#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 10:45 GMT TreeBASE (cc) 1994-2008 Study reference: Meeboon J., Siahaan S., Fujioka K., & Takamatsu S. 2017. Molecular phylogeny and taxonomy of Parauncinula (Erysipheles) and two new species P. polyspora and P. uncinata. Mycoscience, 58(5): 361–368. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S20723] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=14; TAXLABELS Parauncinula_neoseptata_MUMH197_ex_Q._cuspidata_var._horikawae Parauncinula_neoseptata_MUMH4403_ex_Q._serrata Parauncinula_neoseptata_MUMH4928_ex_Q._serrata Parauncinula_neoseptata_MUMH5223_ex_Q._serrata Parauncinula_neoseptata_MUMH5732_ex_Q._aliena 'Parauncinula querci-variabilii MUMH4113 ex Q. variabillis' 'Parauncinula querci-variabilii MUMH4131 ex Q. variabillis' 'Parauncinula querci-variabilii MUMH4187 ex Q. variabillis' 'Parauncinula querci-variabilii MUMH4189 ex Q. variabillis' Parauncinula_septata_MUMH4146_ex_Q._robur Parauncinula_septata_MUMH4435_ex_Q._serrata Parauncinula_septata_MUMH4840_ex_Q._serrata Parauncinula_septata_MUMH4868_ex_Q._serrata Parauncinula_septata_MUMH585_ex_Q._serrata ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M40438] TITLE 'Parauncinula ITS+28S'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1180; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Parauncinula_neoseptata_MUMH197_ex_Q._cuspidata_var._horikawae GGCGAGTCGAGCCTGGCTCCACCGGCCGCCGGCTGGTGTGCGCTCGCCAGAGA-CCCCCCAACTCCACTGTA-TTTAGTGTTGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGCCGCTCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAGATTCGTCTCGCTCCAGGGCACGCGTAGGGCCTGCCAG-AACCCTTCAACCCCCTCCTTAGGTTGACCTCGGATCA????????????????????????????????????????????????????????????????????AGTAACGGCGAGTGAAGCGGTACTAGCTCAAATTTGAAATCTGGCGCCCTCGGCGTCCGAATTGTAATTTGTAGACGATGCTTTGGGTTGGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCCGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCAGGCTTCGGGCCTGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTAGGGCGCCATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGTGCATCATCGACCGATCCTGATGTCT Parauncinula_neoseptata_MUMH4403_ex_Q._serrata GGCGAGTCGAGCCTGGCTCCACCGGCCGCCGGCTGGTGTGCGCTCGCCAGAGA-CCCCCCAACTCCACTGTA-TTTAGTGTTGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGCCGCTCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAGATTCGTCTCGCTCCAGGGCACGCGTAGGGCCTGCCAG-AACCCTTCAA-CCCCTCCTTAGG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Parauncinula_neoseptata_MUMH4928_ex_Q._serrata GGCGAGTCGAGCCTGGCTCCACCGGCCGCCGGCTGGTGTGCGCTCGCCAGAGA-CCCCCCAACTCCACTGTA-TTTAGTGTTGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGCCGCTCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAGATTCGTCTCGCTCCAGGGCACGCGTAGGGCCTGCCAG-AACCCTTCAA-CCCCTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACTAGCTCAAATTTGAAATCTGGCGCCCTCGGCGTCCGAATTGTAATTTGTAGACGATGCTTTGGGTTGGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCCGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCAGGCTTCGGGCCTGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTAGGGCGCCATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGTGCATCATCGACCGATCCTGATGTCT Parauncinula_neoseptata_MUMH5223_ex_Q._serrata GGCGAGTCGAGCCTGGCTCCACCGGCCGCCGGCTGGTGTGCGCTCGCCAGAGA-CCCCCCAACTCCACTGTA-TTTAGTGTTGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGCCGCTCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAGATTCGTCTCGCTCCAGGGCACGCGTAGGGCCTGCCAG-AACCCTTCAACCCCCTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACTAGCTCAAATTTGAAATCTGGCGCCCTCGGCGTCCGAATTGTAATTTGTAGACGATGCTTTGGGTTGGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCCGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCAGGCTTCGGGCCTGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTAGGGCGCCATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGTGCATCATCGACCGATCCTGATGTCT Parauncinula_neoseptata_MUMH5732_ex_Q._aliena GGCGAGTCGAGCCTGGCTCCACCGGCCGCCGGCTGGTGTGCGCTCGCCAGAGA-CCCCCCAACTCCACTGTA-TTTAGTGTTGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGCCGCTCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAGATTCGTCTCGCTCCAGGGCACGCGTAGGGCCTGCCAG-AACCCTTCAACCCCCTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACTAGCTCAAATTTGAAATCTGGCGCCCTCGGCGTCCGAATTGTAATTTGTAGACGATGCTTTGGGTTGGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCCGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCAGGCTTCGGGCCTGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTAGGGCGCCATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGTGCATCATCGACCGATCCTGATGTCT 'Parauncinula querci-variabilii MUMH4113 ex Q. variabillis' GGCGAGTCGAGTCCTGCTCCACCGGCCCCCGGCTGGTGCGCGCTCGCCAGAGA-CCCCCCAACT---CTGTA-TTTAGTGTCGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGTCGCCCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACTCGTCTCGCTCCAGGGTTCGCGTAGGGCTTGCCAG-AACCCTTCAACCCCCCCTCCAGG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Parauncinula querci-variabilii MUMH4131 ex Q. variabillis' ??CGAGTCGAGTCCTGCTCCACCGGCCCCCGGCTGGTGCGCGCTCGCCAGAGA-CCCCCCAACT---CTGTA-TTTAGTGTCGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGTCGCCCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACTCGTCTCGCTCCAGGGTTCGCGTAGGGCTTGCCAG-AACCCTTCAACCCCCCCTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACTAGCTCAAATTTGAAATCTGGCGCCCTCGGCGTCCGAGTTGTAATTTGTAGACGATGCTTTGGGTTGGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCCGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCGGGCTTCGGGCCTGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTAGGGCGTCATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGTGCATCATCGACCGATCCTGATGTCT 'Parauncinula querci-variabilii MUMH4187 ex Q. variabillis' GGCGAGTCGAGTCCTGCTCCACCGGCCCCCGGCTGGTGCGCGCTCGCCAGAGA-CCCCCCAACT---CTGTA-TTTAGTGTCGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGTCGCCCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACTCGTCTCGCTCCAGGGTTCGCGTAGGGCTTGCCAG-AACCCTTCAACCCCCCCTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACTAGCTCAAATTTGAAATCTGGCGCCCTCGGCGTCCGAGTTGTAATTTGTAGACGATGCTTTGGGTTGGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCCGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCGGGCTTCGGGCCTGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTAGGGCGTCATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGTGCATCATCGACCGATCCTGATGTCT 'Parauncinula querci-variabilii MUMH4189 ex Q. variabillis' GGCGAGTCGAGTCCTGCTCCACCGGCCCCCGGCTGGTGCGCGCTCGCCAGAGA-CCCCCCAACT---CTGTA-TTTAGTGTCGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGTCGCCCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACTCGTCTCGCTCCAGGGTTCGCGTAGGGCTTGCCAG-AACCCTTCAACCCCCCCTCCAGG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Parauncinula_septata_MUMH4146_ex_Q._robur GGCGAGTCGAGCCCTGCTCCACCGGCC-CCGGCTGGTGCGCGCTCGCCAGAGACCCCCCCAACTCTTCTGTATTTTAGTGTCGTCTGAGTCGTGAGAAAATGATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCTCGGCTTGGTGTTGGGAGCCGCCGCCCGCGGCGCTCCTTAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACGTGTCTCGCTCCAGGGCTCGCGTAGGGCTCGCCAGCAACCCCCTCAACCCCCCTCCAGG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Parauncinula_septata_MUMH4435_ex_Q._serrata GGCGAGTCGAGCCCTGCTCCACCGGCC-CCGGCTGGTGCGCGCTCGCCAGAGACCCCCCCAACTCTTCTGTATTTTAGTGTCGTCTGAGTCGTGAGAAAATGATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCTCGGCTTGGTGTTGGGAGCCGCCGCCCGCGGCGCTCCTTAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACGTGTCTCGCTCCAGGGCTCGCGTAGGGCTCGCCAGCAACCCCCTCAACCCCCCTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACAAGCTCAAATTTGAAATCTGGCGCCCTCGGCGTCCGAGTTGTAATTTGTAGACGATGCTTTGGGCTGGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCCGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCGGGCTTCGGGCCCGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTAGAGCGCCATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGTGCATCATCGACCGATCCTGATGTCT Parauncinula_septata_MUMH4840_ex_Q._serrata GGCGAGTCGAGCCCTGCTCCACCGGCC-CCGGCTGGTGCGCGCTCGCCAGAGACCCCCCCAACTCTTCTGTATTTTAGTGTCGTCTGAGTCGTGAGAAAATGATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCTCGGCTTGGTGTTGGGAGCCGCCGCCCGCGGCGCTCCTTAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACGTGTCTCGCTCCAGGGCTCGCGTAGGGCTCGCCAGCAACCCCCTCAACCCCCCTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACAAGCTCAAATTTGAAATCTGGCGCCCTCGGCGTCCGAGTTGTAATTTGTAGACGATGCTTTGGGCTGGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCCGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCGGGCTTCGGGCCCGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTAGAGCGCCATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGTGCATCATCGACCGATCCTGATGTCT Parauncinula_septata_MUMH4868_ex_Q._serrata GGCGAGTCGAGCCCTGCTCCACCGGCC-CCGGCTGGTGCGCGCTCGCCAGAGACCCCCCCAACTCTTCTGTATTTTAGTGTCGTCTGAGTCGTGAGAAAATGATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCTCGGCTTGGTGTTGGGAGCCGCCGCCCGCGGCGCTCCTTAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACGTGTCTCGCTCCAGGGCTCGCGTAGGGCTCGCCAGCAACCCCCTCAACCCCCCTCCAGG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Parauncinula_septata_MUMH585_ex_Q._serrata GGCGAGTCGAGCCCTGCTCCACCGGCC-CCGGCTGGTGCGCGCTCGCCAGAGACCCCCCCAACTCTTCTGTATTTTAGTGTCGTCTGAGTCGTGAGAAAATGATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCTCGGCTTGGTGTTGGGAGCCGCCGCCCGCGGCGCTCCTTAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACGTGTCTCGCTCCAGGGCTCGCGTAGGGCTCGCCAGCAACCCCCTCAACCCCCCTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACAAGCTCAAATTTGAAATCTGGCGCCCTCGGCGTCCGAGTTGTAATTTGTAGACGATGCTTTGGGCTGGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCCGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCGGGCTTCGGGCCCGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTAGAGCGCCATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGTTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAAGGGTGCATCATCGACCGATCCTGATGTCT ; END; BEGIN TREES; TITLE 'Parauncinula ITS+28S'; LINK TAXA = Taxa1; TRANSLATE 1 Parauncinula_neoseptata_MUMH197_ex_Q._cuspidata_var._horikawae, 2 Parauncinula_neoseptata_MUMH4403_ex_Q._serrata, 3 Parauncinula_neoseptata_MUMH4928_ex_Q._serrata, 4 Parauncinula_neoseptata_MUMH5223_ex_Q._serrata, 5 Parauncinula_neoseptata_MUMH5732_ex_Q._aliena, 6 Parauncinula_septata_MUMH4146_ex_Q._robur, 7 Parauncinula_septata_MUMH4435_ex_Q._serrata, 8 Parauncinula_septata_MUMH4840_ex_Q._serrata, 9 Parauncinula_septata_MUMH4868_ex_Q._serrata, 10 Parauncinula_septata_MUMH585_ex_Q._serrata, 11 'Parauncinula querci-variabilii MUMH4187 ex Q. variabillis', 12 'Parauncinula querci-variabilii MUMH4131 ex Q. variabillis', 13 'Parauncinula querci-variabilii MUMH4113 ex Q. variabillis', 14 'Parauncinula querci-variabilii MUMH4189 ex Q. variabillis'; TREE Fig._1 = [&R] (((1,2,3,4,5),(6,(7,8,10),9)),(((11,12),13),14)); END;