#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 14:38 GMT TreeBASE (cc) 1994-2008 Study reference: Li Q., Harrington T., Mcnew D.L., & Li J. 2017. Ceratocystis uchidae, a new species on Araceae in Hawaii and Fiji. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S20648] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=26; TAXLABELS Ceratocystis_albofundus_C1048Calbofundus Ceratocystis_atrox_EF070403atrox19385 Ceratocystis_atrox_EF070404atrox19387 Ceratocystis_cercfabiensis_C3302EucGuondong Ceratocystis_cercfabiensis_C3355EucHainan Ceratocystis_cercfabiensis_KP727620cercfabien Ceratocystis_cercfabiensis_KP727643cercfabiens Ceratocystis_collisensis_KP727635collisensis Ceratocystis_corymbicola_HQ236453corymbicola Ceratocystis_corymbicola_HQ236455corymbicola Ceratocystis_ficicola_C1355FicusJapan Ceratocystis_ficicola_C1393FicusJapan Ceratocystis_fimbriata_spX_C2239CeratocystisSP Ceratocystis_fimbriata_spY_C3372EucKunmimg Ceratocystis_larium_EU881900larium Ceratocystis_obpyriformis_EU244937obpyri23806 Ceratocystis_pirilliformis_HQ236445pirCMW29825 Ceratocystis_pirilliformis_HQ236446pirCMW29822 Ceratocystis_polychroma_C2240Cpolychroma Ceratocystis_polyconidia_AY528983Cpir118128 Ceratocystis_polyconidia_EU244940polyconidia Ceratocystis_uchidae_C1714TaroHawaii Ceratocystis_uchidae_C1715ColocaHawaii2 Ceratocystis_uchidae_C1931XanthoFIJI Ceratocystis_variospora_C1963CvarioPrunus Ceratocystis_zombamontana_EU244934zombamontan ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M40281] TITLE Araceae_TEF1a; LINK TAXA = Taxa1; DIMENSIONS NCHAR=773; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ceratocystis_albofundus_C1048Calbofundus GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGATGTGGACAGCAAGCAATTGGTGTTGCCAAGCTCTACTT----GATGACGCTTTGCCCTTTC---TTCGTGCTATTGAAGGGCGGGGTAGCGTCACTGAAGTGGGGCTGCTATTAATTTT---TCTAAATGGCTTGCATGCTGTCTCCACTTTCTTGTTTCAAATCAATTCATGTACTGACATTCTTTGTACAGGAGGCTGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTTGTTGTC-TATTG-----ATTTTTTTTTTCATTATTCCATGCTAACGTCTTTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCTAAGTGGGCTGAGGCTCGTTACAACGAGATCATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACTGTTGCCTTCGTCCCCATCTCTGGTTTCAACGGT Ceratocystis_atrox_EF070403atrox19385 NNNNNNNNNNCCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTTTT-CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAATTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGGCTGAGGCTCGTTTCAACGAGATCATCAAGGGAGACTCCACCTTCATTAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGCTTCAACGGC Ceratocystis_atrox_EF070404atrox19387 NNNNNNNNNNCCATTGAGAAGTTCGAGAATAAGTCTCCCCTACTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTTTT-CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAATTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGGCTGAGGCTCGTTTCAACGAGATCATCAAGGGAGACTCCACCTTCATTAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGCTTCAACGGC Ceratocystis_cercfabiensis_C3302EucGuondong GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTTT--CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACTGCCAAGTGGGCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGTTTCAACGGT Ceratocystis_cercfabiensis_C3355EucHainan GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTTT--CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACTGCCAAGTGGGCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGTTTCAACGGT Ceratocystis_cercfabiensis_KP727620cercfabien GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTTT--CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACTGCCAAGTGGGCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGCTTCAACNNN Ceratocystis_cercfabiensis_KP727643cercfabiens GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTTT--CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACTGCCAAGTGGGCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGCTTCAACNNN Ceratocystis_collisensis_KP727635collisensis GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGTATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTGTTCTTCTGGCAATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGTTATTTTT------TCTAAATGGCTTGCATGCTGTCTCCACTTTCGTGCTTGAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTATGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTG------TTATTTTT-CCATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGCCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGGCTGAGGCTCGTTTCAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGCTTCAACNNN Ceratocystis_corymbicola_HQ236453corymbicola NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTATCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTT---CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCATT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACTGCCAAGTGGGCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Ceratocystis_corymbicola_HQ236455corymbicola NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTT---CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCATT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACTGCCAAGTGGGCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Ceratocystis_ficicola_C1355FicusJapan GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGATGCTGAGCTCTACTTTTT-GATGACGCTTTAC--TCTGTTCTTCTGGCCATCGAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCCATTT-------CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TATTC---ACACTATTTTG--CATTGTTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGGCTGAGGCTCGTTACAACGAGATCATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGTTTCAACGGT Ceratocystis_ficicola_C1393FicusJapan GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGATGCTGAGCTCTACTTTTT-GATGACGCTTTAC--TCTGTTCTTCTGGCCATCGAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCCATTT-------CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TATTC---ACACTATTTTG--CATTGTTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGGCTGAGGCTCGTTACAACGAGATCATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGTTTCAACGGT Ceratocystis_fimbriata_spX_C2239CeratocystisSP GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTATGGCCATCGAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTTT--CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTTAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ATATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACTGCCAAGTGGGCTGAGGCTCGTTTCAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACTGTTGCCTTTGTCCCCATCTCTGGTTTCAACGGT Ceratocystis_fimbriata_spY_C3372EucKunmimg GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTTT--CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACTGCCAAGTGGGCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGTTTCAACGGT Ceratocystis_larium_EU881900larium NNNNNNNNNNCCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGTATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTGTTCTTCTGGCAATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGTTATTTTT------TCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTGAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTATGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTG------TTATTTTT-CCATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGCCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGGCTGAGGCTCGTTTCAACGAGATCATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACTGTTGCCTTCGTCCCCATCTCTGGCTTCAACGGG Ceratocystis_obpyriformis_EU244937obpyri23806 NNNNNNNNNNCCATTGAGAAGTTTGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTCTACCCTCTGTTCTTCTGGCCACCGAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTT------TCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTT--TTCCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---CTT-ATCTC---TTATTATTTTT--CATTATTAGATACTAACAGCTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGTCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGCTTCAACGGC Ceratocystis_pirilliformis_HQ236445pirCMW29825 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTACCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTCTACCCTCTGTTCTTCTGGCCACCGAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTT---CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTT--TTCCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ATATTATTTTT--CATTATTAGATACTAACAGCTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGTCTGAGGCTCGTTTCAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGTNNNNNNNNN Ceratocystis_pirilliformis_HQ236446pirCMW29822 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTACCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTCTACCCTCTGTTCTTCTGGCCACCGAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTT---CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTT--TTCCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ATATTATTTTT--CATTATTAGATACTAACAGCTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGTCTGAGGCTCGTTTCAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGNNNNNNNNNNN Ceratocystis_polychroma_C2240Cpolychroma GACAAGCGTACCATCGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTTTTTCTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACTGCCAAGTGGGCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGTTTCAACGGT Ceratocystis_polyconidia_AY528983Cpir118128 NNNNNNNNNNCCATTGAGAAGTTTGAGAATAAGTCTCCCCTATTTACCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTCTACCCTCTGTTCTTCTGGCCACCGAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTT---CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTT--TTCCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ATATTACTTTT--CATTATTAGATACTAACAGCTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGTCTGAGGCTCGTTTCAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGCTTCAACGGC Ceratocystis_polyconidia_EU244940polyconidia NNNNNNNNNNCCATNGAGAAGTTTGAGAATAAGTCTCCCCTATTTACCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTCTACCCTCTGTTCTTCTGGCCACCGAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTT---CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTT--TTCCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ATATTACTTTT--CATTATTAGATACTAACAGCTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGTCTGAGGCTCGTTTCAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGCTTCAACGGC Ceratocystis_uchidae_C1714TaroHawaii GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTT---CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACTGCCAAGTGGGCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGTTTCAACGGT Ceratocystis_uchidae_C1715ColocaHawaii2 GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTT---CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACTGCCAAGTGGGCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGTTTCAACGGT Ceratocystis_uchidae_C1931XanthoFIJI GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTT---CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ACATTATTTTT--CATTATTAGATGCTAACAGTTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACTGCCAAGTGGGCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGTTTCAACGGT Ceratocystis_variospora_C1963CvarioPrunus GACAAGCGTACCATTGAGAAGTTCGAGAATAAGTCTCCCCTATTTCCCCTCATTGTTGTGGATGACATGAAATTGGCCTTGCTGAGCTCTACTTTAT-GATGACGCTTTACCCTCTG---TTCTGGCCATCCAAGGGCGGGGTAACGTCACTGAAGTGGGGCTACTATTTTTTT--CTTCTAAATAGCATGCATGCTGTCTCCACTTTCATGCTTCAATTCAATTCATGTACTGACCTTCTTTGCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCATTCTTGTCACCTTGTATATATATATATTTTCATCATCAGATGCTAACAATTTTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGATTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTTAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGGCTGAGGCTCGTTACAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACTGTTGCCTTTGTCCCCATCTCTGGTTTCAACGGT Ceratocystis_zombamontana_EU244934zombamontan NNNNNNNNNNCCATTGAGAAGTTTGAGAATAAGTCTCCCCTATTTACCCTCATTGTTGTGGACAGCATGCAATTGGTGTTGCTGAGCTCTACTTTTT-GATGACGCTCTACCCTCTGTTCTTCTGGCCACCGAAGGGCGGGGTAACGTCACTGAAGTGGGGCTGCTATTTTTTT---CTCTAAATGGCGTGCATGCTGTCTCCACTTTCGTGCTTCAATTCAATTCATGTACTGACCTT--TTCCACAGGAGGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTGTGGAAGTTCGAGACCCCCAAGTACTACGTCACTGTCATTGGTAAGCCTT---ATC-TCTTC---ATATTATTTTT--CATTATTAGATACTAACAGCTCTAAAA-CAGATGCCCCTGGTCACAGAGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGCGCTATTCTGATCATTGCTGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTGGCTTTCACCCTCGGTGTCAAGCAGCTGATTGTTGCCATCAACAAGATGGACACCGCCAAGTGGTCTGAGGCTCGTTTCAACGAGATTATCAAGGAGACCTCCACCTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTCCCCATCTCTGGCTTCAACGGC ; END; BEGIN TREES; TITLE Araceae_TEF1a; LINK TAXA = Taxa1; TRANSLATE 1 Ceratocystis_obpyriformis_EU244937obpyri23806, 2 Ceratocystis_zombamontana_EU244934zombamontan, 3 Ceratocystis_pirilliformis_HQ236446pirCMW29822, 4 Ceratocystis_pirilliformis_HQ236445pirCMW29825, 5 Ceratocystis_polyconidia_AY528983Cpir118128, 6 Ceratocystis_polyconidia_EU244940polyconidia, 7 Ceratocystis_atrox_EF070403atrox19385, 8 Ceratocystis_atrox_EF070404atrox19387, 9 Ceratocystis_ficicola_C1355FicusJapan, 10 Ceratocystis_ficicola_C1393FicusJapan, 11 Ceratocystis_cercfabiensis_KP727620cercfabien, 12 Ceratocystis_cercfabiensis_KP727643cercfabiens, 13 Ceratocystis_cercfabiensis_C3302EucGuondong, 14 Ceratocystis_fimbriata_spY_C3372EucKunmimg, 15 Ceratocystis_cercfabiensis_C3355EucHainan, 16 Ceratocystis_uchidae_C1714TaroHawaii, 17 Ceratocystis_uchidae_C1715ColocaHawaii2, 18 Ceratocystis_uchidae_C1931XanthoFIJI, 19 Ceratocystis_corymbicola_HQ236453corymbicola, 20 Ceratocystis_corymbicola_HQ236455corymbicola, 21 Ceratocystis_polychroma_C2240Cpolychroma, 22 Ceratocystis_fimbriata_spX_C2239CeratocystisSP, 23 Ceratocystis_collisensis_KP727635collisensis, 24 Ceratocystis_larium_EU881900larium, 25 Ceratocystis_albofundus_C1048Calbofundus, 26 Ceratocystis_variospora_C1963CvarioPrunus; TREE tef1_PAUP_6 = [&R] (1,((2,(3,4),(5,6)),((((7,8),((11,(13,14,15,(16,17,18,(19,20)),21,(22,(25,26)))),12)),(23,24)),(9,10)))); TREE tef1_PAUP_2 = [&R] (1,((2,3,4,(5,6)),((((7,8),(11,(12,(13,14,15,(16,17,18,(19,20)),21,(22,(25,26)))))),(23,24)),(9,10)))); TREE tef1_PAUP_3 = [&R] (1,((2,3,4,(5,6)),((((7,8),((11,(13,14,15,(16,17,18,(19,20)),21,(22,(25,26)))),12)),(23,24)),(9,10)))); TREE tef1_PAUP_1 = [&R] (1,((2,3,4,(5,6)),((((7,8),(11,12,(13,14,15,(16,17,18,(19,20)),21,(22,(25,26))))),(23,24)),(9,10)))); TREE tef1_PAUP_5 = [&R] (1,((2,(3,4),(5,6)),((((7,8),(11,(12,(13,14,15,(16,17,18,(19,20)),21,(22,(25,26)))))),(23,24)),(9,10)))); TREE tef1_PAUP_4 = [&R] (1,((2,(3,4),(5,6)),((((7,8),(11,12,(13,14,15,(16,17,18,(19,20)),21,(22,(25,26))))),(23,24)),(9,10)))); END;