#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 17:11 GMT TreeBASE (cc) 1994-2008 Study reference: Braun U., Bradshaw M., Goetz M., Meeboon J., & Takamatsu S. 2017. Powdery mildew of Chrysanthemum morifolium – phylogeny and taxonomy in the context of Golovinomyces species on Asteraceae hosts. Mycoscience, 109(3): 508-519. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S20626] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=23; TAXLABELS Golovinomyces_artemisiae_AB077637_ex_Artemisia_dubia_JPN Golovinomyces_artemisiae_AB077649_ex_Artemisia_montana_JPN Golovinomyces_artemisiae_AB077659_ex_Artemisia_princeps_JPN Golovinomyces_artemisiae_AB769430_ex_Artemisia_alsinthium_LIT Golovinomyces_artemisiae_AB769431_ex_Artemisia_verlotiorum_ARG Golovinomyces_artemisiae_AB769432_ex_Artemisia_vulgaris_USA Golovinomyces_artemisiae_AB769433_ex_Nipponanthemum_nipponicum_JPN Golovinomyces_artemisiae_MUMH6848_ex_Artemisia_vulgalis_DEU Golovinomyces_artemisiae_MUMH6849_ex_Artemisia_vulgaris_UK Golovinomyces_chrysanthemi_AB077654_ex_Chrysanthemum_morifolium_JPN Golovinomyces_chrysanthemi_GLM_F047617_ex_Chrysanthemum_morifolium_DEU Golovinomyces_chrysanthemi_GLM_F048600_ex_Chrysanthemum_morifolium_DEU Golovinomyces_chrysanthemi_JKI_2250_C14_ex_Chrysanthemum_X_indicum_DEU Golovinomyces_chrysanthemi_MUMH6851_ex_Chrysanthemum_morifolium_USA Golovinomyces_macrocarpus_AB077685_ex_Achillea_millefolium_JPN Golovinomyces_macrocarpus_AB769429_ex_Achillea_millefolium_LIT Golovinomyces_macrocarpus_GQ183939_ex_Tanacetum_parthenium_AUS Golovinomyces_macrocarpus_GQ183942_ex_Tanacetum_balsamita_AUS Golovinomyces_macrocarpus_GQ183945_ex_Tanacetum_vulgare_AUS Golovinomyces_macrocarpus_GU048822_ex_Matricaria_chamomilla_KOR Golovinomyces_macrocarpus_HAL3153F_ex_Tanacetum_vulgare_DEU Golovinomyces_macrocarpus_VPRI20160_ex_Tanacetum_sp._AUS Golovinomyces_riedlianus_AB430811_ex_Galium_MUMH1301 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M40170] TITLE 'Golovinomyces ITD+28S'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1191; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Golovinomyces_artemisiae_AB077637_ex_Artemisia_dubia_JPN CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATTTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTACCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTCGTCTGAGAAAATAACTAGTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTGTGGCTT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGCGGCTGCTTGCCAATCAATCTTTCATTTC--AAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCGTCGACCGATCCTGATGTCTTCGGATGGATTTGA--------------------- Golovinomyces_artemisiae_AB077649_ex_Artemisia_montana_JPN CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATTTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTACCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTAGTCTGAGAAAATAACTAGTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTGTGGCTT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGCGGCTGCTTGCCAATCAATCTTTCATTTC--AAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_artemisiae_AB077659_ex_Artemisia_princeps_JPN CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATTTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTACCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTAGTCTGAGAAAATAACTAGTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTGTGGCTT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGCGGCTGCTTGCCAATCAATCTTTCATTTC--AAGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Golovinomyces_artemisiae_AB769430_ex_Artemisia_alsinthium_LIT CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGTGCAGAGTTGACCCTCCACCCGTGTTGACTTATTTCATGTTGCTTTGGCGGGCCAGGCGCTTGGCGTCTACCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGATCCAACCTAACTCGTGTTATCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTGTGGTTT-GGTGTTGGGGTTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACAATTCTCGCGACAGAACTCCAGCGGCTGCTAGCCAATCAATCGTTCATTTC--AAGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Golovinomyces_artemisiae_AB769431_ex_Artemisia_verlotiorum_ARG CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTA-TTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTGCCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTGTGGCTT-GGTGTTGGGGCTCGCCAGTTTGGCGGCCCTTAAAGACAGTGGCGGTGCCAGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGTGGCTGCTTGCCAATCAATCTTTCATTTC--AAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGATGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATAGCTGTTGGGA Golovinomyces_artemisiae_AB769432_ex_Artemisia_vulgaris_USA CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATTTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTACCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTCGTCTGAGAAAATAACTAGTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTGTGGCTT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGCGGCTGCTTGCCAATCAATCTTTCATTTC--AAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATAGCTGTTGGGA Golovinomyces_artemisiae_AB769433_ex_Nipponanthemum_nipponicum_JPN CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATTTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTACCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTAGTCTGAGAAAATAACTAGTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTGTGGCTT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGCGGCTGCTTGCCAATCAATCTTTCATTTC--AAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCA---------------------------------------------------------------------------------------------AAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGT---------------------------------------------------------------------------------------------------------------------- Golovinomyces_artemisiae_MUMH6848_ex_Artemisia_vulgalis_DEU CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTA-TTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTGCCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTGTGGCTT-GGTGTTGGGGCTCGCCAGTTTGGCGGCCCTTAAAGACAGTGGCGGTGCCAGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGTGGCTGCTTGCCAATCAATCTTTCATTTC--AAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGATGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTG----------------------------------------- Golovinomyces_artemisiae_MUMH6849_ex_Artemisia_vulgaris_UK CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTA-TTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTGCCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTGTGGCTT-GGTGTTGGGGCTCGCCAGTTTGGCGGCCCTTAAAGACAGTGGCGGTGCCAGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGTGGCTGCTTGCCAATCAATCTTTCATTTC--AAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGATGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTG----------------------------------------- Golovinomyces_chrysanthemi_AB077654_ex_Chrysanthemum_morifolium_JPN CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATTTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTACCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTATGGCTT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGCGGCTGCTTGCCAATCAATCTTTCAATTC--AAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGATGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGCAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATCTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_chrysanthemi_GLM_F047617_ex_Chrysanthemum_morifolium_DEU CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATTTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTACCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTATGGCTT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGCGGCTGCTTGCCAATCAATCTTTCAATTC--AAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATAGTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGATGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGCAAGTGAACGTAGGTGAGAACCCGTTAGGGTGC---------------------------------------------------------- Golovinomyces_chrysanthemi_GLM_F048600_ex_Chrysanthemum_morifolium_DEU CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATTTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTACCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTATGGCTT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGCGGCTGCTTGCCAATCAATCTTTCAATTC--AAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATAGTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGATGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGCAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATAGCTGTTGGGA Golovinomyces_chrysanthemi_JKI_2250_C14_ex_Chrysanthemum_X_indicum_DEU CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATTTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTACCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTATGGCTT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGCGGCTGCTTGCCAATCAATCTTTCAATTC--AAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGATGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGCAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTG----------------------------------------- Golovinomyces_chrysanthemi_MUMH6851_ex_Chrysanthemum_morifolium_USA CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCCGAGTTGACCCTCCACCCGTGTTGACTTATTTCATGTTGCTTTGGCGGGCCAGGCGCTGAGCGTCTACCGGCTTCGGGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTATCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCC-TCAAGCCGTGCCCTGTGTATGGCTT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACAAGTCTCGCGACAGAGCTCCAGCGGCTGCTTGCCAATCAATCTTTCAATTC--AAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATAGTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGATGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGCAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTG----------------------------------------- Golovinomyces_macrocarpus_AB077685_ex_Achillea_millefolium_JPN CAGAGCGTGAGACTCTGCCCGGGCTTGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATCTCATGTTGCTTTGGCGGGCCAGGTGCGTGGCGCCTACCGGCTTCGTGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTGTCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCCCTCAAGCCGCGCTCTGTGCGTGGATT-GGTGTTGGGGCGCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACGATTCTCGCGACAGAGCTCCAGCGGCCGCTAGCCAATCAATCTTTCCTTTC--AAGGAAATCTGGCTCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGCGGCCGCGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGATGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCACCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATAGCTGTTGGGA Golovinomyces_macrocarpus_AB769429_ex_Achillea_millefolium_LIT CAGAGCGTGAGACTCTGCCCGGGCTTGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATCTCATGTTGCTTTGGCGGGCCAGGTGCGTGGCGCCTACCGGCTTCGTGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTGTCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCCCTCAAGCCGCGCTCTGTGCGTGGATT-GGTGTTGGGGCGCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACGATTCTCGCGACAGAGCTCCAGCGGCCGCTAGCCAATCAATCTTTCCTTTC--AAGGAAATCTGGCTCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGCGGCCGCGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGATGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCACCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATAGCTGTTGGGA Golovinomyces_macrocarpus_GQ183939_ex_Tanacetum_parthenium_AUS CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATCTCATGTTGCTTTGGCGGGCCAGGTGCTTGGCGCCTACCGGCTCCGTGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTGTCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCCCTCAAGCCGCGCTCTGTGTGTGGTTT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACGAATCTCGCGACAGAGCTCCAGCGGCTGCTAGCCAATCAATCTTTCCTTTC--AAGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Golovinomyces_macrocarpus_GQ183942_ex_Tanacetum_balsamita_AUS CAGAGCGTGAGACTCTGCCCGGGCTCGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATCTCATGTTGCTTTGGCGGACCAGGTGCTTGGCGCCTACCGGCTCCGTGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTGTCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCCCTCAAGCCGCGCTCTGTGTGTGGTTT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACGAATCTCGCGACAGAGCTCCAGCGGCTGCTAGCCAATCAATCTTTCCTTTC--AAGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Golovinomyces_macrocarpus_GQ183945_ex_Tanacetum_vulgare_AUS CAGAGCGTGAGACTCTGCCCGGGCTTGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATCTCATGTTGCTTTGGCGGGCCAGGTGCTTGGCGCCTACCGGCTTCGTGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTGTCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCCCTCAAGCCGCGCTCTGTGTGTGGATT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACGATTCTCGCGACAGAGCTCCAGCGGCTGCTAGCCAATCAATCTTTCCTTTC--AAGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Golovinomyces_macrocarpus_GU048822_ex_Matricaria_chamomilla_KOR CAGAGCGTGAGACTCTGCCCGGGCTTGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATCTCATGTTGCTTTGGCGGGCCAGGTGCGTGGCGCCTACCGGCTTCGTGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTGTCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCCCTCAAGCCGCGCTCTGTGCGTGGATT-GGTGTTGGGGCGCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACGATTCTCGCGACAGAGCTCCAGCGGCCGCTAGCCAATCAATCTTTCCTTTC--AAGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Golovinomyces_macrocarpus_HAL3153F_ex_Tanacetum_vulgare_DEU CAGAGCGTGAGACTCTGCCCGGGCTTGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATCTCATGTTGCTTTGGCGGGCCAGGTGCTTGGCGCCTACCGGCTTCGTGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTGTCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCCCTCAAGCCGCGCTCTGTGTGTGGATT-GGTGTTGGGGCTCGCCAGTCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGGTGTGGTCTCTACGCGTAGTACGATTCTCGCGACAGAGCTCCAGCGGCTGCTAGCCAATCAATCTTTCCTTTC--AAGGAAATCTGGCTCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGATGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCACCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTGA-GTCTTC--------------------------------- Golovinomyces_macrocarpus_VPRI20160_ex_Tanacetum_sp._AUS CAGAGCGTGAGACTCTGCCCGGGCTTGTCCCGCGCGCAGAGTTGACCCTCCACCCGTGTTGACTTATCTCATGTTGCTTTGGCGGGCCAGGTGCTTGGCGCCTACCGGCTTCGTGCTGGCTCGTGTCCGCCAAAGACCCAACCTAACTCGTGTTGTCGTGTAGTCTGAGGAAATAACTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCCCTCAAGCCGCGCTCTGTGTGTGGATT-GGTGTTGGGGCTCGCCAGTCTGGCGGCC-----------------------------------------------------------------------------------------------------AAATCTGGCTCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAA----------------------------------------------GAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGGTTCTCCTCGGTGCACTCGACGATGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGCAATGCATCCCACCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATAGCTGTTGGGA Golovinomyces_riedlianus_AB430811_ex_Galium_MUMH1301 CAGAGCGTGAGACTCTGCCCGGGCCTGGCCCGCGTGCAGAGTTGACCCTCCACCCGTGTTGACTTATCTCATGTTGCTTTGGCGGGCCAGGTGCTCTGCGCCGACCGGCTTCGTGCTGGCTCGTGCCCGCCAGAGACTCAACCTAACTCGTGTTGTCGTGTCGTCTGAGGAAG-AATTATTGAATTGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCGTCACACCCCCTCAAGCCGCGCCGTGTGTGTGGTCT-GGTGTTGGGGCTCGCCAGCCTGGCGGCCCTTAAAGACAGTGGCGGTGCCGTCGTGGTCTCTACGCGTAGTACGATTCTCGCGACAGAGCTACAGCGGCTGCTAGCCAATCAATCCTTTTTTTTCAAAGGAAATCTGGCTCCTACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGACCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCACCCGAGGTTCTCCTCGGTGCACTCGACGATGCACAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTAGGGCGTAATGCAGCCCATCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATAGCTGTTGGGA ; END; BEGIN TREES; TITLE 'Golovinomyces ITD+28S'; LINK TAXA = Taxa1; TRANSLATE 1 Golovinomyces_chrysanthemi_MUMH6851_ex_Chrysanthemum_morifolium_USA, 2 Golovinomyces_chrysanthemi_GLM_F047617_ex_Chrysanthemum_morifolium_DEU, 3 Golovinomyces_chrysanthemi_GLM_F048600_ex_Chrysanthemum_morifolium_DEU, 4 Golovinomyces_chrysanthemi_AB077654_ex_Chrysanthemum_morifolium_JPN, 5 Golovinomyces_chrysanthemi_JKI_2250_C14_ex_Chrysanthemum_X_indicum_DEU, 6 Golovinomyces_artemisiae_AB077659_ex_Artemisia_princeps_JPN, 7 Golovinomyces_artemisiae_AB077649_ex_Artemisia_montana_JPN, 8 Golovinomyces_artemisiae_AB769433_ex_Nipponanthemum_nipponicum_JPN, 9 Golovinomyces_artemisiae_AB077637_ex_Artemisia_dubia_JPN, 10 Golovinomyces_artemisiae_AB769432_ex_Artemisia_vulgaris_USA, 11 Golovinomyces_artemisiae_AB769431_ex_Artemisia_verlotiorum_ARG, 12 Golovinomyces_artemisiae_MUMH6848_ex_Artemisia_vulgalis_DEU, 13 Golovinomyces_artemisiae_MUMH6849_ex_Artemisia_vulgaris_UK, 14 Golovinomyces_artemisiae_AB769430_ex_Artemisia_alsinthium_LIT, 15 Golovinomyces_macrocarpus_GQ183939_ex_Tanacetum_parthenium_AUS, 16 Golovinomyces_macrocarpus_GQ183942_ex_Tanacetum_balsamita_AUS, 17 Golovinomyces_macrocarpus_AB077685_ex_Achillea_millefolium_JPN, 18 Golovinomyces_macrocarpus_AB769429_ex_Achillea_millefolium_LIT, 19 Golovinomyces_macrocarpus_GU048822_ex_Matricaria_chamomilla_KOR, 20 Golovinomyces_macrocarpus_GQ183945_ex_Tanacetum_vulgare_AUS, 21 Golovinomyces_macrocarpus_VPRI20160_ex_Tanacetum_sp._AUS, 22 Golovinomyces_macrocarpus_HAL3153F_ex_Tanacetum_vulgare_DEU, 23 Golovinomyces_riedlianus_AB430811_ex_Galium_MUMH1301; TREE 'PAUP_242' = [&R] ((((((1,2,3),(4,5)),((6,7,8),(9,10)),(11,12,13)),14),((15,16),((17,18,19),20,21,22))),23); END;