#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:16 GMT TreeBASE (cc) 1994-2008 Study reference: Ota Y., & Hattori T. 2008. Relationships among three Japanese Laetiporus taxa based on phylogenetic analysis and incompatibility tests. Mycoscience, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2053] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=49; TAXLABELS Laetiporus_sulphureus_var._miniatus_FH1108 Laetiporus_sulphureus_var._miniatus_FH1122 Laetiporus_sulphureus_var._miniatus_FH1206 Laetiporus_sulphureus_var._miniatus_FH1259 Laetiporus_sulphureus_var._miniatus_FH1292 Laetiporus_sulphureus_var._miniatus_FH1343 Laetiporus_sulphureus_var._miniatus_FH1379 Laetiporus_sulphureus_var._miniatus_FH1387 Laetiporus_sulphureus_var._miniatus_L114s1 Laetiporus_sulphureus_var._miniatus_L23s4 Laetiporus_sulphureus_var._miniatus_L24 Laetiporus_sulphureus_var._miniatus_L27s4 Laetiporus_sulphureus_var._miniatus_L34s2 Laetiporus_sulphureus_var._miniatus_L39 Laetiporus_sulphureus_var._miniatus_L42s9 Laetiporus_sulphureus_var._miniatus_L43s4 Laetiporus_sulphureus_var._miniatus_L67s5 Laetiporus_sulphureus_var._miniatus_L72s1 Laetiporus_sulphureus_var._miniatus_WD1058 Laetiporus_sulphureus_var._miniatus_WD1061 Laetiporus_sulphureus_var._miniatus_WD1062 Laetiporus_sulphureus_var._miniatus_WD1063 Laetiporus_sulphureus_var._miniatus_WD2090 Laetiporus_sulphureus_var._miniatus_WD3 Laetiporus_sulphureus_var._miniatus_WD723 Laetiporus_sulphureus_var._miniatus_WD728 Laetiporus_sulphureus_var._sulphureus_auct._jap._L32 Laetiporus_sulphureus_var._sulphureus_auct._jap._L35a Laetiporus_sulphureus_var._sulphureus_auct._jap._L35b Laetiporus_sulphureus_var._sulphureus_auct._jap._L46s20 Laetiporus_sulphureus_var._sulphureus_auct._jap._L47 Laetiporus_sulphureus_var._sulphureus_auct._jap._L48 Laetiporus_sulphureus_var._sulphureus_auct._jap._L50s5 Laetiporus_sulphureus_var._sulphureus_auct._jap._L51 Laetiporus_sulphureus_var._sulphureus_auct._jap._L54s7 Laetiporus_sulphureus_var._sulphureus_auct._jap._L55s6 Laetiporus_sulphureus_var._sulphureus_auct._jap._L68s6 Laetiporus_sulphureus_var._sulphureus_auct._jap._L85s1 Laetiporus_sulphureus_var._sulphureus_auct._jap._L90s3 Laetiporus_sulphureus_var._sulphureus_auct._jap._L97a Laetiporus_sulphureus_var._sulphureus_auct._jap._L97b Laetiporus_sulphureus_var._sulphureus_auct._jap._WD1991 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD2024 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD2099 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD820 Laetiporus_versisporus_L49 Laetiporus_versisporus_L5 Laetiporus_versisporus_WD153 Laetiporus_versisporus_WD2073 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=62; TAXLABELS Laetiporus_sulphureus_var._miniatus_FH1019 Laetiporus_sulphureus_var._miniatus_FH1108 Laetiporus_sulphureus_var._miniatus_FH1122 Laetiporus_sulphureus_var._miniatus_FH1206 Laetiporus_sulphureus_var._miniatus_FH1259 Laetiporus_sulphureus_var._miniatus_FH1292 Laetiporus_sulphureus_var._miniatus_FH1343 Laetiporus_sulphureus_var._miniatus_FH1379 Laetiporus_sulphureus_var._miniatus_FH1387 Laetiporus_sulphureus_var._miniatus_L114s1 Laetiporus_sulphureus_var._miniatus_L13 Laetiporus_sulphureus_var._miniatus_L23s4 Laetiporus_sulphureus_var._miniatus_L24 Laetiporus_sulphureus_var._miniatus_L27s4 Laetiporus_sulphureus_var._miniatus_L34s2 Laetiporus_sulphureus_var._miniatus_L39 Laetiporus_sulphureus_var._miniatus_L42s9 Laetiporus_sulphureus_var._miniatus_L43s4 Laetiporus_sulphureus_var._miniatus_L44 Laetiporus_sulphureus_var._miniatus_L66 Laetiporus_sulphureus_var._miniatus_L67s5 Laetiporus_sulphureus_var._miniatus_L72s1 Laetiporus_sulphureus_var._miniatus_WD1058 Laetiporus_sulphureus_var._miniatus_WD1061 Laetiporus_sulphureus_var._miniatus_WD1062 Laetiporus_sulphureus_var._miniatus_WD1063 Laetiporus_sulphureus_var._miniatus_WD2090 Laetiporus_sulphureus_var._miniatus_WD3a Laetiporus_sulphureus_var._miniatus_WD3b Laetiporus_sulphureus_var._miniatus_WD723a Laetiporus_sulphureus_var._miniatus_WD723b Laetiporus_sulphureus_var._miniatus_WD723c Laetiporus_sulphureus_var._miniatus_WD728 Laetiporus_sulphureus_var._sulphureus_auct._jap._L32 Laetiporus_sulphureus_var._sulphureus_auct._jap._L35 Laetiporus_sulphureus_var._sulphureus_auct._jap._L46s20 Laetiporus_sulphureus_var._sulphureus_auct._jap._L47 Laetiporus_sulphureus_var._sulphureus_auct._jap._L48 Laetiporus_sulphureus_var._sulphureus_auct._jap._L50s5 Laetiporus_sulphureus_var._sulphureus_auct._jap._L51a Laetiporus_sulphureus_var._sulphureus_auct._jap._L51b Laetiporus_sulphureus_var._sulphureus_auct._jap._L51c Laetiporus_sulphureus_var._sulphureus_auct._jap._L51d Laetiporus_sulphureus_var._sulphureus_auct._jap._L51e Laetiporus_sulphureus_var._sulphureus_auct._jap._L54s7 Laetiporus_sulphureus_var._sulphureus_auct._jap._L55s6 Laetiporus_sulphureus_var._sulphureus_auct._jap._L68s6 Laetiporus_sulphureus_var._sulphureus_auct._jap._L85s1 Laetiporus_sulphureus_var._sulphureus_auct._jap._L90s3 Laetiporus_sulphureus_var._sulphureus_auct._jap._L97a Laetiporus_sulphureus_var._sulphureus_auct._jap._L97b Laetiporus_sulphureus_var._sulphureus_auct._jap._WD1991 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD2024 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD2099 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD820 Laetiporus_versisporus_L49 Laetiporus_versisporus_L5a Laetiporus_versisporus_L5b Laetiporus_versisporus_PRC17 Laetiporus_versisporus_WD153a Laetiporus_versisporus_WD153b Laetiporus_versisporus_WD2073 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=22; TAXLABELS Laetiporus_sulphureus_var._miniatus_FH1019 Laetiporus_sulphureus_var._miniatus_FH1122 Laetiporus_sulphureus_var._miniatus_FH1206 Laetiporus_sulphureus_var._miniatus_L114s1 Laetiporus_sulphureus_var._miniatus_L23s4 Laetiporus_sulphureus_var._miniatus_L24 Laetiporus_sulphureus_var._miniatus_L27s4 Laetiporus_sulphureus_var._miniatus_L34s2 Laetiporus_sulphureus_var._miniatus_L43s4 Laetiporus_sulphureus_var._miniatus_L67s5 Laetiporus_sulphureus_var._miniatus_L72s1 Laetiporus_sulphureus_var._miniatus_WD1058 Laetiporus_sulphureus_var._sulphureus_auct._jap._L50s5 Laetiporus_sulphureus_var._sulphureus_auct._jap._L54s7 Laetiporus_sulphureus_var._sulphureus_auct._jap._L68s6 Laetiporus_sulphureus_var._sulphureus_auct._jap._L85s1 Laetiporus_sulphureus_var._sulphureus_auct._jap._L90s3 Laetiporus_sulphureus_var._sulphureus_auct._jap._L97a Laetiporus_sulphureus_var._sulphureus_auct._jap._L97b Laetiporus_sulphureus_var._sulphureus_auct._jap._WD820 Laetiporus_versisporus_L5 Laetiporus_versisporus_WD153 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3176] TITLE EF; LINK TAXA = Taxa1; DIMENSIONS NCHAR=581; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Laetiporus_sulphureus_var._miniatus_FH1108 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTACTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTT{CT}GTACTCTTCAAGTTGTTCTCTGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACACGATTCTCT{AG}AATCATATTGACAA{CT}CTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTG{CT}TCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_FH1122 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_FH1206 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTACTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTCGTACTCTTCAAGTTGTTCTCTGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACACGATTCTCTAAATCATATTGACAACCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGCTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_FH1259 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCAT{CT}AACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGG{CT}GCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAA{CT}CATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_FH1292 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCAT{CT}AACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGA{CT}CGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAA{AG}GTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_FH1343 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGG{CT}GCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_FH1379 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTACTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTCGTACTCTTCAAGTTGTTCTCTGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACACGATTCTCTAAATCATATTGACAACCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGCTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_FH1387 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGA{CT}CGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAA{AG}GTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_L114s1 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTACTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTCGTACTCTTCAAGTTGTTCTCTGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACACGATTCTCTAAATCATATTGACAACCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGCTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_L23s4 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTACTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTCGTACTCTTCAAGTTGTTCTCTGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACACGATTCTCTAAATCATATTGACAACCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGCTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_L24 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_L27s4 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTACTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTCGTACTCTTCAAGTTGTTCTCTGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACACGATTCTCTAAATCATATTGACAACCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGCTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_L34s2 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_L39 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCAT{CT}AACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGG{CT}GCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAA{CT}CATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_L42s9 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGATCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAAAGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_L43s4 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_L67s5 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_L72s1 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_WD1058 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTACTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTT{CT}GTACTCTTCAAGTTGTTCTCTGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACACGATTCTCT{AG}AATCATATTGACAA{CT}CTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTG{CT}TCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_WD1061 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGA{CT}CGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAA{AG}GTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_WD1062 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTACTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTCGTACTCTTCAAGTTGTTCTCTGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACACGATTCTCTAAATCATATTGACAACCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGCTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_WD1063 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTACTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTCGTACTCTTCAAGTTGTTCTCTGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACACGATTCTCTAAATCATATTGACAACCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGCTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_WD2090 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTACTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTCGTACTCTTCAAGTTGTTCTCTGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACACGATTCTCTAAATCATATTGACAACCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGCTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_WD3 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_WD723 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGA{CT}CGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAA{AG}GTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._miniatus_WD728 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCATGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTGTTCAAGTTGGTCTCTGGTGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAACCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L32 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L35a CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L35b CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCTGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L46s20 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L47 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L48 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L50s5 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L51 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L54s7 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTTGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L55s6 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L68s6 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L85s1 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTACTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCTGGTGTTGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L90s3 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L97a CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGGGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTCGTACTCTTCGAGTCGTTCTCCGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACATTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTATGTACACGTCACTCGATTCTCTGAATCATGTTGACAATCTCAAACTCGTTCAGCATGCCATGGTACAAAGGTTGGACCAAAGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATTGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._L97b CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._WD1991 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._WD2024 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._WD2099 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_sulphureus_var._sulphureus_auct._jap._WD820 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGGGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTCGTACTCTTCGAGTCGTTCTCCGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACATTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTATGTACACGTCACTCGATTCTCTGAATCATGTTGACAATCTCAAACTCGTTCAGCATGCCATGGTACAAAGGTTGGACCAAAGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATTGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_versisporus_L49 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_versisporus_L5 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT Laetiporus_versisporus_WD153 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGGGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTCGTACTCTTCGAGTCGTTCTCCGTCGCTCATACTGACCGAACCACTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACATTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTATGTACACGTCACTCGATTCTCTGAATCATGTTGACAATCTCAAACTCGTTCAGCATGCCATGGTACAAAGGTTGGACCAAAGAGACCAAGGCTGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATTGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGATGTCTACAAGATCGGTGGT Laetiporus_versisporus_WD2073 CAAGAACATGATCACCGGTACCTCGCAGGCTGACTGCGCTATCCTTATCATTGCCGCTGGTACTGGTGAGTTCGAGGCCGGTATTTCCAAGGACGGCCAGACTCGCGAGCACGCTCTGCTTGCCTTCACCCTTGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACCAAAGTTTGTACTCTTCAAGTTGTTCTCTGTCGTTCATACTGACCGAACCGCTGCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATCAAGAAGGTGGGCTACAACCCGAAGGCGGTACCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCCCCAAGTATGTATACGTTGGTCGATTCTCTGAATCATATTGACAATCTTCAACCCGTTCAGCATGCCATGGTACAAGGGTTGGACCAAGGAGACCAAGGCAGGTGTCGTCAAGGGAAAGACCCTCCTCGATGCCATTGACGCCATCGAGCCACCCGTTCGTCCTTCCGACAAGCCTCTCCGTCTCCCCCTCCAGGACGTCTACAAGATCGGTGGT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = EF) = N: 1-581; CODONPOSSET CodonPositions (CHARACTERS = EF) = N: 1-581; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3178] TITLE btub; LINK TAXA = Taxa3; DIMENSIONS NCHAR=419; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Laetiporus_sulphureus_var._miniatus_FH1019 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCCGACGTGATGTCACGACGTGACAATCGCGTTGCGTGACGGGCATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATTTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._miniatus_FH1122 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACAGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGAACGGGATGTCACGATGTGACAGTCGCGCTGCGTGACGGGTATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATCTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCCGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCAGTACTT Laetiporus_sulphureus_var._miniatus_FH1206 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTCACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCCGACGTGATGTCACGACGTGACAATCGCGTTGCGTGACGGGCATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATTTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._miniatus_L114s1 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCCGACGTGATGTCACGACGTGACAATCGCGTTGCGTGACGGGCATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATTTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._miniatus_L23s4 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCCGACGTGATGTCACGACGTGACAATCGCGTTGCGTGACGGGCATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATTTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTTAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._miniatus_L24 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACAGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGAACGGGATGTCACGATGTGACAGTCGCGCTGCGTGACGGGTATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATCTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCCGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCAGTACTT Laetiporus_sulphureus_var._miniatus_L27s4 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTCACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCCGACGTGATGTCACGACGTGACAATCGCGTTGCGTGACGGGCATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATTTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTTAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._miniatus_L34s2 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACAGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGAACGGGATGTCACGATGTGACAGTCGCGTTGCGTGACGGGTATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATCTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCCGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCAGTACTT Laetiporus_sulphureus_var._miniatus_L43s4 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACAGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGAACGGGATGTCACGATGTGACAGTCGCGTTGCGTGACGGGTATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATTTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCCGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCAGTACTT Laetiporus_sulphureus_var._miniatus_L67s5 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACAGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGAACGGGATGTCACGATGTGACAGTCGCGCTGCGTGACGGGTATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATCTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCCGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCAGTACTT Laetiporus_sulphureus_var._miniatus_L72s1 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACAGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGAACGGGATGTCACGATGTGACAGTCGCGCTGCGTGACGGGTATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATCTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCCGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCAGTACTT Laetiporus_sulphureus_var._miniatus_WD1058 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTCACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCCGACGTGATGTCACGACGTGACAATCGCGTTGCGTGACGGGCATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATTTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._sulphureus_auct._jap._L50s5 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGGACGTGATGTCACGATGTGACAATCGCGTTGCGTGACGGGCATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATTTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._sulphureus_auct._jap._L54s7 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAACACATGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGGACGTGATGTCACGATGTGACAATCGCGTTGCGTGACGGGCATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATTTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._sulphureus_auct._jap._L68s6 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAACACATGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGGACGTGATGTCACGATGTGACAATCGCGTTGCGTGACGGGCATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATTTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._sulphureus_auct._jap._L85s1 TGCTAGCGTTGTCGTGCACGCGGAACGTGCATGAATGCACGTTTTACGGAATTTTCATGCTGAATATATGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCAGTCCTTGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGGACGTGATGTCACGATGTGACAGCCGCGTTGCGTGACGGGTATGACACTGATAATATGTATAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATCTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._sulphureus_auct._jap._L90s3 TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAATACACGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGGACGTGATGTCACGATGTGACAATCGCGTTGCGTGACGGGCATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATTTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._sulphureus_auct._jap._L97a TGCTAGCGTTGTCGTGCACGCGGAACGTGCATGAATGCACGTTTTACGGAATTTTCATGCTGAATATATGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCAGTCCTTGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGGACGTGATGTCACGATGTGACAGCCGCGTTGCGTGACGGGCATGACACTGATAATATGTATAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATCTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._sulphureus_auct._jap._L97b TGCTAACGTTGTCGTGCACGCGGAACGTGCATGAACACATGTTTTACGGAATTCTCGTGCTGAATATCTGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCCGTCCTCGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGGACGTGATGTCACGATGTGACAATCGCGTTGCGTGACGGGCATGACACTGATAATATGTGTAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATTTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_sulphureus_var._sulphureus_auct._jap._WD820 TGCTAGCGTTGTCGTGCACGCGGAACGTGCATGAATGCACGTTTTACGGAATTTTCATGCTGAATATATGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCAGTCCTTGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGGACGTGATGTCACGATGTGACAGCCGCGTTGCGTGACGGGCATGACACTGATAATATGTATAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATCTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_versisporus_L5 TGCTAGCGTTGTCGTGCACGCGGAACGTGCATGAATGCACGTTTTACGGAATTCTCATGCTGAATATATGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCAGTCCTTGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGGACGTGATGTCACGATGTGACAGCCGCGTTGCGTGACGGGCATGACACTGATAATATGTATAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATCTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT Laetiporus_versisporus_WD153 TGCTAGCGTTGTCGTGCACGCGGAACGTGCATGAATGCACGTTTTACGGAATTCTCATGCTGAATATATGCTCTATAGACTACACGGAGGGTGCCGAACTGGTTGACTCAGTCCTTGACGTTGTGCGTAAAGAAGCTGAGGGCACCGATGCGCTTCAAGGTACGCTCGCTCCAGAATGCGGACGTGATGTCACGATGTGACAGCCGCGTTGCGTGACGGGCATGACACTGATAATATGTATAGGTTTCCAGATCACTCACTCTCTCGGTGGTGGTACCGGTGCCGGCATGGGTACTCTGCTGATCTCGAAGATCCGGGAGGAGTACCCTGACCGCATGATGGCCACTTACTCTGTTGTGCCCAGTCCGAAGGTTTCGGATACCGTTGTTGAGGTTAGTTCAGCGTTGCTGTCACTACTT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = btub) = N: 1-419; CODONPOSSET CodonPositions (CHARACTERS = btub) = N: 1-419; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3177] TITLE ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=534; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Laetiporus_sulphureus_var._miniatus_FH1019 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_FH1108 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_FH1122 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTTTCGGAATGT??????GAATGTCTGTTGGGTACA?CAAAATATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCTGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_FH1206 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGG{CT}TGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_FH1259 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_FH1292 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_FH1343 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_FH1379 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGTTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_FH1387 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCTGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L114s1 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L13 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGTTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L23s4 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGTTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L24 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L27s4 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGTTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L34s2 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L39 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L42s9 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L43s4 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L44 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L66 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGTTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L67s5 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_L72s1 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_WD1058 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGG{CT}TGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_WD1061 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_WD1062 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGTTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_WD1063 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGTTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_WD2090 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CGGAATGTACATCAGAATGTCTTACGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGTTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCA?TCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_WD3a ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTTTCGGAATGT??????GAATGTCTGTTGGGTACA?CAAAATATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_WD3b ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_WD723a ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTTTCGGAATGT??????GAATGTCTGTTGGGTACA?CAAAATATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_WD723b ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTTTCGGAATGT??????GAATGTCTGTTGGGTACA?CAAAATATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCTGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_WD723c ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._miniatus_WD728 ACGAACAACGGGGCTCGCCCCTTGTCCACAAA?CACACCCCC??GTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTT?CGGAATGTAGATCGGAATGTCTATTGGGTATA?CAAA?TATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA??CCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L32 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L35 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L46s20 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L47 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L48 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L50s5 ACGAACAACGGGGTTCGCCCCTTGTCCACAAAACACACCCCC?TGTGCACATCGAAGGCCGGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTGTCGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGCTCAAGCTTTGTTTCGATCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L51a ACGAACAACGGGGTCCGCCCCTTGTCCACAAAACACACCCCC?TGTGCACATCGAAGGCCGGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTGTCGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L51b ACGAACAACGGGGTTCGCCCCTTGTCCACAAAACACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGCTCAAGCTTTGTTTCGATCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L51c ACGAACAACGGGGTTCGCCCCTTGTCCACAAAACACACCCCC?TGTGCACATCGAAGGCCGGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTGTCGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L51d ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L51e ACGAACAACGGGGTTCGCCCCTTGTCCACAAAACACACCCCC?TGTGCACATCGAAGGCCGGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTGTCGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGCTCAAGCTTTGTTTCGATCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L54s7 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L55s6 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L68s6 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L85s1 ACGAACAACGGGGTTCGCCCCTTGTCCACAAA?CACACCCCC?TGTGCACATCGAAGGCCGGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTGTCGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGCTCAAGCTTTGTTTCGATCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L90s3 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L97a ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._L97b ACGAACAACGGGGTTCGCCCCTTGTCCACAAAACACACCCCC?TGTGCACATCGAAGGCCGGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTGTCGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGCTCAAGCTTTGTTTCGATCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._WD1991 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._WD2024 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._WD2099 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_sulphureus_var._sulphureus_auct._jap._WD820 ACGAACAACGGGGTTCGCCCCTTGTCCACAAA?CACACCCCCCTGTGCACATCGAAGGCCGGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTGTCGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGCTCAAGCTTTGTTTCAATCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_versisporus_L49 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_versisporus_L5a ACGAACAACGGGGTTCGCCCCTTGTCCACAAA?CACACCCCC?TGTGCACATCGAAGGCCGGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTGTCGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGCTCAAGCTTTGTTTCGATCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_versisporus_L5b ACGAACAACGGGGTTCGCCCCTTGTCCACAAA?CACACCCCC?TGTGCACATCGAAGGCCGGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTGTCGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGCTCAAGCTTTGTTTCGATCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_versisporus_PRC17 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_versisporus_WD153a ACGAACAACGGGGTTCGCCCCTTGTCCACAAA?CACACCCCC?TGTGCACATCGAAGGCCGGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTGTCGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGCTCAAGCTTTGTTTCGATCGTCTTCGGACGAACATCTCTGACCTCT Laetiporus_versisporus_WD153b ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT Laetiporus_versisporus_WD2073 ACGAACAACGGGGTCCGCCCCTTGTCCACAAA?CACACCCCT??GTGCACGTTGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTT?ACACAAACTT?CAGAATGTACATCAGAATGTCTTGCGCGTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCCGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACGCGTTCGGCTCCTCTTGAATGCATAGTGAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTTTCATTCGTCTTCGGGCGAACATCTCTGACCTCT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS) = N: 1-534; CODONPOSSET CodonPositions (CHARACTERS = ITS) = N: 1-534; END; BEGIN TREES; TITLE Tb9041; LINK TAXA = Taxa3; TRANSLATE 1 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD820, 2 Laetiporus_sulphureus_var._sulphureus_auct._jap._L54s7, 3 Laetiporus_sulphureus_var._sulphureus_auct._jap._L68s6, 4 Laetiporus_sulphureus_var._sulphureus_auct._jap._L50s5, 5 Laetiporus_sulphureus_var._sulphureus_auct._jap._L90s3, 6 Laetiporus_sulphureus_var._sulphureus_auct._jap._L85s1, 7 Laetiporus_sulphureus_var._sulphureus_auct._jap._L97a, 8 Laetiporus_sulphureus_var._sulphureus_auct._jap._L97b, 9 Laetiporus_versisporus_WD153, 10 Laetiporus_versisporus_L5, 11 Laetiporus_sulphureus_var._miniatus_FH1122, 12 Laetiporus_sulphureus_var._miniatus_L24, 13 Laetiporus_sulphureus_var._miniatus_L34s2, 14 Laetiporus_sulphureus_var._miniatus_L43s4, 15 Laetiporus_sulphureus_var._miniatus_L67s5, 16 Laetiporus_sulphureus_var._miniatus_L72s1, 17 Laetiporus_sulphureus_var._miniatus_WD1058, 18 Laetiporus_sulphureus_var._miniatus_FH1019, 19 Laetiporus_sulphureus_var._miniatus_FH1206, 20 Laetiporus_sulphureus_var._miniatus_L23s4, 21 Laetiporus_sulphureus_var._miniatus_L27s4, 22 Laetiporus_sulphureus_var._miniatus_L114s1; TREE Fig._3 = [&R] ((((1,7),6),(9,10)),((((2,3),8),((4,5),(((17,19),(20,21)),(18,22)))),(((((11,12),15),16),13),14))); END; BEGIN TREES; TITLE Tb9039; LINK TAXA = Taxa2; TRANSLATE 1 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD820, 2 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD1991, 3 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD2099, 4 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD2024, 5 Laetiporus_sulphureus_var._sulphureus_auct._jap._L32, 6 Laetiporus_sulphureus_var._sulphureus_auct._jap._L35, 7 Laetiporus_sulphureus_var._sulphureus_auct._jap._L47, 8 Laetiporus_sulphureus_var._sulphureus_auct._jap._L48, 9 Laetiporus_sulphureus_var._sulphureus_auct._jap._L51a, 10 Laetiporus_sulphureus_var._sulphureus_auct._jap._L51b, 11 Laetiporus_sulphureus_var._sulphureus_auct._jap._L51c, 12 Laetiporus_sulphureus_var._sulphureus_auct._jap._L51d, 13 Laetiporus_sulphureus_var._sulphureus_auct._jap._L51e, 14 Laetiporus_sulphureus_var._sulphureus_auct._jap._L54s7, 15 Laetiporus_sulphureus_var._sulphureus_auct._jap._L68s6, 16 Laetiporus_sulphureus_var._sulphureus_auct._jap._L50s5, 17 Laetiporus_sulphureus_var._sulphureus_auct._jap._L55s6, 18 Laetiporus_sulphureus_var._sulphureus_auct._jap._L90s3, 19 Laetiporus_sulphureus_var._sulphureus_auct._jap._L46s20, 20 Laetiporus_sulphureus_var._sulphureus_auct._jap._L85s1, 21 Laetiporus_sulphureus_var._sulphureus_auct._jap._L97a, 22 Laetiporus_sulphureus_var._sulphureus_auct._jap._L97b, 23 Laetiporus_versisporus_WD153a, 24 Laetiporus_versisporus_WD153b, 25 Laetiporus_versisporus_L5a, 26 Laetiporus_versisporus_L5b, 27 Laetiporus_versisporus_WD2073, 28 Laetiporus_versisporus_L49, 29 Laetiporus_versisporus_PRC17, 30 Laetiporus_sulphureus_var._miniatus_WD3a, 31 Laetiporus_sulphureus_var._miniatus_WD3b, 32 Laetiporus_sulphureus_var._miniatus_WD723a, 33 Laetiporus_sulphureus_var._miniatus_WD723b, 34 Laetiporus_sulphureus_var._miniatus_WD723c, 35 Laetiporus_sulphureus_var._miniatus_WD728, 36 Laetiporus_sulphureus_var._miniatus_WD1061, 37 Laetiporus_sulphureus_var._miniatus_FH1122, 38 Laetiporus_sulphureus_var._miniatus_FH1259, 39 Laetiporus_sulphureus_var._miniatus_FH1292, 40 Laetiporus_sulphureus_var._miniatus_FH1343, 41 Laetiporus_sulphureus_var._miniatus_FH1387, 42 Laetiporus_sulphureus_var._miniatus_L24, 43 Laetiporus_sulphureus_var._miniatus_L34s2, 44 Laetiporus_sulphureus_var._miniatus_L42s9, 45 Laetiporus_sulphureus_var._miniatus_L43s4, 46 Laetiporus_sulphureus_var._miniatus_L39, 47 Laetiporus_sulphureus_var._miniatus_L44, 48 Laetiporus_sulphureus_var._miniatus_L67s5, 49 Laetiporus_sulphureus_var._miniatus_L72s1, 50 Laetiporus_sulphureus_var._miniatus_WD1058, 51 Laetiporus_sulphureus_var._miniatus_WD2090, 52 Laetiporus_sulphureus_var._miniatus_WD1062, 53 Laetiporus_sulphureus_var._miniatus_WD1063, 54 Laetiporus_sulphureus_var._miniatus_FH1019, 55 Laetiporus_sulphureus_var._miniatus_FH1108, 56 Laetiporus_sulphureus_var._miniatus_FH1206, 57 Laetiporus_sulphureus_var._miniatus_FH1379, 58 Laetiporus_sulphureus_var._miniatus_L66, 59 Laetiporus_sulphureus_var._miniatus_L13, 60 Laetiporus_sulphureus_var._miniatus_L23s4, 61 Laetiporus_sulphureus_var._miniatus_L27s4, 62 Laetiporus_sulphureus_var._miniatus_L114s1; TREE Fig._1 = [&R] ((((((1,((((13,((20,23),25)),16),22),26)),11),9),((2,(3,(4,(5,(6,(7,(8,(12,(14,(15,(17,(18,(19,(21,(24,(27,(28,29))))))))))))))))),10)),(((((50,(((((((51,52),53),57),58),59),60),61)),56),54),55),62)),(((30,32),(33,37)),(((((((((((((((31,34),35),36),38),39),40),42),43),44),45),46),47),48),49),41))); END; BEGIN TREES; TITLE Tb9040; LINK TAXA = Taxa1; TRANSLATE 1 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD820, 2 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD1991, 3 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD2099, 4 Laetiporus_sulphureus_var._sulphureus_auct._jap._WD2024, 5 Laetiporus_sulphureus_var._sulphureus_auct._jap._L32, 6 Laetiporus_sulphureus_var._sulphureus_auct._jap._L35a, 7 Laetiporus_sulphureus_var._sulphureus_auct._jap._L35b, 8 Laetiporus_sulphureus_var._sulphureus_auct._jap._L47, 9 Laetiporus_sulphureus_var._sulphureus_auct._jap._L48, 10 Laetiporus_sulphureus_var._sulphureus_auct._jap._L51, 11 Laetiporus_sulphureus_var._sulphureus_auct._jap._L54s7, 12 Laetiporus_sulphureus_var._sulphureus_auct._jap._L68s6, 13 Laetiporus_sulphureus_var._sulphureus_auct._jap._L50s5, 14 Laetiporus_sulphureus_var._sulphureus_auct._jap._L55s6, 15 Laetiporus_sulphureus_var._sulphureus_auct._jap._L90s3, 16 Laetiporus_sulphureus_var._sulphureus_auct._jap._L46s20, 17 Laetiporus_sulphureus_var._sulphureus_auct._jap._L85s1, 18 Laetiporus_sulphureus_var._sulphureus_auct._jap._L97a, 19 Laetiporus_sulphureus_var._sulphureus_auct._jap._L97b, 20 Laetiporus_versisporus_WD153, 21 Laetiporus_versisporus_L5, 22 Laetiporus_versisporus_WD2073, 23 Laetiporus_versisporus_L49, 24 Laetiporus_sulphureus_var._miniatus_WD3, 25 Laetiporus_sulphureus_var._miniatus_WD723, 26 Laetiporus_sulphureus_var._miniatus_WD728, 27 Laetiporus_sulphureus_var._miniatus_WD1061, 28 Laetiporus_sulphureus_var._miniatus_FH1122, 29 Laetiporus_sulphureus_var._miniatus_FH1259, 30 Laetiporus_sulphureus_var._miniatus_FH1292, 31 Laetiporus_sulphureus_var._miniatus_FH1343, 32 Laetiporus_sulphureus_var._miniatus_FH1387, 33 Laetiporus_sulphureus_var._miniatus_L24, 34 Laetiporus_sulphureus_var._miniatus_L34s2, 35 Laetiporus_sulphureus_var._miniatus_L42s9, 36 Laetiporus_sulphureus_var._miniatus_L43s4, 37 Laetiporus_sulphureus_var._miniatus_L39, 38 Laetiporus_sulphureus_var._miniatus_L67s5, 39 Laetiporus_sulphureus_var._miniatus_L72s1, 40 Laetiporus_sulphureus_var._miniatus_WD1058, 41 Laetiporus_sulphureus_var._miniatus_WD2090, 42 Laetiporus_sulphureus_var._miniatus_WD1062, 43 Laetiporus_sulphureus_var._miniatus_WD1063, 44 Laetiporus_sulphureus_var._miniatus_FH1108, 45 Laetiporus_sulphureus_var._miniatus_FH1206, 46 Laetiporus_sulphureus_var._miniatus_FH1379, 47 Laetiporus_sulphureus_var._miniatus_L23s4, 48 Laetiporus_sulphureus_var._miniatus_L27s4, 49 Laetiporus_sulphureus_var._miniatus_L114s1; TREE Fig._2 = [&R] (((1,18),20),(((((2,(3,(4,(5,(6,(8,(9,(10,(12,(13,(14,(15,(16,(19,(21,(22,23)))))))))))))))),(11,17)),7),((40,(((((((41,42),43),45),46),47),48),49)),44)),(((((((((((24,(((25,(30,35)),27),32)),26),28),33),34),36),38),39),31),29),37))); END;