGGCCAGCGGAAACAAGTATGTCCCTCGCGCCGTCTTGGTCGACCTCGAGCC-CGGTACCATGGATGACAAAGATGGCGATGGCCAGATCACGACCAAGGAGCTGGGAACCGTCATGCGTTCCCTAGGCCAAAATCCCTCCGAGTCCGAGCTTCAGGATATGATCAATGAGGTCGATGCCGACAACAATGGCACCATCGATTTCCCTGAATTCCTTA Sclerocleista_ornata TGTCCCCTCAGCGAAACGGTCCCCTGATGGGTATCGTCCAGGATACCTTGTGCGGTATCTACAAAATCTGCAGACGTGATATCTTCTTAACCAAGGACATGGTGATGAATATCATGCTTTGGGTGCCAGACTGGGATGGCGTTATCCCTCCTCCAGCCATCTTGAAACCCAGGCCAAGATGGACTGGAAAGCAGATCATCAGCATGGCCCTACCCTCGGGCTTGAATCTTCTCCGTGTTGA---CAAGGACAGCGCGCCTTTGTCAGAGAAGTTCTGTCCTTTGAATGATGGCGGAGTCCTCGTTCACGGCGGACAGCTGATGTATGGTATGTTTTCTAAGAAGACTGTCGGTGCCAGTGGTGGCGGTGTGATCCATATCATTTTCAATGAGTACGGGTGGCAGACGGCTGTGTCCTTCTTCAACGGTGCCCAAACGATTGTGAACTATTGGCTTCTGCACAATGGTTTCAGTATCGGTATTGGTGATACAATTCCCGATGCGTTGACTATCCAGGGTATTGAGAATGCAGTCCGTATCCGAAAGCAGGAGGTCGAGGATATCACAGCCAGTGCTACCGAGAATACTCTCGAGGCATTGCCCGGTATGAATGTGCGAGAAACCTTTGAAAGCAAGGTCTCGCGCGCGTTGAACAACGCTCGTGATGAAGCTGGTAGCGCAACCGAGAACAGTTTGAAGGATCTCAACAACGCTATTCAAATGGCTCGTTCTGGATCCAAGGGTTCAACTATCAACATCTCGCAAATGTTGTGTCGAATCTGGCAGGGAAATCTACTTGAACATCGGTATCAAGGCCAGCACTTTGTCTGGTGGTTTGAAATACGCCCTCGCTACCGGTAACTGGGGAGAGCAGAAGAAGGCCGCTAGTGCCAAGGCCGGTGTGTCCCAGGTGCTGAGTCGATACACTTACGCCTCTACCTTATCCCATCTTCGTCGCACAAACACGCCCATTGGTCGTGATGGAAAGATTGCCAAACCTCGTCAACTGCATAACACCCATTGGGGTCTGGTCTGTCCTGCCGAGACCCCTGAAGGTCAAGCTTGTGGTCTGGTGAAGAACTTGGCGCTGATGTGCTACATTACGGTCGGTACGCCGAGTGAACCTATAATTGATTTCATGATTCAACGAAACATGGAAGTTCTGGAAGAGTTCGAACCACAGGTGACGCCGAATGCAACTAAGGTCTTTGTTAACGGTGTCTGGGTTGGTATCCACAGAGACCCAGCTCATCTCGTCAACACTATGCTCTCCTTGCGTCGTCGCAACATGATCTCCCATGAAGTCAGTTTGATTCGTGATATTCGTGAGCGAGAATTCAAGATTTTCACCGATGGCGGTCGTGTTTGCAGACCCCTGTATGTTATCGACAATGACCACAAGAGTGAGAACTGTGGCTCCCTGGTTTTGAACAAGGATCACGTTCACAAGCTAGAGGCCGACAAAGAGC---------TGCCACCAGATCTCGATCCCGAGGAGCGCAGGGAACGCTATTTCGGCTGGGATGGTCTGGTGAAATCAGGTGTCGTCGAGTATGTCGATGCTGAAGAAGAAGAGACCATCATGATCGTGATGACGCCTGAGGATCTGGAAATTTCCAAGCAACTTCAAGCCGGTTACGCTCTTCCGGAGGATGACGAGGGCGACCGCAACAAGCGAGTTCGGTCGATTTTGAGTCAAAAGGCACATACATGGACACATTGTGACAGTGCCTGGGAGACTTCCGAGGACCGCCCCCACGAGCCCGAGGACTGGCGCCGTCTGCTCCAGTTCGCCGACTACAAGGGCTCTCGCAACAGAATGCTTCGCGAGGCTCTCATTGGCGGTGTCAACCCTGGCATTCGCGTGGATATCCACCTGCGCGCCGTTCCTGCTTCCCTGCGCACCCGCCCCCAGCCGCTGGCTCTCTTCTC-CTTGCTCCGCCACGAGCACAAGCACACTGTGGTCAACATCAACATGTCGCTGACCTCGACCGTCGAGCAGCCCCTCCGCTCCAAGGAGGAGGTGATCGTCCAATGCGGCCCTCGTCGCCTGGTCGTCAACCCCGTCTTCTCCTCGAACGGCAACACCCCCAACAACGTGCACAAGTTCGACCGCTTCCTGCACCCCGGCCGCAGCGCCATCGCCACCTGGGTCGGTCCCCTCACCTGGGGCGCCGTCCCCGTTCTTGTCTTCAAGAACCGCACA---------GTCTCCGACCCCGAGATCATGGACGGCGACGCCGCCACC------GCCGCCCCGGAGA---------------TCACCCAGCTCGACCTCATCGGCACCGGTACCGTTGTCGCCCCCGACCAGAACCGCGTGGTTGCCAAGCGTGTCATCCGCAAGGCCAAGGTTGGTGTCTTCAGCTGCCCGATTGATATTTCCCAGACCGAGACCAAGGGTACGGTGCTCTTGAACAATGCTCAGGAGATGCTCGACTTCACCAAGGGTGAGGAGGAGCGCCTGGAATCCGCCATCAAGGAGCTCTATGACTCTGGCCTTCGTGTTGTTGTTGCTGGTTCTAACGTTGGCGAACTGGCTCTTCACTACCTTAACCGCTTCAACATTCTCGTCATCAAGATTCTCTCCAAGTTCGAGCTCCGCCGTCTGTGCCGCGTCGTCGGTGCCACTCCTCTCGCCCGTCTTGGTGCCCCCATGCCCGATGAGATGGGCAGTGTCGATGTCGTGGAGACCATCGAGATTGGTGGTGACCGCGTTACTGTCTTCCGTCAAGAAGATGCCAACACCGTGACTCGCACCGCTACGATCGTTCTGCGTGGTGCCACCCAGAACCACCTTGATGACGTTGAGCGTGCCATCGATGATGGTGTCAACGTTGTCAAGGCCATCACCAAGGACCCCCGTCTTGTTCCCGGTGCCGGTGCCACCGAGATTCAGCTGGTCGAGAGAATTTCTGCTTTCGCCGACAGGACTCCTGGCTTGCCACAGCACGCCATTCGCAAGTACGCCGAAGCTTTCGAGGTCATCCCTCGCACTCTTGCTGAGTCTGCCGGTCTCGACGCTACTGAAGTCATCTCTCGCCTTTACACAGACCATCTCCGGCGAGCATGGCCTTGACGGCTCCGGTGT----CTACAATGGTACCTCTGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGAAACAAGTACGTTCCTCGTGCCGTCCTGGTCGATCTTGAGCC-TGGTACCATGGACGACAAGGATGGCGATGGACAAATCACCACCAAGGAACTTGGTACCGTCATGCGCTCTCTCGGCCAGAACCCTTCCGAGTCGGAATTGCAGGACATGATCAACGAGGTTGATGCCGACAACAACGGCACGATCGATTTCCCAGAGTTCCTTA Sclerocleista_thaxteri TGTCTCCTCAGCGAAACGGTCCCCTGATGGGTATCGTCCAGGACACCTTGTGCGGTATCTACAAAATCTGCAGACGTGATATCTTCTTAACCAAGGACATGGTGATGAATATCATGCTTTGGGTGCCAGACTGGGATGGCGTTATCCCCCCTCCGGCCATCTTGAAACCCAGGCCAAGATGGACTGGAAAGCAGATCATCAGCATGGCCCTACCCTCGGGCTTGAATCTTCTCCGTGTTGA---CAAGGACAGCGCCCCTTTGTCAGAGAAGTTCTGTCCTTTGAATGATGGCGGAGTTCTCGTTCACGGCGGACAGCTGATGTATGGTATGTTTTCTAAGAAGACTGTCGGTGCCAGTGGTGGCGGTGTGATTCATATCATTTTCAATGAGTACGGATGGCAGACGGCTGTGTCCTTCTTCAACGGTGCCCAAACGATTGTGAACTATTGGCTTCTGCACAATGGTTTCAGTATCGGTATTGGTGATACAATCCCCGATGCGTTGACTATTCAGGGTATTGAGAATGCAGTCCGTATCCGAAAGCAGGAGGTCGAGGATATCACAGCCAGTGCTACCGAGAATACTCTCGAGGCATTGCCCGGTATGAATGTGCGAGAAACCTTTGAAAGCAAGGTCTCGCGTGCGTTGAACAACGCTCGTGATGAAGCTGGTAGCGCAACCGAGAACAGTCTGAAGGATCTCAACAACGCCATTCAAATGGCTCGTTCTGGATCCAAGGGTTCAACTATCAACATCTCGCAAATGTTGTGTCGAATCTGGCAGGGAAATCTACTTGAACATTGGTATCAAGGCCAGCACTTTGTCTGGAGGTTTGAAATACGCCCTCGCTACTGGTAACTGGGGAGAGCAGAAGAAGGCCGCTAGTGCCAAGGCCGGTGTGTCACAGGTGCTGAGTCGTTACACTTATGCCTCTACCTTATCCCATCTTCGTCGAACAAACACTCCCATTGGTCGTGATGGAAAGATTGCCAAACCTCGTCAACTGCATAACACCCATTGGGGTCTGGTCTGTCCTGCCGAGACACCTGAAGGTCAAGCTTGTGGTCTGGTGAAGAACTTGGCGCTGATGTGCTACATTACCGTTGGTACCCCGAGTGAACCTATCATTGATTTCATGATTCAACGAAACATGGAAGTTCTGGAAGAGTTCGAACCACAAGTGACGCCGAATGCAACCAAGGTCTTTGTTAACGGTGTCTGGGTTGGTATCCACAGAGACCCAGCTCATCTCGTCAACACTATGCTCTCCTTGCGTCGTCGCAACATGATCTCCCATGAAGTCAGTTTGATTCGTGATATTCGTGAGCGAGAATTTAAGATTTTCACCGATGGCGGTCGTGTTTGCAGACCCCTGTACGTTATTGACAACGACCACAAGAGTGAGAATTGTGGCTCCCTGGTTTTGAACAAGGAGCACGTTCACAAACTAGAGGCCGACAAAGAGC---------TGCCACCAGATCTCGATCCCGAGGAGCGCAGGGAACGCTATTTCGGTTGGGATGGTCTGGTAAAATCAGGTGTTGTCGAGTATGTAGATGCTGAAGAAGAAGAGACCATCATGATTGTGATGACACCTGAGGATCTGGAAATTTCCAAGCAACTTCAAGCCGGTTACGCTCTTCCGGAGGATGACGAGGGCGACCGCAACAAGCGAGTTCGGTCTATTTTGAGTCAAAAGGCACATACATGGACACATTGTGACAGTGCCTGGGAGACTTCCGAGGACCGCCCCCACGAGCCCGAGGACTGGCGCCGTCTGCTCCAGTTCGCCGACTACAAGGGCTCTCGCAACAGAATGCTTCGCGAGGCTCTCATCGGCGGTGTCAACCCTGGCATTCGTGTGGATATCCACCTGCGCGCAGTCCCAGCGTCCCTGCGCACCCGCCCCCAGCCGCTGGCGCTCTTCTC-CTTGCTCCGCCACGAGCACAAGCACACTGTGGTCAACATCAACATGTCGCTGACCTCGACTGTCGAGCAGCCCCTCCGCTCCAAGGAGGAGGTCATCGTCCAATGCGGCCCTCGTCGCCTGGTCGTCAACCCCGTCTTCTCCTCGAACGGCAACACCCCCAACAACGTGCACAAGTTCGACCGCTTCCTGCACCCTGGCCGCAGCGCCATCGCCACCTGGGTCGGTCCCCTCACCTGGGGCGCCGTTCCCGTTCTTGTTTTCAAGAACCGCACA---------GTCTCCGACCCCGAGGTCATGGACGGCGACGCCGCCACC------GCCCCCTCGGAGA---------------TCACCCAGCTCGACCTCATCGGCACCGGTACCGTTGTCGCTCCCGACCAGAACCGTGTGGTTGCCAAGCATGTCATCCGGAAGGCCAAGGTTGGTGTCTTCAGCTGCCCGATTGATATTTCCCAGACCGAGACCAAGGGTACGGTGCTCTTAAACAATGCTCAGGAGATGCTCGACTTCACCAAGGGCGAGGAGGAACGCTTGGAATCCGCCATCAAGGAGCTCTATGACTCTGGCCTTCGTGTTGTTGTTGCTGGTTCCAACGTCGGTGAACTGGCTCTTCACTACCTTAACCGCTTCAACATTCTCGTCATCAAGATTCTCTCCAAGTTCGAGCTCCGCCGTCTGTGCCGTGTCGTTGGTGCCACTCCTCTCGCCCGTCTTGGTGCCCCCATGCCCGATGAGATGGGCAGTATCGATGTTGTGGAGACCATCGAGATCGGTGGTGACCGCGTTACTGTCTTCCGTCAAGAAGATGCCAACACCGTGACTCGCACCGCAACGATCGTTCTGCGTGGTGCCACCCAGAACCACCTTGATGACGTTGAGCGTGCCATCGATGATGGTGTCAACGTTGTCAAGGCCATCACCAAGGACCCCCGTCTTGTTCCCGGTGCCGGTGCCACCGAGATTCAGTTGGTCGAGAGAATTTCTGCTTTCGCCGACAGGACCCCTGGCTTGCCACAGCACGCCATTCGCAAGTACGCCGAGGCTTTCGAGGTCATCCCTCGCACTCTTGCTGAGTCTGCCGGTCTCGACGCTACTGAAGTTATCTCTCGCCTTTACACAGACCATCTCCGGCGAGCATGGCCTTGACGGCTCCGGTGT----CTACAATGGTACCTCTGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGCCAGCGGAAACAAGTACGTTCCCCGTGCCGTCTTGGTCGATCTTGAGCC-TGGTACCATGGACGACAAGGATGGCGATGGACAAATCACAACCAAGGAACTTGGTACCGTCATGCGCTCTCTCGGCCAGAACCCTTCCGAATCGGAATTGCAGGACATGATTAACGAGGTTGATGCCGACAACAACGGCACGATCGATTTCCCAGAGTTCCTTA Talaromyces_flavus TATCGCCACAGAGAAACGGTCCCTTGATGGGTATCGTACAGGACTCACTGTGTGGTATCTACAAGATCTGCCGTCGTGACGTTTTTCTTACCAAAGATCAAGTCATGAACCTGATGCTTTGGGTCCCTGACTGGGATGGCGTCATTCCTCAGCCAGCAATTATCAAACCCAGACCCCGCTGGACTGGAAAGCAGATTATCAGCATGGTCTTACCTTCAGGACTCAACTTGTTACGTGTTGA---CAAAGACAAAGCTCCGCTTTCAGAGAAGTTTTCACCCTTAGCAGACGGTGGAATTCTGGTCCATGGCGGCCAGTTGATGTATGGCATGTTCTCGAAAAAGACCGTTGGAGCTTCTGGCGGCGGTGTCGTTCATACTATTTTCAATGAGTACGGACCTGAAGCTGCAGTATCTTTCTTCAATGGTGCGCAACGTGTTGTTAATTACTGGCTTTTGCACAATGGCTTCTCCATCGGTATTGGTGATACAATCCCTGATAAGAAAACTATTGAACGGATCGAAGGTGCAGTTCGCGCTGGTAAAGCAGAGGTCGAAGAGATCGTTCAAAGTGCAACTGAAAATACGTTGGAGGCATTGCCTGGTATGAATATTCGAGAGACGTTTGAAAGCAAGGTTTCTCGTGCGTTGAACAATGCTCGTGAGGCTGCTGGTAGTGAGACCGAGAAGAGTTTGAAGGACCTGAACAATGCCATTCAAATGGCAAGATCTGGATCCAAGGGTTCCGCCATCAACATCTCCCAGATGATGCGTTGAAACAAACCGTGAAGTGGTTCTCAACGTGGGTCTTAAGCCAGCCACTCTTACAGGTGGTTTGAAATATGCTCTCGCTACCGGAAATTGGGGTGAGCAGAAGAAGGCAATGAGCTCTAAAGCTGGTGTTTCTCAGGTGCTCAGTCGATACACCTTTGCCTCTACTTTGTCTCATTTGAGACGTACCAATACACCTATTGGTCGTGATGGAAAGATTGCCAAGCCTCGTCAGCTACACAATACTCACTGGGGTCTAGTTTGTCCTGCCGAGACTCCTGAAGGTCAAGCTTGTGGTTTGGTCAAGAACTTGGCTTTGATGTGTTCTATCACTGTGGGTTCTCCTAGCGAGCCCATCGTTGATTTCATGATTCAGCGAAACATGGAAGTACTTGAGGAATTCGAACCTCTAGTTACGCCTCATGCCACCAAGGTCTTTGTCAATGGCGTTTGGGTTGGTGTCCATCGTGATCCAGCGCATTTGGTCAGCACCGTTCAGTCACTACGTCGACGAAACATGATTTCGCACGAAGTCAGTTTGGTTCGTGACATTCGTGACCGGGAGTTCAAGATCTTCACAGATGCCGGCCGTGTTTGTCGACCACTTTTCGTTATCGACAACGATCCGCGAAGCGAAAACTGCGGTTCTTTGGTACTCAACAAAGACCATATTCGCAGACTTGAAGCAGACCGCGAAC---------TTCCGCCAGACCTCGACCCCGAAGAACGAAGGGAGCAATACTACGGTTGGGAGGGTCTTGTCAAATCGGGAGTTATTGAGTATGTTGATGCTGAAGAGGAAGAAACCATCATGATTGCCATGTCTCCTGAGGATCTCGAAATTTCGAAACAACTACAAGCCGGTTATGCCTTGCCCGAGGACAA---CAGTGATCCAAACAAGCGTGTCCGTTCAGTGTTGAGTCAGAGGGCGCACATCTGGACTCACTGTGATAGTCGATGGGAGACATCGGAAGATCGACCATTTGAACCCGAAGATTGGCGACGACTACTCCAATTCAGCGACTACAAAGGTATCAAAAATAAGCTTATTCGGGAGGCTCTTATCGGCGGCGTTACACCCGGTACACGAGTTAATGTGCACTTGAAGGCTGTGCCGTCAGTACTGCGCAACAGTCCATTGCCAGTGGCATTATATTC-TTTGCTTCGACATGAACATAAGCACACCGTCATCAATATCAACATGACATTGAACTCTTCCGTCGAGAAGCCTATCAAGTCCAAAGAGGAAGTCATCATCCAATGCGGACCCCGCCGTCTTGTCGTGAATCCCATCTACTCCGGTGCAGGAAATACGCCAAACAACGTACACAAATTCGATCGATACCTCCATCCAGGTCGCAGCGCCATTGCGACATTCATTGGTCCCGTAACCTGGGGCGCCGTTCCAGTGTTGGTATTCAAGAACCAGG---CC------ATCGACGACCCAGAAGTCCTCGACTCCGCCGACG---------------GCACCAGCG---CTGGAAAGACATCCAGCCGTCTGGAACTTATCGCAACAGGCACAGTCGTTGCACCCGATCATTCTCGAGTAATCGCCAAACGAGCCATTCGCAAGGCCAAGGTCGGTGTCTTCAGCTGCCCCATCGATACCTCCCAGACCGAGACCAAGGGCACTGTTCTTTTGAAGAATGCACAGGAGATGCTTGACTTTACCAAAGGAGAGGAAGACCGCCTTGAAGCTACCATTAAAGAATTATACGACTCTGGTGTACGTGTTGTTGTTGCTGGATCCACAGTGGGCGAATTGGCCCTGCACTACCTTAACCGCTTCAATATTCTTGTTATCAAGATTATGTCCAAATTCGAACTCCGCCGTCTTTGCCGTGTTGTAGGCGCTACACCGCTCGCTCGTCTCGGTGCACCCATGCCGGATGAAATGGGTAATATCGATGTTGTTGAGACCACAGAGATTGGAGGTGACCGTGTGACCGTTTTCCGTCAAGAGGATGCCAACACCGTCACTCGAACTGCTACCATCGTTCTACGAGGCGCCACACAAAACCACCTTGATGATGTTGAACGTGCTATTGACGACGGCGTCAATGTTGTCAAAGCTATCACCAAAGACCCCCGTCTTGTTCCTGGTGCTGGTGCCACAGAACTTCAATTGGCTGAACGCATCTCTGCCTTTGCTGATAAGACGCCGGGATTAGCTCAGTATGCTATTAAGAAATACGCAGAAGCATTCGAAGTTGTTCCCAGAACATTGGCCGAGTCCGCTGGTCTTGATGCCACCGAGGTTCTTTCACGACTATACACAAATCATCTCCGCTGAGCACGGTCTCGACGGCTCCGGTGT----CTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAACGTTTACTTCAACGAGGCTTCCGGCAACAAATATGTCCCTCGTGCTGTCCTCGTCGACTTGGAGCC-CGGTACCATGGACGACAAGGATGGAGATGGTCAAATCACAACCAAGGAACTGGGCACCGTCATGCGTTCCCTCGGCCAGAACCCCTCCGAATCCGAATTGCAGGACATGATCAACGAAGTCGACGCTGACAACAACGGCACAATCGATTTCCCTGAATTCTTGA Talaromyces_leycettanus TCTCGCCCCAGCGAAATGGTCCTCTGATGGGTATCGTCCAGGATACTCTATGCGGTATTTACAAGATCTGCCGGCGTGATGTCTTTCTTACCAAAGACCAAGTTATGAACATCATGCTTTGGGTCCCTGATTGGGATGGAGTTATTCCTCCCCCGGCGATTTTGAAGCCCAGGCCAAGATGGACTGGCAAGCAGATGATTAGCATGGCCCTTCCCTCTGGCTTGAACCTCCTGCGGGTTGA---AAAGGATAATTCGCCTCTCTCTGAGAAGTTCTCGCCTCTGAATGATGGTGGTCTCCTCATTCACGGTGGTCAGTTGATGTATGGTATGTTTTCCAAGAAGACCGTCGGTGCCAGTGGTGGAGGTGTTGTTCACACCATCTACAACGAGTACGGTCCTGATACGGCCGTCGCCTTCTTTAACGGTGCGCAGACCATTGTCAACTATTGGTTGTTGCATAATGGTTTCAGTATCGGTATCGGTGACACGATTCCTGATGCTGTGACCATCCAGAGAATCGAGGAGGCTGTGCGGGTGCGAAAGCAAGAAGTCGAGTCTATTACGGCAAGCGCTACTGAGAACACACTGGAGCCATTGCCTGGTATGAATGTGCGTGAAACATTCGAGAGCAAGGTCTCACGCGCACTCAACAATGCTCGTGACGAAGCTGGTAGCGAGACCGAAAAGAGTTTGAAGGATCTCAACAACGCCATTCAAATGGCTCGTTCGGGATCCAAGGGTTCAACCATCAACATCTCGCAGATGATGCGTCGAGACGAATCGCGATGTCTACCTCAACATCGGCATCAAGTCTAATACATTGACGTCAGGATTGAAATATGCTCTGGCAACAGGTAACTGGGGAGAGCAGAAGAAGGCAGCCAGCTCTAAGGCCGGTGTGTCTCAGGTGCTCAGTCGTTACACATATGCTTCTACTCTTTCGCATCTGCGTCGTACCAACACGCCCATTGGTCGTGATGGAAAGATTGCCAAACCTCGCCAGCTTCATAACACTCACTGGGGCTTGGTCTGTCCAGCTGAAACTCCAGAAGGTCAAGCTTGTGGTCTGGTCAAGAACTTGGCGCTCATGTGTTATATCACTGTCGGAACACCTAGCGAGCCTATTATCGACTTCATGATCCAGCGCAACATGGAAGTTCTCGAGGAATTCGAGCCACAGGTGACACCGAATGCCACAAAGGTCTTTGTCAACGGTGTCTGGGTTGGAGTACACCGAGACCCTGCCCATCTGGTCAACACCATGCTCTCCTTGCGCCGGCGAAACTTGATCTCTCACGAGGTCAGCTTGATCCGTGATATTCGTGAGCGGGAATTCAAGATCTTCACTGATGCAGGTCGCGTCTGCCGACCATTGTTCGTCATTGACAATGATCCGAAGAGCGAGAATTGCGGTTCGCTAGTACTGAACAAGGATCACGTCCGCAAGCTGGAGCAAGACAAGGAGT---------TGCCGCCCGATCTCGACCCAGAAGAGCGCAGAGAACGCTACTTCGGATGGGACGGCCTCGTGAAATCGGGAGTCGTTGAATATGTCGATGCGGAGGAGGAAGAGACCATCATGATCGTTATGACACCCGAGGATCTTGAGATTTCGAAACAGTTGCAGGCCGGCTATAGCCT---CGAGGAAGAGAGCAGCGACCCGAACAAACGTGTACGGTCGATACTGAGCCAAAAAGCGCACACCTTCACACACTGCGACAGTCGGTGGGAGACTTCGGAGGATCGAGCCTTCGAGCCCGAAGAGTGGCGGCGCCTCCTTCAGTTCGGCGATTATAAAAGTATCAAAAACAAGATGATTCGAGAGGCTCTTGTTGGGGGTGTCAATCCCGGTACCCGAGTTGATGTACACCTCCGTGCGGTACCATCTTCACTCCGCAATCGTGCATCGCCAATATCATTGTTCTC-CCTTCTCCGCCATGAGCACAAGCGCACCGTCGTCAACATCAATATCACGGTGAACTCGTCCGTGGAGACACCCATCAAGTCGAAGGAGGAGGTGATCATCCAATGCGGGCCTCGTCGCCTAGTGGTCAATCCGATCTTCTCCGGGGCGGGAAATACTCCCAATAACGTCCACAAGTTTGACCGCTTCCTTCACCCTGGTCGTAGCGCGATCGCCACCTTTGTCGGACCGGTGGTTTGGGGCGCTGTCCCGGTGCTGGTTTTCAAAAATCAGA---CC------GTCCAAGACCCTGAGGTACTAGATTCCGCCGACG---------------GGGCTGTGT---CAGAGGCTACTACCAAACGTCTGGAGCTCATTGCGACGGGCACAGTCGTTGCATCCGATCACTCTCGGGTCGTCGCCAAGCGCGCTATCCGCAAAGCGAAGGTCGGTGTGTTCAGCTGCCCGATCGATATCTCTCAGACCGAAACCAAGGGCACCGTGCTTTTGAAGAATGCTCAAGAAATGCTCGATTTCACCAAGGGCGAGGAGCAGCGTCTCGAGGCGGTCATCAAGGAACTCTACGACTCTGGTCTCCGTGTTGTCGTCGCTGGTTCTACGGTTGGCGAGTTGGCTCTGCACTATCTCAACCGTTTCAACATCCTTGTCATCAAGATCCTGTCAAAGTTCGAACTCCGCCGTCTCTGTCGCGTTGTTGGTGCCACGCCTCTTGCCCGTTTGGGCGCCCCCATGCCAGACGAAATGGGTAGCGTTGACGTGGTCGAGACCACGGAAATTGGCGGTGATCGCGTGACTGTTTTCCGCCAGGAGGATGCCAACGCCGTGACTCGCACTGCTACAATCGTTCTGCGTGGAGCGACGCAGAACCACCTGGATGACGTGGAGCGTGCCATCGATGACGGCGTCAACGTCGTGAAAGCCATTACCAAGGACCCCCGTCTTGTTCCCGGTGCAGGCGCTACGGAGATTCAGCTCGTGGAACGCATCTCCGCGTTTGCAGACAAGACTCCCGGCTTGCCGCAGCACGCTATTCGCAAGTATGCAGAGGCCTTTGAGGTAATCCCACGCATACTTGCCGAGTCTGCAGGCTTGGATGCTACCGAGGTGCTCTCGCGTCTTTACACAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGT----TTACAATGGCTCCTCCGATCTTCAGCTGGAGCGTATGAACGTTTACTTCAACGAGGCCAACGGAAACAAGTATGTCCCTCGTGCCGTCCTGGTCGACCTTGAGCC-TGGCACCATGGATGACAAGGATGGTGATGGCCAAATCACCACCAAGGAGCTGGGTACCGTCATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCCGAGCTACAGGACATGATCAACGAGGTTGATGCCGACAACAACGGCACCATCGATTTCCCAGAGTTCCTCA Thermoascus_crustaceus TATCACCCCAGCGAAATGGTCCCCTGATGGGTATCGTCCAAGATACTCTCTGTGGTATCTACAAGATCTGCCGGCGTGATGTGTTCCTGACCAAGGAGCAAGTGATGAATATCATGTTGTGGGTACCCGACTGGGACGGTGTAATTCCTCAGCCGGCCATTCTGAAGCCTAGACCGAGATGGACCGGAAAGCAGATGATCAGCATGGTTCTTCCTCCGGGTTTGAACCTCCTGCGTGTCGA---TAAGGACTCAGCATCGCTGCGAGAGAAGTTCTGTCCATCGACTGACGGCGGTCTCCTCATCCACGGCGGGCAGCTGATGTATGGCATGTTCTCGAAGAAGACAGTTGGTGCTAGCGGCGGTGGTGTCATCCATACCATTTTCAACGAGTATGGGCCAGCGACCGCAATGGCATTTTTCAACGGTGCTCAAACAGTGGTCAACTACTGGCTTCTGCACAACGGTTTCAGTATCGGTATCGGTGACACGATTCCTGATCCAGCTACCATCCAGAAGATCGAAGAGTGTGTTCGCTTACGCAAACGGGAGGTTGATGAAATTACTGCGCAGGCAACGGACAACCTCTTGGAGCCGTTGCCCGGTATGAACGTGCGTGAAACTTTCGAAAGCAAGGTCTCCCGTGCTCTGAACAACGCTCGTGATCAGGCTGGTGACGCGACGGAGAAGAGCTTGAAAGACTTGAATAATGCCATCCAGATGGCCCGTTCTGGATCGAAGGGTTCGACTATTAACATCTCCCAAATGATGTGTGGAGACTAACCGTGAGATCTACTTGAACATCGGTGTCAAGGCTAGCACGTTGACCGGAGGTCTCAAATATGCCCTTGCCACGGGTAACTGGGGTGAGCAGAAGAAGGCAGCAAGCTCCAAGGCGGGTGTGTCGCAGGTGCTGTCACGCTATACCTACGCGTCTACGCTTTCGCATCTTCGCCGTACGAACACACCGATCGGCCGTGATGGAAAGATTGCAAAGCCTCGCCAGCTTCACAACACGCACTGGGGTCTGGTCTGTCCGGCAGAGACGCCTGAAGGTCAGGCTTGTGGTCTGGTCAAGAACTTGGCTCTCATGTGCTATATCACCGTCGGTACTCCTAGCGAGCCGATTATCGACTTCATGATCCAGCGAAACATGGAAGTGCTGGAAGAGTTCGAGCCGCAGGTGACACCAAACGCAACGAAGGTGTTTGTCAATGGTGTCTGGGTCGGAGTACACAGAGATCCTGCTCACCTCGTCAACACCGTCCTTTCCCTTCGTCGGCGCAATATGATCTCCCACGAGGTCAGCTTGGTCAGAGATATCCGTGATCGGGAGTTCAAGATCTTCACCGACGCTGGTCGTGTCTGCAGACCGCTCTTCGTTATCGACAACGATCCCAAGAGCGAGAACTGCGGCTCCCTGGTGCTCAACAAGGAACACATCCACAGACTCGAACAGGACAAGGAGC---------TGCCTCCCGACATGGATCCGGAGGAACGCAGAGAACGGTACTTCGGCTGGGACGGCCTGGTCAAGTCGGGTGTCGTGGAGTATGTCGATGCTGAAGAGGAAGAGACGATCATGATTGTCATGACGCCTGAGGATCTTGAGATCTCGAAGCAACTGCAGGCTGGTTATGCCCTGCCCGAGGATGAGGGCGGCGATCCGAACAAGCGTGTGCGGTCTGTGCTGAGCCAGAAGGCACACACTTGGACGCACTGTGACAGTCGCTGGGAGACCTCCGAGGACAGACCTTTCGAGCCAGAGGACTGGCGACGACTTCTTCAGTTCGCCGATTACAAGGGCTCGAGGAACAAGACCATGAGAGAGGCTCTTGTCGGCGGTGTCAACCCAGGTATCCGTGTCGATGTGCATCTCAAGGCAGTGCCATCATCGCTCCGAAGCCGCCCACAGCCCCTGGCGCTCTTCTC-TCTCCTCCGCCACGAGCACAAGCATACCGTGGTCAACATCAACATGATTCTGAACTCGTCCGTCGAGTCTCCCCTGAAGTCCAAGGACGAAGTCATCATCCAATGCGGCCCGCGCCGTCTGGTAGTCAAACCAATCTTCTCCGCCTCAGGCAACACGCCCAACAACGTACACAAATTCGACCGCTTCCTCCACCCAGGCCGAAGCGCCGTCGCAAGCTACATCGGCCCGCTGACATGGGGTTCCGTTCCCGTCCTCGTCTTCAAAAAAGAAC---AA------GTCAAGGACCCGGAAGTCCTGGACGACGACGACA---------------ACAACC------CAAGAAACATGATCGAGCGCCTCAACCTCATCGGCACCGGCACCGTCGTCGCGCCCGACCACTCCCGCGTCGTCGCCAAGCGCGTCATCCAGAAGGCCAAGGTCGGTGTCTTCAGCTGCCCAATCGACATCTCTCAGACCGAGACCAAGGGTACCGTCCTGCTGCACAACGCGCAGGAGATGCTTAACTTCACCAAGGGAGAGGAGGAGCGCCTCGAGGCAGCTATCAAGGAGCTGTACGACTCAGGCCTCCGCGTCATCGTTGCTGGCGCCACCGTCGGCGAGCTGGCCCTCCACTACCTTAACCGCTTCAACATCCTCGTCATTAAGATTCACTCCAAATTCGAACTCCGCCGGCTCTGCCGCGTCGTGGGCGCTACGCCCCTCGCCCGTCTCGGTGCCCCCATGCCGGACGAGATGGGTACTGTGGACGTTGTTGAGACGACTGAAATTGGTGGTGACAGAGTGACCGTCTTCCGCCAGGAGGACCCCAGCGCCGTCACCCGCACGGCCACCATTGTGCTGCGCGGCGCGACCCAGAACCATCTCGATGATGTTGAGCGCGCCATTGACGATGGTGTCAACGTCGTCAAGGCTATCACCAAGGACCCTCGCCTTGTCCCAGGTGCGGGCGCCACCGAAGTCCAGCTCGTTGAGCGTATCTCCACCTTCGCGGACAAGACCCCCGGTCTTCCCCAGCACGCTATCAGGAAGTACGCCGAGGCCTTCGAGGTCATTCCGCGCACTCTTGCCGAATCTGCCGGTCTCGACGCTACCGAGGTCCTGTCCCGTCTGTATACAGACCATCTCTGGAGAACACGGTCTCGACGGCTCTGGAGT----TTACAATGGCTCCTCTGACCTCCAGCTCGAACGTATGAACGTCTACTTCAACGAGGCCAATGGCAATAAGTACGTTCCTCGTGCCGTCCTCGTCGACCTTGAGCC-CGGTACCATGGACGACAAGGATGGTGATGGCCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCCCTGGGCCAGAACCCGTCCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGACGCTGACAACAACGGCACCATCGACTTCCCAGAGTTTCTGA Warcupiella_spinulosa TCTCCCCTCAGAGAAACGGTCCCCTGATGGGTATCGTCCAGGATACTCTTGCTGGTATCTACAAGATTTGTCGACGTGATACTTTCCTGACCAAAGAGCAAGTCATGAACATCATGCTCTGGGTTCCTGACTGGGATGGTGTCATTCCTCCGCCAGCTATCTTGAAGCCGAGGCCAAGGTGGACTGGAAAGCAGATGATCAGCATGGCCCTTCCTTCTGGCCTGAACCTTTTGCGCGTTGA---AAAGGACAACTCGCCTTTGTCTGAAAAATTCTCTCCGCTTAACGATGGCGGACTTCTGATTCACGGTGGGCAGTTGATGTACGGAATGTTCTCCAAGAAGACAGTCGGCGCCAGCGGTGGAGGTGTTATCCACACCATCTTCAACGAATACGGGCCTCAGACTGCCGTTGCCTTCTTCAATGGAGCACAAACCATTGTCAATTATTGGTTGCTTCACAATGGTTTCAGTATTGGAATCGGTGATACGATTCCTGATGCTGTTACCATTCAGAGGATTGAGAATGCGGTCCGGTTACGCAAACAAGAAGTCGAGTCTATCACGGCAAGCGCTACTGAGAACACTCTCGAGCCATTGCCCGGTATGAACGTGCGTGAGACTTTCGAAAGCAAGGTATCGCGTGCGCTCAACAACGCCCGTGATGAAGCTGGTAGCGAGACCGAGAAGAGCTTGAAGGACTTGAACAACGCCATTCAGATGGCTCGTTCTGGATCCAAGGGTTCCACCATTAACATTTCCCAGATGATGCGTTGAAACTAACCGCGAGATCTACTTGAACATTGGTATCAAGGCCAGCACATTGACTGGAGGTCTAAAATATGCCTTGGCTACTGGCAACTGGGGTGAACAGAAGAAGGCGGCTAGCGCGAAGGCTGGTGTGTCTCAGGTGCTCAGTCGTTACACTTATGCATCTACGCTTTCCCATCTTCGTCGTACCAACACGCCTATCGGTCGTGATGGAAAGATTGCTAAGCCTCGCCAGCTGCATAATACTCACTGGGGTCTGGTTTGCCCAGCCGAAACCCCCGAAGGTCAAGCTTGTGGTCTGGTGAAGAACTTGGCACTCATGTGCTACATCACTGTCGGTACACCTAGCGAGCCTATCATCGACTTCATGATTCAGCGCAACATGGAAGTTCTGGAGGAGTTTGAGCCTCAAGTTACGCCCAATGCCACAAAGGTCTTCGTCAATGGTGTCTGGGTTGGTATCCACCGTGATCCAGCTCACTTGGTCAACACCATGCAGTCTCTTCGGCGGCGCAACATGATCTCTCATGAGGTCAGTTTGATCCGTGATATCCGTGAGCGAGAATTCAAGATTTTCACCGACGCTGGCCGTGTCTGTCGACCTCTCTTTGTCATTGATAATGATCCGAAGAGCGAGAAATGCGGCTCGCTTGTTCTCGACAAGGAGCACGTTCGCAAACTGGAACAAGACAAAGAGT---------TGCCACCTGATCTCGACCCAGAAGAGCGCAGGGAACGCTACTTCGGATGGGAGGGTCTCGTGAGGTCAGGTGTTGTTGAATATGTCGATGCCGAGGAAGAAGAGACGATCATGATTGTTATGACGCCCGAAGATCTCGAAATCTCGAAACAACTGCAGGCAGGCTACGCTCTACCCGAGGAAGAGACGAACGATCCCAACAAGCGTGTCCGCTCTATTCTCAGTCAACGGGCGCATACTTGGACCCACTGCGACAGCCCCTGGGAGACAGCCGAAGACCGCCCTCACGAACCCGAGGACTGGCGCCGACTCCTCCAATTCGCCGATTACAAGGGCTCCAAGAACAGAACCGTCAATGAAGCTTTGGTCGGTGGTGTCAACCCCGGCATCCGCGTGAACGTCCACCTCCGCGCCGTCCCCTCATCGCTCCGCAGCCGTCCTCAGCCCTTGTCGCTCTTCTC-CCTCCTCCGCCACGAACACAAGCACACCGTCGTCAACGTCAACATGTCCCTGAGCTCCGGCATCGAGGAGCCCCTCAAGTCCAAGGAAGAGCTCATCATCCAGTGCGGCCCCCGCCGCCTGGTCGTCAACCCCATCTTCTCCGCCGCCGACAACACCCCCAACAACGTCCACAAGTTCGACCGCTTCCTCCACCCGGGCCGCAGCGCCATCGCAACCTGGATCGGCCCTCTCACGTGGGGCGCCGTCCCCATCCTCGTCTTC---AAGAACAAGCAA------GTCCAGGACCCCGAAG------AT------ATTG---------------CCGGTGACAGCAA---------CGTCAACAAGCTCGAGCTCATCGGCACCGGCACCGTCGTCGCCCCCGACCAGGCCCGGGTCGTCGCCAAGCGCGTCATTCGCAAGGCCAAGGTCGGTGTCTTCAGCTGCCCGATCGACATTTCGCAGACCGAGACCAAGGGCACCGTGCTCTTGAAAAACGCCCAAGAGATGCTTGACTTTACCAAGGGCGAGGAGCAACGTCTGGAGAGTGCCATCAAAGAGCTTTACGACTCTGGTGTTCGCGTCGTTGTTGCCGGTGCTACTGTTGGCGAGCTGGCCCTGCACTACCTCAACCGCTTCAACATCCTTGTGATCAAGATTCTTTCCAAATTTGAACTCCGTCGCCTTTGCCGTGTTGTTGGTGCCACTCCCCTCGCACGCCTTGGAGCACCTATGCCCGACGAGATGGGCAACATTGACGTTGTCGAGACCACTGAAATTGGCGGTGACCGGGTCACCGTCTTCCGCCAGGAGGATGCCAACACCGTGACTCGCACTGCAACCATCGTGCTGCGTGGTGCCACTCAAAACCACCTGGATGATGTTGAGCGTGCTATTGATGACGGCGTCAACGTGGTCAAGGCCATCACCAAGGACCCCCGTCTTGTTCCTGGCGCAGGCGCTACTGAAATCCAGCTCGTGGAACGTATTTCTGCTTTCGCAGACAAGACCCCCGGTTTGCCTCAGCACGCCATTCGCAAGTATGCCGAGGCCTTTGAGGTGATCCCTCGCACTCTCGCCGAATCTGCGGGTCTCGATGCCACCGAGGTTCTGTCTCGTCTTTACACAAACCATCTCTGGCGAGCACGGTCTTGATGGCGATGGACA----GTACAATGGCACCTCCGACCTTCAGCTCGAGCGTATGAACGTCTACTTCAACCATGCCAGCGGGGACAAGTACGTTCCCCGTGCCGTCCTGGTCGACTTGGAGCC-CGGTACCATGGACGACAAGGATGGCGATGGCCAGATCACTACCAAGGAGTTGGGGACCGTTATGCGCTCTCTGGGCCAGAACCCTTCAGAGTCCGAGTTGCAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACCATCGATTTCCCAGAGTTCCTTA ; END; BEGIN TREES; TITLE Aspergillus_monophyly_mrbayes_6_genes; LINK TAXA = Taxa1; TRANSLATE 1 Penicillium_hirayamae, 2 Penicillium_adametzii, 3 Penicillium_catenatum, 4 Penicillium_charlesii, 5 Penicillium_cinnamopurpureum, 6 Penicillium_citreonigrum, 7 Penicillium_citrinum, 8 Penicillium_coffeae, 9 Penicillium_cryptum, 10 Penicillium_dimorphosporum, 11 Penicillium_euglaucum, 12 Penicillium_glabrum, 13 Penicillium_griseolum, 14 Penicillium_herquei, 15 Penicillium_idahoense, 16 Penicillium_janthinellum, 17 Penicillium_javanicum, 18 Penicillium_lagena, 19 Penicillium_lapidosum, 20 Penicillium_lassenii, 21 Penicillium_macrosclerotiorum, 22 Penicillium_malachiteum, 23 Penicillium_ochrosalmoneum, 24 Penicillium_ramusculum, 25 Penicillium_restrictum, 26 Penicillium_shearii, 27 Penicillium_simplicissimum, 28 Penicillium_stolkiae, 29 Penicillium_thiersii, 30 Penicillium_canescens, 31 Penicillium_chrysogenum, 32 Penicillium_expansum, 33 Penicillium_griseofulvum, 34 Penicillium_lanosum, 35 Penicillium_olsonii, 36 Penicillium_paradoxum, 37 Penicillium_tularense, 38 Aspergillus_aculeatus, 39 Aspergillus_arenarius, 40 Aspergillus_avenaceus, 41 Aspergillus_candidus, 42 Aspergillus_coremiiformis, 43 Aspergillus_flavipes, 44 Aspergillus_flavus, 45 Aspergillus_janus, 46 Aspergillus_leporis, 47 Aspergillus_niger, 48 Aspergillus_ochraceus, 49 Aspergillus_oryzae, 50 Aspergillus_robustus, 51 Aspergillus_steynii, 52 Aspergillus_terreus, 53 Aspergillus_togoensis, 54 Aspergillus_cavernicola, 55 Aspergillus_biplanus, 56 Aspergillus_bisporus, 57 Aspergillus_calidoustus, 58 Aspergillus_conjunctus, 59 Aspergillus_egyptiacus, 60 Aspergillus_funiculosus, 61 Aspergillus_nidulans, 62 Aspergillus_ochraceoroseus, 63 Aspergillus_sparsus, 64 Aspergillus_sydowii, 65 Aspergillus_versicolor, 66 Aspergillus_cervinus, 67 Aspergillus_clavatus, 68 Aspergillus_fischeri, 69 Aspergillus_fumigatus, 70 Aspergillus_kanagawaensis, 71 Aspergillus_acanthosporus, 72 Aspergillus_brunneouniseriatus, 73 Aspergillus_pulvinus, 74 Aspergillus_wentii, 75 Aspergillus_glaucus, 76 Aspergillus_amstelodami, 77 Aspergillus_penicillioides, 78 Aspergillus_restrictus, 79 Hamigera_avellanea, 80 Hamigera_striata, 81 Penicillium_megasporum, 82 Talaromyces_leycettanus, 83 Warcupiella_spinulosa, 84 Aspergillus_zonatus, 85 Penicilliopsis_clavariiformis, 86 Monascus_purpureus, 87 Aspergillus_clavatoflavus, 88 Penicillium_arenicola, 89 Sclerocleista_ornata, 90 Sclerocleista_thaxteri, 91 Thermoascus_crustaceus, 92 Byssochlamys_nivea, 93 Byssochlamys_spectabilis, 94 Talaromyces_flavus, 95 Polypaecilum_insolitum, 96 Basipetospora_halophila; TREE tree_3 = [&R] ((82:0.115169,((((((((((((((1:0.106514,(14:0.0212,22:0.028757):0.081296):0.016308,2:0.110237):0.025119,(12:0.10593,29:0.123301):0.019366):0.028754,(4:0.11934,8:0.097053):0.115507):0.021677,13:0.072542):0.01612,(5:0.097586,15:0.096844):0.088782,(23:0.116034,24:0.158334):0.013033):0.013501,(((3:0.081914,10:0.04689):0.059699,((6:0.041161,25:0.044038):0.018077,19:0.104375):0.065824):0.015032,((((7:0.10225,26:0.083073):0.034935,11:0.163718):0.072334,(((16:0.061637,17:0.060569):0.0169,27:0.056274):0.063823,28:0.076137):0.040898):0.008958,21:0.15049):0.013388):0.010684):0.035297,((9:0.147564,18:0.132893):0.029754,20:0.154279):0.041108):0.025871,(30:0.093513,((((31:0.040493,33:0.049286):0.010157,32:0.030003):0.039025,36:0.089834):0.037984,(34:0.053077,(35:0.084295,37:0.081096):0.027539):0.038553):0.034082):0.077235):0.115027,(((((((38:0.157456,47:0.117471):0.037617,((43:0.116621,52:0.092836):0.026949,45:0.178444):0.036276):0.010644,(39:0.159384,41:0.171232):0.05776):0.01663,((40:0.1163,(((42:0.037208,53:0.040768):0.037027,(44:0.080573,49:5.01E-4):0.090764):0.034219,46:0.083038):0.04114):0.061707,((48:0.053545,51:0.064381):0.091862,50:0.143021):0.026931):0.01156):0.014115,((((((54:0.078261,59:0.102824):0.018993,(61:0.177935,(64:0.032041,65:0.026536):0.063747):0.038689):0.012987,57:0.111688):0.038577,56:0.107157):0.027285,(60:0.127072,62:0.124273):0.024022):0.019769,((55:0.136468,63:0.125442):0.037708,58:0.124332):0.018222):0.073437):0.014909,((66:0.027592,70:0.024642):0.139133,((67:0.040571,71:0.027824):0.086756,(68:0.014776,69:0.019338):0.089734):0.053638):0.046481):0.016047,((72:0.137121,(73:0.150549,74:0.113157):0.02058):0.036234,((((75:0.02779,76:0.045303):0.089572,78:0.134832):0.024526,77:0.105067):0.080807,(95:0.162489,96:0.147752):0.102303):0.011428):0.018421):0.014611):0.019459,((88:0.170512,(89:0.011252,90:0.014978):0.166864):0.03464,(91:0.172408,(92:0.078688,93:0.080796):0.103751):0.075077):0.019336):0.023203,83:0.139007):0.015253,(((79:0.10547,81:0.108603):0.013051,87:0.229817):0.012702,80:0.107598):0.012969,(84:0.175052,85:0.16522):0.060069):0.022144,86:0.227316):0.07362):0.199104,94:0.199104); END; BEGIN TREES; TITLE Aspergillus_monophyly_iqtree_partitioned_6_genes; LINK TAXA = Taxa1; TRANSLATE 1 Penicillium_hirayamae, 2 Penicillium_adametzii, 3 Penicillium_catenatum, 4 Penicillium_charlesii, 5 Penicillium_cinnamopurpureum, 6 Penicillium_citreonigrum, 7 Penicillium_citrinum, 8 Penicillium_coffeae, 9 Penicillium_cryptum, 10 Penicillium_dimorphosporum, 11 Penicillium_euglaucum, 12 Penicillium_glabrum, 13 Penicillium_griseolum, 14 Penicillium_herquei, 15 Penicillium_idahoense, 16 Penicillium_janthinellum, 17 Penicillium_javanicum, 18 Penicillium_lagena, 19 Penicillium_lapidosum, 20 Penicillium_lassenii, 21 Penicillium_macrosclerotiorum, 22 Penicillium_malachiteum, 23 Penicillium_ochrosalmoneum, 24 Penicillium_ramusculum, 25 Penicillium_restrictum, 26 Penicillium_shearii, 27 Penicillium_simplicissimum, 28 Penicillium_stolkiae, 29 Penicillium_thiersii, 30 Penicillium_canescens, 31 Penicillium_chrysogenum, 32 Penicillium_expansum, 33 Penicillium_griseofulvum, 34 Penicillium_lanosum, 35 Penicillium_olsonii, 36 Penicillium_paradoxum, 37 Penicillium_tularense, 38 Aspergillus_aculeatus, 39 Aspergillus_arenarius, 40 Aspergillus_avenaceus, 41 Aspergillus_candidus, 42 Aspergillus_coremiiformis, 43 Aspergillus_flavipes, 44 Aspergillus_flavus, 45 Aspergillus_janus, 46 Aspergillus_leporis, 47 Aspergillus_niger, 48 Aspergillus_ochraceus, 49 Aspergillus_oryzae, 50 Aspergillus_robustus, 51 Aspergillus_steynii, 52 Aspergillus_terreus, 53 Aspergillus_togoensis, 54 Aspergillus_cavernicola, 55 Aspergillus_biplanus, 56 Aspergillus_bisporus, 57 Aspergillus_calidoustus, 58 Aspergillus_conjunctus, 59 Aspergillus_egyptiacus, 60 Aspergillus_funiculosus, 61 Aspergillus_nidulans, 62 Aspergillus_ochraceoroseus, 63 Aspergillus_sparsus, 64 Aspergillus_sydowii, 65 Aspergillus_versicolor, 66 Aspergillus_cervinus, 67 Aspergillus_clavatus, 68 Aspergillus_fischeri, 69 Aspergillus_fumigatus, 70 Aspergillus_kanagawaensis, 71 Aspergillus_acanthosporus, 72 Aspergillus_brunneouniseriatus, 73 Aspergillus_pulvinus, 74 Aspergillus_wentii, 75 Aspergillus_glaucus, 76 Aspergillus_amstelodami, 77 Aspergillus_penicillioides, 78 Aspergillus_restrictus, 79 Hamigera_avellanea, 80 Hamigera_striata, 81 Penicillium_megasporum, 82 Talaromyces_leycettanus, 83 Warcupiella_spinulosa, 84 Aspergillus_zonatus, 85 Penicilliopsis_clavariiformis, 86 Monascus_purpureus, 87 Aspergillus_clavatoflavus, 88 Penicillium_arenicola, 89 Sclerocleista_ornata, 90 Sclerocleista_thaxteri, 91 Thermoascus_crustaceus, 92 Byssochlamys_nivea, 93 Byssochlamys_spectabilis, 94 Talaromyces_flavus, 95 Polypaecilum_insolitum, 96 Basipetospora_halophila; TREE tree_2 = [&R] (((91:0.206813,(92:0.091194,93:0.096777):0.122961):0.032381,((88:0.204309,(89:0.012286,90:0.017312):0.19793):0.043362,((((((79:0.116953,87:0.264984):0.023531,81:0.131281):0.017459,(80:0.118513,(82:0.217339,86:0.290618):0.019518):0.023063):0.022604,83:0.164699):0.017857,(84:0.193732,85:0.216827):0.063118):0.031543,((((((((38:0.188721,47:0.135851):0.041411,(39:0.192847,41:0.197247):0.064098):0.012584,((43:0.137294,52:0.11182):0.031505,45:0.218996):0.04086):0.021868,((40:0.140127,(((42:0.043428,53:0.045574):0.043882,(44:0.092819,49:2.0E-6):0.109381):0.038788,46:0.098676):0.049233):0.076678,((48:0.064013,51:0.072685):0.111718,50:0.174893):0.023898):0.015488):0.012305,((((((54:0.093155,59:0.119703):0.021339,(61:0.218605,(64:0.034966,65:0.030443):0.074363):0.04435):0.017797,57:0.133072):0.042846,56:0.126852):0.033935,(60:0.146705,62:0.14722):0.031836):0.022516,((55:0.164892,63:0.153245):0.047788,58:0.150715):0.02155):0.088654):0.015093,((66:0.030765,70:0.029515):0.176039,((67:0.044359,71:0.032326):0.103486,(68:0.016208,69:0.021259):0.10674):0.060111):0.059216):0.021125,((72:0.171123,(73:0.184663,74:0.135476):0.022309):0.051597,((((75:0.032422,76:0.051956):0.105418,78:0.168051):0.026827,77:0.131796):0.096647,(95:0.201579,96:0.177079):0.122801):0.008925):0.024448):0.015923,((30:0.106468,((((31:0.044728,33:0.05469):0.010518,32:0.033373):0.043092,36:0.103032):0.043651,(34:0.058513,(35:0.096213,37:0.090784):0.031634):0.047757):0.040847):0.092123,(((9:0.173993,18:0.152594):0.035037,20:0.177699):0.045188,((((3:0.092957,10:0.052344):0.06724,((6:0.044245,25:0.049486):0.022944,19:0.119673):0.071703):0.018754,((((7:0.120028,26:0.09325):0.040643,11:0.193718):0.083648,(((16:0.068986,17:0.068063):0.019395,27:0.0611):0.074256,28:0.088943):0.042964):0.010724,21:0.182242):0.014323):0.013775,(((5:0.116674,15:0.109668):0.099804,(23:0.130126,24:0.181113):0.01573):0.005862,(13:0.084489,((4:0.140651,8:0.113396):0.136577,((12:0.12353,29:0.145849):0.022085,(2:0.132971,(1:0.131057,(14:0.022861,22:0.03208):0.089427):0.018334):0.02862):0.031114):0.023394):0.019026):0.014669):0.041564):0.030184):0.131405):0.018451):0.020108):0.068026):0.248085,94:0.248085); END; BEGIN TREES; TITLE Aspergillus_monophyly_raxml_partitioned_6_genes; LINK TAXA = Taxa1; TRANSLATE 1 Penicillium_hirayamae, 2 Penicillium_adametzii, 3 Penicillium_catenatum, 4 Penicillium_charlesii, 5 Penicillium_cinnamopurpureum, 6 Penicillium_citreonigrum, 7 Penicillium_citrinum, 8 Penicillium_coffeae, 9 Penicillium_cryptum, 10 Penicillium_dimorphosporum, 11 Penicillium_euglaucum, 12 Penicillium_glabrum, 13 Penicillium_griseolum, 14 Penicillium_herquei, 15 Penicillium_idahoense, 16 Penicillium_janthinellum, 17 Penicillium_javanicum, 18 Penicillium_lagena, 19 Penicillium_lapidosum, 20 Penicillium_lassenii, 21 Penicillium_macrosclerotiorum, 22 Penicillium_malachiteum, 23 Penicillium_ochrosalmoneum, 24 Penicillium_ramusculum, 25 Penicillium_restrictum, 26 Penicillium_shearii, 27 Penicillium_simplicissimum, 28 Penicillium_stolkiae, 29 Penicillium_thiersii, 30 Penicillium_canescens, 31 Penicillium_chrysogenum, 32 Penicillium_expansum, 33 Penicillium_griseofulvum, 34 Penicillium_lanosum, 35 Penicillium_olsonii, 36 Penicillium_paradoxum, 37 Penicillium_tularense, 38 Aspergillus_aculeatus, 39 Aspergillus_arenarius, 40 Aspergillus_avenaceus, 41 Aspergillus_candidus, 42 Aspergillus_coremiiformis, 43 Aspergillus_flavipes, 44 Aspergillus_flavus, 45 Aspergillus_janus, 46 Aspergillus_leporis, 47 Aspergillus_niger, 48 Aspergillus_ochraceus, 49 Aspergillus_oryzae, 50 Aspergillus_robustus, 51 Aspergillus_steynii, 52 Aspergillus_terreus, 53 Aspergillus_togoensis, 54 Aspergillus_cavernicola, 55 Aspergillus_biplanus, 56 Aspergillus_bisporus, 57 Aspergillus_calidoustus, 58 Aspergillus_conjunctus, 59 Aspergillus_egyptiacus, 60 Aspergillus_funiculosus, 61 Aspergillus_nidulans, 62 Aspergillus_ochraceoroseus, 63 Aspergillus_sparsus, 64 Aspergillus_sydowii, 65 Aspergillus_versicolor, 66 Aspergillus_cervinus, 67 Aspergillus_clavatus, 68 Aspergillus_fischeri, 69 Aspergillus_fumigatus, 70 Aspergillus_kanagawaensis, 71 Aspergillus_acanthosporus, 72 Aspergillus_brunneouniseriatus, 73 Aspergillus_pulvinus, 74 Aspergillus_wentii, 75 Aspergillus_glaucus, 76 Aspergillus_amstelodami, 77 Aspergillus_penicillioides, 78 Aspergillus_restrictus, 79 Hamigera_avellanea, 80 Hamigera_striata, 81 Penicillium_megasporum, 82 Talaromyces_leycettanus, 83 Warcupiella_spinulosa, 84 Aspergillus_zonatus, 85 Penicilliopsis_clavariiformis, 86 Monascus_purpureus, 87 Aspergillus_clavatoflavus, 88 Penicillium_arenicola, 89 Sclerocleista_ornata, 90 Sclerocleista_thaxteri, 91 Thermoascus_crustaceus, 92 Byssochlamys_nivea, 93 Byssochlamys_spectabilis, 94 Talaromyces_flavus, 95 Polypaecilum_insolitum, 96 Basipetospora_halophila; TREE tree_5 = [&R] (((91:0.416252,(92:0.17095,93:0.177719):0.23163):0.061707,(((89:0.026298,90:0.027545):0.380514,88:0.367311):0.078529,((86:0.544785,((84:0.430863,85:0.363277):0.132144,((82:0.417084,80:0.216719):0.048803,(83:0.328579,(81:0.247834,(79:0.221447,87:0.484972):0.031277):0.024375):0.033791):0.017655):0.03786):0.042052,(((((((55:0.304108,63:0.273792):0.090174,58:0.294604):0.032423,((60:0.283591,62:0.275783):0.049496,((57:0.253577,((59:0.23589,54:0.184462):0.041554,(61:0.413382,(65:0.053181,64:0.065629):0.144169):0.081485):0.032002):0.088192,56:0.246941):0.071792):0.055177):0.192758,(((41:0.43553,39:0.381416):0.135947,(((52:0.229411,45:0.397324):0.049502,43:0.2761):0.11097,(38:0.351983,47:0.274297):0.085097):0.016467):0.044607,((50:0.317594,(48:0.11474,51:0.146769):0.238866):0.057393,((46:0.164086,((44:0.164352,49:1.0E-6):0.197649,(42:0.078781,53:0.080535):0.080591):0.074708):0.080899,40:0.271707):0.132767):0.027855):0.034656):0.031156,((66:0.052734,70:0.052282):0.296188,((67:0.08429,71:0.056958):0.204599,(68:0.029712,69:0.036723):0.190946):0.115873):0.096844):0.04003,(((95:0.355115,96:0.357934):0.217722,(77:0.228952,(78:0.295519,(75:0.060722,76:0.092348):0.212671):0.054948):0.179345):0.019839,(72:0.303279,(73:0.334321,74:0.247815):0.03949):0.087538):0.035487):0.029499,(((((21:0.364536,((28:0.175007,(27:0.120712,(17:0.129683,16:0.141792):0.040148):0.154401):0.09224,(11:0.403646,(7:0.225134,26:0.18273):0.070473):0.176328):0.017619):0.030597,((10:0.097849,3:0.176588):0.13197,((25:0.089025,6:0.090314):0.038818,19:0.244439):0.151274):0.041002):0.021889,(((13:0.171845,((4:0.254124,8:0.229177):0.274313,((29:0.271434,12:0.241016):0.043659,(2:0.237665,(1:0.235795,(22:0.058778,14:0.043417):0.176229):0.032206):0.051074):0.05858):0.047105):0.031275,(5:0.229092,15:0.212967):0.202185):0.0126,(24:0.355299,23:0.245749):0.03039):0.028002):0.07715,(20:0.350525,(9:0.347628,18:0.297557):0.07751):0.095421):0.048403,(30:0.215161,((36:0.190523,(33:0.093038,(32:0.072281,31:0.085145):0.017119):0.082427):0.083496,((35:0.181154,37:0.174245):0.058517,34:0.112485):0.090438):0.081138):0.20026):0.279698):0.036417):0.037544):0.14362):0.436864,94:0.436864); END; BEGIN TREES; TITLE Aspergillus_monophyly_iqtree_6_genes; LINK TAXA = Taxa1; TRANSLATE 1 Penicillium_hirayamae, 2 Penicillium_adametzii, 3 Penicillium_catenatum, 4 Penicillium_charlesii, 5 Penicillium_cinnamopurpureum, 6 Penicillium_citreonigrum, 7 Penicillium_citrinum, 8 Penicillium_coffeae, 9 Penicillium_cryptum, 10 Penicillium_dimorphosporum, 11 Penicillium_euglaucum, 12 Penicillium_glabrum, 13 Penicillium_griseolum, 14 Penicillium_herquei, 15 Penicillium_idahoense, 16 Penicillium_janthinellum, 17 Penicillium_javanicum, 18 Penicillium_lagena, 19 Penicillium_lapidosum, 20 Penicillium_lassenii, 21 Penicillium_macrosclerotiorum, 22 Penicillium_malachiteum, 23 Penicillium_ochrosalmoneum, 24 Penicillium_ramusculum, 25 Penicillium_restrictum, 26 Penicillium_shearii, 27 Penicillium_simplicissimum, 28 Penicillium_stolkiae, 29 Penicillium_thiersii, 30 Penicillium_canescens, 31 Penicillium_chrysogenum, 32 Penicillium_expansum, 33 Penicillium_griseofulvum, 34 Penicillium_lanosum, 35 Penicillium_olsonii, 36 Penicillium_paradoxum, 37 Penicillium_tularense, 38 Aspergillus_aculeatus, 39 Aspergillus_arenarius, 40 Aspergillus_avenaceus, 41 Aspergillus_candidus, 42 Aspergillus_coremiiformis, 43 Aspergillus_flavipes, 44 Aspergillus_flavus, 45 Aspergillus_janus, 46 Aspergillus_leporis, 47 Aspergillus_niger, 48 Aspergillus_ochraceus, 49 Aspergillus_oryzae, 50 Aspergillus_robustus, 51 Aspergillus_steynii, 52 Aspergillus_terreus, 53 Aspergillus_togoensis, 54 Aspergillus_cavernicola, 55 Aspergillus_biplanus, 56 Aspergillus_bisporus, 57 Aspergillus_calidoustus, 58 Aspergillus_conjunctus, 59 Aspergillus_egyptiacus, 60 Aspergillus_funiculosus, 61 Aspergillus_nidulans, 62 Aspergillus_ochraceoroseus, 63 Aspergillus_sparsus, 64 Aspergillus_sydowii, 65 Aspergillus_versicolor, 66 Aspergillus_cervinus, 67 Aspergillus_clavatus, 68 Aspergillus_fischeri, 69 Aspergillus_fumigatus, 70 Aspergillus_kanagawaensis, 71 Aspergillus_acanthosporus, 72 Aspergillus_brunneouniseriatus, 73 Aspergillus_pulvinus, 74 Aspergillus_wentii, 75 Aspergillus_glaucus, 76 Aspergillus_amstelodami, 77 Aspergillus_penicillioides, 78 Aspergillus_restrictus, 79 Hamigera_avellanea, 80 Hamigera_striata, 81 Penicillium_megasporum, 82 Talaromyces_leycettanus, 83 Warcupiella_spinulosa, 84 Aspergillus_zonatus, 85 Penicilliopsis_clavariiformis, 86 Monascus_purpureus, 87 Aspergillus_clavatoflavus, 88 Penicillium_arenicola, 89 Sclerocleista_ornata, 90 Sclerocleista_thaxteri, 91 Thermoascus_crustaceus, 92 Byssochlamys_nivea, 93 Byssochlamys_spectabilis, 94 Talaromyces_flavus, 95 Polypaecilum_insolitum, 96 Basipetospora_halophila; TREE tree_1 = [&R] (((91:0.207706,(92:0.090478,93:0.098336):0.123669):0.033946,((88:0.204663,(89:0.012937,90:0.016571):0.193196):0.045189,(((((((79:0.110414,87:0.269591):0.022119,81:0.131464):0.016548,80:0.132373):0.019071,83:0.162861):0.012505,(84:0.203136,85:0.213363):0.066482):0.015873,(82:0.220847,86:0.287354):0.022714):0.030781,((((((((38:0.188476,47:0.135303):0.040901,(39:0.192311,41:0.195786):0.065083):0.012855,((43:0.135623,52:0.11182):0.031065,45:0.218287):0.039732):0.020027,((40:0.139962,(((42:0.043975,53:0.045368):0.043789,(44:0.093847,49:2.0E-6):0.109875):0.038416,46:0.099044):0.049156):0.075498,((48:0.063857,51:0.072437):0.111365,50:0.17359):0.024092):0.016407):0.012222,((((((54:0.092115,59:0.12023):0.020742,(61:0.217431,(64:0.03538,65:0.030485):0.074955):0.043157):0.017753,57:0.132605):0.042012,56:0.128566):0.032642,(60:0.149463,62:0.148168):0.031029):0.021484,((55:0.167635,63:0.153515):0.046857,58:0.148601):0.022378):0.088211):0.015267,((66:0.031093,70:0.02985):0.176107,((67:0.044679,71:0.032494):0.104714,(68:0.016342,69:0.021453):0.105813):0.059655):0.058014):0.02059,(((72:0.170113,(73:0.183375,74:0.135198):0.022459):0.043303,(95:0.201881,96:0.178136):0.122426):0.011015,(((75:0.032684,76:0.050682):0.101519,78:0.166831):0.027582,77:0.133466):0.100621):0.021113):0.012222,((30:0.1091,((((31:0.045363,33:0.055527):0.010067,32:0.034175):0.04394,36:0.103626):0.043801,(34:0.059088,(35:0.096618,37:0.092304):0.032123):0.047997):0.040833):0.093728,(((9:0.174049,18:0.153308):0.03451,20:0.180584):0.046747,((((3:0.094607,10:0.052382):0.067299,((6:0.044677,25:0.050203):0.02362,19:0.120297):0.072607):0.019382,((((7:0.120244,26:0.094709):0.041313,11:0.194643):0.084318,(((16:0.069842,17:0.068691):0.020066,27:0.06088):0.074033,28:0.08976):0.043031):0.010735,21:0.184927):0.01395):0.013516,(((5:0.11776,15:0.111661):0.101335,(23:0.131499,24:0.182105):0.015964):0.006438,(13:0.086125,((4:0.139958,8:0.117744):0.13554,((12:0.123107,29:0.147358):0.022098,(2:0.134277,(1:0.132345,(14:0.023067,22:0.032447):0.090395):0.018004):0.029391):0.032066):0.023238):0.018726):0.015433):0.042341):0.026186):0.134558):0.019692):0.021135):0.067025):0.243902,94:0.243901); END; BEGIN TREES; TITLE Aspergillus_monophyly_raxml_6_genes; LINK TAXA = Taxa1; TRANSLATE 1 Penicillium_hirayamae, 2 Penicillium_adametzii, 3 Penicillium_catenatum, 4 Penicillium_charlesii, 5 Penicillium_cinnamopurpureum, 6 Penicillium_citreonigrum, 7 Penicillium_citrinum, 8 Penicillium_coffeae, 9 Penicillium_cryptum, 10 Penicillium_dimorphosporum, 11 Penicillium_euglaucum, 12 Penicillium_glabrum, 13 Penicillium_griseolum, 14 Penicillium_herquei, 15 Penicillium_idahoense, 16 Penicillium_janthinellum, 17 Penicillium_javanicum, 18 Penicillium_lagena, 19 Penicillium_lapidosum, 20 Penicillium_lassenii, 21 Penicillium_macrosclerotiorum, 22 Penicillium_malachiteum, 23 Penicillium_ochrosalmoneum, 24 Penicillium_ramusculum, 25 Penicillium_restrictum, 26 Penicillium_shearii, 27 Penicillium_simplicissimum, 28 Penicillium_stolkiae, 29 Penicillium_thiersii, 30 Penicillium_canescens, 31 Penicillium_chrysogenum, 32 Penicillium_expansum, 33 Penicillium_griseofulvum, 34 Penicillium_lanosum, 35 Penicillium_olsonii, 36 Penicillium_paradoxum, 37 Penicillium_tularense, 38 Aspergillus_aculeatus, 39 Aspergillus_arenarius, 40 Aspergillus_avenaceus, 41 Aspergillus_candidus, 42 Aspergillus_coremiiformis, 43 Aspergillus_flavipes, 44 Aspergillus_flavus, 45 Aspergillus_janus, 46 Aspergillus_leporis, 47 Aspergillus_niger, 48 Aspergillus_ochraceus, 49 Aspergillus_oryzae, 50 Aspergillus_robustus, 51 Aspergillus_steynii, 52 Aspergillus_terreus, 53 Aspergillus_togoensis, 54 Aspergillus_cavernicola, 55 Aspergillus_biplanus, 56 Aspergillus_bisporus, 57 Aspergillus_calidoustus, 58 Aspergillus_conjunctus, 59 Aspergillus_egyptiacus, 60 Aspergillus_funiculosus, 61 Aspergillus_nidulans, 62 Aspergillus_ochraceoroseus, 63 Aspergillus_sparsus, 64 Aspergillus_sydowii, 65 Aspergillus_versicolor, 66 Aspergillus_cervinus, 67 Aspergillus_clavatus, 68 Aspergillus_fischeri, 69 Aspergillus_fumigatus, 70 Aspergillus_kanagawaensis, 71 Aspergillus_acanthosporus, 72 Aspergillus_brunneouniseriatus, 73 Aspergillus_pulvinus, 74 Aspergillus_wentii, 75 Aspergillus_glaucus, 76 Aspergillus_amstelodami, 77 Aspergillus_penicillioides, 78 Aspergillus_restrictus, 79 Hamigera_avellanea, 80 Hamigera_striata, 81 Penicillium_megasporum, 82 Talaromyces_leycettanus, 83 Warcupiella_spinulosa, 84 Aspergillus_zonatus, 85 Penicilliopsis_clavariiformis, 86 Monascus_purpureus, 87 Aspergillus_clavatoflavus, 88 Penicillium_arenicola, 89 Sclerocleista_ornata, 90 Sclerocleista_thaxteri, 91 Thermoascus_crustaceus, 92 Byssochlamys_nivea, 93 Byssochlamys_spectabilis, 94 Talaromyces_flavus, 95 Polypaecilum_insolitum, 96 Basipetospora_halophila; TREE tree_4 = [&R] (((91:0.207181,(92:0.090261,93:0.09833):0.123501):0.033822,((88:0.204086,(89:0.012898,90:0.016594):0.192941):0.045501,(((((77:0.132435,((75:0.032614,76:0.050697):0.101521,78:0.166472):0.02805):0.098614,((95:0.203075,96:0.176274):0.122257,(74:0.143235,(73:0.180561,72:0.160723):0.023351):0.043855):0.011833):0.021421,((((((52:0.111611,43:0.135374):0.030872,45:0.218124):0.039816,((41:0.195347,39:0.191895):0.064991,(47:0.135087,38:0.188215):0.040965):0.012784):0.019877,(((48:0.063795,51:0.072316):0.110945,50:0.173238):0.024069,(40:0.139739,(46:0.098841,((49:1.0E-6,44:0.093747):0.109752,(42:0.04394,53:0.04532):0.04371):0.038461):0.049128):0.07559):0.016224):0.012185,(((63:0.153261,55:0.167455):0.046825,58:0.148487):0.022201,((60:0.149296,62:0.147879):0.031047,(56:0.128461,(57:0.132463,((61:0.21714,(64:0.035398,65:0.030451):0.074886):0.043153,(59:0.12017,54:0.091994):0.020732):0.017765):0.041978):0.03255):0.021612):0.088137):0.014936,((66:0.031102,70:0.029799):0.175649,((69:0.021479,68:0.016293):0.105922,(71:0.032476,67:0.044651):0.104252):0.060024):0.05791):0.020947):0.011766,((30:0.109057,(((35:0.096527,37:0.092225):0.032029,34:0.05912):0.048099,(36:0.103599,(32:0.03419,(31:0.045326,33:0.055489):0.010052):0.043832):0.043623):0.040722):0.092746,(((((13:0.085502,((8:0.117667,4:0.139678):0.135095,((29:0.146934,12:0.123104):0.022393,(2:0.133937,(1:0.132261,(22:0.032379,14:0.02311):0.090396):0.017919):0.029053):0.03223):0.023587):0.01749,(23:0.131838,24:0.182136):0.019438):0.004913,(15:0.111798,5:0.117603):0.102815):0.013982,(((((26:0.09469,7:0.119986):0.041187,11:0.194352):0.084413,(28:0.089643,(27:0.060814,(16:0.069799,17:0.068601):0.020056):0.073922):0.042844):0.010636,21:0.184819):0.013654,((19:0.120152,(6:0.044683,25:0.050121):0.02367):0.072443,(10:0.052503,3:0.094341):0.067187):0.019631):0.013203):0.042446,(20:0.180924,(18:0.153576,9:0.173367):0.034464):0.046223):0.02652):0.134098):0.020761,(((84:0.202678,85:0.213099):0.06609,(83:0.162361,(80:0.132303,(81:0.131298,(87:0.269246,79:0.110335):0.021986):0.016478):0.019021):0.012835):0.015786,(82:0.220459,86:0.287124):0.022751):0.030381):0.021094):0.066647):0.243676,94:0.243676); END;