#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 10:45 GMT TreeBASE (cc) 1994-2008 Study reference: Marmolejo J., Siahaan S.A., Takamatsu S., & Braun U. 2018. Three new records of powdery mildews found in Mexico with one genus and one new species proposed. Mycoscience, 59(1): 1-7. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S20692] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=13; TAXLABELS 'Cystotheca lanestris Ex_Castanea_KR048055_CHN' 'Cystotheca lanestris Ex_Myrica_AF011288_USA' 'Cystotheca lanestris Ex_Quercus_AB000933_USA' 'Cystotheca lanestris Ex_Quercus_AF011289_USA' 'Cystotheca lanestris Ex_Quercus_AF073354_KOR' 'Cystotheca lanestris Ex_Quercus_MUMH6845_MEX' 'Cystotheca tjibodensis Ex_Castanopsis_JN807325_IDN' 'Cystotheca tjibodensis Ex_Castanopsis_JN807326_IDN' 'Cystotheca wrightii Ex_Quercus_AB000932_JPN' 'Cystotheca wrightii Ex_Quercus_KF735066_KOR' 'Sawadaea nankinensis Ex_Acer_AB353763' 'Setoidium castanopsidis Ex_Castanopsis_AB743781_IDN' 'Setoidium castanopsidis Ex_Castanopsis_AB743782_IDN' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=55; TAXLABELS 'Arthrocladiella mougeotii Ex_AB022379' 'Blumeria graminis f.sp. bromi ex_Bromus_AB022362' 'Blumeria graminis f.sp. horde ex_Hordeum_AB022399' 'Blumeria graminis f.sp. tritici ex_Triticum_AB022376' 'Bulbomicroidium bauhiniicola Ex_Bauhinia_MUMH6844' Byssoascus_striatosporus_U17912 'Cystotheca lanestris Ex_Quercus_ABAB022353' 'Cystotheca wrightii Ex_Quercus_AB022355' 'Erysiphe abbreviata Ex_Quercus_AB271785' 'Erysiphe alphitoides Ex_Quercus_AB257431' 'Erysiphe aquilegiae Ex_Cimicifuga_AB022405' 'Erysiphe arcuata Ex_Carpinus_AB252473' 'Erysiphe australiana Ex_Lagerstroemia_AB022407' 'Erysiphe corylopsidis Ex_corylopsis_AB478987' 'Erysiphe glycines Ex_Desmodium_AB022397' 'Erysiphe heraclei Ex_Daucus_AB022391' 'Erysiphe hypogena Ex_Quercus_AB292727' 'Erysiphe hypophylla Ex_Quercus_AB292716' 'Erysiphe monascogera Ex_Styrax_AB331645' 'Erysiphe mori Ex_Morus_AB022418' 'Erysiphe staphyleae Ex_Staphylea_AB015922' 'Erysiphe trinae Ex_Quercus_AB022350' 'Golovinomyces adenophorae Ex_Adenophora_AB077632' 'Golovinomyces cichoracearum Ex_Solidago_AB077650' 'Golovinomyces orontii Ex_Nicotiana_AB022412' 'Golovinomyces orontii Ex_Physalis_AB077646' 'Golovinomyces sordidus Ex_Plantago_AB077657' 'Leveillula duriaei Ex_Salvia_AB080475' 'Leveillula lanuginosa Ex_Daucus_AB042641' 'Leveillula saxaouli Ex_Haloxylon_AB080469' 'Leveillula taurica Ex_Artemisia_AB080470' 'Leveillula taurica Ex_Helianthus_AB080472' 'Microidium phyllanthi Ex_Phyllanthus_AB120754' 'Microidium phyllanthi Ex_Phyllanthus_AB120755' 'Microidium phyllanthi reticulti Ex_Phyllanthus_AB120758' 'Neoerysiphe galeopsidis Ex_Acanthus_AB329670' 'Neoerysiphe galeopsidis Ex_Lamium_AB329674' 'Neoerysiphe galii Ex_Galium_AB329681' 'Neoerysiphe hiratae Ex_Cacalia_AB329669' 'Parauncinula septata Ex_Quercus_AB022420' 'Phyllactinia ailanthi Ex_Ailanthus_AB080380' 'Phyllactinia angulata Ex_Quercus_AB080464' 'Phyllactinia carpinicola Ex_Carpinus_AB080420' 'Phyllactinia fraxini Ex_Fraxinus_AB080451' 'Phyllactinia hemipteleae Ex_Hemiptelea_AB080430' 'Phyllactinia linderae Ex_Litsea_AB080421' 'Phyllactinia moricola Ex_Morus_AB022401' 'Pleochaeta shiraiana Ex_Celtis_AB022403' 'Podosphaera filipendulae Ex_Filipendula_AB022384' 'Podosphaera longiseta Ex_Prunus_AB022423' 'Podosphaera pannosa Ex_Rosa_AB022347' 'Podosphaera tridactyla Ex_Prunus_AB022393' 'Podosphaera xanthii Ex_Melothria_AB022410' 'Sawadaea polyfida Ex_Acer_AB022364' 'Sawadaea tulasnei Ex_Acer_AB022366' ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=37; TAXLABELS 'Leveillula cylindrospora Ex_Noaea_AB080468' 'Leveillula lanuginosa Ex_Daucus_AB042641' 'Leveillula quilanensis Ex_Chondrilla_AB080478' 'Leveillula saxaouli Ex_Haloxylon_AB080469' 'Leveillula taurica Ex_Artemisia_AB080470' 'Leveillula taurica Ex_Impatiens_AB080473' 'Phyllactinia adesmiae Ex_Adesmia_LC108834' 'Phyllactinia alni Ex_Alnus_AB080411' 'Phyllactinia angulata Ex_Quercus_AB080464' 'Phyllactinia betulae Ex_Betula_AB080396' 'Phyllactinia broussonetiae kaempferi_ex_Broussonetia_AB080382' 'Phyllactinia cassiae fistulae_ex_Cassia_AB691227' 'Phyllactinia cassiae fistulae_ex_Cassia_AB691228' 'Phyllactinia chubutiana Ex_Lycium_AB243690' 'Phyllactinia enkianthi Ex_Rhododendron_AB080408' 'Phyllactinia eupteleae Ex_Euptelea_AB080388' 'Phyllactinia fraxini Ex_Fraxinus_AB080451' 'Phyllactinia fraxini Ex_Syringa_AB080436' 'Phyllactinia fraxinicola Ex_Fraxinus_AB080383' 'Phyllactinia guttata Ex_Acer_AB080433' 'Phyllactinia hamamelidis Ex_Hamamelis_AB080410' 'Phyllactinia juglandis Ex_Juglans_AB080422' 'Phyllactinia kakicola Ex_Diospyros_AB080381' 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_LC177377' 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_LC177378' 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_LC177379' 'Phyllactinia leveilluloides Ex_Quercus_LC108847' 'Phyllactinia magnoliae Ex_Magnolia_AB080416' 'Phyllactinia mimosae Ex_Mimosa_MUMH6846' 'Phyllactinia moricola Ex_Morus_AB080372' 'Phyllactinia obclavata Ex_Spathodea_LC108846' 'Phyllactinia obclavata Ex_Tabebuia_LC108832' 'Phyllactinia paliuri Ex_Paliurus_AB080458' 'Phyllactinia pterostyracis Ex_Pterostyrax_AB080403' Phyllactinia_sp._ex_Rhabdaclema_LC108841 'Pleochaeta polychaeta Ex_Celtis_LC108836' 'Pleochaeta shiraiana Ex_Celtis_LC108831' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M45255] TITLE Phyllctinieae_28S_37_taxa; LINK TAXA = Taxa3; DIMENSIONS NCHAR=603; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Leveillula cylindrospora Ex_Noaea_AB080468' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATACGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCC 'Leveillula lanuginosa Ex_Daucus_AB042641' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCC 'Leveillula quilanensis Ex_Chondrilla_AB080478' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGACGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCC 'Leveillula saxaouli Ex_Haloxylon_AB080469' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCC 'Leveillula taurica Ex_Artemisia_AB080470' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGCGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTCCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGCAATGAAAGTGAACGTAGGTGAGAACCC 'Leveillula taurica Ex_Impatiens_AB080473' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGAAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGACGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia adesmiae Ex_Adesmia_LC108834' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTGGCTCCCTTC--GGGGGGTGTTATAGCCTGCGACGCAATACCGCCAACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGCAA------------------------- 'Phyllactinia alni Ex_Alnus_AB080411' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-TAT-CGACGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia angulata Ex_Quercus_AB080464' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCACGCGGCTCAGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGG-GGC-GCACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGTGTCGTTGATCATCCAACG-TTCTCGT-TGGTGCACTCGGCGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCTTTTC--GGGGAGTGTTATAGCCCGCGGCGTAATACCGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATGCGCGAAATGAAAGTGAACATAGGTGAGAACCC 'Phyllactinia betulae Ex_Betula_AB080396' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTT-CGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia broussonetiae kaempferi_ex_Broussonetia_AB080382' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCAG-TGTCCGGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAGACACTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC--GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTTGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTG-AAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia cassiae fistulae_ex_Cassia_AB691227' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTTCGGGCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-TGATACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGTGTCGCTGATCATCCGAAG-TTTTCTT-TGGTGCACTCGACGA-CACACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTCGTAGGAACGTGGCTTCCCTC--GGGGAGTGTTATAGCCTGCGGCGCAATACTGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCTATGCGAGTGTTTGGGTGTG-AAACCCATACGCGAAATGAAAGTGAACGTAGGTGAGACCCC 'Phyllactinia cassiae fistulae_ex_Cassia_AB691228' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTTCGGGCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-TGATACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGTGTCGCTGATCATCCGAAG-TTTTCTT-TGGTGCACTCGACGA-CACACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTCGTAGGAACGTGGCTTCCCTC--GGGGAGTGTTATAGCCTGCGGCGCAATACTGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCTATGCGAGTGTTTGGGTGTG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGACCCC 'Phyllactinia chubutiana Ex_Lycium_AB243690' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-ACACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGTTGATCATCCAACG-TTTTCGT-TGGTGCACTCGACGA-CGCGCAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCTTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCAAGTGTTTGGGTGCA-AAACCCATGCGCGGAATGAAAGTGAACGC------------ 'Phyllactinia enkianthi Ex_Rhododendron_AB080408' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTT-CGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCGCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia eupteleae Ex_Euptelea_AB080388' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TGT-CGGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAGACTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC--GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia fraxini Ex_Fraxinus_AB080451' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGT-GGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-CGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTC--GGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia fraxini Ex_Syringa_AB080436' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGT-GGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-CGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTC--GGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia fraxinicola Ex_Fraxinus_AB080383' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGT-GGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-CGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGCAGGAACGTAGCTCTTTTC--GGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia guttata Ex_Acer_AB080433' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGT-GGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-CGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTGGGAACGTAGCTCTCTTC--GGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia hamamelidis Ex_Hamamelis_AB080410' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTT-CGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia juglandis Ex_Juglans_AB080422' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-CGT-CGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACTGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia kakicola Ex_Diospyros_AB080381' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTT-CGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCATCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_LC177377' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-CAACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCATCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTAGGAACGTAGCTCCTTAC--GGGGAGTGTTATAGCCTGCGGCGCAATACCGCCTACCCCGACCGAGGACCGCGCTTTGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGAGAAACCCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_LC177378' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-CAACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCATCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTAGGAACGTAGCTCCTTAC--GGGGAGTGTTATAGCCTGCGGCGCAATACCGCCTACCCCGACCGAGGACCGCGCTTTGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGAGAAACCCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_LC177379' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTTTGGTCCGGCCTAAGTTCCGTGGAACCGGACGTCAGAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-CAACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCATCGCTGATCATCCAAAG-TTTTCTT-TGGTGCACTCGACGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCGCCTACCCCGACCGAGGACCGCGCTTTGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCCCTGCGAGTGTTTGGGTG-------------------------------------------- 'Phyllactinia leveilluloides Ex_Quercus_LC108847' AGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCACGCGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGTATCGTTGATCATCCAACG-TTCTCGT-TGGTGCACTCGGCGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCCGCGGCGCAATACTGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATGCGCGAAATGAAAGTGAACATAGGTGAGAACCC 'Phyllactinia magnoliae Ex_Magnolia_AB080416' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTT-CGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia mimosae Ex_Mimosa_MUMH6846' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGC-GCACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGTTGATCATCCAAAG-TTCTCTT-TGGTGCACTCGGCGA-GGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGCCGTAGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACTGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCTATGCGAGTGTTTGGGTGCA-A---------------------------------------- 'Phyllactinia moricola Ex_Morus_AB080372' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCAG-TGT-CGGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG---CTCTT-TGGTGCACTTGACGA-CGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC--GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTG-AAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia obclavata Ex_Spathodea_LC108846' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTGCGGTCCGGTCTAAGTTCCTTGGAATAGGACGTCGTAGAGGGTGAGAACCCCGTGTGCGGCCGG-GAC-GCACGGCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCCGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGAGGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGATCGTAGGAATGTAGCTCCTTTC--GGGGAGTGTTATAGCCTACGGTGCAATACCGCCTACGCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCTATGCGAGTGTTTGGGTGCA-AAACCCATCCGCGCAATGAAAGTGAACGCAGGTGAGAACCC 'Phyllactinia obclavata Ex_Tabebuia_LC108832' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGATGTGCGGTCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAGCCCCGTGTGCGGCCGG-GAC-GCACGTCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCCGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGAGGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGATCGTAGGAATGTAGCTCCTTTC--GGGGAGTGTTATAGCCTACGGTGCAATACCGCCTACGCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCTATGCGAGTGTTTGGGTGCA-AAACCCATCCGCGCAATGAAAGTGAACGCAGGTGAGAACCC 'Phyllactinia paliuri Ex_Paliurus_AB080458' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TGT-CGGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAGACTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Phyllactinia pterostyracis Ex_Pterostyrax_AB080403' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TGT-CGGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCTAAAGACTCTCTT-TGGTGCACTCGACGA-CGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC--GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCC Phyllactinia_sp._ex_Rhabdaclema_LC108841 AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GAC-GCACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCGGATCATCCAAAG-TTTTCTT-TGGTGCACTCGGCGA-TGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTAGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATGTCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCC----------------------------------- 'Pleochaeta polychaeta Ex_Celtis_LC108836' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGAAGC-CTGTACCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTTGGGCGTTGGTGATCATCCTGAG-TTTTCTCATGGTGCACTCGGCGA-CGCACAGGCCAGCATCGGTTTGGGTGGTTGGAAAAAGGTCTTGGGAACGTAGCTCTTCTTCGGGGGAGTGTTATAGCCCGGGATGCAATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCC 'Pleochaeta shiraiana Ex_Celtis_LC108831' AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTAGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-TGC-CTGTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTTGGTGATCATCCGGAG-TTTTCTC-TGGTGCACTCGGCAA-TGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTAGGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCCTGGGCGCAATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M45254] TITLE Bauhinia_Microidium_28S; LINK TAXA = Taxa2; DIMENSIONS NCHAR=772; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Arthrocladiella mougeotii Ex_AB022379' AAGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-AGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGCCG-CGGCCTACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGACCCTAGGAACGTAGCTCCCTTC--GGGGCGTGTTATAGCCTAGGGTGCAATGCAGCCTACCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTACGTGAGAACCCGTAA------GGGTGCATCATCGAC 'Blumeria graminis f.sp. bromi ex_Bromus_AB022362' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGATCCAT---TAGGAGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGC--GACGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATGC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACCTGTGGAATGTAGCTCCTTTC--GGGGAGTGTTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATAA------GGGGGCATCATCGAC 'Blumeria graminis f.sp. horde ex_Hordeum_AB022399' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACC-CAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGGT---TACGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGT--AGTGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGAGTACTCAGTGC--CATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC--GGGGAGTGTTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACC------------------------------------------------------------------------------------------------------ 'Blumeria graminis f.sp. tritici ex_Triticum_AB022376' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGTT---TACGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGT--GGCGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATGC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC--GGGGAGTGTTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATAA------GGGGGCATCATCGAC 'Bulbomicroidium bauhiniicola Ex_Bauhinia_MUMH6844' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCGGGCTCCTT---C-GGAGCTCGAGTTGTAATTTGCAGAAGATGCTTTGGGTTTGCTGGCTCGATCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTACGTGATCG-TGGCCGGCACC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCTTCACTGTTCAGCCAGAGTTAT-CTCTGGTGCACTCGGTGTCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAAGCCGTAGGAATGTAGCTCCTCTC--GAGGAGTGTTATAGCCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGTCCTTTCGAGGACTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCGAAACCCAGGCGCGGAATGAAAGTGAACGTAGGTGAGAGCCCGTTA------GGGCGCATCATCGAC Byssoascus_striatosporus_U17912 ----------------------------------------------------------AAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTT---T-GGGGTCCGAGTTGTAATTTGGAGAAGATGCTTCGGG--TACGGTCCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCG-GTGGCCGTGCC--CGTGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCCATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGTCGATCATCCTGGGTTCG-CCCGGGTGCACTCGGCCGCGCTCAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTCGGGAACGTGGCTCCCCTC--GGGGAGTGTTATAGCCCGAGGTGCAATGCAGCCTACCTGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC------------------------------------------------------------------------------------------------------------------------- 'Cystotheca lanestris Ex_Quercus_ABAB022353' TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---T-GGAGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGG--TATGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTTGTC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCTGGGGTTCT-CCCCGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGAGGAATGTAGCTGTCTCTCGGGGCAGTGTTATAGCCTCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCGTTA------GGGTGCATCATCGAC 'Cystotheca wrightii Ex_Quercus_AB022355' TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---C-GGGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGG--CGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGTCGGGGTTCT-CCCCGGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGTGAGGGGAATGTAGCTGTCTCTCGGGGCAGTGTTATAGCCCCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTTA------GGGTGCATCATCGAC 'Erysiphe abbreviata Ex_Quercus_AB271785' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCG-AGGCCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGCTGCCGATCACCCGGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC--GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGCAGGTG-------------------------------- 'Erysiphe alphitoides Ex_Quercus_AB257431' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC--GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT------------------------------------------------------------------- 'Erysiphe aquilegiae Ex_Cimicifuga_AB022405' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCA-TGGCCCGCGCC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC--GGGGAGTGTTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGAC 'Erysiphe arcuata Ex_Carpinus_AB252473' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCTGCGCC--TGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAGTTCT-CTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACG{CT}AGGTG-------------------------------- 'Erysiphe australiana Ex_Lagerstroemia_AB022407' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTGGTAAC-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCG-TGGCTTGCGCC--TGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGACTTGGGCATCGCTGATCATCCGGGGGTAT-CTCCGGTGCACTCGACGATGCACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCTGTGGGAACGTGGCTCCTTTC--GAGGAGTGTTATAGCCCACGGTGCAATGCAGCCCATCCGGACCGAGGACCGCG--CCCTTCGGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTT-----GGGGTGCATCATCGAC 'Erysiphe corylopsidis Ex_corylopsis_AB478987' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG--------------------------------------------------------------AATCTGGCTCCGT---CTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-CAGCCTGCGCC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCGTGAGTTCT-CTCTCGTGCACTCGTCAGCGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC--GGAGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCTTCATT---GGAGGCGCATCATCGAC 'Erysiphe glycines Ex_Desmodium_AB022397' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCG-AGGTTTGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTTGATCATCTAGAGTTTT-CTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT--GGGGAGTGTTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTG-AAACCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCCTTT-----GGGGTGCATCATCGAC 'Erysiphe heraclei Ex_Daucus_AB022391' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---T-GGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC--GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTTT---GGGGGCGCATCATCGAC 'Erysiphe hypogena Ex_Quercus_AB292727' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCAGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC--GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGC-AAACCCATACGCGGAATGAAAGTGAACG-------------------------------------- 'Erysiphe hypophylla Ex_Quercus_AB292716' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-CGGCCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTGGCTCCCCTC--GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT------------------------------------------------------------------- 'Erysiphe monascogera Ex_Styrax_AB331645' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAG???????????????????????????GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTG---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCTCTTC--GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCAGACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGAC 'Erysiphe mori Ex_Morus_AB022418' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---C-GGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCTGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGACCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCTGATCATCCAGAGTTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTCTCGGGGGAGTGTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGCAGGTG-------------------------------- 'Erysiphe staphyleae Ex_Staphylea_AB015922' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---G-GGAGTCCGAGTTGTAATTTGTAGAAGCTGCTTTGGG-TTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCTGCGCC--TATGTAAAGCGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGGGTGCACTCGTCAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCG--CCTTT--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGT--------------------------------- 'Erysiphe trinae Ex_Quercus_AB022350' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTGACAGCTCAAATTTGAAATCTGGCTCCGT---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGCAGAATCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCG-AGGTTTGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGCC---AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCTACCAGACTTGGGCGCTGCCGATCATCCCGAGTTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCCTTCGGGGCAGTGTTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCG--CCTTC--GGGTTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTTACATCAATGCGAGTGTTTGGGCGTG-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTGTAAAGGGGGTGCATCATCGAC 'Golovinomyces adenophorae Ex_Adenophora_AB077632' TTGACCTCGAATCAGGTAGGGATACCCG------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---C-GGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGG-AGGTCGGCGCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCG-TGGCCGACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC--GGGGAGTGTTATAGCCTAGGGCGTCATGCAGCCCATCCGGACCGAGGACCGCG--CCTTT--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTCT------GGGTGCATCATCGAC 'Golovinomyces cichoracearum Ex_Solidago_AB077650' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-AGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCG-TGGCCTACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGGTTCT-CCTCGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCGAGGAACGTAGCTCTCTTC--GGGGAGTGTTATAGCCTCGGGCGCAATGCAACCCATCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTCA------GGGTGCATCATCGAC 'Golovinomyces orontii Ex_Nicotiana_AB022412' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-AGGTGAGCTCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGCCCG-TGGCCTATGCC--CGTGTAAGGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC--GGGGAGTGTTATAGCCTAGGGCGTAATGCAGCCTATCTGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGTGCATCATCGAC 'Golovinomyces orontii Ex_Physalis_AB077646' ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATTTGGCTCCTG---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-AGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCG-CGGCCTACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCGATGCACAGGCCAGCATCGGTTTGGATGGCTGGAGAAAGGCGCTAGGAACGTAGCTCTCTTC--GGGGAGTGTTATAGCCTAGGGCGTAATGCAGCCCATCCGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTA------GGGTGCATCATCGAC 'Golovinomyces sordidus Ex_Plantago_AB077657' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-AGGGAGGCTCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCG-TGGTCTCCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCGCTTC--GGGGAGTGTTATAGCCTAGGGCGGAATGCAGCCCATCTGGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTCT------GGGTGCATCATCGAC 'Leveillula duriaei Ex_Salvia_AB080475' TTGACCTCAAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-GGGCGCCTGCC--CATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTT-CTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTTCG-----AGGGGG---------- 'Leveillula lanuginosa Ex_Daucus_AB042641' ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCCG---CGGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-GGGCGCCTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTT-CTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTTCG-----AGGGGG---------- 'Leveillula saxaouli Ex_Haloxylon_AB080469' TTGACCTCGAATC-----------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCCT---GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGCGTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-GGGCGCCTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTT-CTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACTCCGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTTCG-----AGGGGGCATCAT---- 'Leveillula taurica Ex_Artemisia_AB080470' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGCGCGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-GGGCGCCTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTC-CTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGCAATGAAAGTGAACGTAGGTGAGAACCCTTCG-----AGGGGGCATCATCGAC 'Leveillula taurica Ex_Helianthus_AB080472' ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCCT---GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-GGGCGCCTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTT-CTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC--GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTTCG-----AGGGGG---------- 'Microidium phyllanthi Ex_Phyllanthus_AB120754' ----------------------------------------------------------------------------------------------------------AGCTCAAATTTGAAATCTGGCTCCTT---T-GGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGG-TTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGTCGAGACCCTACGCC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTTGTTGATCATCCGAGGTTCTGCCTCGGTGCACTCGACAATGTGCAGGCCAGCATCGGTTTGACTGGCTGGACAAAGGTCCTAGGAACGTAACTCCTCGC--GGGGAGTGTTATAGCCTAGGGCGTCATGCAGCCCAGTCGGACCGAGGACCGCG--CCTTTT-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTT-----AGGGTGCATCATCGAC 'Microidium phyllanthi Ex_Phyllanthus_AB120755' ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCTT---T-GGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGG-TTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGTCGAGACCCTACGCC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTTGTTGATCATCCGAGGTTCTGCCTCGGTGCACTCGACAATGTGCAGGCCAGCATCGGTTTGACTGGCTGGACAAAGGTCCTAGGAACGTAACTCCTCGC--GGGGAGTGTTATAGCCTAGGGCGTCATGCAGCCCAGTCGGACCGAGGACCGCG--CCTTTT-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTT-----AGGGTGCATCATCGAC 'Microidium phyllanthi reticulti Ex_Phyllanthus_AB120758' ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTTCCT---C-GGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGG-TTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGAGACCCTACACCTATATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCATCGTTGATCATCCGAGGCTTTGCCTCGGTGCACTCAACAATGCACAGGCCAGCATCGGTTTGACTGGCTGGAAAAAGGCCCTAGGAATGTAGCTCCTTTC--GGGGAGTGTTATAGCCTAGGGCGTCATGCAGCCCAGTTAGACCGAGGACCGCG--CCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTT-----AGGGTGCATCATCGAC 'Neoerysiphe galeopsidis Ex_Acanthus_AB329670' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCGGCCG-TGACCTGTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC--GGGGAGTGTTATAGTCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGAC 'Neoerysiphe galeopsidis Ex_Lamium_AB329674' TTGACCTCGAATCAGGTAGG--------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCGGCCG-TGACCTGTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC--GGGGAGTGTTATAGTCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGAC 'Neoerysiphe galii Ex_Galium_AB329681' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGCAGGTTTGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGCCG-TGACCTGTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTCGGATGGCTGGAAAAAGGTCCTAGAAATGTAGCTCCTCGC--GGGGAGTGTTATAGTCTAGGGCGCAATGCAGCCCAACTGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGAC 'Neoerysiphe hiratae Ex_Cacalia_AB329669' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---C-GGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TTGTAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGCCG-TGACCTGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCATGGATCATCCGAGGTTCT-CCTCGGTGCACTCGATGACGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGA--GGGGAGTGTTATAGTCTAGGGCGCAATGCAGCCCACCCGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGAC 'Parauncinula septata Ex_Quercus_AB022420' TTGACCTCGGATCA--------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTACTAGCTCAAATTTGAAATCTGGCGCCCT---C-GGCGTCCGAATTGTAATTTGTAGACGATGCTTTGGG--TAGGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCC--CGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCAGGCTTCG-GGCCTGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCTAGGGCGCCATGCAGCCTACCTGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAA------GGGTGCATCATCGAC 'Phyllactinia ailanthi Ex_Ailanthus_AB080380' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-GCGTCGACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTCT-CTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACTGCCTACCTCGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTG-----AGGGGG---------- 'Phyllactinia angulata Ex_Quercus_AB080464' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-CACGCGGCTCAGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GGGCGCACGCC--TGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTTGATCATCCAACGTTCT-CGTTGGTGCACTCGGCGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCTTTTC--GGGGAGTGTTATAGCCCGCGGCGTAATACCGCCTACTCCGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATGCGCGAAATGAAAGTGAACATAGGTGAGAACCCGATC----AAGGGGG---------- 'Phyllactinia carpinicola Ex_Carpinus_AB080420' ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-GCGTCGACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTCT-CTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACTGCCTACCTCGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTG-----AGGGGG---------- 'Phyllactinia fraxini Ex_Fraxinus_AB080451' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-GGGTGGGTGCT--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTT-CTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTC--GGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCG-----AGGGGGCATCATCGAC 'Phyllactinia hemipteleae Ex_Hemiptelea_AB080430' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGCACGGTCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-GGGCAGGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGCGGGAACGTAGCTCTTCTC--GGAGAGTGTTATAGCCTGCGGCGCAATACCGCCCACCTCGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTCG-----AGGGGG---------- 'Phyllactinia linderae Ex_Litsea_AB080421' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-GCGTCGACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTCT-CTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTC--GGAGAGTGTTATAGCCTGCGGTGCAATACTGCCTACCTCGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTTG-----AGGGGG---------- 'Phyllactinia moricola Ex_Morus_AB022401' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCA-GTGTCGGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGACAT-CTTTGGTGCACTTGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC--GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTG-AAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTCG-----AGGGGGCATCATCGAC 'Pleochaeta shiraiana Ex_Celtis_AB022403' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTCA---CCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG-TGCTAGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCG-GTGCCTGTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTTGGTGATCATCCGGAGTTTT-CTCTGGTGCACTCGGCAATGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTAGGGAACGTAGCTCCTCTC--GGGGAGTGTTATAGCCCTGGGCGCAATGCAGCCTACCTGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTA------GGGTG---------- 'Podosphaera filipendulae Ex_Filipendula_AB022384' ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---T-GGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGG--TGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCT-CCCTGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAA------GGGTGCATCATCGAC 'Podosphaera longiseta Ex_Prunus_AB022423' ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---C-GGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGG--TCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGTGCC--CGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCT-CCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC--GGGCAGTGTTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTGA------GGGTGCATCATCGAC 'Podosphaera pannosa Ex_Rosa_AB022347' ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---T-GGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGG--TGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGCGCC--CATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCT-CCCTGGGGTACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAA------GGGTGCATCATCGAC 'Podosphaera tridactyla Ex_Prunus_AB022393' ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---C-GGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGG--TCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGTGCC--CGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGGAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCT-CCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC--GGGCAGTGTTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTGA------GGGTGCATCATCGAC 'Podosphaera xanthii Ex_Melothria_AB022410' ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC-----GGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGG--TCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGTGCC--CGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCT-CTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTCTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAA------GGGTGCATCATCGAC 'Sawadaea polyfida Ex_Acer_AB022364' TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---C-GGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGG--TGTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGGTTCT-CCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCCACCTGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGAC 'Sawadaea tulasnei Ex_Acer_AB022366' TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACC---------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCTC-----GGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGG--TGTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGGTTCT-CCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCCACCCGGACCGAGGACCGCG--CTT----CGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGAC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M45253] TITLE Cystotheca_ITS_13_taxa; LINK TAXA = Taxa1; DIMENSIONS NCHAR=487; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Cystotheca lanestris Ex_Castanea_KR048055_CHN' CTGAGCGTGAAGCCACGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTATCTTCTCATGTTGCTTTGGCGGGCCGGGCCTTGCGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTATGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGAGTGGTGACGGGACCTGCCAGAACACCCATTCTAACAGG 'Cystotheca lanestris Ex_Myrica_AF011288_USA' ---------------CGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTATCTTCTCATGTTGCTTTGGCGGGCCGGGCCGCGTGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAAAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTGAGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAATACCCATCTTAACAGG 'Cystotheca lanestris Ex_Quercus_AB000933_USA' CTGAGCGTGAGGCCACGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTATCTTCTCATGTTGCTTTGGCGGGCCGGGCCGCGTGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAAAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTGAGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGAGTGGTGACGGGACCTGCCAGAATACCCATCTTAACAGG 'Cystotheca lanestris Ex_Quercus_AF011289_USA' ------------GCACGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTATCTTCTCATGTTGCTTTGGCGGGCCGGGCCGCGTGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAAAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTGAGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAATACCCATCTTAACAGG 'Cystotheca lanestris Ex_Quercus_AF073354_KOR' CTGAGCGTGAAGCCACGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTATCTTCTCATGTTGCTTTGGCGGGCCGGGCCTTGCGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTATGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGAGTGGTGACGGGACCTGCCAGAACACCCATTCTAACAGG 'Cystotheca lanestris Ex_Quercus_MUMH6845_MEX' CTGAGCGTGAGGCCACGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTATCTTCTCATGTTGCTTTGGCGGGCCGGGCCGCGTGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAAAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTGAGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAATACCCATCTTAACAGG 'Cystotheca tjibodensis Ex_Castanopsis_JN807325_IDN' -------------------------------------------------CCACCCGTGTCTATCTTCTCATGTTGCTTTGGCGGGCCGGGCCTCGTGCCCTCCCGGCGTCGGCTGGGACGCGCCCGCCAGAGCCCCCCTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCGTAGCTTGGTCTTGGGGCGCGCCCCGCGGGGCGGCCCTTAAATGCAGTGGCGGTGCCGTTGGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACTTGCCAAAAGGCTCATCTCATTCGG 'Cystotheca tjibodensis Ex_Castanopsis_JN807326_IDN' ---GACGTGAGGCCACGCTGGGCGCCTGGCGCCTGGCGGGGCTGACCCTCCACCCGTGTCTATCTTCTCATGTTGCTTTGGCGGGCCGGGCCTCGTGCCCTCCCGGCGTCGGCTGGGACGCGCCCGCCAGAGCCCCCCTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCGTAGCTTGGTCTTGGGGCGCGCCCCGCGGGGCGGCCCTTAAATGCAGTGGCGGTGCCGTTGGGCTCTACGCGTAGTTATTTCTCTCGCG------------------------------------------- 'Cystotheca wrightii Ex_Quercus_AB000932_JPN' CTGAGCGTGAGGCCACGCTGGGCGCCTGGCGCCAGGCGTGGCTGACCCTCCACCCGTGTCTATCTTCTCATGTTGCTTTGGCGGGCCGGGCCCTGTGCCCTCCCGGCGCCTGCTGGGACGCGCCCGCCAGAGCCACCCTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTGGCTTGGTCTTGGAGCGCGCCCCGCGGGGCGGCTCTTAAATGCAGTGGCGGTGCCGTCGGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAAGCCTCATCATACTAGG 'Cystotheca wrightii Ex_Quercus_KF735066_KOR' CTGAGCGTGAGGCCACGCTGGGCGCCTGGCGCCAGGCGTGGCTGACCCTCCACCCGTGTCTATCTTCTCATGTTGCTTTGGCGGGCCGGGCCCTGTGCCCTCCCGGCGCCTGCTGGGACGCGCCCGCCAGAGCCACCCTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTGGCTTGGTCTTGGAGCGCGCCCCGCGGGGCGGCTCTTAAATGCAGTGGCGGTGCCGTCGGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAAGCCTCATCATACTAGG 'Sawadaea nankinensis Ex_Acer_AB353763' CTGAGCGTGAGGCCACGCAGGGCGC---AAGCCCCGCGCGGCCGACCCTCCACCCGTGCCGACTCATATCCGGTT-------------GCCCTGGCGGCCTGCCGGCCCCGGCTGGCA-GTGCCCGCGAGAGGCGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTCGCAGTTAATAAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCCGCC-GGCCTGGCGGCCCTTAAACACAGTGGCGGCGCCGCCGCGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCAGGCGGGGCCAGCCGAAGCACCCCCTTCTCTCGG 'Setoidium castanopsidis Ex_Castanopsis_AB743781_IDN' ----------------------CGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTATCTTCTCATGTTGCTTTGGCGGGCCGGGCCTCGTGCCCTCCTGGCGCCTGCTGGGACGCGCCCGCCAGAGCCCCCCTAACGCGTGCTGTTTGTGTGGTCTGAGTGGTAATAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCCGCGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCGGGCTCTACGCGTAGTTATCTCTCTCGCGACAGGGCGGCGACGGGACTTGCCAAGAACCCCATCTTTACAGG 'Setoidium castanopsidis Ex_Castanopsis_AB743782_IDN' ----------------------CGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTATCTTCTCATGTTGCTTTGGCGGGCCGGGCCTCGTGCCCTCCTGGCGCCTGCTGGGACGCGCCCGCCAGAGCCCCCCTAACGCGTGCTGTTTGTGTGGTCTGAGTGGTAATAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCCGCGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCGGGCTCTACGCGTAGTTATCTCTCTCGCGACAGGGCGGCGACGGGACTTGCCAAGAACCCCATCTTTACAGG ; END; BEGIN TREES; TITLE Cystotheca_ITS_13_taxa; LINK TAXA = Taxa1; TRANSLATE 1 'Cystotheca lanestris Ex_Quercus_MUMH6845_MEX', 2 'Cystotheca lanestris Ex_Quercus_AB000933_USA', 3 'Cystotheca wrightii Ex_Quercus_KF735066_KOR', 4 'Cystotheca lanestris Ex_Quercus_AF073354_KOR', 5 'Cystotheca wrightii Ex_Quercus_AB000932_JPN', 6 'Cystotheca lanestris Ex_Quercus_AF011289_USA', 7 'Cystotheca lanestris Ex_Myrica_AF011288_USA', 8 'Cystotheca tjibodensis Ex_Castanopsis_JN807326_IDN', 9 'Cystotheca lanestris Ex_Castanea_KR048055_CHN', 10 'Cystotheca tjibodensis Ex_Castanopsis_JN807325_IDN', 11 'Setoidium castanopsidis Ex_Castanopsis_AB743782_IDN', 12 'Setoidium castanopsidis Ex_Castanopsis_AB743781_IDN', 13 'Sawadaea nankinensis Ex_Acer_AB353763'; TREE Fig._1 = [&R] (((((((1,6,7),2),(4,9)),(11,12)),(3,5)),(8,10)),13); END; BEGIN TREES; TITLE Bauhinia_Microidium_28S; LINK TAXA = Taxa2; TRANSLATE 1 'Arthrocladiella mougeotii Ex_AB022379', 2 'Sawadaea polyfida Ex_Acer_AB022364', 3 'Sawadaea tulasnei Ex_Acer_AB022366', 4 'Podosphaera xanthii Ex_Melothria_AB022410', 5 'Podosphaera longiseta Ex_Prunus_AB022423', 6 'Podosphaera tridactyla Ex_Prunus_AB022393', 7 'Podosphaera pannosa Ex_Rosa_AB022347', 8 'Podosphaera filipendulae Ex_Filipendula_AB022384', 9 'Cystotheca wrightii Ex_Quercus_AB022355', 10 'Cystotheca lanestris Ex_Quercus_ABAB022353', 11 'Blumeria graminis f.sp. horde ex_Hordeum_AB022399', 12 'Blumeria graminis f.sp. tritici ex_Triticum_AB022376', 13 'Blumeria graminis f.sp. bromi ex_Bromus_AB022362', 14 'Erysiphe abbreviata Ex_Quercus_AB271785', 15 'Erysiphe alphitoides Ex_Quercus_AB257431', 16 'Erysiphe aquilegiae Ex_Cimicifuga_AB022405', 17 'Erysiphe arcuata Ex_Carpinus_AB252473', 18 'Erysiphe australiana Ex_Lagerstroemia_AB022407', 19 'Erysiphe corylopsidis Ex_corylopsis_AB478987', 20 'Erysiphe glycines Ex_Desmodium_AB022397', 21 'Erysiphe heraclei Ex_Daucus_AB022391', 22 'Erysiphe hypogena Ex_Quercus_AB292727', 23 'Erysiphe hypophylla Ex_Quercus_AB292716', 24 'Erysiphe monascogera Ex_Styrax_AB331645', 25 'Erysiphe mori Ex_Morus_AB022418', 26 'Erysiphe staphyleae Ex_Staphylea_AB015922', 27 'Erysiphe trinae Ex_Quercus_AB022350', 28 'Golovinomyces adenophorae Ex_Adenophora_AB077632', 29 'Golovinomyces cichoracearum Ex_Solidago_AB077650', 30 'Golovinomyces orontii Ex_Nicotiana_AB022412', 31 'Golovinomyces orontii Ex_Physalis_AB077646', 32 'Golovinomyces sordidus Ex_Plantago_AB077657', 33 'Neoerysiphe galeopsidis Ex_Acanthus_AB329670', 34 'Neoerysiphe galeopsidis Ex_Lamium_AB329674', 35 'Neoerysiphe galii Ex_Galium_AB329681', 36 'Neoerysiphe hiratae Ex_Cacalia_AB329669', 37 'Bulbomicroidium bauhiniicola Ex_Bauhinia_MUMH6844', 38 'Microidium phyllanthi Ex_Phyllanthus_AB120754', 39 'Microidium phyllanthi Ex_Phyllanthus_AB120755', 40 'Microidium phyllanthi reticulti Ex_Phyllanthus_AB120758', 41 'Leveillula duriaei Ex_Salvia_AB080475', 42 'Leveillula lanuginosa Ex_Daucus_AB042641', 43 'Leveillula saxaouli Ex_Haloxylon_AB080469', 44 'Leveillula taurica Ex_Artemisia_AB080470', 45 'Leveillula taurica Ex_Helianthus_AB080472', 46 'Phyllactinia ailanthi Ex_Ailanthus_AB080380', 47 'Phyllactinia angulata Ex_Quercus_AB080464', 48 'Phyllactinia carpinicola Ex_Carpinus_AB080420', 49 'Phyllactinia fraxini Ex_Fraxinus_AB080451', 50 'Phyllactinia hemipteleae Ex_Hemiptelea_AB080430', 51 'Phyllactinia linderae Ex_Litsea_AB080421', 52 'Phyllactinia moricola Ex_Morus_AB022401', 53 'Pleochaeta shiraiana Ex_Celtis_AB022403', 54 'Parauncinula septata Ex_Quercus_AB022420', 55 Byssoascus_striatosporus_U17912; TREE Fig._2 = [&R] ((((((((((1,(((28,(30,32)),31),29)),(((33,34),35),36)),((38,39),40)),18),((((((14,22),(((15,24),23),21)),16),(19,26)),((20,27),25)),17)),37),((((((41,45),42,43),44),47),(((46,48,51),(49,52)),50)),53)),54),((((2,3),(9,10)),((4,(5,6)),(7,8))),((11,12),13))),55); END; BEGIN TREES; TITLE Phyllctinieae_28S_37_taxa; LINK TAXA = Taxa3; TRANSLATE 1 'Phyllactinia kakicola Ex_Diospyros_AB080381', 2 'Phyllactinia hamamelidis Ex_Hamamelis_AB080410', 3 'Phyllactinia enkianthi Ex_Rhododendron_AB080408', 4 'Phyllactinia magnoliae Ex_Magnolia_AB080416', 5 'Phyllactinia alni Ex_Alnus_AB080411', 6 'Phyllactinia betulae Ex_Betula_AB080396', 7 'Phyllactinia paliuri Ex_Paliurus_AB080458', 8 'Phyllactinia juglandis Ex_Juglans_AB080422', 9 'Phyllactinia eupteleae Ex_Euptelea_AB080388', 10 'Phyllactinia pterostyracis Ex_Pterostyrax_AB080403', 11 'Phyllactinia broussonetiae kaempferi_ex_Broussonetia_AB080382', 12 'Phyllactinia moricola Ex_Morus_AB080372', 13 'Phyllactinia fraxini Ex_Fraxinus_AB080451', 14 'Phyllactinia fraxini Ex_Syringa_AB080436', 15 'Phyllactinia guttata Ex_Acer_AB080433', 16 'Phyllactinia fraxinicola Ex_Fraxinus_AB080383', 17 'Leveillula taurica Ex_Artemisia_AB080470', 18 'Leveillula quilanensis Ex_Chondrilla_AB080478', 19 'Leveillula saxaouli Ex_Haloxylon_AB080469', 20 'Leveillula lanuginosa Ex_Daucus_AB042641', 21 'Leveillula cylindrospora Ex_Noaea_AB080468', 22 'Leveillula taurica Ex_Impatiens_AB080473', 23 'Phyllactinia angulata Ex_Quercus_AB080464', 24 'Phyllactinia leveilluloides Ex_Quercus_LC108847', 25 'Phyllactinia adesmiae Ex_Adesmia_LC108834', 26 'Phyllactinia cassiae fistulae_ex_Cassia_AB691227', 27 'Phyllactinia cassiae fistulae_ex_Cassia_AB691228', 28 'Phyllactinia obclavata Ex_Tabebuia_LC108832', 29 'Phyllactinia obclavata Ex_Spathodea_LC108846', 30 Phyllactinia_sp._ex_Rhabdaclema_LC108841, 31 'Phyllactinia chubutiana Ex_Lycium_AB243690', 32 'Phyllactinia mimosae Ex_Mimosa_MUMH6846', 33 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_LC177377', 34 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_LC177378', 35 'Phyllactinia lagerstroemiae Ex_Lagerstroemia_LC177379', 36 'Pleochaeta shiraiana Ex_Celtis_LC108831', 37 'Pleochaeta polychaeta Ex_Celtis_LC108836'; TREE Fig._3 = [&R] (((((((((1,2,3,4,5),6),8),(7,(9,10,(11,12)))),((13,14),15,16)),(((((17,(18,((19,25),22),20,21)),((23,24),31)),(28,29)),32),30)),(26,27)),((33,34),35)),(36,37)); END;