#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:40 GMT TreeBASE (cc) 1994-2008 Study reference: Burlakoti R., Ali S., Secor G., Neate S., Mcmullen M., & Adhikari T. 2008. Genetic relationships among populations of Gibberella zeae from barley, wheat, potato and sugar beet in the Upper Midwest of the United States. Phytopathology, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2076] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=63; TAXLABELS 'Fusarium acaciae-mearnsii NRRL26752' 'Fusarium acaciae-mearnsii NRRL26754' Fusarium_asiaticum_NRRL13818 Fusarium_asiaticum_NRRL26156 Fusarium_asiaticum_NRRL6101 Fusarium_austroamericanum_NRRL28718 Fusarium_austroamericanum_NRRL2903 Fusarium_boothi_NRRL26916 Fusarium_boothi_NRRL29011 Fusarium_boothi_NRRL29105 Fusarium_brasilicum_NRRL31238 Fusarium_brasilicum_NRRL31281 Fusarium_cerealis_NRRL13721 Fusarium_cerealis_NRRL25491 Fusarium_cortaderiae_NRRL31185 Fusarium_cortaderiae_NRRL31205 Fusarium_culmorum_NRRL25475 Fusarium_culmorum_NRRL3288 Fusarium_graminearum_Fgb20 Fusarium_graminearum_Fgb25 Fusarium_graminearum_Fgb7 Fusarium_graminearum_Fgb9 Fusarium_graminearum_Fgp21 Fusarium_graminearum_Fgp23 Fusarium_graminearum_Fgp24 Fusarium_graminearum_Fgp38 Fusarium_graminearum_Fgp39 Fusarium_graminearum_Fgs2 Fusarium_graminearum_Fgs3 Fusarium_graminearum_Fgs4 Fusarium_graminearum_Fgs5 Fusarium_graminearum_Fgs9 Fusarium_graminearum_Fgw115 Fusarium_graminearum_Fgw121 Fusarium_graminearum_Fgw133 Fusarium_graminearum_Fgw136 Fusarium_graminearum_Fgw155 Fusarium_graminearum_Fgw158 Fusarium_graminearum_Fgw166 Fusarium_graminearum_Fgw187 Fusarium_graminearum_Fgw190 Fusarium_graminearum_Fgw195 Fusarium_graminearum_Fgw199 Fusarium_graminearum_Fgw228 Fusarium_graminearum_Fgw37 Fusarium_graminearum_Fgw51 Fusarium_graminearum_Fgw62 Fusarium_graminearum_Fgw77 Fusarium_graminearum_Fgw79 Fusarium_graminearum_Fgw90 Fusarium_graminearum_NRRL13383 Fusarium_graminearum_NRRL28063 Fusarium_graminearum_NRRL28336 Fusarium_graminearum_NRRL31084 Fusarium_graminearum_NRRL34079 Fusarium_graminearum_NRRL5883 Fusarium_graminearum_NRRL6394 Fusarium_meridonale_NRRL28436 Fusarium_meridonale_NRRL29010 Fusarium_mesoamericanum_NRRL25797 Fusarium_mesoamericanum_NRRL29148 Fusarium_pseudograminearum_NRRL28334 Fusarium_pseudograminearum_NRRL28338 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=63; TAXLABELS 'Fusarium acaciae-mearnsii NRRL26752' 'Fusarium acaciae-mearnsii NRRL26754' Fusarium_asiaticum_NRRL13818 Fusarium_asiaticum_NRRL26156 Fusarium_asiaticum_NRRL6101 Fusarium_austroamericanum_NRRL28718 Fusarium_austroamericanum_NRRL2903 Fusarium_boothi_NRRL26916 Fusarium_boothi_NRRL29011 Fusarium_boothi_NRRL29105 Fusarium_brasilicum_NRRL31238 Fusarium_brasilicum_NRRL31281 Fusarium_cerealis_NRRL13721 Fusarium_cerealis_NRRL25491 Fusarium_cortaderiae_NRRL31185 Fusarium_cortaderiae_NRRL31205 Fusarium_culmorum_NRRL25475 Fusarium_culmorum_NRRL3288 Fusarium_graminearum_Fgb20 Fusarium_graminearum_Fgb25 Fusarium_graminearum_Fgb7 Fusarium_graminearum_Fgb9 Fusarium_graminearum_Fgp21 Fusarium_graminearum_Fgp23 Fusarium_graminearum_Fgp24 Fusarium_graminearum_Fgp38 Fusarium_graminearum_Fgp39 Fusarium_graminearum_Fgs2 Fusarium_graminearum_Fgs3 Fusarium_graminearum_Fgs4 Fusarium_graminearum_Fgs5 Fusarium_graminearum_Fgs9 Fusarium_graminearum_Fgw115 Fusarium_graminearum_Fgw121 Fusarium_graminearum_Fgw133 Fusarium_graminearum_Fgw136 Fusarium_graminearum_Fgw155 Fusarium_graminearum_Fgw158 Fusarium_graminearum_Fgw166 Fusarium_graminearum_Fgw187 Fusarium_graminearum_Fgw190 Fusarium_graminearum_Fgw195 Fusarium_graminearum_Fgw199 Fusarium_graminearum_Fgw228 Fusarium_graminearum_Fgw37 Fusarium_graminearum_Fgw51 Fusarium_graminearum_Fgw62 Fusarium_graminearum_Fgw77 Fusarium_graminearum_Fgw79 Fusarium_graminearum_Fgw90 Fusarium_graminearum_NRRL13383 Fusarium_graminearum_NRRL28063 Fusarium_graminearum_NRRL28336 Fusarium_graminearum_NRRL31084 Fusarium_graminearum_NRRL34079 Fusarium_graminearum_NRRL5883 Fusarium_graminearum_NRRL6394 Fusarium_meridonale_NRRL28436 Fusarium_meridonale_NRRL29010 Fusarium_mesoamericanum_NRRL25797 Fusarium_mesoamericanum_NRRL29148 Fusarium_pseudograminearum_NRRL28334 Fusarium_pseudograminearum_NRRL28338 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3226] TITLE TEF; LINK TAXA = Taxa1; DIMENSIONS NCHAR=625; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Fusarium acaciae-mearnsii NRRL26752' TCTGGCAAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATCCTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCCCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCACTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT---CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACTAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG 'Fusarium acaciae-mearnsii NRRL26754' TCTGGCAAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATCCTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCCCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCACTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT---CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACTAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_asiaticum_NRRL13818 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-TCCTTTCGAAATATCATTCGAATCGCACTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTTC-CCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_asiaticum_NRRL26156 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-TCCTTTCGAAATATCATTCGAATCGCACTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTTC-CCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_asiaticum_NRRL6101 TCTGGCAAGTCGACCACTGTGAGTACCACCGTATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-TCCTTTCGAAATATCATTCGAATCGCACTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTTC-CCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_austroamericanum_NRRL28718 TCTGGCAAGTCGACCACTGTGAGTACCACCACATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATTGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACTACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGACTATCAGACGCTCCCGGTCACCGTG Fusarium_austroamericanum_NRRL2903 TCTGGCAAGTCGACCACTGTGAGTACCACCACATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATTGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACCCATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACTACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGACTATCAGACGCTCCCGGTCACCGTG Fusarium_boothi_NRRL26916 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGGGTAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT---CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTCTCAGACGCTCCCGGTCACCGTG Fusarium_boothi_NRRL29011 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT---CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTCTCAGACGCTCCCGGTCACCGTG Fusarium_boothi_NRRL29105 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGGGTAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT---CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTCTCAGACGCTCCCGGTCACCGTG Fusarium_brasilicum_NRRL31238 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGTTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATGCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_brasilicum_NRRL31281 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGTTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATGCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_cerealis_NRRL13721 TCTGGCAAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGATATTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTT-GATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAACATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTCT-----GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCGCACCATCACGTGTCAATCAGTTACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACTACTGCTGTCATGACCTTCTCATACTAACACGACTATCAGACGCTCCCGGTCACCGTG Fusarium_cerealis_NRRL25491 TCTGGCAAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGATATTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTT-GATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAACATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTCT-----GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCGCACCATCACGTGTCAATCAGTTACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACTACTGCTGTCATGACCTTCTCATACTAACACGACTATCAGACGCTCCCGGTCACCGTG Fusarium_cortaderiae_NRRL31185 TCTGGCAAGTCGACCACTGTGAGTACCACCACATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTTAAATATCCAATGTGCTGACATACTTTAATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCA--CGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGTTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_cortaderiae_NRRL31205 TCTGGCAAGTCGACCACTGTGAGTACCACCACATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTTAAATATCCAATGTGCTGACATACTTTAATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCA--CGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTTTTCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGTTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_culmorum_NRRL25475 TCTGGCAAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGATACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAACATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTCT-----GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCTTGCCCTCTTCCCACAAACC-ATTCCCTAGGCGCGCACCATCACGTGTCAATCAGTTACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACTACTGCTGTCATCACATTCTCATACTAACACGACTATCAGACGCTCCCGGTCACCGTG Fusarium_culmorum_NRRL3288 TCTGGCAAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGATACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAACATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTCT-----GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCTTGCCCTCTTCCCACAAACC-ATTCCCTAGGCGCGCACCATCACGTGTCAATCAGTTACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACTACTGCTGTCATCACATTCTCATACTAACACGACTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgb20 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgb25 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgb7 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgb9 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgp21 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgp23 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgp24 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TATTTTCAATTTTCCAATGTGCTGACATACTTTGATACACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTCC-CC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgp38 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTCC-CC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgp39 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGGGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTAACAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgs2 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgs3 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTCC-CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgs4 TCTGGCGAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgs5 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgs9 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw115 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAATTTTTGCGGCTTTGTCGTAATTTTTTT--CCCGATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw121 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTCC-CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw133 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw136 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw155 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTTT-CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCTTCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw158 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw166 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTCC-CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw187 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw190 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw195 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw199 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTCC-CC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw228 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw37 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw51 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTCC-CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw62 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGATGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw77 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTCC-CC-GGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw79 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_Fgw90 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL13383 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL28063 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL28336 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL31084 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTT-CCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL34079 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTCC-CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL5883 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_graminearum_NRRL6394 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTT--CCCGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTCTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_meridonale_NRRL28436 TCTGGCAAGTCGACCACTGTGAGTACCACCACATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAACGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCTTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_meridonale_NRRL29010 TCTGGCAAGTCGACCACTGTGAGTACCACCACATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAACGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCTTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCCTGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAAATTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_mesoamericanum_NRRL25797 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCATGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTTC-CCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACCCATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGTCTATCAGACGCTCCCGGTCACCGTG Fusarium_mesoamericanum_NRRL29148 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCGACACTTGGCGGGG-TAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTTCCTCGATCGCGCGCCCTTTTCCCTTTCGAAATATCATTCGAATCGCCCTCACACGACGACTCGATACGCGCATGTTACCCCGCTCGAGGTCAAAAATTTTGCGGCTTTGTCGTAATTTTTTTC-CCTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGTTTGCCCTCTTCCCACAAACC-ATTCCCTGGGCGCTCATCATCACGTGTCAACCAGTCACTAACCACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACCACTGCTGTCATCACATTCTCATACTAACATGGCTATCAGACGCTCCCGGTCACCGTG Fusarium_pseudograminearum_NRRL28334 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCTACACTTGGCGGGG-TAGTTTCACATTTCCGATGTGCTGACATGCTTTAATAGACCGGTCACTTGATCTACCAGTGCGGTGGCATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCCCATTTTCCTCGATCGCGCGCCCTTATCCCCTTCGAAACATCATTCGAATCGCTC------GACGACTCGACACGCGCCTGTTACCCCGCTCGAGGACAAAATTTTTACGGCTTTGTCGTAATTTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCTTGCCCTCCTCCCACAAATC-ATTCCCTGGGCG--CATCATCACGTGTCAATCAGTCACTAACAACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACTATTGTCCTCATCACATTCTCATACTAACATGTCTACCAGACGCTCCCGGTCACCGTG Fusarium_pseudograminearum_NRRL28338 TCTGGCAAGTCGACCACTGTGAGTACCACCGCATCCCAACCCCGCCTACACTTGGCGGGG-TAGTTTCACATTTCCGATGTGCTGACATGCTTTAATAGACCGGTCACTTGATCTACCAGTGCGGTGGCATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCCCATTTTCCTCGATCGCGCGCCCTTATCCCCTTCGAAACATCATTCGAATCGCTC------GACGACTCGACACGCGCCTGTTACCCCGCTCGAGGACAAAATTTTTACGGCTTTGTCGTAATTTTTTTT--CTGGTGGGGCTCATACCCCGCCACTCGAGCGACAGGCGCTTGCCCTCCTCCCACAAATC-ATTCCCTGGGCG--CATCAT---GTGTCAATCAGTCACTAACAACCTGTCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAAGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGTTGTCACTATTGTCCTCATCACATTCTCATACTAACATGTCTACCAGACGCTCCCGGTCACCGTG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = TEF) = N: 1-625; CODONPOSSET CodonPositions (CHARACTERS = TEF) = N: 1-625; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3227] TITLE PHO; LINK TAXA = Taxa2; DIMENSIONS NCHAR=799; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Fusarium acaciae-mearnsii NRRL26752' GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCACAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTACGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA 'Fusarium acaciae-mearnsii NRRL26754' GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCACAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTATACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTACGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_asiaticum_NRRL13818 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCTAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_asiaticum_NRRL26156 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCTAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_asiaticum_NRRL6101 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTGACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCTAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_austroamericanum_NRRL28718 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTCACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_austroamericanum_NRRL2903 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTCACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_boothi_NRRL26916 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACACTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_boothi_NRRL29011 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACACTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_boothi_NRRL29105 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACACTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_brasilicum_NRRL31238 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTTACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCA---GGACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACCATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGGGTTGGA Fusarium_brasilicum_NRRL31281 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTTACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAGCACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGGACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACCATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGGGTTGGA Fusarium_cerealis_NRRL13721 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATTACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGTTTCGGAGCTGTCCCCGCTTGCATTGCACTCTACTGTAAGTCATCATATTCTTGGCATGTGAATCTATCTAACTAACTTTACTAGACCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGATGTCGCCCGTGACGTCGAGCAGGCTGATGAGGATGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCTCCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTTGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACTATCCAGCTTGGTGGTTTTATCATCCTGACTATTCTTTTCATTGTAAGTTGGATGCGTTGGA Fusarium_cerealis_NRRL25491 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGCCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGTTTCGGAGCTGTCCCCGCTTGCATTGCACTCTACTGTAAGTCATCATATTCTTGGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGATGTCGCCCGTGACGTCGAGCAGGCTGATGAGGATGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCTCCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTTGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACTATCCAGCTTGGTGGTTTTATCATCCTGACTATTCTTTTCATTGTAAGTTGGATGCGTTGGA Fusarium_cortaderiae_NRRL31185 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTCACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGGACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_cortaderiae_NRRL31205 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTCACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGGACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_culmorum_NRRL25475 GACTACCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATTGAGCTCTTATTCCAATTCAGTCGCTTATTCTTCATCAGATTCGCTACTACTAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGCATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGATTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGCATCCATCTAACTCACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGATGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCTCCCGTGCCCAAAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTTGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACTATCCAGCTTGGTGGTTTTATCATCCTGACTATTCTTTTCATTGTAAGTTGGATGCGTTGGA Fusarium_culmorum_NRRL3288 GACTACCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATTGAGCTCTTATTCCAATTCAGTCGCTTATTCTTCATCAGATTCGCTACTACTAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGCATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGATTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGCATCCATCTAACTCACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGATGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCTCCCGTGCCCAAAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTTGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACTATCCAGCTTGGTGGTTTTATCATCCTGACTATTCTTTTCATTGTAAGTTGGATGCGTTGGA Fusarium_graminearum_Fgb20 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgb25 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgb7 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgb9 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgp21 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgp23 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgp24 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgp38 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgp39 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgs2 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgs3 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgs4 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgs5 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgs9 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw115 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw121 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw133 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw136 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw155 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw158 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw166 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw187 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw190 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw195 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw199 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw228 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw37 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw51 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw62 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw77 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTAT-GATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw79 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_Fgw90 GACTATCCATTGTCTTC-ATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_NRRL13383 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_NRRL28063 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_NRRL28336 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTTCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_NRRL31084 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_NRRL34079 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAACTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_NRRL5883 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAGGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_graminearum_NRRL6394 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCTGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCTTGCATTGCCCTCTACTGTAAGCCATAGCATTCTTAGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCCGAGACTCCTCGTTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCCGATGAGGACGTCAAGGCTTATATCAACGGCAAGAGCGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACCATCCTCAAGGTTATTGGATATTCCACCAAGGATGCTACTAATGTCTACGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTAACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_meridonale_NRRL28436 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTCACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATTTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACCATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGGGTTGGA Fusarium_meridonale_NRRL29010 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATTTCACGCTTCTATTTCAAGTCGGTCGCTCATCTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTGACATGTGAATCTATTTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACCATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGGGTTGGA Fusarium_mesoamericanum_NRRL25797 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTAACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCATTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_mesoamericanum_NRRL29148 GACTATCCATTGTCTTCCATCATTACTTCAGAGTAAGTATATCACGCTTCTATTTCAAGTCGGTCGCTCATTTGTTCTCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTCGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGTCAAATTGCCGTTGACAAGATGTGGCGAACACTTGTTGGCTTCGGAGCTGTCCCCGCCTGCATTGCCCTCTATTGTAAGTGATCATCTTCTTAACATGTGAATCTATCTAACTTACTTCACTAGATCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGCAAAAGTGAAGGCAACACCGACGAAGTCACCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTCGATGTGGCATTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCTACCAAGGATGCTACTAATGTCTATGAGTTTCTCCACAACACAGCTGTCGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACGATTCAGCTTGGTGGTTTCATTATCCTGACTATCCTTTTCATTGTAAGTTGTATGTGTTGGA Fusarium_pseudograminearum_NRRL28334 GATTATCCATTGTCTTCCATCATCACTTCAGAGTAAGTACGTCAAGCTCCTATTTCAAGTCAGTCGCTGATCTTTCATCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTTGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCCGTTGACAAGATGTGGCGAACACTCGTCGGCTTTGGAGCTGTCCCTGCTTGCATTGCCCTCTACTGTAAGTCATCATATTCTTGGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGTAAAAGCGAAGGCAACACCGACGAAGTCTCCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTGGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCAACCAAGGATGCCACCAATGTCTACGAGTTCCTCCACAACACAGCTGTTGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACTATCCAGCTTGGTGGTTTTATCATACTGACTATTCTTTTCATTGTAAGTTATATGTGTTGAT Fusarium_pseudograminearum_NRRL28338 GATTATCCATTGTCTTCCATCATCACTTCAGAGTAAGTACGTCAAGCTCCTATTTCAAGTCAGTCGCTGATCTTTCATCAGGTTCGCTACTACCAAGTGGCGAGGTGCCATGATGGCTGCCGTCTTTGCCATGCAAGGTATCGGCCAACTTGTCGCAGCTCTTGTCATGATGTTCCTCACTCTTGGCTTCAAGTCTTCTCTTGAGCAAGCTGCCGATACAAAGAGCTGCACTGGAGATTGCCAAATTGCCGTTGACAAGATGTGGCGAACACTCGTCGGCTTTGGAGCTGTCCCTGCTTGCATTGCCCTCTACTGTAAGTCATCATATTCTTGGCATGTGAATCTATCTAACTAACTTCACTAGACCGTCTTACTATCCCTGAGACTCCTCGCTACACCTTTGACGTCGCCCGTGACGTCGAGCAGGCTGATGAGGACGTCAAGGCTTATATCAACGGTAAAAGCGAAGGCAACACCGACGAAGTCTCCCGTGCCCAGAACCTTCAATCCGCCAAGAGAACTGCTGGTTCATGGTTCTGTCTGGATGTGGCTTTCTATGGTCTCTCTTTGAATAACGGAACTATCCTCAAGGTTATTGGATATTCAACCAAGGATGCCACCAATGTCTACGAGTTCCTCCACAACACAGCTGTTGGAAATATCATTATTGTCTTGGCAGGAGCTGTTCCAGGTTACTGGGTTTCTGTGGCGACTATTGATACTCTTGGACGAAAGACTATCCAGCTTGGTGGTTTTATCATACTGACTATTCTTTTCATTGTAAGTTATATGTGTTGAT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = PHO) = N: 1-799; CODONPOSSET CodonPositions (CHARACTERS = PHO) = N: 1-799; END; BEGIN TREES; TITLE Tb9092; LINK TAXA = Taxa1; TRANSLATE 1 Fusarium_culmorum_NRRL25475, 2 Fusarium_culmorum_NRRL3288, 3 Fusarium_cerealis_NRRL13721, 4 Fusarium_cerealis_NRRL25491, 5 Fusarium_austroamericanum_NRRL2903, 6 Fusarium_austroamericanum_NRRL28718, 7 Fusarium_meridonale_NRRL28436, 8 Fusarium_meridonale_NRRL29010, 9 Fusarium_cortaderiae_NRRL31205, 10 Fusarium_cortaderiae_NRRL31185, 11 Fusarium_brasilicum_NRRL31281, 12 Fusarium_brasilicum_NRRL31238, 13 Fusarium_graminearum_Fgp23, 14 Fusarium_graminearum_Fgs5, 15 Fusarium_graminearum_Fgs9, 16 Fusarium_graminearum_Fgw158, 17 Fusarium_graminearum_Fgw62, 18 Fusarium_graminearum_Fgw133, 19 Fusarium_graminearum_Fgw136, 20 Fusarium_graminearum_Fgw187, 21 Fusarium_graminearum_Fgw190, 22 Fusarium_graminearum_Fgw37, 23 Fusarium_graminearum_Fgw115, 24 Fusarium_graminearum_Fgw155, 25 Fusarium_graminearum_NRRL28063, 26 Fusarium_graminearum_NRRL6394, 27 Fusarium_graminearum_Fgb9, 28 Fusarium_graminearum_Fgb25, 29 Fusarium_graminearum_Fgw79, 30 Fusarium_graminearum_NRRL31084, 31 Fusarium_graminearum_Fgw195, 32 Fusarium_graminearum_Fgb7, 33 Fusarium_graminearum_Fgb20, 34 Fusarium_graminearum_Fgp21, 35 Fusarium_graminearum_Fgp39, 36 Fusarium_graminearum_NRRL28336, 37 Fusarium_graminearum_NRRL5883, 38 Fusarium_graminearum_NRRL13383, 39 Fusarium_graminearum_Fgw228, 40 Fusarium_graminearum_Fgs3, 41 Fusarium_graminearum_Fgw166, 42 Fusarium_graminearum_Fgw51, 43 Fusarium_graminearum_Fgw121, 44 Fusarium_graminearum_NRRL34079, 45 Fusarium_graminearum_Fgp38, 46 Fusarium_graminearum_Fgw199, 47 Fusarium_graminearum_Fgw77, 48 Fusarium_graminearum_Fgp24, 49 Fusarium_graminearum_Fgw90, 50 Fusarium_graminearum_Fgs2, 51 Fusarium_graminearum_Fgs4, 52 Fusarium_mesoamericanum_NRRL25797, 53 Fusarium_mesoamericanum_NRRL29148, 54 Fusarium_asiaticum_NRRL13818, 55 Fusarium_asiaticum_NRRL6101, 56 Fusarium_asiaticum_NRRL26156, 57 Fusarium_boothi_NRRL26916, 58 Fusarium_boothi_NRRL29105, 59 Fusarium_boothi_NRRL29011, 60 'Fusarium acaciae-mearnsii NRRL26754', 61 'Fusarium acaciae-mearnsii NRRL26752', 62 Fusarium_pseudograminearum_NRRL28334, 63 Fusarium_pseudograminearum_NRRL28338; TREE Fig._1B = [&R] (1,2,((3,4),(((5,6),(7,8),(9,10),(11,12),((13,14,15,16,17,18,19,20,21,22,23),24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,(40,41,42,43,44,45,46,47,48),49,50,51),52,53,(54,55,56),(57,58,59),(60,61)),(62,63)))); END; BEGIN TREES; TITLE Tb9091; LINK TAXA = Taxa2; TRANSLATE 1 Fusarium_cerealis_NRRL13721, 2 Fusarium_cerealis_NRRL25491, 3 Fusarium_cortaderiae_NRRL31205, 4 Fusarium_cortaderiae_NRRL31185, 5 Fusarium_brasilicum_NRRL31281, 6 Fusarium_brasilicum_NRRL31238, 7 Fusarium_meridonale_NRRL28436, 8 Fusarium_meridonale_NRRL29010, 9 Fusarium_austroamericanum_NRRL2903, 10 Fusarium_austroamericanum_NRRL28718, 11 Fusarium_mesoamericanum_NRRL25797, 12 Fusarium_mesoamericanum_NRRL29148, 13 Fusarium_boothi_NRRL29105, 14 Fusarium_boothi_NRRL29011, 15 Fusarium_boothi_NRRL26916, 16 Fusarium_graminearum_Fgp23, 17 Fusarium_graminearum_Fgp24, 18 Fusarium_graminearum_Fgs5, 19 Fusarium_graminearum_Fgw158, 20 Fusarium_graminearum_Fgw115, 21 Fusarium_graminearum_Fgw37, 22 Fusarium_graminearum_Fgw155, 23 Fusarium_graminearum_Fgw90, 24 Fusarium_graminearum_Fgw190, 25 Fusarium_graminearum_Fgw136, 26 Fusarium_graminearum_Fgp21, 27 Fusarium_graminearum_Fgs2, 28 Fusarium_graminearum_Fgb7, 29 Fusarium_graminearum_Fgb20, 30 Fusarium_graminearum_Fgw166, 31 Fusarium_graminearum_Fgw121, 32 Fusarium_graminearum_Fgw79, 33 Fusarium_graminearum_Fgw195, 34 Fusarium_graminearum_NRRL34079, 35 Fusarium_graminearum_NRRL31084, 36 Fusarium_graminearum_Fgp38, 37 Fusarium_graminearum_Fgw77, 38 Fusarium_graminearum_Fgp39, 39 Fusarium_graminearum_Fgs3, 40 Fusarium_graminearum_Fgb9, 41 Fusarium_graminearum_Fgb25, 42 Fusarium_graminearum_Fgw51, 43 Fusarium_graminearum_Fgs4, 44 Fusarium_graminearum_Fgs9, 45 Fusarium_graminearum_Fgw228, 46 Fusarium_graminearum_Fgw187, 47 Fusarium_graminearum_Fgw133, 48 Fusarium_graminearum_Fgw62, 49 Fusarium_graminearum_Fgw199, 50 Fusarium_graminearum_NRRL28336, 51 Fusarium_graminearum_NRRL13383, 52 Fusarium_graminearum_NRRL28063, 53 Fusarium_graminearum_NRRL5883, 54 Fusarium_graminearum_NRRL6394, 55 Fusarium_asiaticum_NRRL13818, 56 Fusarium_asiaticum_NRRL6101, 57 Fusarium_asiaticum_NRRL26156, 58 'Fusarium acaciae-mearnsii NRRL26754', 59 'Fusarium acaciae-mearnsii NRRL26752', 60 Fusarium_pseudograminearum_NRRL28334, 61 Fusarium_pseudograminearum_NRRL28338, 62 Fusarium_culmorum_NRRL25475, 63 Fusarium_culmorum_NRRL3288; TREE Fig._1A = [&R] (1,2,(((((3,4,((5,6),(7,8)),9,10),(11,12)),(13,14,15)),((16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,(43,44,45,46,47,48,49,50),51,52,53,54),55,56,57,(58,59))),(60,61),(62,63))); END;