#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 19:35 GMT TreeBASE (cc) 1994-2008 Study reference: Watanabe K., Ohi-toma T., & Murata J. 2008. Multiple hybridization in the Aristolochia kaempferi group (Aristolochiaceae): evidence from reproductive isolation and molecular phylogeny. American Journal of Botany, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2058] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=29; TAXLABELS Aristolochia_K642_1_K160_1_K95_1_K555_1_AC2_2_K653_2 Aristolochia_Setu2allele1_K580homo Aristolochia_cucurbitifolia_AC2_allele1 Aristolochia_kaempferi_K158_allele1 Aristolochia_kaempferi_K158_allele2 Aristolochia_kaempferi_K160_allele2 Aristolochia_kaempferi_K325_allele1 Aristolochia_kaempferi_K325_allele2 Aristolochia_kaempferi_K61_allele1 Aristolochia_kaempferi_K61_allele2 Aristolochia_kaempferi_K642_allele2 Aristolochia_liukiuensis_K32_homo Aristolochia_manshuriensis_SEST21_allele1 Aristolochia_manshuriensis_SEST21_allele2 Aristolochia_mollissima_AM2_allele1 Aristolochia_mollissima_AM2_allele2 Aristolochia_moupinensis_allele1 Aristolochia_moupinensis_allele2 Aristolochia_saccata_Asa_allele1 Aristolochia_saccata_Asa_allele2 Aristolochia_shimadai_AS2_homo Aristolochia_shimadai_K282_homo Aristolochia_shimadai_K437_allele1 Aristolochia_shimadai_K437_allele2 Aristolochia_shimadai_Setu2_allele2 Aristolochia_tanzawana_K555_allele2 Aristolochia_tanzawana_K653_allele1 Aristolochia_tanzawana_K95_allele2 Aristolochia_westlandii_SETS36 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=23; TAXLABELS Aristolochia_K580homo_K325homo_K61_1_Setu2_2_AM2_1 Aristolochia_cucurbitifolia_AC2_allele2 Aristolochia_kaempferi_K158_allele1 Aristolochia_kaempferi_K158_allele2 Aristolochia_kaempferi_K61allele2_K437allele2 Aristolochia_kaempferi_K642homo_K160homo Aristolochia_liukiuensis_K32_allele1 Aristolochia_liukiuensis_K32_allele2 Aristolochia_manshuriensis_SEST21_allele1 Aristolochia_manshuriensis_SEST21_allele2 Aristolochia_mollissima_AM2_allele2 Aristolochia_moupinensis_Mou2_allele1 Aristolochia_moupinensis_Mou2_allele2 Aristolochia_saccata_Asa_homo Aristolochia_shimadai_AS2_allele1 Aristolochia_shimadai_AS2_allele2 Aristolochia_shimadai_K282_allele1 Aristolochia_shimadai_K282_allele2 Aristolochia_shimadai_K437_allele1 Aristolochia_shimadai_Setu2allele1_AC2allele1 Aristolochia_tanzawana_K95homo_K555homo_K653homo Aristolochia_westlandii_SETS36_allele1 Aristolochia_westlandii_SETS36_allele2 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=18; TAXLABELS Aristolochia_K282allele1_AS2allele2_K32allele2_AM2allele2 Aristolochia_K61allele1_K325homo_K437homo_Setu2homo Aristolochia_K95homo_K555allele2_K580homo_K653homo Aristolochia_cucurbitifolia_AC2_homo Aristolochia_kaempferi_K158_allele1 Aristolochia_kaempferi_K158_allele2 Aristolochia_kaempferi_K160_allele1 Aristolochia_kaempferi_K160allele2_K642homo Aristolochia_kaempferi_K61_aellele2 Aristolochia_liukiuensis_K32_allele1 Aristolochia_manshuriensis_SEST21_homo Aristolochia_mollissima_AM2_allele1 Aristolochia_moupinensis_Mou2_homo Aristolochia_saccata_Asa_homo Aristolochia_shimadai_AS2_allele1 Aristolochia_shimadai_K282_allele2 Aristolochia_tanzawana_K555_allele1 Aristolochia_westlandii_SETS36_homo ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=26; TAXLABELS Aristolochia_AS2allele2_AM2allele2 Aristolochia_K555allele2_K437allele1_AS2allele1 Aristolochia_K580homo_Setu2homo Aristolochia_cucurbitifolia_AC2_allele1 Aristolochia_cucurbitifolia_AC2_allele2 Aristolochia_kaempferi_K158_allele1 Aristolochia_kaempferi_K158allele2_K325homo Aristolochia_kaempferi_K160_allele2 Aristolochia_kaempferi_K160allele1_K642allele1 Aristolochia_kaempferi_K61_homo Aristolochia_kaempferi_K642_allele2 Aristolochia_liukiuensis_K32_homo Aristolochia_manshuriensis_SEST21_homo Aristolochia_mollissima_AM2_allele1 Aristolochia_moupinensis_Mou2_allele1 Aristolochia_moupinensis_Mou2_allele2 Aristolochia_saccata_Asa_allele1 Aristolochia_saccata_Asa_allele2 Aristolochia_shimadai_K282_homo Aristolochia_shimadai_K437_allele2 Aristolochia_tanzawana_K555_allele1 Aristolochia_tanzawana_K653_allele2 Aristolochia_tanzawana_K95_allele1 Aristolochia_tanzawana_K95allele2_K653allele1 Aristolochia_westlandii_SETS36_allele1 Aristolochia_westlandii_SETS36_allele2 ; END; BEGIN TAXA; TITLE Taxa5; DIMENSIONS NTAX=21; TAXLABELS Aristolochia_K325homo_AS2allele1_AM2allele1 Aristolochia_K555_2_K653homo_K61_2_K158_1_K437_1_AC2_2_AM2_2 Aristolochia_cucurbitifolia_AC2_allele1 Aristolochia_kaempferi_K158_allele2 Aristolochia_kaempferi_K160_allele1 Aristolochia_kaempferi_K580_homo Aristolochia_kaempferi_K61_allele1 Aristolochia_kaempferi_K642homo_K160allele2 Aristolochia_liukiuensis_K32_homo Aristolochia_manshuriensis_SEST21_allele1 Aristolochia_manshuriensis_SEST21_allele2 Aristolochia_moupinensis_Mou2_homo Aristolochia_saccata_Asa_homo Aristolochia_shimadai_AS2_allele2 Aristolochia_shimadai_K282_homo Aristolochia_shimadai_K437_allele2 Aristolochia_shimadai_Setu2_allele1 Aristolochia_shimadai_Setu2_allele2 Aristolochia_tanzawana_K555_allele1 Aristolochia_tanzawana_K95_homo Aristolochia_westlandii_SETS36_homo ; END; BEGIN TAXA; TITLE Taxa6; DIMENSIONS NTAX=47; TAXLABELS Aristolochia_kaempferi_group_Type1 Aristolochia_kaempferi_group_Type10 Aristolochia_kaempferi_group_Type11 Aristolochia_kaempferi_group_Type12 Aristolochia_kaempferi_group_Type13 Aristolochia_kaempferi_group_Type14 Aristolochia_kaempferi_group_Type15 Aristolochia_kaempferi_group_Type16 Aristolochia_kaempferi_group_Type17 Aristolochia_kaempferi_group_Type18 Aristolochia_kaempferi_group_Type19 Aristolochia_kaempferi_group_Type2 Aristolochia_kaempferi_group_Type20 Aristolochia_kaempferi_group_Type21 Aristolochia_kaempferi_group_Type22 Aristolochia_kaempferi_group_Type23 Aristolochia_kaempferi_group_Type24 Aristolochia_kaempferi_group_Type25 Aristolochia_kaempferi_group_Type26 Aristolochia_kaempferi_group_Type27 Aristolochia_kaempferi_group_Type28 Aristolochia_kaempferi_group_Type29 Aristolochia_kaempferi_group_Type3 Aristolochia_kaempferi_group_Type30 Aristolochia_kaempferi_group_Type31 Aristolochia_kaempferi_group_Type32 Aristolochia_kaempferi_group_Type33 Aristolochia_kaempferi_group_Type34 Aristolochia_kaempferi_group_Type35 Aristolochia_kaempferi_group_Type36 Aristolochia_kaempferi_group_Type37 Aristolochia_kaempferi_group_Type38 Aristolochia_kaempferi_group_Type39 Aristolochia_kaempferi_group_Type4 Aristolochia_kaempferi_group_Type40 Aristolochia_kaempferi_group_Type41 Aristolochia_kaempferi_group_Type42 Aristolochia_kaempferi_group_Type43 Aristolochia_kaempferi_group_Type5 Aristolochia_kaempferi_group_Type6 Aristolochia_kaempferi_group_Type7 Aristolochia_kaempferi_group_Type8 Aristolochia_kaempferi_group_Type9 Aristolochia_manshuriensis_SEST21 Aristolochia_moupinensis_Mou2 Aristolochia_saccata_Asa Aristolochia_westlandii_SETS36 ; END; BEGIN TAXA; TITLE Taxa7; DIMENSIONS NTAX=22; TAXLABELS Aristolochia_K325homo_AS2_allele1 Aristolochia_K555_2_K653homo_K61_2_K158_1_K437_1_AC2_2_AM2_2 Aristolochia_cucurbitifolia_AC2_allele1 Aristolochia_kaempferi_K158_allele2 Aristolochia_kaempferi_K160_allele1 Aristolochia_kaempferi_K580_homo Aristolochia_kaempferi_K61_allele1 Aristolochia_kaempferi_K642homo_K160allele2 Aristolochia_liukiuensis_K32_homo Aristolochia_manshuriensis_SEST21_allele1 Aristolochia_manshuriensis_SEST21_allele2 Aristolochia_mollissima_AM2_allele1 Aristolochia_moupinensis_Mou2_homo Aristolochia_saccata_Asa_homo Aristolochia_shimadai_AS2_allele2 Aristolochia_shimadai_K282_homo Aristolochia_shimadai_K437_allele2 Aristolochia_shimadai_Setu2_allele1 Aristolochia_shimadai_Setu2_allele2 Aristolochia_tanzawana_K555_allele1 Aristolochia_tanzawana_K95_homo Aristolochia_westlandii_SETS36_homo ; END; BEGIN TAXA; TITLE Taxa8; DIMENSIONS NTAX=23; TAXLABELS Aristolochia_K580homo_K325homo_K61_1_Setu2_2_AM2_1 Aristolochia_cucurbitifolia_AC2_allele2 Aristolochia_kaempferi_K158_allele1 Aristolochia_kaempferi_K158_allele2 Aristolochia_kaempferi_K61allele2_K437allele2 Aristolochia_kaempferi_K642homo_K160homo Aristolochia_liukiuensis_K32_allele1 Aristolochia_liukiuensis_K32_allele2 Aristolochia_manshuriensis_SEST21_allele1 Aristolochia_manshuriensis_SEST21_allele2 Aristolochia_mollissima_AM2_allele2 Aristolochia_moupinensis_Mou2_allele1 Aristolochia_moupinensis_Mou2_allele2 Aristolochia_saccata_Asa_homo Aristolochia_shimadai_AS2_allele1 Aristolochia_shimadai_AS2_allele2 Aristolochia_shimadai_K282_allele1 Aristolochia_shimadai_K282_allele2 Aristolochia_shimadai_K437_allele1 Aristolochia_shimadai_Setu2allele1_AC2allele1 Aristolochia_tanzawana_K95homo_K555homo_K653homo Aristolochia_westlandii_SETS36_allele1 Aristolochia_westlandii_SETS36_allele2 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3191] TITLE 'cpDNA (ML)'; LINK TAXA = Taxa6; DIMENSIONS NCHAR=2911; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aristolochia_kaempferi_group_Type1 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGAGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTACTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA---------GAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTGTTTTAT-AAAAAAAAAAA----------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGCAAAAGCAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTAAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGAAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTTATTTCGGATAACGATTTTCACCAAAATAGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAGGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type10 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAAA-----------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTT-?----CGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type11 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTTGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTT-?----CGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type12 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTAATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type13 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTT-CCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAAA-----------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTAATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type14 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGAAAGAAGGAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTAATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type15 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTA--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAA----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type16 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTA--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAA----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATCGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCGGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type17 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTA--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAA----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAA-TGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATCGATATGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCGGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type18 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAA----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTTCAACTCATTTTTATGTTCCAGCTTCAATGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTTAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTTATTTCGGATAACTATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTCATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type19 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAACCAATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTA--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAAA-----------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAAA-GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTGATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTTCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type2 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGAGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTACTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA--------GAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTGTTTTAT-AAAAAAAAAA-----------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAAA-GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGCAAAAGCAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTAAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGAAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTTATTTCGGATAACGATTTTCACCAAAATAGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAAAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAGGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type20 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAACCAATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTA--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAAA-----------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGTCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTGATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTTCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type21 CATCTCTCCCAATTC-----CAATTAAAAAATTTAGAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAACCAATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTA--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAAA-----------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTGATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTTCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type22 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAACCAATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCACTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTA--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAAA-----------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTGATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type23 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAACCAATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTA--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAAA-----------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTGATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type24 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAAA--CAGAAT--------------ATCGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type25 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGG-------TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type26 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTCTTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGG-------TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAAAA-GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type27 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGG-------TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTTGTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGGTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type28 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGGTATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------ACAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTCTTATTAGTTTTTC-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTCATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type29 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGG-------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACATGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type3 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGAGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTACTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA--------GAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTGTTTTAT-AAAAAAAAAA-----------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGCAAAAGCAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTAAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGAAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTTATTTCGGATAACGATTTTCACCAAAATAGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCCTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAGGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type30 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAA-TGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type31 CATCTCTCCCAATTC-----CAATTATAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCATTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCCATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type32 CATCTCTCCCAATTC-----CAATTATAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGGGGGGG-TTT----ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCCATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type33 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAAAA-GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACTATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type34 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTCGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type35 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAA-TGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATAATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type36 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTTAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATAATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type37 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTATTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type38 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGGGGG---TTTT---ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type39 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAAAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type4 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---CAGAAT--------------AGGGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type40 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTA--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAA----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTTAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATCGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCGGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type41 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type42 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTAGTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGG-------TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type43 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGG-------TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAA--------CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTGATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type5 CATCTCTCCCAATTCAATTCCAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGGGGGG--TTT----ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---CAGAATCAGAAT--------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAACGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGACTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAAGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type6 CATCTCTCCCAATTCAATTCCAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTCTTTTTTATTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGGGGGGGGTTT----ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAAA--CAGAATCAGAAT--------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAACGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGACTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAAGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type7 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGGGGG---TTTT---ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type8 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTATTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type9 CATCTCTCCCAATTC-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATATTATGATAGGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAA----CAGAAT--------------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTAT-AAAAAAAAA------------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAATAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_manshuriensis_SEST21 CATCTCTCCCAATTC-----CAATTAAAAAATTTAGAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTCTTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTTTTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGGAGATCAAATGAAATGATTTGTCTGGTTTGATAAAC---------------------------GCAAATTTATGTTACGAAAACAGCAATAACAACAAGGACTATTTGAATTCCTATCAGAAATTTCTTTATGATA--------GGCGTTTTTTTATAGGCGTTTTTTTCTTATTAGTTTTTC-------------TTTTTTATTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAA--------CAGAAT-AGAAT--------ATTTGATTTGTATTA--------?GTATTATAATCCCCTTTTTCTTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAACGAAACGAATACTATTTTATTAAAAAAAAAAAA------GAAGTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAAAAGGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATATAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCGTTTTCAGCATTCTAATGCTATCTTGATTACGTCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAATAAATGTCCGATATCAAGTTGATCGGTTAATTCAATATCAATAAGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTATTGATTTCCACCTATTTTCCCTTCTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGATAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAAT-------ATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TTAATGGATCGACTGTTTACGAATCGATGGAAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGCTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTTTATTTCGGGTAACGATTTTCACCAAAATAGATTCGTTAGGAAAAGCAATAATTTTGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAGTTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATTTCATAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTAAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTCTCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGATAATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCACTTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTATATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCCATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCTTTGGCTAAAGCGAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_moupinensis_Mou2 CATCTCTCCCAATTC-----CAATTAAAAAATTTTTAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTCTTTTTTCTTTATCTTTCTTTATTCTATCTTTATTCTATAATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACTGAAATGATTTGTCTGGTTTGATAAACGAAAATTTCTGTTACGAAAACAGCAATAGCAACAAGGACTATTTGAATTCCTATCAGAAGTTTCTTTATGATA--------GGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAAAAACAGAATCCGAAT--CAGAATATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTCTTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATT-----AAAAAAAAAAAAAAAAAA---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAAA-G-AGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCACTCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGTCTCACCCCTTTGTTCGACAAAGGACCCATTCATATTCAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAATAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGTCGTTGTTCCTTATTTATCAGCATATTTATTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATTGATAATATTTAG-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGAAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGGTAACGATTTTCACCAAAATAGATTCGTTAGGAAAAGCAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCATAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTAAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTTTTTTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCGAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTGTCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_saccata_Asa CATCTCTCCCAATTC-----CAATTAAAAAATTTTAAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTCTTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCACTTTTGATTTAGTGGGGGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACTGAAATGATTTGTCTGGTTTGATAAACGAAAATTTCTGTTACGAAAACAGCAATAGCAACAAGGACTATTTGAATTCCTATCAGAAGTTTCTTTATGATA--------GGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAAAA-CAGAATCAGAAT--------ATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTCTTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATTAAACGAATACTATTTTATTAAAAAAAAAAA----------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAA-----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTAATTACGTCTCATCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAATAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAATAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTATTGATTTCCTACTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAAGAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATTGATAATATTTAG-------TTGATAATTTTGTGAAGGATTCCTGCCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGAAAATTTAGGTTATGACAACAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGGTAACGATTTTCACCAAAATAGATTCGTTAGGAAAAGCAAGAATTTGGATTCTCAAATCATATCAGAAGCCTTTGCAATCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCATAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTAAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTTTT?TCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCGAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_westlandii_SETS36 CATCTCTCCCAATTC-----CAATTAAAAAATTTAGAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTAT-----------AATCCTATAACATAATTTTATTAATATTAAC-AGTTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAG-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACTGAAATGATTTGTCTGGTTTGATAAACGCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGGACTATTTGAATTCCTATCAGAAGTTTCTTTATGATA--------GGCGTTTTTTT--------------CTTATTAGTTTTTC--------------------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------CAGAATCACAATATCACAATATTGGATTTGTATTATTTGTATTAGTATTATAATCCCCTTTTTCTTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTTTATTAAAAAAAAAAAA---------GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATT----------TTTATGTTCCAGCTTCAATGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAG------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGTCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAATAAATGTCCGATATCAAGTTGATCGGTTAATTCAATA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTATCATACAACCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTATTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATTGATAATATTTAGTATTTAGTTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGGAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTATTATTTCGGGTAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGCAAGAATTTGGATTCTCAAATCATATCAGAAGCCTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCATAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTAAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCTACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTT---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATAATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTTTCTAATTAGTTCCTTGGCTAAAGCGAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'cpDNA (ML)') = N: 1-2911; CODONPOSSET CodonPositions (CHARACTERS = 'cpDNA (ML)') = N: 1-2911; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3190] TITLE 'PI exon (ML)'; LINK TAXA = Taxa5; DIMENSIONS NCHAR=573; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aristolochia_K325homo_AS2allele1_AM2allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_K555_2_K653homo_K61_2_K158_1_K437_1_AC2_2_AM2_2 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_cucurbitifolia_AC2_allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CACCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_kaempferi_K158_allele2 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGAATATCCATCTCACATCCCTTACACCTTCTGCGCTCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTT----GGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_kaempferi_K160_allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATTTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGAATATCCATCTCACATCCCTTACACCTTCTGCGCTCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTT----TGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_kaempferi_K580_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTTCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_kaempferi_K61_allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---AGATTGTCTGGATGGTCATACTCCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_kaempferi_K642homo_K160allele2 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATTTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGAATATCCATCTCACATCCCTTACACCTTCTGCGCTCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTT----TGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_liukiuensis_K32_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATCAACTCCCTCCCTCTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_manshuriensis_SEST21_allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGCTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTGA---GGATTGTCTGGATGGTCATACTCCTTCCTTTGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_manshuriensis_SEST21_allele2 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTGA---GGATTGTCTGGATGGTCATACTCCTTCCTTTGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_moupinensis_Mou2_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTTTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGGTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGATTATCCATCTCACATCCCTTACACCTTCTGCGCGCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTCCTTGGTCACCAAGAAGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_saccata_Asa_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGATTATACATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTCCTTGGTCACCAAGATGATAAAAGGACTTGTCTTGGTAGGT Aristolochia_shimadai_AS2_allele2 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGGGAAGATATAAACTCCCTCCCACCGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_shimadai_K282_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTCAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_shimadai_K437_allele2 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---AGATTGTCTGGATGGTCATACTCCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCATGGTAGGT Aristolochia_shimadai_Setu2_allele1 TCTTCTCCAGCACGGGAAAGATGTCCGAGTTCAGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAAATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTTCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_shimadai_Setu2_allele2 TCTTCTCCAGCACGGGAAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTTCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_tanzawana_K555_allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTTCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_tanzawana_K95_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGTAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTTCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTCCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_westlandii_SETS36_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCCAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTCCTTG------------------------------------ ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'PI exon (ML)') = N: 1-573; CODONPOSSET CodonPositions (CHARACTERS = 'PI exon (ML)') = N: 1-573; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3192] TITLE 'PhyA (MP & ML)'; LINK TAXA = Taxa3; DIMENSIONS NCHAR=697; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aristolochia_K282allele1_AS2allele2_K32allele2_AM2allele2 TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACGCTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_K61allele1_K325homo_K437homo_Setu2homo TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACACTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCTCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_K95homo_K555allele2_K580homo_K653homo TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACGCTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCTGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_cucurbitifolia_AC2_homo TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACACTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_kaempferi_K158_allele1 TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACACTGAGGGCCTCACATAGTTGTCACCAGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCTCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_kaempferi_K158_allele2 TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACACTGAGGGCCTCACATAGTTGTCACCAGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCTCAACCAAGAACCACAATCGAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_kaempferi_K160_allele1 TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACGCTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTTGTGGTTTGCCACAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_kaempferi_K160allele2_K642homo TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACGCTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTTGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_kaempferi_K61_aellele2 TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACACTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCTCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACAGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_liukiuensis_K32_allele1 TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACGCTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACTATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_manshuriensis_SEST21_homo TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACGCTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTTGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCCTCTTGTGCCAAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAAAGCTCTTTCTCTTGGTGACATAGTT Aristolochia_mollissima_AM2_allele1 TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCCAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACGCTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_moupinensis_Mou2_homo TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTAAAAGTTTGTCAGGATGAGAGGCTTTCATTTGATTTGACTTTGTGTGGTTCCACGCTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTTAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGACTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCAAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAAAGCTCTTTCTCTCGGTGACATAGTT Aristolochia_saccata_Asa_homo TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACGCTAAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATCACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAAGGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCAAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAAAGCTCATTCTCTCGGTGACATAGTT Aristolochia_shimadai_AS2_allele1 TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACGCTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTTTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_shimadai_K282_allele2 TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACACTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGAAGCCCAAACATTATGGACCTTGTCAAATGTGACGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_tanzawana_K555_allele1 TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGGATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACGCTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCTGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTCGTGGTTTGCCATAACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTACGGACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCAAAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCGAAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAAATACGTGAGATAAACCAATGGCTCTCTGAGTACCATATGGATTCCACGGGTCTTAGTACAGATAGCCTTCATGATGCTGGATATCCTAATGCTCTTTCTCTCGGTGACATAGTT Aristolochia_westlandii_SETS36_homo TATTCCTCAAGCTTCTAGGTTTCTGTTCATGAAGAACAAGGTTCGAATGATTTGTGATTGCTATGCTAAGCCTGTGAAAGTTTATCAGGATGAGAGGCTTTCATTTGATTTGACTTTATGTGGTTCCACGCTGAGGGCCTCACATAGTTGTCACCTGCAGTATATGAAGAATATGGGTTCCGTTGCTTCTCTTGTCTTGGCAGTGGTTGTGAAAGAAGGTGAAGAGGATGATAATCCAGACCCCAACCAAGAACCACAATCAAAGAGAAAGAGGCTTTGGGGCCTTGTGGTTTGCCATCACACAACTCCTAGATTTGTTCCCTTTCCTCTAAGATATGCATGTGAATTTCTCATGCAAGTTTTTGCCATCCATGTCAATAATGAGGTCGAACTAGAGAACCAAATACGAGAAAAAAACATTTTGCGTACGCAGACACTTCTCTGTGACATGCTCCTTCGAGATTCCTCCTTGAGTATTGTGACCCGTAGCCCAAACATTATGGACCTTGTCAAATGTGATGGAGCAGCCTTCTTGTGCCATAACAAAGTTTATACACTAGGCGTAACTCCAACCGAATCACAGATACGTGAGATAAACGAATGGCTCTCTGAGTACCATATGGATTCCACAGGTCTTAGTACAGATAGCCTTCAAGATGCTGGATATCCTAAAGCTCATTCTCTCGGTGACATAGTT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'PhyA (MP & ML)') = N: 1-697; CODONPOSSET CodonPositions (CHARACTERS = 'PhyA (MP & ML)') = N: 1-697; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3193] TITLE 'AP3 exon (MP & ML)'; LINK TAXA = Taxa4; DIMENSIONS NCHAR=680; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Aristolochia_AS2allele2_AM2allele2 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGATTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGTGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_K555allele2_K437allele1_AS2allele1 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGATTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_K580homo_Setu2homo AAACTTTCCGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGGTTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGACCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTACATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_cucurbitifolia_AC2_allele1 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGATTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGTCTTGCTTAG---TAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_cucurbitifolia_AC2_allele2 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGGTTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGAATCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGTCTTGCTTAG---TAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_kaempferi_K158_allele1 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGGTTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAGCTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTTCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_kaempferi_K158allele2_K325homo AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGATTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATATCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_kaempferi_K160_allele2 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGATTTCTAGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGAAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTTTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_kaempferi_K160allele1_K642allele1 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGATTTCTAGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATATCGTAAAAAG---ATAAGAAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_kaempferi_K61_homo AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGATTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGACCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGCAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAGTACTTGCCTTT Aristolochia_kaempferi_K642_allele2 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGATTTCTAGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGAAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_liukiuensis_K32_homo AAACTTTCTGAGTATTGCAGCCCTTCCACCACGACAAAGAAAGTATACGATCGATTACAGGAGGTTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGACCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGTTATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGTGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_manshuriensis_SEST21_homo AAACTTTCCGAGTATTGCAGCCCTTCTACTACGACAAAGAAAGTATACGATCGATTACAGGAGGTTTCTGGGATTAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGATCTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCTTAAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGTTGATTCAGGTAGGCCCGTCTTTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATTTTTCATCAAGAAGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTTTTTTCTAGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_mollissima_AM2_allele1 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGGTTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGTTATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_moupinensis_Mou2_allele1 AAACTTTCCGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGGTTTCTGGGATTAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAACAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGATCTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACTTACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTAAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGACCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTACGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAGTTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_moupinensis_Mou2_allele2 AAACTTTCCGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGGTTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAACAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTAAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGACCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAGTTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_saccata_Asa_allele1 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTGCAGGAGGTTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAAGACACAAACAAAAGATTCCTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGATTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATCAGTTTGATGAGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_saccata_Asa_allele2 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTGCAGGAGGTTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCCTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGATTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATCAGTTTGATGAGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_shimadai_K282_homo AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGATTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAACCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGTGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_shimadai_K437_allele2 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGATTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTCAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTGTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_tanzawana_K555_allele1 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGATTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTCAACAAGTTGAAAGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAGCTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGAC---------------- Aristolochia_tanzawana_K653_allele2 AAACTTTCCGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGGTTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAGCTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCAGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCTTGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATT-GTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAGTACTTGCCTTT Aristolochia_tanzawana_K95_allele1 AAACTTTCCGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGATTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAGCTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAGTACTTGCCTTT Aristolochia_tanzawana_K95allele2_K653allele1 AAACTTTCCGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTACAGGAGGTTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAGCTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCTTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGCTTTCGGATTGGCCAGCGGAGGGCCTCACATGTTCGGATTCCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATTAGTTTGATGCGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAGTACTTGCCTTT Aristolochia_westlandii_SETS36_allele1 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTGCAGGAGGTTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTTGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCCTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGATTTCGGTTTGGCCAGCGGAGGGCCTCACATGTTCGGATTTCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATCAGTTTGATGAGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT Aristolochia_westlandii_SETS36_allele2 AAACTTTCTGAGTATTGCAGCCCTTCCACTACGACAAAGAAAGTATACGATCGATTGCAGGAGGTTTCTGGGATCAACTTGTGGAGCTCTCACTATGAGAAAATGCAAAATCATTTGAACAAGTTGAAGGAGGAGAATAGCAATCTGAGGAGGGAAATTAGCCAGAGAATGGGAGAAGAACTGGATGGTCTGGAAATGGAGGAACTGCGCGGTCTTGAGCAAAATATGGATAGTGCCCTGAAGGTCGTTCGTGAACGGAAG---TATCATGTGATCCACACACAGTGCGATACATACCGTAAAAAG---ATAAGGAACTTAGAGGACACAAACAAAAGATTCCTGAGAGCTCTGGAAGGAAGAGATGAGACTGCGGGTTTGCTGTATGCTGATTCAGGTAGGCCCGTCTGTGAATCAGATTTCGGTTTGGCCAGCGGAGGGCCTCACATGTTCGGATTTCGGGTGCAACCATGCCAACCTAATCTCCATGATTCTGGATATGGGAACGATGATCTGCGCCTTGCTTAG---CAGATTTCCAGGTGAAGAACCAGGAAGATATCTTTCATCAAGATGAATCAGTTTGATGAGGAGAATCATAAAATACCAAACTCTTTTCTGGTATTTGTTGGGAAAGTAGACCTTTAATCTACTTGTTTCAGACTCTAATACTTGCCTTT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'AP3 exon (MP & ML)') = N: 1-680; CODONPOSSET CodonPositions (CHARACTERS = 'AP3 exon (MP & ML)') = N: 1-680; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3187] TITLE 'PI exon (MP)'; LINK TAXA = Taxa7; DIMENSIONS NCHAR=574; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aristolochia_K325homo_AS2_allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_K555_2_K653homo_K61_2_K158_1_K437_1_AC2_2_AM2_2 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_cucurbitifolia_AC2_allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CACCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_kaempferi_K158_allele2 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGAATATCCATCTCACATCCCTTACACCTTCTGCGCTCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTC----GGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_kaempferi_K160_allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATTTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGAATATCCATCTCACATCCCTTACACCTTCTGCGCTCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTC----TGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_kaempferi_K580_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTTCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_kaempferi_K61_allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---AGATTGTCTGGATGGTCATACTCCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_kaempferi_K642homo_K160allele2 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATTTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGAATATCCATCTCACATCCCTTACACCTTCTGCGCTCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTC----TGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_liukiuensis_K32_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATCAACTCCCTCCCTCTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_manshuriensis_SEST21_allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGCTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTGA---GGATTGTCTGGATGGTCATACTCCTTACCTTTGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_manshuriensis_SEST21_allele2 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTGA---GGATTGTCTGGATGGTCATACTCCTTACCTTTGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_mollissima_AM2_allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTC----GGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_moupinensis_Mou2_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTTTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGGTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGATTATCCATCTCACATCCCTTACACCTTCTGCGCGCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTACCTTGGTCACCAAGAAGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_saccata_Asa_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGATTATACATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTACCTTGGTCACCAAGATGATAAAAGGACTTGTCTTGGTAGGT Aristolochia_shimadai_AS2_allele2 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGGGAAGATATAAACTCCCTCCCACCGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_shimadai_K282_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTCAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_shimadai_K437_allele2 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---AGATTGTCTGGATGGTCATACTCCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCATGGTAGGT Aristolochia_shimadai_Setu2_allele1 TCTTCTCCAGCACGGGAAAGATGTCCGAGTTCAGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAAATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTTCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_shimadai_Setu2_allele2 TCTTCTCCAGCACGGGAAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTTCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_tanzawana_K555_allele1 TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTTCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_tanzawana_K95_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGTAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGACATAAACTCCCTTCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCAAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAGAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGTCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTACCTTGGTCACCAAGATGATAAAAAGACTTGTCTTGGTAGGT Aristolochia_westlandii_SETS36_homo TCTTCTCCAGCACGGGGAAGATGTCCGAGTTCTGCAGTCCCTCCACCACACTGGTGAAGTTGCTGGATCGATATCACAAGCAAGCGGGAAAGAAGCTTTGGGATGCTAAGCATGAGTATCTGAGCAATGAAGTTGAAAGAACCAAGAAAGAGAATGACAACATGCAGATCAAGCTGAGGCACTTGAAAGGCGAAGATATAAACTCCCTCCCACTGAAAGAACTCATGGCAATAGAGGAAGCACTTGAGGAAGGAGTTGCTGGTGTTCGTGCCAGGCAG---ATGGAAGCTTTAAAGATACATAAGAAGAAT---GGTAGAAACTTGGAAGAGGAGCACAAGTGCCTTAGTTATATCTTG---CATCAACAAGAACTGGCAATGCATGGGAATCTGAGAGAATTGGCTAATGGGTATCCAGAAAGAGAAAAGGATTATCCATCTCAGATCCCTTACACCTTCTGCGCGCAACCTAGCCAGCCCAATCTGCATCAGAAAAAGTAA---GGATTGTCTGGATGGTCATACTCCTTACCTTG------------------------------------ ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'PI exon (MP)') = N: 1-574; CODONPOSSET CodonPositions (CHARACTERS = 'PI exon (MP)') = N: 1-574; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3188] TITLE 'PI intron (ML)'; LINK TAXA = Taxa8; DIMENSIONS NCHAR=259; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . ] Aristolochia_K580homo_K325homo_K61_1_Setu2_2_AM2_1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_cucurbitifolia_AC2_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACAGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_kaempferi_K158_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGATCACTGATAGTGGGGCATGGTCTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_kaempferi_K158_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTTCCAAAGAAATGAACCAGTAATATTAACAAGGTTTCTACATGTGATTTGTATATTAAACTACATAAGTTTTCCATTTTGACAG Aristolochia_kaempferi_K61allele2_K437allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACATTGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_kaempferi_K642homo_K160homo GTATGCCATTTCTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACAGATGATGGTTTCACTGCTGTTATGGTGATCCAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_liukiuensis_K32_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACAGATGATGGTTTCACTGCTGTTATGGTGATCCAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTCCCAAAGAAATGAACCAGTTATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACCACACAAGTTTTCTATTTTGACAG Aristolochia_liukiuensis_K32_allele2 GTATGCCCTTACTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACAGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAATTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_manshuriensis_SEST21_allele1 GTATGCTCTTTCTTTTTCATAATAAACTGATTAAACTTTCCTTATCTCTTAAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTCCATTCTGTGGTCACTGATAGTGGGATATGGTCTTCAAAATGCTTCTGAGCTTGGGCCTGTTCCACATTCAGTTTTTTAAGTTCCCAAAGAAATGAACCAGTGATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACTACACAAGTTTTCCATTTTGACAG Aristolochia_manshuriensis_SEST21_allele2 GTATGCTCTTTCTTTTTCATAATAAACTGATTAAACTTTCCTTATCTCTTAAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTCTCCATTCTGTGGTCACTGATAGTGGGATATGGTCTTCAAAATGCTTCTGAGCTTGGGCCTGTTCCACATTCAGTTTTTTAAGTTCCCAAAGAAATGAACCAGTGATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACTACACAAGTTTTCCATTTTGACAG Aristolochia_mollissima_AM2_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTCCCAAAGAAATGAACCAGTTATATTAACAAGGTTTCTACTTGTGACTTGTATATTAAACCACACAAGTTTTCTATTTTGACAG Aristolochia_moupinensis_Mou2_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTCTTCACAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTT---------CCCAAAGAAATGAACTAGTAATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACTACACAAGTTTTCCATTTTGACAG Aristolochia_moupinensis_Mou2_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTCTTCACAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTT---------CCCAAAGAAATGAACCAGTAATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACTACACAAGTTTTCCATTTTGACAG Aristolochia_saccata_Asa_homo GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCA--CTGTGGTCACTGATAGTGGGATATGGTCGTCACAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTT---------CCCAAAGAAATGAACCAGGAATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACTACACAAGTTTTCCATTTTGACAG Aristolochia_shimadai_AS2_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATTGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_shimadai_AS2_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATTACTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAATTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_shimadai_K282_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTCATCTCTTGAACTGATAATGGTTTCACTGCTGTTATGGTGATCTAAATTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATAAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_shimadai_K282_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTCATCTCTTGAACTGATAATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_shimadai_K437_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTT--AAGTTCCCACAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_shimadai_Setu2allele1_AC2allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_tanzawana_K95homo_K555homo_K653homo GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTT--AAGTTCCCACAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_westlandii_SETS36_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTGAACTCCCTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTCTTCAAAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTTT--------CCCAAAGAAATGAACCAGTAATATTAACAAGGTTTCTACTTGTGATTCGTATATTAAACCACACAAGTTTTCCATTTTGACAG Aristolochia_westlandii_SETS36_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTGAACTCTCTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCATTCTGTGGTCACTGATAGTGGGATATGGTCTTCAAAATACTTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAGTTCCCAAACAAATGAACCAGTAATATTAACAAGGTTTCTACTTGTGATTCGTATATTAAACCACACAAGTTTTCCATTTTGACAG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'PI intron (ML)') = N: 1-259; CODONPOSSET CodonPositions (CHARACTERS = 'PI intron (ML)') = N: 1-259; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3185] TITLE 'PI intron (MP)'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=261; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aristolochia_K580homo_K325homo_K61_1_Setu2_2_AM2_1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_cucurbitifolia_AC2_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACAGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_kaempferi_K158_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGATCACTGATAGTGGGGCATGGTCTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_kaempferi_K158_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTTCCAAAGAAATGAACCAGTAATATTAACAAGGTTTCTACATGTGATTTGTATATTAAACTACATAAGTTTTCCATTTTGACAG Aristolochia_kaempferi_K61allele2_K437allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACATTGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_kaempferi_K642homo_K160homo GTATGCCATTTCTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACAGATGATGGTTTCACTGCTGTTATGGTGATCCAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_liukiuensis_K32_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACAGATGATGGTTTCACTGCTGTTATGGTGATCCAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTCCCAAAGAAATGAACCAGTTATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACCACACAAGTTTTCTATTTTGACAG Aristolochia_liukiuensis_K32_allele2 GTATGCCCTTACTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACAGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAATTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_manshuriensis_SEST21_allele1 GTATGCTCTTTCTTTTTCATAATAAACTGATTAAACTTTCCTTATCTCTTAAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTCCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTCAAAATGCTTCTGAGCTTGGGCCTGTTCCACATTCAGTTTTTTAAAGTTCCCAAAGAAATGAACCAGTGATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACTACACAAGTTTTCCATTTTGACAG Aristolochia_manshuriensis_SEST21_allele2 GTATGCTCTTTCTTTTTCATAATAAACTGATTAAACTTTCCTTATCTCTTAAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTCTCCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTCAAAATGCTTCTGAGCTTGGGCCTGTTCCACATTCAGTTTTTTAAAGTTCCCAAAGAAATGAACCAGTGATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACTACACAAGTTTTCCATTTTGACAG Aristolochia_mollissima_AM2_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTCCCAAAGAAATGAACCAGTTATATTAACAAGGTTTCTACTTGTGACTTGTATATTAAACCACACAAGTTTTCTATTTTGACAG Aristolochia_moupinensis_Mou2_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTCACAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTT----C-----CCCAAAGAAATGAACTAGTAATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACTACACAAGTTTTCCATTTTGACAG Aristolochia_moupinensis_Mou2_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTCACAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTT----C-----CCCAAAGAAATGAACCAGTAATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACTACACAAGTTTTCCATTTTGACAG Aristolochia_saccata_Asa_homo GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAC--CTGTGGTCACTGATAGTGGGATATGGTCGTCACAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTT----C-----CCCAAAGAAATGAACCAGGAATATTAACAAGGTTTCTACTTGTGATTTGTATATTAAACTACACAAGTTTTCCATTTTGACAG Aristolochia_shimadai_AS2_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATTGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_shimadai_AS2_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATTACTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAATTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_shimadai_K282_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTCATCTCTTGAACTGATAATGGTTTCACTGCTGTTATGGTGATCTAAATTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATAAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_shimadai_K282_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTCTTCATCTCTTGAACTGATAATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_shimadai_K437_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTT--AAAGTTCCCACAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_shimadai_Setu2allele1_AC2allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTTTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTCCCAAAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_tanzawana_K95homo_K555homo_K653homo GTATGCCCTTTCTTTTTCATAATAAACTGATTAAACTCTTTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTTACAATGCCTCTGAGCTTGGGCATTTTCCATATTCAGTTTT--AAAGTTCCCACAGAAATGAACCAGTAATATTAACAAGGTTTATACTTGTGATTTGTATATTAAACTACACAAGTTTTCTATTTTGACAG Aristolochia_westlandii_SETS36_allele1 GTATGCCCTTTCTTTTTCATAATAAACTGATTGAACTCCCTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTCAAAATGCTTCTGAGCTTGGGCATTTTCCATATTCAGTTT---C-----CCCAAAGAAATGAACCAGTAATATTAACAAGGTTTCTACTTGTGATTCGTATATTAAACCACACAAGTTTTCCATTTTGACAG Aristolochia_westlandii_SETS36_allele2 GTATGCCCTTTCTTTTTCATAATAAACTGATTGAACTCTCTTTATCTCTTGAACTGATGATGGTTTCACTGCTGTTATGGTGATCTAAACTGTTCAATTCTGTGGTCACTGATAGTGGGATATGGTCTTCAAAATACTTCTGAGCTTGGGCATTTTCCATATTCAGTTTTT-AAAGTTCCCAAACAAATGAACCAGTAATATTAACAAGGTTTCTACTTGTGATTCGTATATTAAACCACACAAGTTTTCCATTTTGACAG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'PI intron (MP)') = N: 1-261; CODONPOSSET CodonPositions (CHARACTERS = 'PI intron (MP)') = N: 1-261; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3186] TITLE 'AP3 intron (MP)'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=375; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aristolochia_K642_1_K160_1_K95_1_K555_1_AC2_2_K653_2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_Setu2allele1_K580homo GTCAGCTCTGTATATCACTCTTACCCTAAGGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCGTTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CTTTCTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_cucurbitifolia_AC2_allele1 GTCAGCTCTGTATATAACTTTTACCCTAATGAAATATTAGCTTATACAATTGCCACTTGAACTTCAGAAGAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTT-CT--CATTTGGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K158_allele1 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCCGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTCGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K158_allele2 GTCAGCTCTGTATATAACTTTTACCCTAATGAAATATTAGCTTATACAATTGCCACTTGAACTTCAGAAGAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTTCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K160_allele2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTCCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGACCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K325_allele1 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAGGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGGCAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCTATACTATTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTT-CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K325_allele2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCTATACAATTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTT-CT--CATTTTGGTCAACTTCACCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K61_allele1 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAGGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGGCAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCTATACAATTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTCTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K61_allele2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCGTTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CTTTCTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K642_allele2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGACCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_liukiuensis_K32_homo GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACAGAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGATGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_manshuriensis_SEST21_allele1 GTCAGCTCTGTATATAACTCT-ACCCTAATGAAATATTAGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGAAAGAAGTCAAGAAGACAGCC--TTTTTCTTGAACGTATTTTGAGTGTAGATTAAACAGGTTTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATTCATTTTCCTGTCCACCATTGCAGTTGCTACTATTCCTTTCTTTGTTTTTTTT--CTTTCATTTTGGTCAACTTCTCCTACGCTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_manshuriensis_SEST21_allele2 GTCAGCTCTGTATATAACTCT-ACCCTAATGAAATATTAGCCTATAGAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGGAAGAAAACTTTCAGAAAAATTCTGCGAAAGAAGTCAAGAAGACAGCC--TTTTTCTTGAACGTATTTTGAGTGTAGATTAAACAGGTTTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATTCATTTTCCTGTCCACCATTGCAGTTGCTACTATTCCTTTCTTTGTTTTTTTT--CTTTCATTTTGGTCAACTTCTCCTACGCTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_mollissima_AM2_allele1 GTCAGCTCTGTATATAACTTTTACCCTAATGAAATATTAGCTTATACAATTGCCACTTGAACTTCAGAAGAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACTTTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTTTCT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_mollissima_AM2_allele2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACAGAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACTTTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTTTCT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_moupinensis_allele1 GTCAGCTCTGTATATAACTCTTACCCTAATATAATATTAGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTATGCGAAAGAAGTCAAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTTTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTATTTGTTTTTTTTTTCTTTCTTTTTTGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_moupinensis_allele2 GTCAGCTCTGTATATAACTCTTACCCTAATGAAATATTAGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTTTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTATTTGTTTTTTTTT-CTTTCTTTTTTGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_saccata_Asa_allele1 GTCAGCTCTGTATATAACTCTTACCCTAATGAAATATTAGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAATTTCTGCGAAAGAAGTCTAGAAGACGGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATGCATTTTCCTGTCCTCCATTGCAGTTGCTTCTATTCCTTGCTTTGCTTTTTTT--CTTTCTTTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_saccata_Asa_allele2 GTCAGCTCTGTATATAACTCTTACCCTAATGAAATATTAGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAATTTCTGCGAAAGAAGTCTAGAAGACGGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCTCCATTGCAGTTGCTTCTATTCCTTGCTTTGCTTTTTTT--CTTTCTTTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_shimadai_AS2_homo GTCAGCTCTGTATATAACTTTTACCCTAATGAAATATTAGCTTATACAATTGCCACTTGAACTTCAGAAGAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_shimadai_K282_homo GTCAGCTCTGTATATAACTTTTACCCTAATGAAATATTAGCTTATACAATTGCCACTTGAACTTCAGAAGAGGAACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_shimadai_K437_allele1 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAGGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGGCAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCTATACAATTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTT-CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_shimadai_K437_allele2 GTCAGCTCTGTATATAACTTTTACCCTAATGAAATATTAGCTTATACAATTGCCACTTGAACTTCAGAAGAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGCGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_shimadai_Setu2_allele2 GTCAGCTCTGTATATCACTCTTACCCTAAAGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCGTTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CTTTCTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_tanzawana_K555_allele2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACAATTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTT-CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_tanzawana_K653_allele1 GTCAGCTCTGTATATCACTCTTACCCTAAGGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_tanzawana_K95_allele2 GTCTGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGC--------AAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACAATTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTT-CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_westlandii_SETS36 GTCAGCTCTGTATATAACTCTTACCCTAATGAAATATTAGCTTAGACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCTGAAAAATTCTGCGAAAGAAGTCAAGAAGACAGCAACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCTCCATTGCAGTTGCTTCTATTCCTTGCTTTGCTTTTTTT--CTTTCTTTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGATGCAG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'AP3 intron (MP)') = N: 1-375; CODONPOSSET CodonPositions (CHARACTERS = 'AP3 intron (MP)') = N: 1-375; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3194] TITLE 'AP3 intron (ML)'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=373; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aristolochia_K642_1_K160_1_K95_1_K555_1_AC2_2_K653_2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_Setu2allele1_K580homo GTCAGCTCTGTATATCACTCTTACCCTAAGGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCGTTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CTTTCTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_cucurbitifolia_AC2_allele1 GTCAGCTCTGTATATAACTTTTACCCTAATGAAATATTAGCTTATACAATTGCCACTTGAACTTCAGAAGAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTT-CT--CATTTGGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K158_allele1 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCCGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTCGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K158_allele2 GTCAGCTCTGTATATAACTTTTACCCTAATGAAATATTAGCTTATACAATTGCCACTTGAACTTCAGAAGAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTTCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K160_allele2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTCCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGACCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K325_allele1 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAGGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGGCAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCTATACTATTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTT-CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K325_allele2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCTATACAATTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTT-CT--CATTTTGGTCAACTTCACCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K61_allele1 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAGGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGGCAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCTATACAATTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTCTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K61_allele2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCGTTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CTTTCTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_kaempferi_K642_allele2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGACCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_liukiuensis_K32_homo GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACAGAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGATGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_manshuriensis_SEST21_allele1 GTCAGCTCTGTATATAACTCT-ACCCTAATGAAATATTAGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCGAAGAAGTCAAGAAGACAGC--TTTTTCTTGAACGTATTTTGAGTGTAGATTAAACAGGTTTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATTCATTTTCCTGTCCACCATTGCAGTTGCTACTATTCCTTTCTTTGTTTTTTTT--CTTTCATTTTGGTCAACTTCTCCTACGCTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_manshuriensis_SEST21_allele2 GTCAGCTCTGTATATAACTCT-ACCCTAATGAAATATTAGCCTATAGAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGGAAGAAAACTTTCAGAAAAATTCTGCGAAGAAGTCAAGAAGACAGC--TTTTTCTTGAACGTATTTTGAGTGTAGATTAAACAGGTTTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATTCATTTTCCTGTCCACCATTGCAGTTGCTACTATTCCTTTCTTTGTTTTTTTT--CTTTCATTTTGGTCAACTTCTCCTACGCTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_mollissima_AM2_allele1 GTCAGCTCTGTATATAACTTTTACCCTAATGAAATATTAGCTTATACAATTGCCACTTGAACTTCAGAAGAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACTTTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTTTCT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_mollissima_AM2_allele2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACAGAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACTTTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTTTCT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_moupinensis_allele1 GTCAGCTCTGTATATAACTCTTACCCTAATATAATATTAGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTATGCGAAGAAGTCAAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTTTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTATTTGTTTTTTTTTTCTTTCTTTTTTGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_moupinensis_allele2 GTCAGCTCTGTATATAACTCTTACCCTAATGAAATATTAGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTTTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTATTTGTTTTTTTTT-CTTTCTTTTTTGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_saccata_Asa_allele1 GTCAGCTCTGTATATAACTCTTACCCTAATGAAATATTAGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAATTTCTGCGAAGAAGTCTAGAAGACGGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATGCATTTTCCTGTCCTCCATTGCAGTTGCTTCTATTCCTTGCTTTGCTTTTTTT--CTTTCTTTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_saccata_Asa_allele2 GTCAGCTCTGTATATAACTCTTACCCTAATGAAATATTAGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAATTTCTGCGAAGAAGTCTAGAAGACGGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCTCCATTGCAGTTGCTTCTATTCCTTGCTTTGCTTTTTTT--CTTTCTTTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_shimadai_AS2_homo GTCAGCTCTGTATATAACTTTTACCCTAATGAAATATTAGCTTATACAATTGCCACTTGAACTTCAGAAGAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_shimadai_K282_homo GTCAGCTCTGTATATAACTTTTACCCTAATGAAATATTAGCTTATACAATTGCCACTTGAACTTCAGAAGAGGAACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_shimadai_K437_allele1 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAGGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGGCAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCTATACAATTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTT-CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_shimadai_K437_allele2 GTCAGCTCTGTATATAACTTTTACCCTAATGAAATATTAGCTTATACAATTGCCACTTGAACTTCAGAAGAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGCGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_shimadai_Setu2_allele2 GTCAGCTCTGTATATCACTCTTACCCTAAAGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCGTTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CTTTCTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_tanzawana_K555_allele2 GTCAGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACAATTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTT-CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_tanzawana_K653_allele1 GTCAGCTCTGTATATCACTCTTACCCTAAGGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTT--CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_tanzawana_K95_allele2 GTCTGCTCTGTATATCACTCTTACCCTAATGAAATATTTGCTTATACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCAGAAAAATTCTGCG--------AAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACAATTTCCTGTCCACCATTGCAGTTGCTTCTATTCCTTTCTTTGTTTTTTTTT-CT--CATTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGGCGCAG Aristolochia_westlandii_SETS36 GTCAGCTCTGTATATAACTCTTACCCTAATGAAATATTAGCTTAGACAATTGCTACTTGAACTTCAGAAAAGGGACACAGAAGCATGAAAGAAAACTTTCTGAAAAATTCTGCGAAGAAGTCAAGAAGACAGCACTTTTTCTTGAACGTATTT-GAGTGTAGATTAAACAGGTGTTTAGAACTTAGCCACTGATTCTGCTCTCTATTGTTCTACTGTAACAG---GTGAGTAAAGTTCATTCTGATCACCTGTTCCATACATTTTCCTGTCCTCCATTGCAGTTGCTTCTATTCCTTGCTTTGCTTTTTTT--CTTTCTTTTTGGTCAACTTCTCCTACACTTCTGTACCTCATCCTGAATTCCTGGATGCAG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'AP3 intron (ML)') = N: 1-373; CODONPOSSET CodonPositions (CHARACTERS = 'AP3 intron (ML)') = N: 1-373; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3189] TITLE 'cpDNA (MP)'; LINK TAXA = Taxa6; DIMENSIONS NCHAR=2932; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aristolochia_kaempferi_group_Type1 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGAGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTACTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------C--GAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTGTTCTTAT-AAAAAAAAAAA-------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGCCAAAAGCAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTAAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGAAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTTATTTCGGATAACGATTTTCACCAAAATAGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAGGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type10 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAAA--------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTCTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTA-?----CGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type11 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTTGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTCTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTA-?----CGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type12 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTCTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTAATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type13 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTT-CCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAAA--------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTCTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTAATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type14 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGCAAAGAAGGAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTCTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTAATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type15 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTAA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAA----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTCTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type16 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTAA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAA----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTCTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATCGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCGGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type17 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTAA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAA----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTCTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAA-TGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATCGATATGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCGGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type18 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAA----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTCTCAACTCATTTTTATGTTCCAGCTTCAATGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTTAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTTATTTCGGATAACTATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTCATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type19 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAACCAATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTAA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAAA--------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAAA-GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTGATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTTCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type2 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGAGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTACTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------C--GAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTGTTCTTAT-AAAAAAAAAA--------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAAA-GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGCCAAAAGCAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTAAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGAAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTTATTTCGGATAACGATTTTCACCAAAATAGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAAAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAGGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type20 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAACCAATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTAA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAAA--------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGTCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTGATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTTCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type21 CATCTCTCCCAATTCA-----CAATTAAAAAATTTAGAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAACCAATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTAA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAAA--------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTGATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTTCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type22 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAACCAATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCACTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTAA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAAA--------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTGATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type23 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAACCAATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTAA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAAA--------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTGATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type24 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAAA--ACAGAATC------C--------ATCGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type25 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGG-------TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type26 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTCTTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGG-------TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAAAA-GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type27 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGG-------TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTTGTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGGTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type28 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGGTATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------ACAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCCTTATTAGTTTTTCA-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTCATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type29 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGG-------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACATGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type3 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGAGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTACTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------C--GAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTGTTCTTAT-AAAAAAAAAA--------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGCCAAAAGCAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTAAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGAAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTTATTTCGGATAACGATTTTCACCAAAATAGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCCTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAGGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type30 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAA-TGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type31 CATCTCTCCCAATTCA-----CAATTATAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCATTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCCATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type32 CATCTCTCCCAATTCA-----CAATTATAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGGGGGGG-TTT----ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCCATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type33 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAAAA-GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACTATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type34 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTCGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type35 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAA-TGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATAATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type36 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTTAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATAATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type37 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAA-----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAA----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTAAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTATTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type38 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGGGGG---TTTT---ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAA------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type39 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAAAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type4 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGGG-----TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---ACAGAATC------C--------AGGGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type40 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTAA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAA----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTCTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTTAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATCGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCGGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type41 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTTCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTCTCAACTCATTTTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTCAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGACTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type42 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTAGTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGG-------TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type43 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGG-------TTTTTT-ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAA--------ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGACGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTGATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTTATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type5 CATCTCTCCCAATTCCAATTCCAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGGGGGG--TTT----ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---ACAGAATACAGAATC--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAACGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGACTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAAGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type6 CATCTCTCCCAATTCCAATTCCAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTCTTTTTTATTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGGGGGGGGTTT----ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAAA--ACAGAATACAGAATC--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAACGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGACTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAAGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type7 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGGGGG---TTTT---ATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type8 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAA---ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTATTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_kaempferi_group_Type9 CATCTCTCCCAATTCA-----CAATTAAAAAATTTATAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTATTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTTTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATAAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGAACTATTTGAATTCCTATCAGAAGTTTCTTTATGATACTTATGATAGGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAA----ACAGAATC------C--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTATTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTAT-AAAAAAAAA---------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAA---GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGCCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTTATTGCGAATAATTATCGAATCGAAAAAAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTTTTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGCAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGATAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGTAATAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTTAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCTAAATTTTGTAATGGATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_manshuriensis_SEST21 CATCTCTCCCAATTCA-----CAATTAAAAAATTTAGAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTCTTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTTTTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGGAGATCAAATGAAATGATTTGTCTGGTTTGATAAACA---------------------------GCAAATTTATGTTACGAAAACAGCAATAACAACAAGGACTATTTGAATTCCTATCAGAAATTTCTTTATGATAA--------GGCGTTTTTTTCATAGGCGTTTTTTTCTTATTAGTTTTTCA-------------CTTTTTTATTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAA--------ACAGAATA-AGAATC--------ATTTGATTTGTATTAA--------?GTATTATAATCCCCTTTTTCTTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAACGAAACGAATACTATTCTTATTAAAAAAAAAAAA------CGAAGTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAAAAGGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATATAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCGTTTTCAGCATTCTAATGCTATCTTGATTACGTCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAATAAATGTCCGATATCAAGTTGATCGGTTAATTCAATACTCAATAAGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTATTGATTTCCACCTATTTTCCCTTCTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGATAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATA-------ATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TTAATGGATCGACTGTTTACGAATCGATGGAAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGCTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTTCTTATTTCGGGTAACGATTTTCACCAAAATAGATTCGTTAGGAAAAGCAATAATTTTGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAGTTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATTTCATAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTAAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTCTCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGATAATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCACTTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTATATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCCATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCTTTGGCTAAAGCGAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_moupinensis_Mou2 CATCTCTCCCAATTCA-----CAATTAAAAAATTTTTAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTCTTTTTTCTTTATCTTTCTTTATTCTATCCTTTATTCTATAATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACCTGAAATGATTTGTCTGGTTTGATAAACGAAAATTTCTGTTACGAAAACAGCAATAGCAACAAGGACTATTTGAATTCCTATCAGAAGTTTCTTTATGATAA--------GGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAAAAAACAGAATACCGAATA--CAGAATATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTCTTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTA-----AAAAAAAAAAAAAAAAAAA---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAAA-G-AGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCACTCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTTTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGTCTCACCCCTTTGTTCGACAAAGGACCCATTCATATTCAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAATAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGTCGTTGTTCCTTATTTATCAGCATATTTATTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATCTGATAATATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGAAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGGTAACGATTTTCACCAAAATAGATTCGTTAGGAAAAGCAAGAATTTGGATTCTCAAATCATATCAGAAGCTTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCATAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTAAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTATTTTTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCGAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTGTCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_saccata_Asa CATCTCTCCCAATTCA-----CAATTAAAAAATTTTAAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTCTTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AATTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCACTTTTGATTTAGTGGGGGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACCTGAAATGATTTGTCTGGTTTGATAAACGAAAATTTCTGTTACGAAAACAGCAATAGCAACAAGGACTATTTGAATTCCTATCAGAAGTTTCTTTATGATAA--------GGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAAAAAAAA-ACAGAATACAGAATC--------ATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTCTTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATTAAACGAATACTATTCTTATTAAAAAAAAAAA-------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAA-----GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAACGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTAATTACGTCTCATCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAATAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTACCATACAGCCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAATAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTATTGATTTCCTACTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAAGAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATCTGATAATATTTAGA-------TTGATAATTTTGTGAAGGATTCCTGCCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGAAAATTTAGGTTATGACAACAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGGTAACGATTTTCACCAAAATAGATTCGTTAGGAAAAGCAAGAATTTGGATTCTCAAATCATATCAGAAGCCTTTGCAATCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCATAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTAAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCCACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTATTT?TCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATCATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTCTCTAATTAGTTCCTTGGCTAAAGCGAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT Aristolochia_westlandii_SETS36 CATCTCTCCCAATTCA-----CAATTAAAAAATTTAGAATTTAGATGTGACGTGTGAAGTAAAGATTGATAAAAGTATTTTTTCTTTATCTTTCTTTATTCTATA-----------AATCCTATAACATAATTTTATTAATATTAAC-AGTTTGGATAATGATTCGAAACGGATATTTCCAATAGAAAGAAGA-------GAGTACCCCTTTTGATTTAGTGGGGGGG------TTCTTTTATTCCCTCGGCCCGGCCGGGTAGTGGCCGGGCCGTTCTTTGTTCCAATGAATCGTAGATCAAATGAAATGATTTGTCTGGTTTGATAAACCTGAAATGATTTGTCTGGTTTGATAAACGCAAATTTCTGTTACGAAAACAGCAATAGCAACAAGGACTATTTGAATTCCTATCAGAAGTTTCTTTATGATAA--------GGCGTTTTTTTA--------------CTTATTAGTTTTTCA-------------A-------TTTTTCCTTTTATCTATTTACTTACTTGAATAAAAAAAAAA-------ACAGAATACACAATAATCACAATATTGGATTTGTATTACTTTGTATTAGTATTATAATCCCCTTTTTCTTCAAGGTAAAGCTTTGTTTGAACACTTGAGTCCACAAATGAAACGAATACTATTCTTATTAAAAAAAAAAAA------A---GTTTTTGCTTCAAAAAATCGATGGGGAAATTGAAAAAAAAAAA--GGAGGGTGGAGCTATGGATTGGATTCTTTCACAACTCAACTCATTA----------TTTATGTTCCAGCTTCAATGGCTTCTTCAATCCGGGCCTGTCAATAACAACTCCATCAGA------CAAAAGATAGAATTTGTTATTTAAATGATTTTCCTATTCTATCAAGCACCCGTTGGAACACACGAAGACGCCATTTTCAGCATTCTAATGCTATCTTGATTACGTCTCACCCCTTTGTTCGACAAAGGACCCATTCATATACAA-----TAATAATGAAATGTGTCGAAATTAATTGCGAATAATTATCGAATCGAAAATAAATGTCCGATATCAAGTTGATCGGTTAATTCAATAA------AGAAATAGAAATGGGAGTTAGCGCCCGATTTCGCCGGTATCATACAACCAAATCGAATTCAACCGTTTATTTATTCAATGAGTGAATTTTGAAGTTCAACCAACCCTTTATTCAAGGAAAAAATATCAAGAATATGAATAAGAATCATAAGTAAGTGTTTTATTTATCTATCATTATAGACAATCCCATACAAATTCTCTATGGAATTCGAACCTGAACTCTGTTTATGATTCATCATTTCTATCTTATTGGCCGTTGTTCCTTATTTATCAGCATATTTATTGATTTCCGCCTATTTTCCCTTTTAGGATTTATTTACATATACAACATGTATCGCTGTCAAGAGTTAATTTCTTATTCTATTTAGATTCAAAAAATAAGAGAGAATTTGCAAAACAAAGATTGGGTTGCGCCATACATATGAAAGAGTATACAATAATGATGTATTTGGCGAATCAAATACCATGGTCTAATAATGAACATGAACCATTTTAATTAATTGATAATCTGATAATATTTAGCTATTTAGTTGATAATTTTGTGAAGGATTCCTGTCCTGTGAAAGATTTCATTCGCGCCTAATACATGTACATGTCGAGTAGACCTTGTCGTTGTGAGAATTCTTAATTCATGAG-----TAAATGGATCGACTGTTTACGAATCGATGGGAAATTTAGGTTATGACAATAAATTTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATCAACAGAACCCTTTTAATTTTACTTATTTCGGGTAACGATTTTCACCAAAATCGATTCGTTAGGAAAAGCAAGAATTTGGATTCTCAAATCATATCAGAAGCCTTTGCAGTCATTATGGAAATTCCACTCTCCCTGCAATTAGTATCTTGCCTGGAAGAAAAAGAAGTAGCAAAATCTCATAATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTAAATCATGTGTTAGATATCTTAATACCCCACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAACTGCTGGATACAAGATGCTCCCTCTTTGCATTTATTGAGATTTTTTATCTACGAGTATCGTAATTCGAATAGTCTCGTTAGTTCAAAGAAATCCATTCCTTTTTTTC---TTCTCAAAAGAGAATCAAAGATTATTCTTGTTTCTATATAATTCTCATGTATATGAATGCGAATCCATATTCGTTTTTCTCGGTAAACAAGCCTCTCGTTTACGATCAACATCCTCTGGAGCCTTTCTTGAGCGAACATATTTCTATGGAAAAATAGAGCATTTTTTAGTAGTGCTTTGTAATCATTTTCAGAAGACCCTGTGGTTACTTAAGGACCCTTTTGCACATTATGTCAGATACCAAGGAAAATTAATTCTGGCATCAAAAGGGGCTCATCTTATGATGAAGAAATGGAAATATCACCTTGTCAATTTATGGCAGTGCAATTTTCAATTGTGGTCTCAACCGGGCAGAATCCATATAAACCGATTATACAATAATTCCTTCTATTTTATGGGCTATCTCTCAAGTCTACGAATAGGCCCTTCGATGGTAAGGAGTCAAATGCTAGAAAATGCATTTCTAATAGATACTTCTATTAATAGATTTGAGACCCTAGTCCCAATTTTTTTTCTAATTAGTTCCTTGGCTAAAGCGAAATTTTGTAATGTATCAGGACATCCTGTTAGTAAGCCGGCTTGGTCCGATTTGTCCGATTCTGATATTATCGATCGATTTGGGCGTATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAACAT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'cpDNA (MP)') = N: 1-2932; CODONPOSSET CodonPositions (CHARACTERS = 'cpDNA (MP)') = N: 1-2932; END; BEGIN TREES; TITLE Tb9048; LINK TAXA = Taxa6; TRANSLATE 1 Aristolochia_kaempferi_group_Type1, 2 Aristolochia_kaempferi_group_Type2, 3 Aristolochia_kaempferi_group_Type3, 4 Aristolochia_kaempferi_group_Type4, 5 Aristolochia_kaempferi_group_Type5, 6 Aristolochia_kaempferi_group_Type6, 7 Aristolochia_kaempferi_group_Type7, 8 Aristolochia_kaempferi_group_Type8, 9 Aristolochia_kaempferi_group_Type9, 10 Aristolochia_kaempferi_group_Type10, 11 Aristolochia_kaempferi_group_Type11, 12 Aristolochia_kaempferi_group_Type12, 13 Aristolochia_kaempferi_group_Type13, 14 Aristolochia_kaempferi_group_Type14, 15 Aristolochia_kaempferi_group_Type15, 16 Aristolochia_kaempferi_group_Type16, 17 Aristolochia_kaempferi_group_Type17, 18 Aristolochia_kaempferi_group_Type18, 19 Aristolochia_kaempferi_group_Type19, 20 Aristolochia_kaempferi_group_Type20, 21 Aristolochia_kaempferi_group_Type21, 22 Aristolochia_kaempferi_group_Type22, 23 Aristolochia_kaempferi_group_Type23, 24 Aristolochia_kaempferi_group_Type24, 25 Aristolochia_kaempferi_group_Type25, 26 Aristolochia_kaempferi_group_Type26, 27 Aristolochia_kaempferi_group_Type27, 28 Aristolochia_kaempferi_group_Type28, 29 Aristolochia_kaempferi_group_Type29, 30 Aristolochia_kaempferi_group_Type30, 31 Aristolochia_kaempferi_group_Type31, 32 Aristolochia_kaempferi_group_Type32, 33 Aristolochia_kaempferi_group_Type33, 34 Aristolochia_kaempferi_group_Type34, 35 Aristolochia_kaempferi_group_Type35, 36 Aristolochia_kaempferi_group_Type36, 37 Aristolochia_kaempferi_group_Type37, 38 Aristolochia_kaempferi_group_Type38, 39 Aristolochia_kaempferi_group_Type41, 40 Aristolochia_kaempferi_group_Type40, 41 Aristolochia_kaempferi_group_Type39, 42 Aristolochia_kaempferi_group_Type42, 43 Aristolochia_kaempferi_group_Type43, 44 Aristolochia_saccata_Asa, 45 Aristolochia_westlandii_SETS36, 46 Aristolochia_moupinensis_Mou2, 47 Aristolochia_manshuriensis_SEST21; TREE Fig._1_cpDNA = [&R] (((1,2,3),((4,(5,6),7,8,9,41),((10,11),12,13,14,15,(16,17,40),18,39),((19,20,21),22,23),24,((25,26,27,28,29,42,43),(30,(31,32),33,34,(35,36),37),38))),(((44,46),45),47)); END; BEGIN TREES; TITLE Tb9055; LINK TAXA = Taxa5; TRANSLATE 1 Aristolochia_saccata_Asa_homo, 2 Aristolochia_westlandii_SETS36_homo, 3 Aristolochia_moupinensis_Mou2_homo, 4 Aristolochia_manshuriensis_SEST21_allele1, 5 Aristolochia_manshuriensis_SEST21_allele2, 6 Aristolochia_kaempferi_K642homo_K160allele2, 7 Aristolochia_kaempferi_K160_allele1, 8 Aristolochia_kaempferi_K158_allele2, 9 Aristolochia_tanzawana_K95_homo, 10 Aristolochia_tanzawana_K555_allele1, 11 Aristolochia_K555_2_K653homo_K61_2_K158_1_K437_1_AC2_2_AM2_2, 12 Aristolochia_shimadai_Setu2_allele1, 13 Aristolochia_shimadai_Setu2_allele2, 14 Aristolochia_kaempferi_K580_homo, 15 Aristolochia_shimadai_K437_allele2, 16 Aristolochia_kaempferi_K61_allele1, 17 Aristolochia_K325homo_AS2allele1_AM2allele1, 18 Aristolochia_shimadai_AS2_allele2, 19 Aristolochia_liukiuensis_K32_homo, 20 Aristolochia_shimadai_K282_homo, 21 Aristolochia_cucurbitifolia_AC2_allele1; TREE Fig._3_PIexon = [&R] (1,(2,(3,((6,7),8)),(4,5),((9,10),11,((12,13),14),(15,16),17,18,19,20,21))); END; BEGIN TREES; TITLE Tb9050; LINK TAXA = Taxa4; TRANSLATE 1 Aristolochia_saccata_Asa_allele1, 2 Aristolochia_saccata_Asa_allele2, 3 Aristolochia_westlandii_SETS36_allele1, 4 Aristolochia_westlandii_SETS36_allele2, 5 Aristolochia_moupinensis_Mou2_allele1, 6 Aristolochia_moupinensis_Mou2_allele2, 7 Aristolochia_manshuriensis_SEST21_homo, 8 Aristolochia_kaempferi_K160allele1_K642allele1, 9 Aristolochia_kaempferi_K642_allele2, 10 Aristolochia_kaempferi_K160_allele2, 11 Aristolochia_tanzawana_K95_allele1, 12 Aristolochia_tanzawana_K95allele2_K653allele1, 13 Aristolochia_tanzawana_K653_allele2, 14 Aristolochia_tanzawana_K555_allele1, 15 Aristolochia_K555allele2_K437allele1_AS2allele1, 16 Aristolochia_K580homo_Setu2homo, 17 Aristolochia_kaempferi_K61_homo, 18 Aristolochia_shimadai_K437_allele2, 19 Aristolochia_kaempferi_K158_allele1, 20 Aristolochia_kaempferi_K158allele2_K325homo, 21 Aristolochia_liukiuensis_K32_homo, 22 Aristolochia_shimadai_K282_homo, 23 Aristolochia_cucurbitifolia_AC2_allele1, 24 Aristolochia_cucurbitifolia_AC2_allele2, 25 Aristolochia_AS2allele2_AM2allele2, 26 Aristolochia_mollissima_AM2_allele1; TREE Fig._3_AP3_exon = [&R] ((1,2,(3,4)),((5,6),7,(8,9,10),11,12,13,14,15,16,17,18,19,20,21,22,(23,24),25,26)); END; BEGIN TREES; TITLE Tb9057; LINK TAXA = Taxa8; TRANSLATE 1 Aristolochia_saccata_Asa_homo, 2 Aristolochia_westlandii_SETS36_allele1, 3 Aristolochia_westlandii_SETS36_allele2, 4 Aristolochia_moupinensis_Mou2_allele2, 5 Aristolochia_kaempferi_K158_allele1, 6 Aristolochia_shimadai_Setu2allele1_AC2allele1, 7 Aristolochia_shimadai_K282_allele2, 8 Aristolochia_shimadai_K282_allele1, 9 Aristolochia_shimadai_AS2_allele1, 10 Aristolochia_shimadai_AS2_allele2, 11 Aristolochia_liukiuensis_K32_allele1, 12 Aristolochia_liukiuensis_K32_allele2, 13 Aristolochia_cucurbitifolia_AC2_allele2, 14 Aristolochia_mollissima_AM2_allele2, 15 Aristolochia_moupinensis_Mou2_allele1, 16 Aristolochia_manshuriensis_SEST21_allele2, 17 Aristolochia_manshuriensis_SEST21_allele1, 18 Aristolochia_kaempferi_K642homo_K160homo, 19 Aristolochia_tanzawana_K95homo_K555homo_K653homo, 20 Aristolochia_K580homo_K325homo_K61_1_Setu2_2_AM2_1, 21 Aristolochia_kaempferi_K61allele2_K437allele2, 22 Aristolochia_shimadai_K437_allele1, 23 Aristolochia_kaempferi_K158_allele2; TREE Fig._3_PI_intron = [&R] ((1,((2,3),(16,17)),4,15),(((((18,(12,13)),(7,8)),(19,22),20,21,6,9,10),5,(11,14)),23)); END; BEGIN TREES; TITLE Tb9053; LINK TAXA = Taxa3; TRANSLATE 1 Aristolochia_saccata_Asa_homo, 2 Aristolochia_westlandii_SETS36_homo, 3 Aristolochia_moupinensis_Mou2_homo, 4 Aristolochia_manshuriensis_SEST21_homo, 5 Aristolochia_kaempferi_K160_allele1, 6 Aristolochia_kaempferi_K160allele2_K642homo, 7 Aristolochia_K95homo_K555allele2_K580homo_K653homo, 8 Aristolochia_tanzawana_K555_allele1, 9 Aristolochia_kaempferi_K61_aellele2, 10 Aristolochia_K61allele1_K325homo_K437homo_Setu2homo, 11 Aristolochia_kaempferi_K158_allele1, 12 Aristolochia_kaempferi_K158_allele2, 13 Aristolochia_cucurbitifolia_AC2_homo, 14 Aristolochia_shimadai_K282_allele2, 15 Aristolochia_K282allele1_AS2allele2_K32allele2_AM2allele2, 16 Aristolochia_shimadai_AS2_allele1, 17 Aristolochia_liukiuensis_K32_allele1, 18 Aristolochia_mollissima_AM2_allele1; TREE Fig._3_PhyA = [&R] (1,(2,(3,4,((5,6),(7,8),((9,10,(11,12)),13,14),15,16,17,18)))); END; BEGIN TREES; TITLE Tb9054; LINK TAXA = Taxa3; TRANSLATE 1 Aristolochia_saccata_Asa_homo, 2 Aristolochia_westlandii_SETS36_homo, 3 Aristolochia_moupinensis_Mou2_homo, 4 Aristolochia_manshuriensis_SEST21_homo, 5 Aristolochia_kaempferi_K160_allele1, 6 Aristolochia_kaempferi_K160allele2_K642homo, 7 Aristolochia_K95homo_K555allele2_K580homo_K653homo, 8 Aristolochia_tanzawana_K555_allele1, 9 Aristolochia_kaempferi_K61_aellele2, 10 Aristolochia_K61allele1_K325homo_K437homo_Setu2homo, 11 Aristolochia_kaempferi_K158_allele1, 12 Aristolochia_kaempferi_K158_allele2, 13 Aristolochia_cucurbitifolia_AC2_homo, 14 Aristolochia_shimadai_K282_allele2, 15 Aristolochia_K282allele1_AS2allele2_K32allele2_AM2allele2, 16 Aristolochia_shimadai_AS2_allele1, 17 Aristolochia_liukiuensis_K32_allele1, 18 Aristolochia_mollissima_AM2_allele1; TREE Fig._3_PhyA = [&R] (1,(2,(3,4,((5,6),(7,8),((9,10,(11,12)),13,14),15,16,17,18)))); END; BEGIN TREES; TITLE Tb9051; LINK TAXA = Taxa1; TRANSLATE 1 Aristolochia_saccata_Asa_allele1, 2 Aristolochia_saccata_Asa_allele2, 3 Aristolochia_westlandii_SETS36, 4 Aristolochia_moupinensis_allele1, 5 Aristolochia_moupinensis_allele2, 6 Aristolochia_manshuriensis_SEST21_allele1, 7 Aristolochia_manshuriensis_SEST21_allele2, 8 Aristolochia_kaempferi_K642_allele2, 9 Aristolochia_kaempferi_K160_allele2, 10 Aristolochia_K642_1_K160_1_K95_1_K555_1_AC2_2_K653_2, 11 Aristolochia_tanzawana_K653_allele1, 12 Aristolochia_tanzawana_K95_allele2, 13 Aristolochia_tanzawana_K555_allele2, 14 Aristolochia_kaempferi_K325_allele1, 15 Aristolochia_kaempferi_K325_allele2, 16 Aristolochia_kaempferi_K61_allele1, 17 Aristolochia_kaempferi_K61_allele2, 18 Aristolochia_kaempferi_K158_allele1, 19 Aristolochia_kaempferi_K158_allele2, 20 Aristolochia_Setu2allele1_K580homo, 21 Aristolochia_shimadai_Setu2_allele2, 22 Aristolochia_shimadai_K282_homo, 23 Aristolochia_shimadai_K437_allele1, 24 Aristolochia_shimadai_K437_allele2, 25 Aristolochia_shimadai_AS2_homo, 26 Aristolochia_liukiuensis_K32_homo, 27 Aristolochia_cucurbitifolia_AC2_allele1, 28 Aristolochia_mollissima_AM2_allele2, 29 Aristolochia_mollissima_AM2_allele1; TREE Fig._3_AP3_intron = [&R] (((1,2),3),(((4,5),(6,7)),((8,9),10,11,(12,13,((14,16,23),15)),(17,20,21),18,(26,28)),(19,22,24,25,27,29))); END; BEGIN TREES; TITLE Tb9058; LINK TAXA = Taxa2; TRANSLATE 1 Aristolochia_saccata_Asa_homo, 2 Aristolochia_westlandii_SETS36_allele1, 3 Aristolochia_westlandii_SETS36_allele2, 4 Aristolochia_moupinensis_Mou2_allele2, 5 Aristolochia_moupinensis_Mou2_allele1, 6 Aristolochia_manshuriensis_SEST21_allele2, 7 Aristolochia_manshuriensis_SEST21_allele1, 8 Aristolochia_kaempferi_K642homo_K160homo, 9 Aristolochia_tanzawana_K95homo_K555homo_K653homo, 10 Aristolochia_K580homo_K325homo_K61_1_Setu2_2_AM2_1, 11 Aristolochia_kaempferi_K61allele2_K437allele2, 12 Aristolochia_shimadai_K437_allele1, 13 Aristolochia_kaempferi_K158_allele2, 14 Aristolochia_kaempferi_K158_allele1, 15 Aristolochia_shimadai_Setu2allele1_AC2allele1, 16 Aristolochia_shimadai_K282_allele2, 17 Aristolochia_shimadai_K282_allele1, 18 Aristolochia_shimadai_AS2_allele1, 19 Aristolochia_shimadai_AS2_allele2, 20 Aristolochia_liukiuensis_K32_allele1, 21 Aristolochia_liukiuensis_K32_allele2, 22 Aristolochia_cucurbitifolia_AC2_allele2, 23 Aristolochia_mollissima_AM2_allele2; TREE Fig._3_PI_intron = [&R] (((1,4,5),((2,3),(6,7))),((8,9,10,11,12,14,15,(16,17),18,19,(20,23),21,22),13)); END; BEGIN TREES; TITLE Tb9047; LINK TAXA = Taxa6; TRANSLATE 1 Aristolochia_kaempferi_group_Type1, 2 Aristolochia_kaempferi_group_Type2, 3 Aristolochia_kaempferi_group_Type3, 4 Aristolochia_kaempferi_group_Type4, 5 Aristolochia_kaempferi_group_Type5, 6 Aristolochia_kaempferi_group_Type6, 7 Aristolochia_kaempferi_group_Type7, 8 Aristolochia_kaempferi_group_Type8, 9 Aristolochia_kaempferi_group_Type9, 10 Aristolochia_kaempferi_group_Type10, 11 Aristolochia_kaempferi_group_Type11, 12 Aristolochia_kaempferi_group_Type12, 13 Aristolochia_kaempferi_group_Type13, 14 Aristolochia_kaempferi_group_Type14, 15 Aristolochia_kaempferi_group_Type15, 16 Aristolochia_kaempferi_group_Type16, 17 Aristolochia_kaempferi_group_Type17, 18 Aristolochia_kaempferi_group_Type18, 19 Aristolochia_kaempferi_group_Type19, 20 Aristolochia_kaempferi_group_Type20, 21 Aristolochia_kaempferi_group_Type21, 22 Aristolochia_kaempferi_group_Type22, 23 Aristolochia_kaempferi_group_Type23, 24 Aristolochia_kaempferi_group_Type24, 25 Aristolochia_kaempferi_group_Type25, 26 Aristolochia_kaempferi_group_Type26, 27 Aristolochia_kaempferi_group_Type27, 28 Aristolochia_kaempferi_group_Type28, 29 Aristolochia_kaempferi_group_Type29, 30 Aristolochia_kaempferi_group_Type30, 31 Aristolochia_kaempferi_group_Type31, 32 Aristolochia_kaempferi_group_Type32, 33 Aristolochia_kaempferi_group_Type33, 34 Aristolochia_kaempferi_group_Type34, 35 Aristolochia_kaempferi_group_Type35, 36 Aristolochia_kaempferi_group_Type36, 37 Aristolochia_kaempferi_group_Type37, 38 Aristolochia_kaempferi_group_Type38, 39 Aristolochia_kaempferi_group_Type41, 40 Aristolochia_kaempferi_group_Type40, 41 Aristolochia_kaempferi_group_Type39, 42 Aristolochia_kaempferi_group_Type42, 43 Aristolochia_kaempferi_group_Type43, 44 Aristolochia_saccata_Asa, 45 Aristolochia_westlandii_SETS36, 46 Aristolochia_moupinensis_Mou2, 47 Aristolochia_manshuriensis_SEST21; TREE Fig._1_cpDNA = [&R] (((1,2,3),((4,(5,6),7,8,9,41),((10,11,12,13,14,(15,(16,17,40)),18,39),((19,20,21),22,23)),24,((25,26,27,28,29,42,43),(30,(31,32),33,34,(35,36),37),38))),(((44,46),47),45)); END; BEGIN TREES; TITLE Tb9049; LINK TAXA = Taxa4; TRANSLATE 1 Aristolochia_saccata_Asa_allele1, 2 Aristolochia_saccata_Asa_allele2, 3 Aristolochia_westlandii_SETS36_allele1, 4 Aristolochia_westlandii_SETS36_allele2, 5 Aristolochia_moupinensis_Mou2_allele1, 6 Aristolochia_moupinensis_Mou2_allele2, 7 Aristolochia_manshuriensis_SEST21_homo, 8 Aristolochia_kaempferi_K160allele1_K642allele1, 9 Aristolochia_kaempferi_K642_allele2, 10 Aristolochia_kaempferi_K160_allele2, 11 Aristolochia_tanzawana_K95_allele1, 12 Aristolochia_tanzawana_K95allele2_K653allele1, 13 Aristolochia_tanzawana_K653_allele2, 14 Aristolochia_tanzawana_K555_allele1, 15 Aristolochia_K555allele2_K437allele1_AS2allele1, 16 Aristolochia_K580homo_Setu2homo, 17 Aristolochia_kaempferi_K61_homo, 18 Aristolochia_shimadai_K437_allele2, 19 Aristolochia_kaempferi_K158_allele1, 20 Aristolochia_kaempferi_K158allele2_K325homo, 21 Aristolochia_liukiuensis_K32_homo, 22 Aristolochia_shimadai_K282_homo, 23 Aristolochia_cucurbitifolia_AC2_allele1, 24 Aristolochia_cucurbitifolia_AC2_allele2, 25 Aristolochia_AS2allele2_AM2allele2, 26 Aristolochia_mollissima_AM2_allele1; TREE Fig._3_AP3_exon = [&R] (1,(2,(3,4),(((5,6),7,((11,14),12,13,19),16),((8,9,10),15,17,18,20,(22,25),(23,24)),(21,26)))); END; BEGIN TREES; TITLE Tb9052; LINK TAXA = Taxa1; TRANSLATE 1 Aristolochia_saccata_Asa_allele1, 2 Aristolochia_saccata_Asa_allele2, 3 Aristolochia_westlandii_SETS36, 4 Aristolochia_moupinensis_allele1, 5 Aristolochia_moupinensis_allele2, 6 Aristolochia_manshuriensis_SEST21_allele1, 7 Aristolochia_manshuriensis_SEST21_allele2, 8 Aristolochia_kaempferi_K642_allele2, 9 Aristolochia_kaempferi_K160_allele2, 10 Aristolochia_K642_1_K160_1_K95_1_K555_1_AC2_2_K653_2, 11 Aristolochia_tanzawana_K653_allele1, 12 Aristolochia_tanzawana_K95_allele2, 13 Aristolochia_tanzawana_K555_allele2, 14 Aristolochia_kaempferi_K325_allele1, 15 Aristolochia_kaempferi_K325_allele2, 16 Aristolochia_kaempferi_K61_allele1, 17 Aristolochia_kaempferi_K61_allele2, 18 Aristolochia_kaempferi_K158_allele1, 19 Aristolochia_kaempferi_K158_allele2, 20 Aristolochia_Setu2allele1_K580homo, 21 Aristolochia_shimadai_Setu2_allele2, 22 Aristolochia_shimadai_K282_homo, 23 Aristolochia_shimadai_K437_allele1, 24 Aristolochia_shimadai_K437_allele2, 25 Aristolochia_shimadai_AS2_homo, 26 Aristolochia_liukiuensis_K32_homo, 27 Aristolochia_cucurbitifolia_AC2_allele1, 28 Aristolochia_mollissima_AM2_allele2, 29 Aristolochia_mollissima_AM2_allele1; TREE Fig._3_AP3_intron = [&R] ((((1,2),3),(4,5),(6,7)),(((8,9),10,11,(12,13,((14,16,23),15)),(17,20,21),18,(26,28)),(19,22,24,25,27,29))); END; BEGIN TREES; TITLE Tb9056; LINK TAXA = Taxa7; TRANSLATE 1 Aristolochia_saccata_Asa_homo, 2 Aristolochia_westlandii_SETS36_homo, 3 Aristolochia_moupinensis_Mou2_homo, 4 Aristolochia_manshuriensis_SEST21_allele1, 5 Aristolochia_manshuriensis_SEST21_allele2, 6 Aristolochia_kaempferi_K642homo_K160allele2, 7 Aristolochia_kaempferi_K160_allele1, 8 Aristolochia_kaempferi_K158_allele2, 9 Aristolochia_tanzawana_K95_homo, 10 Aristolochia_tanzawana_K555_allele1, 11 Aristolochia_K555_2_K653homo_K61_2_K158_1_K437_1_AC2_2_AM2_2, 12 Aristolochia_shimadai_Setu2_allele1, 13 Aristolochia_shimadai_Setu2_allele2, 14 Aristolochia_kaempferi_K580_homo, 15 Aristolochia_shimadai_K437_allele2, 16 Aristolochia_kaempferi_K61_allele1, 17 Aristolochia_K325homo_AS2_allele1, 18 Aristolochia_shimadai_AS2_allele2, 19 Aristolochia_liukiuensis_K32_homo, 20 Aristolochia_shimadai_K282_homo, 21 Aristolochia_cucurbitifolia_AC2_allele1, 22 Aristolochia_mollissima_AM2_allele1; TREE Fig._3_PIexon = [&R] (1,(2,(3,((6,7),8)),(4,5),((9,10),11,(12,13),14,15,16,17,18,19,20,21,22))); END;