#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 19:46 GMT TreeBASE (cc) 1994-2008 Study reference: Cabrera L., Salazar G., Chase M., Mayo S., Bogner J., & Davila P. 2008. Phylogenetic relationships of aroids and duckweeds (Araceae) inferred from coding and non-coding plastid DNA. American Journal of Botany, 95: 1153-1165. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2078] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=109; TAXLABELS Acorus_calamus_M91625 Aglaodorum_griffithii_AM905758 Aglaonema_modestum_AM905757 Alisma_plantago_aquatica_L08759 Alloschemone_occidentalis_AM905744 Alocasia_odora_AM905802 Ambrosina_bassii_AM905798 Amorphophallus_hottae_AM905785 Amydrium_humile_AM905745 Anadendrum_sp._AM905740 Anaphyllopsis_americana_AM905753 Anchomanes_difformis_AM905761 Anthurium_acaule_AM905735 Anubias_barteri_AM905756 Aridarum_nicolsonii_AM905784 Ariopsis_peltata_AM905804 Arisaema_franchetianum_AM905806 Arisarum_vulgare_AM905797 Arophyton_buchetii_AM905820 Arum_hygrophilum_AM905809 Asterostigma_pavonii_AM905768 Biarum_tenuifolium_AM905810 Bognera_recondita_AM905765 Bucephalandra_motleyana_AM905822 Caladium_lindenii_AM905788 Calla_palustris_AM905819 Callopsis_volkensii_AM905773 Carlephyton_glaucophyllum_AM905821 Cercestis_mirabilis_AM905817 Chlorospatha_sp._AM905791 Colletogyne_perrieri_AM905823 Colocasia_esculenta_AM905800 Cryptocoryne_lingua_AM905779 Culcasia_liberica_AM905816 Cyrtosperma_macrotum_AM905750 Dieffenbachia_aglaonematifolia_AM905764 Dracontioides_desciscens_AM905754 Dracontium_polyphyllum_AM905747 Dracunculus_vulgaris_AM905812 Eminium_spiculatum_AM905813 Epipremnum_pinnatum_AM905746 Filarum_manserichense_AM905795 Gearum_brasiliense_AM905763 Gonatopus_angustus_AM905777 Gorgonidium_sp._AM905767 Gymnostachys_anceps_AM905727 Hapaline_benthamiana_AM905787 Hedyosmum_mexicanum_AM905824 Helicodiceros_muscivorus_AM905811 Heteropsis_oblongifolia_AM905737 Holochlamys_beccarii_AM905736 Homalomena_magna_AM905774 Jasarum_steyermarkii_AM905792 Lagenandra_ovata_AM905780 Landoltia_punctata_AY034223 Lasia_spinosa_AM905749 Lasimorpha_senegalensis_AM905755 Lemna_minor_AM905730 Lysichiton_americanus_AM905728 Magnolia_umbrella_AF206791 Mangonia_tweedieana_AM905766 Monstera_adansonii_AM905743 Montrichardia_arborescens_AM905818 Nephthytis_afzelii_AM905759 Orontium_aquaticum_AM905729 Pedicellarum_paiei_AM905733 Peltandra_virginica_AM905815 Philodendron_deltoideum_AM905775 Phymatarum_borneense_AM905783 Pinellia_pedatisecta_AM905807 Piper_betle_L12660 Piptospatha_ridleyi_AM905781 Pistia_stratiotes_AM905799 Podolasia_stipitata_AM905752 Pothoidium_lobbianum_AM905734 Pothos_scandens_AM905732 Protarum_sechellarum_AM905805 Pseudodracontium_lacourii_AM905786 Pseudohydrosme_gabunensis_AM905760 Pycnospatha_arietina_AM905751 Remusatia_vivipara_AM905803 Rhaphidophora_crassifolia_AM905741 Rhodospatha_oblongata_AM905739 Scaphispatha_gracilis_AM905793 Schismatoglottis_trifasciata_AM905782 Scindapsus_hederaceus_AM905742 Spathantheum_intermedium_AM905769 Spathicarpa_hastifolia_AM905772 Spathiphyllum_wallisii_AJ235807 Spirodela_polyrrhiza_AM905731 Stenospermation_ulei_AM905738 Steudnera_colocasiifolia_AM905801 Stylochaeton_bogneri_AM905776 Symplocarpus_foetidus_L10247 Synandrospadix_vermitoxicus_AM905771 Syngonium_auritum_AM905789 Taccarum_weddellianum_AM905770 Tofieldia_pusilla_AJ286562 Triglochin_maritimum_U80714 Typhonium_blumei_AM905808 Typhonodorum_lindleyanum_AM905814 Ulearum_sagittatum_AM905794 Urospatha_sagittifolia_AM905748 Wolffia_columbiana_AY034255 Wolffiella_oblonga_AY034242 Xanthosoma_helleborifolium_AM905790 Zamioculcas_zamiifolia_AM905778 Zantedeschia_albomaculata_AM905762 Zomicarpella_amazonica_AM905796 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3249] TITLE 'rbcL, matK-trnK, trnL-trnF and indels'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=5421; FORMAT DATATYPE=Standard SYMBOLS= "A C G T 0 1 2 3 4 9 B D E F H J K L M N P Q R 5 6 7" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910 4920 4930 4940 4950 4960 4970 4980 4990 5000 5010 5020 5030 5040 5050 5060 5070 5080 5090 5100 5110 5120 5130 5140 5150 5160 5170 5180 5190 5200 5210 5220 5230 5240 5250 5260 5270 5280 5290 5300 5310 5320 5330 5340 5350 5360 5370 5380 5390 5400 5410 5420 5430] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Acorus_calamus_M91625 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCACCCGA{AG}GAAGCAGGGGCTGCGGTAGCTGCCGAATCCTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGCCGATGCTACCACATCGAGCCCGTTGTTGGGGAGCAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTTTGGAGGATCTTCGAATTCCCCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCCCATGG{AG}ATCCAGGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCGAAGAACTACGGTAGAGCAGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCACAGCCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCTGAAGCATTTTATAAAGCGCAAGC{CG}GAAACAGGTGAAATCAAAGGACATTATTTGAATGCTACTGCGGGTACATGTGAAGAAATGATGAGAAGGGCCCAATGTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGTGGATTCACTGCAAATACTAGCTTGGCTATTTATTGCCGAAACAACGGCCTACTTCTTCACATCCATCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCGCTACGTATGTCTGGTGGAGATCACATTCACGCCGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAAATGACTTTAGGTTTTGTTGATTTACTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTTTGCCCGTAGCTTCCGGTGGTATTCACGTTTGGCATATGCCTGCCTTGACCGAGAACTTTGGGGATGATTCTGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGCGAAAGTACTCAAATTATCCGTGAAGCTTGTAAATGGAG?????????????????????????????????????????????????????????????????????????ATGGAAGAATTCAAAGTCTATTTC------GAAAAAGATGGGTCTCGTCAACAATACTTCCTATATCCACTTCTCTTTCAGGAGTACATCTACGCACTTGCTCATAATCAT------GTTTTA---------AATGGATTGA------TTTTTTACGAATCCTCGGAAAATTTCGTTTATGATAATAAATTTAGTTTAATAATTGTAAAACGTTTAATTACTCAAATGTATCAAAAGAATTCTTTGAGTAATTTGGTTAAT------GATTCTAACCGAAATCGATTAGTTCGGCAAAAC------AAGAATTTTTATTATCAA------ACGATATT-GAGGGTTTTTCAGTCATTATGGAAATTCCATTCTCGATAATATTTTTATCTTCCGTTGAAGAAAAAAAAGCAAAAATACCAAAAATTCAGAATTTACGATCTATTCATACAACATTTCCCTTTTTAGAAGACAAATTATCACATTTAAATCATGTA------TCAGATATATTAATACCCTATCCCATCCATCTCGAAATCCTGGTTCAAGTTCTTCAAGGCTGGATACAAGATGTTCCGTCTTTACATTTATTGCGATTCTTTCTCCATGAGTTTCATAATTGGAATAGTCTCATTACTCCA---------AAGAAA------TCCATTTCTTTTCTTTTTTCAAAAGGGAATCAAAGACTCTTCTTGTTCTT------ATATAATTCTTATGTATTTGAGTGTGAATCCGCATTAGTCTTTCTCCGTAAACAATCC---TTTTATTTACGATCAACATCTTTTGGAACCTTTGTTGAGCGAACACATTTCTATGTAAAAATAGAG------CATATTGTAGTAGTGCGTAGGAATAATTTTCAAAAGGCCTTATCTTTGTTCAAAGATCCTTTCATCCATTATATCCGATATAAAGGAAAATCAATTCTGGCTTCAAAGGGGACTGATTTTCTGATGAAGAAATGGAAATATCACC?TCTAAATTTCTGGCAATGTCATTTTCACTTTTGGTCTCAACCGCATAGGATTCATATAAACCG??TATCAAATCGTTCTTTCTATTTTATGGGCTATCTTTCAAGTGTACGAATCAAT------TTTTCAACGGTAAGGAGTCAAATGCTAGAGAGTTCATTTCTAATGGATACTCCT------ACTAAAAAATTCGATACTATAGTCCCAATTATTCCTCTAATCGGATCATTG-TTAAAGCTAAGTTTTGTAACGTATCGGGGCATCCTGTTAGTAAGCCGGTCTGGGCTGATTTGTCAGATGCTGATATTATCGATCGATTTGGACGAATATGTAGAAATCTTTCTCATTATCACAGTGGATCCTCAAAAAAACAGAGTTTGTATCGAGTAAAGTATATACTTCGCCTTTCGTGTGCGAGAACTTTGGCCCGTAAACATAAAAGTACAGTGCGCGCTTTTTTCAAACGATTAGGTTCAGAATTCTTAGACGAATTCTTTACGGATAAAGAACAAGTTCTTTCTTTGATCTTC---CCT----TCCCTT--------------CGTTCACCTTCACAC------AGGGTCCAT------------------AAA---GGAGAA---CGTATTTGGTATTTGGATATTATACGTATCAATGACCTGGTG----AATAATTC-----------ATGATT--------TGTCATGGGACTT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATT---AAAAATGGGCAATCCTGAGCCAAATCC?TGTTTT---------GATAAAACAAAGTTTCATTTCAT----------------AAAACGAG---------------------------------------------------------------------------------------AATAAAAAAG---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ACTGCATTACGTTGGTAGC-GGAATCCTTTCT--ATCG----------AGAAATTACA----------------GAGAGGAAG-----ACCCTATTT-------ATATAC-----GTAATA-------------------CCGATGTATACGTAGTAT--------------------------------ACATATCAAA----------------CGATTAATGAT--GA------CCCAAATTC-TGAATCCTATTTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTAGGAAATTTCCGAA-TTCTTTGGAAAA---------GAATTGGGAATCC-----ACTCC---------AA-GTT------GAAG-----------GAAGAATCAAATATTCAGTGATCAAATAATTCACTC-----CAGAATATGCTAGATC-----TTTTGAAAAAC-------------------------------------------------------------TGATTAATCCGACGAGAATAAAGATAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGT-CAAGTCC-TCTATCCCCAATAAAAAG--------CTTGTTTGACTTACT------AACTATCTATCCTCTTT----GTTTTGTCAG----CGGTTCCAAATTAAA-TTGGCTATGTTTCTTTTTGACTC----TATT-TTTCACAAA------TAAATGC-ATCGGAGTCAAAATTTTT-----GAATCT---------TATCAAAAGTCTTGTGATAGATACGATATACGTACAAA-----------TGCACAT------------------ATCTGGGC------AAGGAATCCCCATTATTGAAT------------CATTCACAGTTCATATGATT----------------ACCCTTTTACTTAGAA--------------------------------GTAAAGTCTTCTCTTTTT--------------GAAAATGAAA--AAACTCAAAAG-----GCGGGGTAAGATTTTGG---------------AATAC---AATTTCGATCTCTTTAA-----------------------------------------------------------------TTTATTGACAAAAACACAAAT---ACTCT-------AGTAAGATGA--------------TC-TATCGGGAATAG-----------------CCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1110111?11101????????????1010011?0???00?10100??101?001???000001?000010001??1?01000?1100100011?101?0 Aglaodorum_griffithii_AM905758 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGATTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTGATTCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAAATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTCGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACATAATTATTTAATCAATTCTGTTAAT------GATTCCAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGCCATTGTGGAAATTCCTTTCTCGCTGCGATTAGCATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTTTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCAA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCT------ATATAATTCTTATGTAGTTGAATGTGAATTTATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGACCCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGGACAA---CAGCTTATAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTGGAAATCTTTCTCATTATTACAGTGGGTCTC??????????????????????????????????????TGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTCCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAATTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATGGAATAGAAA------------CACAAATTATCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACAGATTGT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTT----GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTATTTATATAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAATTCAAAA-TTTTATGAAAAAATT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC------TTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCA??????????TCCCCAAAAAA-----------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAATTTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AAGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTA------TTT------AAGACCAAA-AAAATTCCAAGG-----ATTAGATAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTGTT---------------------------------------------------------------------AACGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------AGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGC???1011110111100101011001100101000010???0??001001?101?011???001?01?010000101??010001?10100?001?1?001?0 Aglaonema_modestum_AM905757 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGATTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTGATTCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAAATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGGAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAAATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCG{CT}GGAAATTTCAGGTTATGACAATAAATTTAGCCCATT{AT}CTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTAATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ACGATATCAGAGGGTTTTGCTGCCATTGTGGAAATTCCTTTCTCTCTGCGATTAGCATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTACCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTCTACATTTATTACGATTTTTTTTTCACGAATATCATAATTGGAATAATCTCATTACCTCA---------AAGAAA------TCTAGTTAT---GGGTTTTCAAAAGAGAATCCAAGACTATTCCGGTTCCT------ATATAATTCTTATGTAGTCGAATGGGAATCTATATTAGTTTTTCTCCGTAAACAATCC---TTTTATTTACGATCAACATCTTATGGACCCTTTCTTGAGCGAACACATTTCTTTGAAAAAATAGAACAA---CATCTTATAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTTAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTTACTTTTGGTCTCAACCCTGTAGGATCTACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCTGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTCCTTTCTTTAATCTTA---CCAAGAATTTCTTATCCTTTACATAATTCTTATCCTTTACAT------AAATTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTCGTCATGAGACCATGT-----------AAATG-AAATGGAATAGAAA------------CAAAAATTATCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTCGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATGTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAGAACTGCAAGCACGGGATGT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTT----GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCATTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATATAATGAATTAAAAA-TTTTATGAAAAAATT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC------TTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAA-----------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AAGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTTTA---TTT------AAGACCAAA-AAAATTCCAAGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTGTT---------------------------------------------------------------------AACGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------AGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAG-GGACTGAATC????????????1011110111100101011001100101000010???0??001001?101?011???001?01?010000101??010001?10100?001?1?001?0 Alisma_plantago_aquatica_L08759 TCAAAGCCGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCGCAACCGGGAGTTCCACCTGAGGAAGCAGGTGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACTAGTCTGGATCGTTACAAAGGACGATGCTACCACATCGAACCTGTTATTGGAGAGGAAAATCAATATTTTTGTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTTAAAGCTCTACGAGCTCTACGTTTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCTGAAGCAATTTATAAATCACAAGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATTGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTACCTTGGCAGCGTATTGCCGTGACAACGGTTTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATCGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTTGGTAAACTGGAAGGTGACCGTCAGCTGACTTTAGGTTTTGTTGATTTACTACGCGATGATTATATTGAAAAAGACCGAAGCCGCGGTATCTTTTTCACTCAAGATTGGGTGTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTCGGC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATGGAAGAATTAAAAAAATATTTA------GAAAGAGATAGATATTGGCAACAGCACTTCCTATATCCACTTCTATTTCAGGAATATATATATGCACTTGCTCATATTCATAATCGTGGTTTA---------AATGGATCAA------TTTTTTACGAATCTGGGGAAATTTTAGGTTATGACAATAAATCCAGTTTCATACTTGTGAAACGTCTAATTCTTCGAATGTATCAACAGAATTTTGAGATTCATTCATCTAAT------GAATCTCATAAAAATAGATTCGTTGGACACAAC------AACCCTTTTTTTTCCAAA------ATGATATGGGGGGGCTTTGCGGTTATTGTAGAAATTCCTTTCTCGCTTCCATCCTTA------ATT-AAGAAAAAAAAAAAGAAATACCAAAATCTCAGAATTTACGATCTATTCATTCGA?ATTTCCTTTTTTGG?GGACCAATTTTCCCATTTAAATTATGTA------TCAGATATACGGATACCGTATCCCATTCATCTCGAAATTTTGATTCAAATAATACAATCCTGGATACAAGATGTTCCCTCTTTGCACTTATTGCGATTTTTTCTATACGAATACCATAATTGGAATTGTTTCATTACTCTA---------AAGAAA------TCTCTTTCT---ATTTTTGCAAAGGGGAATCCAAGATTATTTTGGTTCTT------ATATAATTCTTATGTATCTGAATATGAATCCGTATTTTGTTTTCTTCGTAAACAATCC---TCTTATTTACTATCAACATCCTATAGAAATTTGATTGAGCGAACACATTTTTATGGAAAAATGGAG------CATCTTGCAGTAGTTTGTTGTAATTGTTTTCATAAAACCCTGCAGTTGTTCAAAGATCCTTGTATACATTATGTTAGATATCAAGGAAAATCAATTCTCGCTTCAAAGGGAACTTATCTTCTGATGAAGAAATGGAAATGTTACCTTGTCAATTTTTGGGAATGTCACTTTTCTTTTTGGTCTCAACCATATAGGATTCATATAAACCAATTATCCAATAATTCTTTCGATTTTTTGGGTTATTTTTCAATTGTATTAATAAAT------CCTTTGACAGTAAGAA?TCAAATGCTAGAGTACTCATGTCTAATAGACAATACTGCT---ACTAAAAAATTCGATACTATAGTTCCGATTATTCCTCTCATTGGATCGTTGTCCAAAGCGAAATTTTGTAATGTGTCCGGGCATCCTATTAGTAAACCCATTTGGACTGATTTATCCGATTCTGATATTATTGATCGGTTTGTTCGGATATGTAGAAATCTTTCTCATTATCATAGTGGATCCTCAAAAAAACAGAGTTTGTATCGAATGAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCTCGGAAACATAAAACTACGGTACGCGCTTTTTTTCAAAGATTAGGTTCAGGATTTTTAGAAGAATTCTTTGCGGAAGAACAAAAGTTTCTTTCCTTGGTCTTG---CCGGGAATCCCTCTT------------GCCTCAGGCTCTGAT------AGGGTATAT------------------------AAAGAA---CGTATTTGGTATTTGGATATTATTCGTATCAATGACTTGGTG----AATTACTC-----------ATGATT--------GACTATGAAACTC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGTAT-TGAGCCTTGGTATGGAAACCTACTAAGTGAAAACTTCCAAATTCAGAGAAACCCTGGAATT---AGAGATGGGCAATCCTGAGCCAAATCCTTCTTTT---------TGGAAAACAAGGGTTTATTTTATATTTATTATCAAAATTCTAGATTTATAGAAATTCTATATTTCATTTCGAAAAAGCATTTCTAAAAAAAAAGATTTTCTATTTCTATTTATATAGAAAAATAATCTCAAAATAATCAAAAAA---GGATAGGTGCAGAGACTCAATGGGAGCTGTTCT-----AACGA---------ATGGGGTTG--------------------GTTGGATTACGTTGGTAACAGGAATCTTTCTATAGAAA----------CAAAATTACA----------------GAAAGGAGGGTATTACCTT-----------ATATAC-----GTAATAGAATA--------------CGTACGTATACATA--------------------------------CTGGATATATCAAA----------------TGATTAATCAT--AA------TCACGATTT-TAAT-TGTGAATTTAGAATTGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATAATATCAATTCTAAATTAAA-TTCTATGAAAAATTT-----ATGATTGTGAATCC-----ATACCAATTCAAGCAA-ATT------GAAG-----------GAAGAATCGGATATTCAATGATAAACTCATTCACTA-----CGGAGTCTGATTTATC-----ATTTGAACAAACATTAAAAAAAA-------------------------------------------------TAATTAACCAGGCGAGAATAAAGAGAGAGTCCC---------------------------GTTCTACATGTC-------AATACTGACAGCAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------------TAACCCTTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAC------AAAGAATCTCCATTATTGAAT------------CATTCATAGTCCATACCATT----------------ATTTTTACAC----------------------------------------AAAATCTTTTTTTTTT---------------AAGATACAAA-AAATTTCAGGG-----ACTAAATAAGATTTTT-----------------ATAC---TTTTTTAGTCCCTTT---------------------------------------------------------------------AATTGACATAAACATGGGT---CCTACACTAT--AGTAGGATAA--------------TG-TGCGAAAAGTAG-----------------TCGGG-----------------------------------ATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1110111?11101????????????101000000???0??10100?0101?00?????0????????????????1?01???00100?000101101?? Alloschemone_occidentalis_AM905744 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTACTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACGGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCAAAGCAGTAGATACTCTAGATATGGAAGAATTTAAAGGATATTTT------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCATAAC------CAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCA---------AGGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAATTCTTATGTAGCTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTATTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAAT------CTTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------GCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGCTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGTTTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATTCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTC-----------ATGATT----CATTGGTCATCAGACCCCGT-----------AAATG-AAATAGAATAGAAA------------CCCAAATTAACAAG---AGAGAAAAAAAAAA------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCGC??TTGCCTTGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTTTCTTT-CTAT----------CTAATTTACA----------------GAAAGGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCGAATCCATAATATTTATTTATTTATATAATATAAATAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATCAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCATTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCGCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA----------------------AAGTCTTCCTTTTTTT--------------AAGACCCAA-AAATTTCCAGGG-----------TAAGGT--------------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------TATGGACATAAAAACAAGC---CTTCTAATCT--AATAAGATAA---------AGTGATG-CATGGAAAACGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?01100101011001100001000010???0??001001?101?001???001?01?0101?010001010000010?11?00010100100 Alocasia_odora_AM905802 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGCGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAAGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTGTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGTATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGCGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATCCCTGTAGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCTGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATGGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCCTTCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTATA------TCAGATATACTAATACCTTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTTTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATTCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATTAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCAAACTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTCCTAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCGGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCGGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG???????????????????GGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTTT--GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTGGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCC-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATATAA-----------------------TTATTATTTATATATAAATATAATTATTATTTTATTTA--------------------------------------------------------------------------------------------------------------------------------------------TTTATTTATATAAGAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATTGAAATTGAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGGCGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAA-TCGTGAGGGT-CAAGTCC-TCTATCCCCAAAAAA------------CCATTTGACCTCCT------AAGGATTTTTCCTCC------TTTCCGCCGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTTACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTATTT------------AAGACCAAA--AAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTA?????????????????????????????1011010111100101011001101??1000010???0??001001?1000001???001?01?010000111??010001??1100?00001?001?0 Ambrosina_bassii_AM905798 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTTCAAGGGCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTACGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGCGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATACGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTACTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATAGA---AATGGTTCAA------TTTTTTACGAACCCGCAGAGATTTCAGGTTATGACAAGAAATTTTGTTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAGTTCTGTTAAT------GATTCTAAACAAAATAGATTCATTGGGTATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGCCATTGTGGAAATTCCTTTCTCATTGGGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTATTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTCACTATTATGGTTTTTCAAAAGAGAATCCAAGATTATTGTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTCGTTTTTCTCCGTAAACAATCC---TTTTATTTACGGTCAACGTCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATTTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCTTATGGTTGTTCAAGGACCCTTTCATGTATTATGTTAGATATCAAGGAAGATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATATTACATTGTCAATTTTTGGCAATGTCATTTTAACTTTTGGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCCGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGACAAAA----------------TGTCAGTC-----ATTT---TCATTCCGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTA------GGGATCTAATCTATGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCGCGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAAAGGGCAATCCTGAGCCAAATCCTTGTGTGTTTTTTTTTGAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGTTAGCTGGAATTCTTCTTT-CTAT----------GTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCGCGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATAATTATAATAAATTCAAAA-TTTTATGAAAAAATA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CGGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCAGACAAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAA-----------CCAATTTTACCTCCTAAGTT-AAGTATTTTTCCTCC------TTTCCGTCGG----TGACTAA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGTGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGCAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA-----------------------AGTCTTCCTTTTTTTT-------------AAGACCAAA-AATACGTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC-----TTTTTGTCCTTTTA---------------------------------------------------------------CTTTTGATGGGCAGAAACACAAGCAAGCCGCC-------AGTAAGATAA---------GGCAATG-CATGGAAAAGGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTC??1011010111100101011001100101000010???0??001001?101?000001001?01?010000111??010001?10100?00001?001?0 Amorphophallus_hottae_AM905785 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGGTGCTACCACATCGAACCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCGAAGGCCCACCTCACGGTATCCAAAGCGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGTGTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAACGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACCTAACAGGGGGATTCACCGCAAATACGAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGTATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGACCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAACCGGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCGAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCCT------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATGGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTACCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCT------ATATAATTCTTATGTAATTGAATGTGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTCGAGCGAGCACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAGTGGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGAGCATTGTCAAAAGCGAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCCGATTCTGATATTATTGATCGATTTGGTCGGACATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACAGTACGCGCCTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGCTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAG---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGATCATGA-----------AAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACG??GCA--TGAGCCTTAGTATGGAAACCTACTAAGTGGTAACTTCCAA-CTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CACACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATAATTAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATATAATTATAAAAAATTCAAAA-TTTTATGAAAAATAA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATT----------------------------------TGAAAAAAAAAAA--------------------------------------------------------TGATTAAGCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGT-CAAGTCCCTCTATCCCCAAA---------------CCATTTTACCTCTT------AAGTATTTTTCTTCT------TTTCTGTCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATTCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAGAT------------------ATGTGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTTATTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AGGTCCTCCTTTTTATTTAATTATTT----AAGACCAAA-AAATTTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC----TTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001100?01000010???0??001001?101?1?1???001?01?010000111??010001?10100?001?1?001?0 Amydrium_humile_AM905745 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTATCACATCGAACCCGTTGTTGGGGAGGAAGATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTAGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGTCCCTATCGTAATGCATGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCAAACCAGTAGATACGATAGATATGGAAGAATTCAAAGGATATTTAGAAATAGAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCAT------GGTTTAAATGTA---AATGGATCAATATCCATTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACATTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTTTTAAT------GATTCTAATAAAAATAGATTCGTTGGTCACAAC------CAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCATTACTCCA---------AGGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTTCT------ATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATTTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTTTCCCATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAAT------CCTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTTATAGATACTGTT------GCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATTCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATAA-----------ATGATTGATTCATTGGTCATCAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CCAAAATTAACAAG---AGAGGAAAAAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTCCTTTTCGGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAGAACTGCAAGCACG???????????CCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTAT----------CTAATTTACA----------------GAAAGGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATTAAA----------------CGATTAATCAC--GA------CCCGAATCCATAATATTTATTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATAATATAAATAAATAG-TTTTATTAAAAAT{GT}G-AAGAGTTATTGTGA-TCC-------------------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAAAAA----------------------------------------------------TGATCAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGG-TTCAAGTCCCTCTATCCCCAA---------------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCATTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TATTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCAC-----GTAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA----------------------AAGTCTTCCTTTTTTT--------------AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------TATGGACATAAACACAAGC---CCTCTAATCT--AATAAGATAA---------AGTGATG-CATGGAAAACGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC0001111?01100001011001000?01000010???0??001001?101?001???001?01?0101?010001011000010?11?00010100100 Anadendrum_sp._AM905740 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCATTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACCTTTTAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACGAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTTTGGAAAGAGATCAAATTCGAGTTCAAACCAGTAGATACGCTAGATATGGAAGAATTCAAAGGATATTTAGAAATAGAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCAT------GGTTTAAATGTA---AATGGATCAATATCCATTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCACAAC------CAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTACTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCTCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCA---------AGGAAA------CCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTTCT------ATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATTTTACTTTGTCCATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAAT------CTTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTTATAGATACTGTT------GCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATTCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATGA-----------ATGATTGATTCATTGGTCATCAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CCAAAATTAACAAG---AGAGGAAAAAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTCCTTTTCGGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTAT----------CTAATTTACA----------------GAAAGGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA-----------------GATTAATCAC--GA------CACGAATCCATAATATTTATTTATATAATAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATCAATCAGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCATTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TATTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCAT-----GCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATAAAA----------------------AAGTCTTCCTTTTTTT--------------AAAACCCCA-AAATTACCAGGG-----------TAAGGT--------------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------TATGGGCATAAACACAAGC---CCTCTAATCT--AATAAGATAA---------AGTGATG-CATGGAAAACGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC0001111?01100001011001000??1000010???0??001001?101?001???001?01?0101?010001011000010?11?00010100100 Anaphyllopsis_americana_AM905753 TCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTTCTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTTTTAAT------AATTCCAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATGTA------TCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGATTCCT------ATATAATTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCTTAAACAATCC---TCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTTTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGT------ACTTCAGCGGCAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGGATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGTTCATGAGACCATGT-----------AAATG-ACATAGAATAGAAA------------CCCACATTTTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----GTTC---TAATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG???????????????????GGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------AAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCATATATATATA---------------------------------CTGATATATCAAA----------------CGATTAATTAC--GA------CCCGAATCCTGAATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTATAATTATATAAATTCAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAA----------------------------------------------------------TGATTAATTGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATATCGACAACAATGAAATTTATAGTAAGAGGAAA-TCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTCGACTTCCT------GAGTATTTTTCCTCT------TTTCTGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAAAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTT--------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC---CCCCT-------AGTAAGATAG---------GGTAATG-CATGGGAAATTG-----------------TCGGG-----------------------------------ATAGCTCAGTT?????????????????????????????????1011111?11100101011001100??1000010???0??0?1001?101?001???001?01?0101?010001010001?10100?00011?001?0 Anchomanes_difformis_AM905761 TCAAAGCCGGTGTTAAA??TTACAAATTGACTTATTATACTCCCGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCTGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCGAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTGTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGCGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTGCAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGCAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGTTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCCA------TTTTTTATGAACCCGCAGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTAATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGCCATTGTGGAAATTCCTTTCTCGCTGCGATTAGCATCCTCCCTCGAAGAAAAAAAAGAA---ATACCCAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCAA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCT------ATATAATTCTTATGTAGTTGAATGTGAATCTATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGACCCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGGACAA---CATCTTATAGTACTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGACCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTTTGGCTTCAAAAAGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAAT------CCTTCAGCAGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTCCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CCCAAATTATCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCA???????????????????TGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCGACGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGATAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTTATCAC--GA------CCCAAATCCATAATTTTTATTTATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAAATTCAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCGTCGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----TTGTTT-----TGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTATTT------------AAGACCCCC-AAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---CTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAC????????????1011110111100101011001100101000010???0??001001?101?001???001?01?010000101??010001?10100?001?1?001?0 Anthurium_acaule_AM905735 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAGGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCACCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCTTATTGGGATGTACGATTAAACCAAAATTAGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACGGGTGAAATAAAAGGGCATTACCTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCCGGTACAGTAGTAGGTAAACTGGAAGGCGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGGGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAACGAGGGGCGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCCAACCAGTGGATACGCTAGATATGGAAGAATTCAAAGAATATTTA------GAAAAAGGTAGATCTAAACAACGACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTATTCATGATCGT------GGTTTAAATGTA---AATGGACCTT------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCACAGC------CGTAATTTGGATTCTCAA------ATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCCCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTTTCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCATCCATCTGGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCGTTACTCCA---------AAGAAA------TCTAGTTAT---GATTTTTCAAAAGAGAATCCAAGACTAATTTTGTTCCT------GTATAATTCTTATGTAGTTGAAT{AG}CGAATCCATATTAGTTTTTCTCTTTAAACAATCC---TCTTATTTACGATCAACATTTTTTGGACCTTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAA------GATCTTGTAGTAGTTTGGTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTAGCTTCAAAAGGGACTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGCCTCAACCCTGTAGGATCCACATAAATCAATTCCCCAGTTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCCGCGGTAAAGAGTAAAATGCTAGAGAATTCTTTTTTAATAGATACTATT------GCTAATAAATTTGAAACTATACTTCCAATTATTCTTATGATTGGATCATTGTCGAAAGCTAAATTTTGTAACGTATCAGGAAATCCTATTAGTAAGCCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCCTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGGCTGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CG?ATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGGCCGTGT-----------AAATG-AAATAGAATAGAAA------------CAAAAATTACCAAG---AGAGAAGAGAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCGTACAATAATGGTGGAATCAAGTGAGTA----TTCAAGTTTC---GA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAATGGCAAGCACGA????T-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGGGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CCAATTTACA----------------GAAAGGATA-----ACCCTATTCCT-----ATATAC-----TTAATA-------------------CGCACATATATATATATATATA-------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCGAATCCATAAATTTTATTTATAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATAAAATATATTATAAATAA-TTTTATGAAAAATTG-AAGAATTATTGTGAATCC-----ATTCCAAAC-----AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCAGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTAGATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGA?????????????????????????????????????????????????TTCCT------AAGTCTTTTTCCTCT------TTTTCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA--AAAAAAGATCTGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTTGAGTATTGAAT-----TATTCACTATTTGCAATCTACGTTGTT-----------AGGTTACCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTT----------------AAGACCCA--AAAATTCCAGGG-----------TAAGGGTTTT----------------AAATT---TTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC---CCTCTAATCT--AATAAGATAA---------GGTGATG-CATGGAAAAGG??????------------?????-----------------------------------????????????????????????????????????????????1011111?01100101011001100101000010???00?0010011101?001???001?0010101?0101??010001??0?10?00010100100 Anubias_barteri_AM905756 TCAAGGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGTTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTACATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTCTATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------AATTCTAACCAAAATAGATTCATTGGGCACAAC------AAGAATTTTGATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTATACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTCGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACCCATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAAGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTTATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCGAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTGCCAATAAAT------CCTTCAGCGGTAAAAAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCTGTAAACATAAAAGTACGGTACGCGCTTTTTTGCCAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTACCACCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CCAAAATTCTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTTTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCAC??TGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTT----GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGTTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAAATA-----ATCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--AA------CCCAAATCCATAATTTTTATTTATATAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATTCAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTTTGATTGATC-----TTTTGAAAAAAAAAAAAA------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCT---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAA----------CCCATTTTACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTTAGTTTAGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAT------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTATTTTA-TTT------AAGACCCCA-AAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATATACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAA??????????????1011110111100101011001100101000010???0??001001?101?001???001?01?010000101??010001?10100?001?1?001?0 Aridarum_nicolsonii_AM905784 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTATGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAACTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------ATTTTGATGAACCTGCGGAAATTTCAGATTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCCA------ACGATATCAGAGAGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACAATTCTTTTTTCACGAATATAATAATTGGAATAATCTCATTACTCTA---------AAAAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTTATTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCAAAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTAAAAATTTTGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTAT??????TGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAAT-----AGAAA------------CAAAAA-TCTCAAG---AGAGATAAAA----------------TGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAATA----GTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG?????????????????????????????????TGGTAACTTCCAAATTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAAGAAA--------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTGCA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATATTTATATAATAATAATAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAATCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAGA---------CCCATTTTACTTCCT------AAGTATTTTTCCTCT------TTTCCGCTAG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATATACGTACAAA-----------TGAAGAT----------------ATATATGTACAAAA-CAAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAAA----------------------AGTCTTCCTTTTTTTT-------------AAGACCCCC-CAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTGTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111100111101001100??1000010???0??001001?101?001???001?01?0100001001?010001?10100?001?1?000?0 Ariopsis_peltata_AM905804 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCCGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGGTAAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTATTTAACAGGGGGATTCACTGCAAATACGAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTAGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGCGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGAT?TGGAAGAATTAAAGGGATATTTA------GAAAAAAGTAAATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAATATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCCA------TTTTTTGTGAACCCCCTGAAATTTCAGGTTATGACAATAAATTAAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGGACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATTAGAGGGTTTTGCTGTCATTGTGGAAATTCCTCTCTCATTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACAAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTATA------TCAGATATACTAATACCGTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGGTGGATACAAGATGTTTCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCGAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATACAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTACCTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTCGATATCAAGGAAAATCAATTCTGGCTTCAAAGGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCGGTAGGATCCACATAAGCCAATTCTCCAAATTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCCGTAAAGAGTCAAATGCTAGAGAGTTATTTTTTAATAGATACTGTT------ACTCAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTTAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTATAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTCGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATCGAATAGGAA------------CTCAAATTCTAAAG---AGAGAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTT---GAGAAAAAAA-----------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGACTAATCAC--GA------CCCCAATCCATAATTATTATTTATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATATTAAATA-TTTTATGAAAAATGA-AATAGTTATTGCGAATCC-----ATTCT---------AA-ATTGAAATTGAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CTATTTTACCTCCT------AAGTATTTTTCCTCC------TTTCCGCCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAAATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACCCGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGGGTATTGCAT-----TTTTCAATATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTTA--------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC------TTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001100101000010???0??001001?1000001???001?01?010000111??010001?10100?00001?001?0 Arisaema_franchetianum_AM905806 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAACTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATCGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACGGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCGAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTGGCCGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAGAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCTGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATGGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCCTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTACGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTCCAAATAAAT------CCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTT------ACTAAAAAATTAGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATCGATCGATTTGGTCGTATATGTGGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGCGCTAGAACTGTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTATGGAAGAAGAAAAGGTGCTTTCTTTAATCTTA---CCAGGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-----------------TGTCAGTC-----ATTT---TTATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTT------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTACAT-TGAGCCTTGGTATGGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCC-----ATTCT---------AA-ATTTAAATTTAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAGAAAAAAAAAA-------------------------------------------------------GATTAATCAGACGAGAATAAAGAGAAAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTGACCTCCT------AAGTATTTTTCCTCC------TTTC-GCCGG----TGACTCC-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------TAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTTTT-------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------CAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC101101011110010101100110010??0?????????????????1000001???001?01?010000111??010001?10100?00001?0?1?0 Arisarum_vulgare_AM905797 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGGCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGAGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGCGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAACCGTGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAACTGCTGCTTGTGA?????????????????????????????????????????????????ATGGAAGAATTAAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGG------------TTTTTATGAACCCGCGGAGATTTCAGGTTATGACAATAAATTGAGTTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAAACAAAATAGATTCATTGGGCATAAC------AATAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGGGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAACGAGAATCCAAGACTATTGTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TTTTATTTACGATCAACATTTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCTTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAGAGCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATATTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATAATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCCGTTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATCGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAAACCATGT-----------AAATG-AAATAGAATAGAAA------------CTCCAATTCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTGTTTTTTTTT--GAGAAAAAAAAA---------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATTATAATAAATTAAGAAATTTAAAA-TTTTATGAAAAAATA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CGGGGTCTGATTGATC-----TTTAAAAAAAAAAAAA--------------------------------------------------------TGATTAATCAGACAAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAA-----------CCAATTTTACCTCCTAAGTT-AAGTATTTTTCC--------------GTCAG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAG--------------CAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTTTT------------AAGACCAAA-AAAATGTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATAGGCATAAACACAAGCAAGCCCCC-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TTGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC10?1010111100101011001100101000010???0??001001?101?00000110??01?01000??11??010001?10100?00001?001?0 Arophyton_buchetii_AM905820 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATACGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCGT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTTTTTGATCAATTCTGTTAAT------GATTCTAAACAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCCTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATTTCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTTATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCAAAATTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------ACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TATTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAT--GA------CCCAAATCCATAATTATTATTTATATAATTATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATAATAAATAAATAATTTCAAAATTTTATGAAAAAATA-AAGAGTTATTGCGAATCC-----ATTCT---------AA---------------------------AGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCAGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAA---------------CCATTTTACCTCTTAA-TT-TAGTATTTTTCCTCT------TTTCCGTTGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAAATCCGAGC------------------------TT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCCAAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATAAAA----------------------AAGTCTTCCTTTTTTATTT-----------AAGAC-----AAAAG------------ATTAGGTAAGGATTTT----------------CAAAC--TTTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAGCACAAGC----CCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCA?1011010111100101011001100??1000010???0??000001??1??000011001?01?1?0000101??010001?000?0?001?1?001?0 Arum_hygrophilum_AM905809 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGTGTTATGAATGTCTCCGCGGTGGGCTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACATAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACACAATTTTTTGATCCATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AATAATTTTTATTCTCAA------ACGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACAAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAAAAATCTCATTACTCTA---------AAGAAA------TCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGGTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCAAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTCCCCAAAAAT------CCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTT------ACTAAAAGATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAGGAATTCTTTACGGAAGAAGAAAAGGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATCCACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------AGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG??????????????GGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAAAGGGCAATCCTGAGCCAAATCCTTGTTTTTTT------GAGTAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCGTTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACAG------------ACAGAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATAATTTATATTTATATTATATCATAATATTTATAATTATATATATATTATTTTAAATTCTATTTAAATATTTAATTTATTTAAATTATATTTTTATATTTATTTAAATTTAAATAAATAAT----------------------------------------------------------------------------------------------AAAAAATAAATTAAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AACATTGAAATTGAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTTTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------GGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACTGACAACAATGAAATTTATAGTAAGAGGAAA????????????????????????GGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTGACCTCCT------AAGTATTTTTCCTCC------TTTCCGCCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT-------------AAAATATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTTTTT------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGGAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001101??10000100?10??001001?0000001???001?01?0100001100?010001?10100?00001?001?0 Asterostigma_pavonii_AM905768 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAAGTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCCGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCCATTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGGATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAGTTTTTATTCTCAA------ATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAACTTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACAAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTACA---------AAAAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAACTCTTATGTAGTTGAATGCGAATCTATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACGTCTTCTGGAATCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTAGGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAG------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATGACTTTTTAATAGATACTGTT------ACTAACAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAGTGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CAACAATTCTCAAG---AGAGAAAAAAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGAGA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTATTGAAATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATTTATAAATTCAAAA-TATTATGAAATATTT-AAGAGTTATTCTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTTACTTCCT------AAGTATTTTTCC--------------GTTGG----TGGCTCA-----AAA-TGCATTATGTTTTCCATTTATTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCCAGTTTTT------GGGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATCAAAA------------------AAAAAGTCTTTCTTTTTATTTAAATTT------AAGACCCCA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATCAAAC---TTTTTATGTCCTTTTAATAGAACTTTTTCTGTCTTTTT----------------------------------------------AATAGACATAAAAA-AAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111110001011001100101000010???0??001001?101?001???10??01?010000101??0100001101000011?1?001?0 Biarum_tenuifolium_AM905810 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCGCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGCGGTGGGCTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCGATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGCTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAATAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTACGAACCCCCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACACAAATTTTTGATCAATTCTGTTAAT------GATTCTAACCAAAATATATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ACGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATACTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCTA---------AAGAAA------TCTAACTATTATGTTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGCCTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCCTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTAATTTTCACTTTTGGTCTCAACCAAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTCCCAAAAAAT------CCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAGGAATTCTTTACGGAAGAAGAAAAGGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATCGAATAGAAA------------CTCAAATTATAAAG---AGAGAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATCCACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------AGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACAG------------ACAGAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATAATTTATTTATA--TTATATCATAATATATATTATATTTTATATATTATTATTATTTATATTTTAATATTTATATATATTTTAATTTAAATATAAATATTTAATTTAAAT--------------------------------------------------------------------------------------------------------AAATAATAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AACATTGAAATTGAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAAATTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTGACCTCCT------AAGTATTTTTCCTCC------TTTCCGCCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTTTTT------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGGAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001101??10000100?10??001001?0000001???001?01?010000111??010001?10100?00001?001?0 Bognera_recondita_AM905765 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAATCCGTTATTGGGGAGGACAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAGGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGCGCCGAAGCAATTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGCGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGAT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAAAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCAAAGACTATTTCGGTTCCT------ATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATACTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTAACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAG------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTACTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAAATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTATAGTGGGTCTTCAAAAAAGCAGAGTTTGTATC??????????????????GACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CAACAATTCTCAAG---AGAGAAAAAAAAA-------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACTTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTATTTAATTTATATTTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATTAAAAA-TATTATGAAATATTT-AAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAGAA---------CCCATTTTACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----TTGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATAAAAA-------------------AAAAGTCTTCCTTTTTATTTAAATTT------AAGACCCCA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATAAAAC---TTTTTCTGTCTTTTT---------------------------------------------------------------------AATAGACATAAAAACAAGC----CC--------------GATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCCC????110111110001011001100101000010???0??001001?101?001???001?01?010000101??0100001101000001???001?0 Bucephalandra_motleyana_AM905822 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGGTCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAACTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------ATTTTGATGAACCTGCGGAAATTTCAGATTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCCA------ATGATATCAGAGAGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACAATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCTA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTTATTCCTATTCCTATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTATAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTAACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCCAAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTAAAAATTTGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTTGGAT??????????????????????????????????????????????????????????????????????????GACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTAGTCGTATGAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAAA-----------------CAAAAATCTCAAG----AGAGATAAAGAGATAAAA--------TGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTAAATA----GTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG????T-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAAGAAA--------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTGCA----------------GAAAAGATA-----ACCCT-----------ATATACTATACCTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATATATTTATATAATATAATAATAATATAATAATAATAAATATATTTATATAATATAATAATTTATATAATATAATAATATTTATA----------------------------------------------------------------------------------------------------------TAATATAATAATAATAAAATAATAATAATAAATTTGAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAATCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAAA------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAGA---------CCCATTTTACTTCCTAAGCT-AAGTATTTTTCCTCT------TTTCCGCTAG----TGGCTCA-----AAA-TGCACTATGTTTTC-------------TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATATACGTACAAA-----------TGAAGAT----------------ATATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTTT-------------AAGACCCCC-CAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTGTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC101111011110010?000001100101000010??00??001001?101?000001001?01?0100001001?010001?10100?001?1?001?0 Caladium_lindenii_AM905788 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGACAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGCGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGTACTTGCTCATGATCAT------GGTTTAAATGGA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAATTTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGGACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAGGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTCTCACATTTAAATTGTGTA------TTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGCCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCACATTTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTTTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGGCTTGGTG----AATCATTT-----------ATGGTT----CATTAGTCATAAGACCGTGT-----------AAATG-AAATAGAATAGAAA------------CAAGAATTCTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCCATGG???????????????TGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGGGTTG--------------------ATTGCATTGCGTTGGTAACTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATAATTTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTAAATATAATAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAAA-TCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCT---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAA-----------CCCATTTTACCTCTTAA-TT-AAGTATTTTTCCTCT------TTTCCGTTGG----TGACTCA-----AAA-TTCACTATGTTTTCTATTTACTC----TACTCTTTCACAAA------AAGATCCGAGC------------------------TT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAGAT------------------ATATGTAC------AAAGATTCTCGAGTATTGAAT-----GTTTCACTATTCACAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTATTT------------AAGACAAAA--AAATTTCATGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------AAGGGACATAAGCACAAGC----CCCT-------AGTAAGATAA---------GGCAATG-CATGCAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGAC??????????????????1011010111100101011001100101000010???0??001001?101?000011001?01?1?0000111??010001??1100?001?1?001?0 Calla_palustris_AM905819 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAACTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTGTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAGGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGAGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATTGTAATGCATGACTACATAACAGGGGGATTCACAGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGGAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAATTAGATCTAAA------CACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTAAAAAATGGATCCA------TTTTTTATGAACCCTCGGAAATTTCAGGTTATAACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATGGATTCGTCGGACACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTTGAGGACAAATTCTCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAGGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTCTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTATGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAGTGGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCGATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTAATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAACGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTTTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGTCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCACTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAATTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGCCCATGT-----------AAGTG-AAATAGAATAGAAA------------CAAAAATTATCAAG---AGAGAAAAAAAAAA------------TGTCAGTC-----ATTT---TAATTGTGAAATGCTCATGCAGTAATGGTTGAATCAACTTAGTA----TTCAAGTTTTTTAGA------------CC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTAGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------GTGGAGTTG--------------------ATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTCATCAC--GA------CCCAAATCCATAATTTTTATTTATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAAAATTCCAAA-TTTTATGAAAAATTT-AAGAGTTATTTTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTAAAATATTCAGTGATCGAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAAA------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCACTAAAAA---------CCCATTTGACTTCCT------AAGTATTTTCCCTCT------TTTCTGTTGG----TGGCTCA-----AAA-TTAACTACGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCGAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAATATTCTAGAGTAGTGAAT-----TATTCACTATTAACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATAAAA----------------------AAGTCTTCCTTTCTTTTTATTT--------AAGACCCCA-AAAATTCTAGGG-----ATTAGATAAGGG---------------------------CTTTTTTTGTCCTGTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGAGATG-CATGAAAAAAGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111100101011001100101000010???0??001001?101?001???001?01?010000101??010001?0010??001?1?001?0 Callopsis_volkensii_AM905773 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTCCCGCCTGAAGAAGCGGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGAATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATAAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGCGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCCAACCAGTAGATACGCTGGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAAATCTAAACAACA---CTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTTAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGACACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATCATGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCACGAATATCATGATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGATTCCT------ATATAATTCTTATGTGGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAATTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCTGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATTCTTTACAT------AAGTTATAT------------------------AAAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCGTGT-----------AAATG-AAATAGAATAGAAA------------CCAAAATTCTCAAG---AGAGAAAAAAA---------------TGTAAGTC-----ATTT---TTATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTCCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAT--GA------CCCAAATCCCTAATTTTTATTTATATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATTCAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCAATTTGACTTCCT------AAGTATTTTTCCTTT------TTTCCATTGG----TGGCTCA-----AAA-TTCACTACGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTACAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCCATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA---------------TATCAAAAAGTCTTCCTTTTTATTT------------AAGACCCCA-AAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------CAAAC----TTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAGCACAAGC----CCCT-------AGTAAGATAA---------GACGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111100101011001100101000010???0??001001?101?001???001?01?010000101??010001?10100?001?1?001?0 Carlephyton_glaucophyllum_AM905821 ??????????????????????????????CTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGTCTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATACGAACCAGTAGATAAGCTAGATATGGAAGAATTTAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCGT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTTTTTGATCAATTCTGTTAAT------GATTCTAAACAAAATGGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCATAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTC-AAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTATATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCGGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTTGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCAAAATTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAG??????????GACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTATTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGCATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATCGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTGTTTTTTTTTT-GAGAAAAAAAAAA--------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCCTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATAATATAATTATAATATAATAAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATAATTTCAAAATTTTATGAAAAAATA-AAGAGTTATTGCGAATCC-----ATTCT---------AA---------------------------AGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCAGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAA-----------CCCATTTTACCTCCTAAGTT-AAGTATTTTTCCTCT------TTTCCGTCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------TCAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGGGTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTT--------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC-----CTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAG-CCCCT------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001100101000010???0??000001??1??000001001?01?010000101??010001?00100?00000?00110 Cercestis_mirabilis_AM905817 TCAAAGCTGGTGTTAAAGATTACAAATTGAATTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCGGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAG{AG}GCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCTAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATTCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGGCGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGTTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCT------CAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCTGCAGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAAAAGATTCATTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAAGGTTTTGCTGTCATTGTGGAAATTCCTTTCTTGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGGA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAAAAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATTTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACTCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATTCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTATCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGATCTTCAAAAAAACAGAGTTTGTATCGAATAAGGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGCATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CCCAAATTCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTAGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCGACGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGATAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTTATCAC--GA------CCCAAATCCATAATTTTTATTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATAAAAAATTCAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCGTCGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----TTGTTT-----TGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTATTT------------AAGACCCCC-AAAATTCCAGGG-----TTAAGGTAAGGGTTTT----------------AAAAC---CTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111100101011001100101000010???0??001001?101?001???001?01?010000101??010001?00100?001?1?001?0 Chlorospatha_sp._AM905791 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAAGTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACGTCGAAGCCGTTGTTGGGGAGGAAACTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCGGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTACTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGAATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCGGAACTAGCTGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATTTTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGTACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTTGGGTTATGACAAAAATTTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCATCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTTACGAATATCATAATTGGAATAATCTTATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTCTTTTTGTTCCT------ATATAATTCTTATGTGGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGCTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTTACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGGTTGGATCATTGTCAAAAGCGAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTAGAAATCTTTCTCATTATTATAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTATTCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTCTTATCCTTTACATAAGTTATAT------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTTG--------------------ATTGCATTGCGTTGGTAACTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATAATTTATATAATTTATATATATAATTTATATATATATTTATATATATAAATAGAAATAGAAAAATTTATAAATAGAATTTCTAATTTATTAGAATATAATTTATTAGAATTTATTAATATAATTTATA-----------------------------------------------------------------------TTCAATATAATATATTCAATATTAAATATAATAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAGGAAG-------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAAAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTTACCTCTTAA-TT-AAGTATTTTTCCTCT------TTTCCGTTGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCTT-----------------------------AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGCAT-----TTTTCACTATTCCCAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTATTT-----------AAGACAACC--AAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC--TTTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAGCACAAGC----CCCT-------AGTAAGATAA---------GGCAATG-CCTGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010110100101011001100???000010???0??001001?101?000011001?01?0?1000111??010001??1100?001?1?001?0 Colletogyne_perrieri_AM905823 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATGGAAGAATTTAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCGT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTTTTTGATCAATTCTGTTAAT------GATTCTAAACAAAATGGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCATAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTATATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTTGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCAAAATTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATGCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTATTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGCATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATCGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTGTTTTTTTTTT-GAGAAAAAAAAA---------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATAATATAATTATAATATAATAAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATAATTTCAAAATTTTATGAAAAAATA-AAGAGTTATTGCGAATCC-----ATTCT------------------------------------AAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCAGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAA-----------CCCATTTTACCTCCTAAGTT-AAGTATTTTTCCTCT------TTTCCGTCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------TCAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGGGTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTT--------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC-----CTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAG-CCCCT------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001100101000010??00??000001??0??000001001?01?010000111??010001?10100?00000?00110 Colocasia_esculenta_AM905800 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCACTTTTTAAAGCACAGTCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAACCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTACTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAGGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTGTGAACCCCCTGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATTAGAGGGTTTTGCTGTCATTGTGGAAATTCCTCTCTCATTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGGTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACAATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTGCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TATTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGATTTGGTG----AACCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATCGAATAGAAA------------TTCAAATTCTAAAG---AGAGAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATAGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTTT--GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGAGA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCCAATCCATAATTATTATTTATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATTGAAATTGAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTTTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTTACCTCCT------AAGTATTTTTCCTCC------TTTCCGCCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAAATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTTTT-------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001101101000010???0??001001?1000001???001?01?010000111??010001?10100?00001?001?0 Cryptocoryne_lingua_AM905779 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGGCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCTGTTCCTGGCGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCCATTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATTAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGGGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTAGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGGAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCTGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTTAGAAGCGTGTGTACAAGCGCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCTTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAACAGATTAAATTTGAATTCGAACCAGTGGATAAACTAGATATGGAAGAATTAAAAGGATATTTT------GAAAAAACTAGATCTAAACAACAACACTTCTTATACCCGCTTCTCTTTCAAGAGTCTATTTATTCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------ATTTTGATGAATCTGCGGAAATTTCAGATTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCCA------ATGATATCAGAGGGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAATACCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCGTTTTTTGAGGACAAATTTTTACATTTAAATTATGTA------TCAGATATACTAATACCCTATTCCGTCCATCTAGAATTTTTGGTTCAAATTTTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTATTTTTTCACGAATATCATAATTGGAAAAATCTCATTACTCTC---------AAAAAA------TCTAGTTAT---GGGTTTTCAAAAGAGAATCCAAGAATATATGTATTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGCAATGATTTTCATAAAACCCTATGGTTATTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTATTTTTTAAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCTTGTAGGATCCACATAAACCAATTCCCAAAATTTGCTTTCTATTTTCTGGGTTATCTTTTAAGTGTATCAATAAAT------CCTTCGGTGGTAAAGAGTCAAATGCTAGATAATTCCTTTTTAATGGATACTGTT------ACTAAAAAATGGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCGGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATATTTTTCATTATTGCAGTGGATCTTCAAAAAAACAGAATTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAAAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CACATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTA----AATCATTT-----------ATGATT----CATTGGTCATGAGACCGTGT-----------AAATG-AAATAGAATAGAAA------------CAAAAA-TTTCGAG---AGAGATAAAA----------------TGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAAT-----------CTGAATA----GTCAAGTTTTTTAGA----CTTTCTATTC------GGGATCT-----AAGTTTTAGATGTATACATAGGTAAAGTCGTGTACAA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGTTCAAGTCCCTCTATCCCCAATAACGA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCTTTTTT---------------AAGACCCCTTCCCCTTACAGGG-----ATTAGGTAAGAGTTTT----------------CAAAC-----TTTTTGTCCTGTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111100101101011110????????????????????????????1???01???????????????????????00100?001?1?0???? Culcasia_liberica_AM905816 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAACTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTATTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGGCGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCTGTACTACAGTTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCCAAGCAGTAGATACGATA???ATGGAAGAATTAAAAGGATATTTA------GAAAAAGGTGGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATCTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAAAAGATTCATTGGGCACAAC------AAGAATCTTGATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGGA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTAGAATGCTGGATACAAGATGTTCACTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAAAAATCTCATTACTCCA---------AATAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATACAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATTTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTATTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCCTTTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCATATAAACCAATTCTCACATTTTTATTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAGGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CCAAAATTCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTATTTATTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCGACGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGATGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACACATCAAA----------------CGATTTATCAC--GA------CCCAAATCCATAATTTTTATTTATATATA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAAATTCAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATAGTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTTTTTCACAAA------AAGATCCGAGCGT----------TTT-----TTGTTT-------ATTAGCCCGAGTTTTT------GTGCAATACACGTACAAA-----------TGAGGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-------------------------------------------------TTATTT------------AAGACCCAA-AAAATTCCAGGG-----ATTTGGTAAGGGTTTT----------------AAAAC---CCTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111100101011001100101000010???0??001001?101?001???001?01?010000101??0100???00100?001?1?001?? Cyrtosperma_macrotum_AM905750 TCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTTCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTATTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGAAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGAT?????????????????????????????????AAAATGAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTATG------GATTCCAACCAAAATAGATTCGTTGAGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAAGGTTTTGCTGCCATTGTGGAAATTCCCTTTTCGCTGCGA------TCCTTCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCACTTTTAGAGGACAAATTATCACACATAAATTATGTA------TCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCT------ATATAATTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGT------ACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATATTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCCCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGGATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGTTCATGAGACCATGT-----------AAATG-ACATAGAATAGAAA------------CCCACACTTTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----GTTC---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTATCTAAATTACACTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCATATATATATATA-------------------------------CTGATATATCAAA----------------CGATTAATTAC--GA------CCCGAATCCATAATTTGAATTTATTATAATTATATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATAAATTCAAAATTTTTATGAAAAATTT-AAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAA----------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAG---------CCCATTCGATTTCCT------AAGTATTTTTCCTCT------TTTCTGTTGG----TGGCTCA-----AAA-TTCACTACGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAA--------------------------TCTTCCTTT--------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC---CCCCT-------AGTAAGATAG---------GGTAATG-CATGGGAAATTG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC?011111?11100101011001100101000010???01?000001?101?001???001?01?0101?010001010001?10100?00011?001?0 Dieffenbachia_aglaonematifolia_AM905764 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCAGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCCCTTTTTAAAGCACAAGTCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTAGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAGTTTTTATTCTCAA------ATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAAAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAACTCTTATGTAGTTGAATGCGAATCCATATTCGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTCCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATTGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAG------CCCTCGGCGGTAAAGAGTCAAATGCTAGAGAATGACTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTTTTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTGGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAGAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGGATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTGATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATAGCTTGGTG----AATCA------------------------CATTGGTCATGAGACTACAT-----------AAATG-AAATAGAATAGAAA------------CAACGATTTTCAAG---AGAGAAAGGGAGAAAAAAAAA-----TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATGTAAGTTTTAGATGTATACATAGGTAAAGTCGTGTGCAATGAAAACTGCAAGCACGG?GC-T-TGAGC-TTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGTACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCAAAATCCATAATTTTTATTTAATTTATATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATAAATTAAAAA-TATTATGAAATATTT-AAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAGAA---------CCCATTTTACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCTATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATCAAAA------------------AAAAAGTCTTCATTTTTATTTAAATTT------AAGACCCCC-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATCAAAC---TTTTTCTGTCCTTTTAATAGAGCTTTTTCTGTCTTTTT----------------------------------------------AATAGACATAAAAACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAG-GGACTGAAT?????????????1011110111110001011001100111000010???0??001001?101?001???001?01?010000101??0100001101000001?1?001?0 Dracontioides_desciscens_AM905754 TCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCAAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCCTTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTGTGCCAGAGAATTAGGAGTCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCCAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATGTA------TCAGATATACTAATACCCTATCCCATCCATTTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCT------ATATAATTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTTTGGAACTTTTATTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTATTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTTATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGT------ACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAAGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGGATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGTTCATGAGACCATGT-----------AAATG-ACATAGAATAGAAA------------CCCACATTTTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----GTTC---TAATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTATA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCATATATATA-----------------------------------CTGATATATCAAA----------------CGATTAATTAC--GA------CTCGAATCCTGAATTATTAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTATATAAATTCAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATTGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTCGACTTCCT------GAGTATTTTTCCTCT------TTTCTGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTT--------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TCTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAAAGCAAGC---CCCCT-------AGTAAGATAG---------GGTAATG-CATGGGAAATTG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011101?11100101011001100101000010???1??001001?101?001???001?01?0101?010001010001?10100?00011?001?0 Dracontium_polyphyllum_AM905747 TC{AC}AAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATTGAACCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGCCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTTTAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCGCGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCCAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATAATATCGGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATGTA------TCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCT------ATATAACTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGT------ACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGGATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGTTCATGAGACCATGT-----------AAATG-ACATAGAATAGAAA------------CCCACATTTTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----GTTC---TAATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGC????TGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCATATATATATA---------------------------------CTGATATATCAAA----------------CGATTAATTAC--GA------CCCGAATCCTGAATTTATTATTTATTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATTATATAAATTAAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAA------------------------------------------------------------TGATTAATTGAACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCC-ATAAAAA---------CCCATTCGACTTCCT------GAGTATTTTTCCTCT------TTTCTGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTT--------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGTGTTTT----------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC---CCCCT-------AGTAAGATAG---------GGTAATG-CATGGGAAATTG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTA?????????????????????????????1011111?11100101011001100101000010???0??001001?101?001???001?01?0101?010001010001?10100?00011?001?0 Dracunculus_vulgaris_AM905812 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGGCTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCAGATATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACACAATTTTTTGATCAATTCTGTTAAT------GATTCTAACCAAAATGGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ACGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTTTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAAAAATCTCATTACTCTA---------AAGAAA------TCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTTAAAAGGGACTCACCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCAAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTATACTTTCTGGGTTATCTTTCAAGTGTCCCAAAAAAT------CCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAGGAATTCTTTACGGAAGAAGAAAAGGCGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATCCACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------AGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACAG------------ACAGAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATAATTTATATTTT--TTATATCATAACATAATATTTATTTATAATATTATAACATAATATTTATTTATAATATTATAACATAATATTTAATTATTAATATTAATATAATATTTAATTATAATTAATTATAATATAATATTATATAATAATAATA-------------------------------------------------------------------------------TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AACATTGAAATTGAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTGCACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAA--------------CCATTTGACCTCCT------AAGTATTTTTCCTCC------TTTCCGCCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTTTT-------------AAGACCAAA--AAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGGAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001101??10000100?10??00?001?0000001???001?01?010000111??010001??1100?00001?001?0 Eminium_spiculatum_AM905813 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTATGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGGCTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACGGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACACAATTTTTTGATCAATTCTGTTAAT------TATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ACGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGAAAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCATGAATATTATAATTGGAATAATCTCATTACTCTA---------AAGAAA------TCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTGTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCAAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTCCCAAAAAAT------CCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTT------ACTAAAAAATTGGAAACCATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAGGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TATTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AAAGAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATTATTGAATCCACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------AGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTT----GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATA------------------TCATAATTATTATTTATATCATAATTATTATTTTATTATATATAATA---------------------------------------------------------------------------------------------------------------------------------------TATTTTTTATATTTATAAATAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AACATTGAAATTGAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------TCATTTGACCTCCT------AAGTATTTTTCCTCC------TTTCCGCCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATAAAA----------------------AAATATTCCTTTTTTT--------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGGGAACGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001101101000010???0??001001?0000001???001?01?010000111??010001?00100?00001?001?0 Epipremnum_pinnatum_AM905746 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCAAACCAGTAGATACGATAGATATGGAAGAATTCAAAGGATATTTAGAAATAGAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCAT------GGTTTAAATGTA---AATGGATCAATATCCATTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTTTTAAT------GATTCTAATAAAAATAGATTCGTTGGTCACAAC------CAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCATTACTCCA---------AGGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATTTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTATTTTCCGGGTTATCTTTCAAGTGTACTAATAAAT------CCTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTTATAGATACTGTT------GCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATTCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATAA-----------ATGATTGATTCATTGGTCATCAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CCAAAATTAACAAG---AGAGGAAAAAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTCCTTTTCGGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAGAACTGCAAGCACGG???????????CTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTAT----------CTAATTTACA----------------GAAAGGATA-----ACCCC-----------ATATAC-----CTAATA-------------------CGCATGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCGAACCCATAATATTTATTTATATAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAAAAA----------------------------------------------------TGATCAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAA???????????????????????????C-ATAAAAA---------CCCATTTGACTTCCTAAGTCTAAGTATTTTTCCTCT------TTTCCATTGG----TAGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TATTCTTTCACAAA------AAGATCCGAGCAT----------TTT----------T----------AGCCCAAGTTTTT------GGGCAATACACGTATAAA-----------TGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCAC-----GCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA----------------------AAGTCTTCCTTTTTTT--------------AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------CAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------TATGGACATAAACACAAGC---CCTCTAATCT--AATAAGATAA---------AGTGATG-GATGGAAAACGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGT-AC0001111?01100001011001000?01000010???0??001001?101?000000001?01?0101?010001011000010?11?000101001?0 Filarum_manserichense_AM905795 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGGACTGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACAGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGCGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAGCTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTTTGTACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCGGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTGATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCTCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAATTTGTGTA------TTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATAATAATTGGAGTAATCTTATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAGTCC---TCTTATTTACGATCAACATCCTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTTTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAATCCTGTAGGATCCACATAAACCAATTCCCCAATTTTTCTTTACATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCCGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTCTAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCCGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCCTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT------ATGATATGATT----TATTAGTCATAAGACCTTGT-----------AAATG-AAAT-----AGAAA------------CAAAAAATCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGAT--AATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGAAATGAAAACTGCAAGCACGG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GATC-----TTTTGAAAAAC-------------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTTACCTCTTAA-TT-AAGTATTTTTTCTCT------TTTCCGTTGG----TGACTCA-----AAA-TTCACTATGTTTTCCACTTACTC----TACTCTTTCACAAA------AAGATCCGAGCTT------------------AAGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCCCAATCTATATTGTT-----------AGTTTACCCTTACACTTAT-----AAATATCAAA----------------------AAGTGTTCCTTTTTTATTT-----------AAGACAAAA--AAATTTCAGGG-----ATTAGGTAA---------------------------------------------------------------------------------------------------------------------TGGACATAAGCACAAGT----CCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100111011001100????????????0??1??????????000011001?01?0?0000111??010001??110??001?1?0?1?0 Gearum_brasiliense_AM905763 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCACTTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTTTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATAACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTTGTTGGGCACAAC------AAGAGTTTTTATTCTCAA------ATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAAAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TTTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCCGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAG------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTACTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTATGGAAGAAGAAAAAGTTCTTCCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGGCCACGT-----------AAATG-AAATAGAATAGGAA------------CAACAATTCTCAAG---AGAGAAAAAAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTTAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAAACGA---------ATGGAGTTG--------------------ATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTATTTAATTTATATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATAAATTCAAAA-TATTATGAAATATTT-AAGAGTTATTGTGAATTC-----ATTCA---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------GTTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTTACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATAAAA-------------------AAAAAGTCTTCCTTTTTATTTAAATTT------AAGACCCTA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATCAAAC---TTTTTCTGTCCTTTT---------------------------------------------------------------------AATAGACATAAAAACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111110001011001100101000010???0??001001?101?001???001?01?010000101??0100001101000001?1?001?0 Gonatopus_angustus_AM905777 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGATAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAAGGCTGTGTTTGCCAGAGAATTGGGAGCTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTTTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGCATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTAGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGGGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCGGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCAATCAAATTCGAGTTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTATATCTAAACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTACACATTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCCA------TTTTTTATGAACCCACGGAATTTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTATCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCCCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AATAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAATTCTTATGTAATTGAATGCGAGTCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATTAACATCTTCTGGAACCTTTATTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTCGTTTGTTGTAATGATTTTCAGAAAATCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGCCATTTTCGCTTTTGGTCTCAACCCTGTAGGATCCGCATAAACCAATTCTCAAAAATTTCTTTCTATATTTTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAACGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTGGAAACTCTAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGGTATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCACAAAACCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCACTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTATTTCTTTAATCTTA---CCAAGAATT------------------TATTATCCTTTACATATACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTTGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGACT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGACA--CTTTCTTTTT------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACCAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTG-----GTAGCTGGAATTCTTATTT-CTAT----------ATAAATTACA----------------GAAAAGATA-----ATCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA-----------TCAAACGCTTAATCAC--GA------CCCGAATCCATAATTTTTATTTCTATAATCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAAATAAAAAAGACATTTTTTATATAAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATTGA----GAAG-----------TAAGAATCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAA----------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTT-------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTTTTATTT--------AAGACCCCC-----TTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---CTTTTTTGTCCCTTT---------------------------------------------------------------------AATGGACATAAACACAAGT---CCCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110101100101011000100101010010???0?1001001?1001001???001?01?0101?1?01??010001???100?00011?001?0 Gorgonidium_sp._AM905767 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAAGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCAATTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTACGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAGTTTTTATTCTCAA------ATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAACTTTCAGAATTTACGATCTATTCATTCAATATTTTCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTACA---------AAAAAA------TCTAGTTAT---GGGTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAACTCTTATGTAGTTGAATGCGAATCCATATTCGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTAGGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATTTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTACTTTCTGGGTTATCTTTCCAATGTACCAATAAAG------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTACTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTCCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAGTGCCTTGGTG----GATCA------------------------CATTGGTCATGAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CAACAATTCTCAAA---AGAGAAAAAAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAGCTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTACATTGCGTTGGTAGCTGAAATTCTTCTTTTCTAT----------CTAAATTACA----------------GAAAAGAGA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTATTGAATTTATATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATAAATTCAAAA-TATTATGAAATATTT-AAGAGTTATTCTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAA----------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCC--------------GTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTGACTC----TACTCTTTCACAAA------AAAATTCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATCAAAT------------------AAAAAGTCTTCCTTTTTATTTCAATTT------AAGACCCCA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATCAAAC---TTTTTCTGTCCTTTT---------------------------------------------------------------------AATAGACATAAAAA-AAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111110001011001100101000000???0??001001?101?001???10??01?010000101??0100001101000011?1?001?0 Gymnostachys_anceps_AM905727 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCGGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACAACATCGAGGCCCTTGTTGGGGAAGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCTTTACGAGCTCTACGTCTGGAGGATCTTCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGGCCGCCCCATGGCATCCAAGTTGAGAGAGATAAATTAAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCTGTGTTTGCTAGAGAATTGGGAGCCCCTATTGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACCAGTTTGGCTTATTATTGCCGAGACAACGGCCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTAGAAGGTGAGCGTGAGATGACTTTGGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCGTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTGGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAGGAGATCAAATTCGAATTCGCCCCAGTAGATCCAGATGTCATGGAAGAATTAAAAGGATATTTA------GAAAAAGATAGATCTCGGCAACAACACTTCCTATATACGCTTCTCTTTCAGGAGTATATTTACGCGCTTGCTCACGATCAT------GGTTTA---------AATGGATCAA------TTTTTTATGAACCCGTGGAAATTTTAGGTTATGACACTAAATCCAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTATCAACAGAATTATTTGATTAATTCGGTTAAT------GATTCTAACCAAAATGGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCAGTTATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCTCCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGACAAATTATCACATTTAAATTATGTG------TCAGATATACTAATACCCTATCCCATCCATCTCGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGCTCCCTCTTTACATTTATTGCGATTCTTTCTTCACGAATATCATAATTGGAATAGTTTCATTACTCCA---------AAGAAA------TCTATTTAC---GTTTTTTCAAAAGAGAATCGAAGACTATTTTGGTTCCT------ATATAATTCTTATGTATCTGAATGGGAATCCATATTAGTTTTTATTCGTAAACAATCC---TCTTATTTACGATCAACATCTTCCGGAGCCTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAACGAAAATCAATTCTGGCTTCAAAAGGGACTCAGCTTCTGATGAAGAAATGGAAATGTCATCTTGTGAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCATATAGAATCCATATAAACCAATTCTCAAATTATTCCTTCTATTTTCTGGGCTATCTTTCAAGTGTACTAAAAAAT------CCTTCATCGGTAAGGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAATAAATTCGATACTATAGTCCCAATTATTCCTATGATTGGATCATTGTCTAAAGCTAAATTTTGTAATGTATTGGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATCACAGTGGGTCCTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGGTTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTGATCTTA---CCAAGAACC------------------TCTTTTCCTTTACAT------AAGTCATAT------------------------AGAGAG---CGTATTTGGTATTTGGATATTATTCGTATCAATGACTTGGTG----AATCATTT-----------ATGATT--------GGTCATGAGACCCTCT-----------TAATA-AAATGGAATAGAAATGG-------TCTATAAATGATCCAG---AGAAAAAAAAAAAAA-----------TGTCATTC-----ATTT---TCATTCCGAAATGCTCATGCAGTAGTGGTGGAATCAATTGAGTA----GTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCT-----AAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAAATGCAAGCACGGTGGAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATT---AAAAATGGGCAATCCTGAGCCAAATCCTTTTTTT---------T---------------------------------------------------------------------------------------------------------------------------------------TCAAAAAA---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAATTG--------------------ACTGCGTTGCGTTGGTAGCTGGAATTTTTCCTT-CTCT----------CGAAATTAAA----------------GAAAGGATG-----ACC-T-----------ATATAC-----CTAATA-------------------CGGACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCGAATCCATAATTTATTTTTTTA--TAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAAATTCAAAA-TTTTATAAAAAATTT-AAGAGTTATTGTGAATCCATTACATTCCAATCC----AA-GTT------GAAG-----------TAAGAGTCAAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTTACTTCCT------AAGTATTTTTACTCTT-----TTTTCGTTGG----TGGTTCA-----AAA-TTCGCTATGTTTCCCATTCACTC----TACTCTTTCACAAA------TGGATCCGAGCAG----------TTT-----GTGTCT---------TATCCCAGGTTTTT------GTATGATACACGTACAAA-----------TGAACAC------------------ATATGGGC------AAGGAATCTCCATTATTGAAT------------TATACGTAGTCCATATCTTC------------------CCTTACACTTA------------CAAA--------------------GAAAGTCTTCTTTTT----------------GAAGATCCAA-GAAATTCCGGGGA-----CTAGGTAAGATTTTTTAATACTTTTT---AAAATAC---TTTTTTAGTCCCTTT---------------------------------------------------------------------AATGGACATAAACACAAGT---CCTAT-------AGTAGGATAA--------------TG-CATGGGGAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1111111?11101?00011001110101000010???0??0010010101?001???000101?010010101??1?0????10000000011?101?? Hapaline_benthamiana_AM905787 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATCAGACAAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAAGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCTAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTGCTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACAGCGGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGAGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGTACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTGGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAAATTTGATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCCCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCAATTACTCCAAAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTCATTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAA---CATCTCGTGGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTAACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAAGAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTCAAAAATTCGAAACTATAGTTCCAATTTTTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTAATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATTCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTTGTATAAATGACTTGGTG----AATCATTT-----------ATGGTT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CAAAGATTCTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAG------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGAGATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATAATTTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTAAATATAATAAATTCAAAT-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCAAATATTCAGTGATCAAATCATTCATTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAAAAA----------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAA------------CCCATTTTACCTCTT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTATT--TGTG-----AGTTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTATTT------------AAGACAAAA--AAATTTCAGGG-----GTT---TAA------------------------AAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAGCACAAGT----CCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001100101000010???0??001001?101?001???001?01?010000111??010001??110??001?1?001?0 Hedyosmum_mexicanum_AM905824 TCAAAGCCGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGACACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATTGAGCCCGTTGCTGGGGAGGAAAATCAATACATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTCTGGAGGATCTGAGAATTCCTCCTGCTTATACCAAAACTTTCCAAGGCCCACCCCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCCAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCCCTTTTTAAAGCACAGTGCGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGGGCTGTATTTGCCAGAGAATTAGGAGTTCCTATTGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATACACTTTCGCGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACCGTAGTAGGTAAACTGGAAGGAGAACGTGGTATCACTTTGGGTTTTGTTGATTTACTACGTGATGATTATATTGAAAAAGACCGAAGTCGCGGTCTTTATTTCACTCAAGATTGGGTCTCTCTGCCAGGTGTTCTGCCTGTGGCTTCGGGGGGTATTCACGTTTGGCATATGCCTGCCCTAACCGAGATTTTTGGGGATGATTCCGTACTACAGTTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGGCGTGATCTTGCTCGTGAAGGAAATGAAGTTATCCGTGAAGCTAGCAAATGGAGCCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATTCGAATTCGAAGCAATGGATACTGTGTAAATGGAGGAATTACAAGGATATCTA------GAAATTGATAGATCTCGTCAACAACACTTCCTATACCCGCTTTTCTTCCAAGAGTATATCTACGTACTTGCTCATGATCAT------GGTTTA---------AATGGTTCGA------TTCTTTACGAACCCATGGAAAATTTAGGTTATGACAATAAATCCAGTTCACTAATTGTCAAACGTTTAATTATTCAAATGCATCAACAGAATCATTTGAGAATTTCGGTGAAT------CATTCTAACCAAAATAGATTCCTTGGGTACAAC------AAGAATTTTTATTCTCA-------ATGATACCAGAGAGTTTTGCAGTCATTGTGGAAATTCCATTCTCTCTGCAATTAGTATCTTCCCTAGAAGAAAAAAAAGAA---CTACCAAAATCTCATAATTTACGATCTATTCATTCAATATTTCCCTTTTTAGAGGACAAATTATCACATTTAAATCATGTG------TCAGATATCCTAATACCTTACCCCATCCATCTGGAAATCTTGGTTCAAACCCTTCACTACTGGGTACAAGATGCTCCCTCTTTGCATTTATTGCGATTCTTTCTCCACGAGTATCATAATTGGAATAGTTTCATTACTCCA---------AAGAAA------TCCATTTATTTTTTTTTTTCAAAAGAGAATCAAAGATTCTTCTGGTCCCT------ATATAATTCTCATGTATATGAATGTGAATCTGTATTAGTTTTTCTCCGTAAACAATCC---TCTCATTTACGATCAACATCTTCTGGAGCCTTTATTGAGCGAACACATTTCTATGGGAAAATAGA-------TTTCTTGTGGTAGGGCTTCGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTCAGATATCGAGGAAAATCACTTCTGGCTTCAAAAGGAACTCATCTTCTGATGAAGAAATGGAAATATCACCTTGTCAATTTCTGGCAATGCCATTTTTACATGTGGTCCCAACCGGATAGGATCCATATAAACCTATTATCCAACCATTCCTTCTATTTTCTGGGTTATCTTTCAAGTGTACTCCTAAAT------CTTTCGGCGGTAAGGAGTCAAATGCTAGAAAATCCATTTCTAATGGATACTTCT------ATTAAGAAATTCGATACCATAGTTCCAATTATTCCTCTGATTGGAGCATTGGCTAAAGCCAAATTTTGTAACGTATCAGGGCATCCTATTAGTAAGCCGGCCTGGTCCGATTTGTCAGATTCTGACATTATCGATCGATTTGGGCGGATATACAGAAATCTTTCTCATTATCATAGTGGATCCTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATCCTTCGATTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTGCGGTACGCACTTTTATGAAAAGATTAGGTTCGGAATTATTAGAAGAATTCCTTACAGAGGAAGAACAAGTTATTTCTTTGATCTTC---CCAAGAAAC------------------TCTTCGCCTTCGCAC------AGGTCACAT------------------------AGAGAA---CGAATTTGGTATTTGGATATTATCCGTATCAATGACCTGGCC----AATCATGA-----------ATGATT--------GGTCATGAGACCA-GG-----------TAATGTAAATGCGAACCATCCCT------AAATGATAGATATAATG--AAGAAAAAAAATAAAA-------TGAATGAAATTC-----ATTT---TCATTCTGAAATGCCCATGCAGTTGTAGTTGAATCAACTGAGTA----TTCAACTTTCTTCTAG-TTCTTTCTTATA------GAGAG--AA-CTGAGTTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTGGAT-TGAGCCTTGGTATGGAAACCTACCAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATT---AAAAATGGGCAATCCTGAGCCAAATCCT-GTTTT---------CATAAAAAAAAAGAATTT-------------------------------------------------------------------------------------------------------AGAAAGTGAAAATAATCAAAA-----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ACTGCGTTACGTTGGTAGA-GGAATCCTTCTA----------------TCGAAATTGC---------------GGAAAGGATG-----ATCCC-----------ATATAT-----G--ATA-----------------------CATATACATA---------------------------------TTGAAATATCAAA----------------CGATTAATCAC--AA------CTTTTTTT-ATATGC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAATTTC--AGAGTTATTGTGAATCG-----ATTCCAA----------GTT------GAAG-----------GAAGAATCCAATATTCAGCGAGC----CGATCACTT-----CAGAGTCTGATAGATC-----TTTTGAAGAATTGAT---------------------------------------------------------TCATTCATCGGACGAGAATAAAGATAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACCTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATCAAAAAAAAAAAGGACCGTTTTACTCCCT------AACTATTTATCCTCTT-----TTTTCGTCAG----CGGTTCA-----AAA-TGGAATATGTTTCTCATTCACTC----TACTCTTTCACAAA------TGGATCCGAGCAG-----AAATGTTT-----CTCTCT---------TATCACA----TTGT------TACGATATACATACAAAATAAAATGAGCATAACAT------------------ATATGGGTATGATCAAAGAATGACCATTATTGAAT------------CATTCACAGTCTAT---------------------------CTCA---------------TCA------------------------CCCTTACACTTACTATTTTTTTTT----GAAAGATCCAA-GA--CTTGCGGA-----CCTAGGTAAAATTTTTG----------------ATGC----TTGTTAGCCCCTTT---------------------------------------------------------------------AATTGACATAGACCCAAGT---TCTCT-------AGTAGGATGA--------------GG-CATAGGGAATGGCCGGGTGTCGGAAATGGTCGGGATAGCTCAGCTGGTAGAGCAGAGGGCTGAAATACAATAGCTCAGCCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC111111??11101?000010001001010011?01??0??0??00??101?001???000101?000010001??1?0????10100?00011?100?? Helicodiceros_muscivorus_AM905811 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATTTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCCAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGGCTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACACAATTTTTTGATCAATTCTGTTAAT------GATTCTAACCAAAATGGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ACGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACTAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTTTA---------AAGAAA------TCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAGCAA---CATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCAAGTAGGATCCACATAAGCCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTCCCAAAAAAT------CCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAGGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----TATTAGTCATAAGACCATGT-----------AAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGATAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATCCACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------AGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTT------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCAC--ATATA-----------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTAATATTTTCTATTTTATTTTATATAATA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTAAATTAAATAAAATAAATAATAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AACATTGAAATTGAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTGACCTCCT------AAGTATTTTTCCTCC------TTTCCGCCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTTTTT------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGGAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATC??????????1011010111100101011001101101000010??01??001001?0000001???001?01?010000111??010001?10100?00001?001?0 Heteropsis_oblongifolia_AM905737 TCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCCGGGGCTGCGGTAGCCGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACGGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTACTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACGGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTGGGGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAGCTAGCCGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAGTTCGCAGCAGTAGATACTCTAGATATGGAAGAATTTAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCAT------GGTTTAAATGTA---AATGGATCTA------TTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAAGCAAAATGGATTCGTTGGGCATAAC------CAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCA---------AGGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAATTCTTATGTAGCTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTATTGAGCGAACACATTTCTATGGAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCGTCTTTTGATGAATAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTATTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAAT------CTTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------GCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAATGTATCGGGGAATCCCATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGTTTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATTCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATGA-----------ATGATT----CATCGGTAATCAGACCACGT-----------AAATG-AAATAGAA---------------------AAATTAACAAG-----AGAAAAAAAAA-------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACAGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG??????????CCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTTTCTTT-CTAT----------CTAATTTACA----------------GAAAGGATA-----ACCCT-----------ATATAC-----CT------------------------GCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCCAATCCATAATATTTATTTATATAATAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A-AATAAATATATAATATAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATCAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCCCT------TTTCCATTG-----------------AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCCAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCGCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATAAAA----------------------AAGTCTTCCTTTTTTTTTTTTATTTT----AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------AAAACC--TTTTTTTGTCCTTTT---------------------------------------------------------------------TATGGACATAAACACAAGC---CTTCTAATCT--AATAAGATAA---------AGTGATG-CGTGGAAAACGG-----------------TCGGG-----------------------------------ATAG????????????????????????????????????????1011111?0110010?011001100?01000010???0??001001?101?001???001?01?0101?010001010000010?11?00010100100 Holochlamys_beccarii_AM905736 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAACCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAAGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAAGGCTGTGTTTGCCAGAGAATTGGGCGTCCCTATCGTAATGCATGACTATTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCGGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTGTTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTTTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGCGAGGTTTGGAAAGAGATCAAATTTGAGTACAAACCAGTAGATACGCTAGATATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATGGATTCGTTGGGCACAAC------CAGAATTTGGATTCTCAA------ATGATATCAGAGGGTTTTGTTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTTCATTTTTAGAGGATAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGTTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCA---------AGGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCTATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACCCATTTCTATGGAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATCGTTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAAT------CCTTCAGTAGTAAAGAGTCAATTGCTAGAACATTCTTTTTTAATAGATACTGTT------GCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGCCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATATTA---CCAAGAATT------------------TCTTATTCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGCG----AATCATAA-----------ATGATT----CATTGGTCATCAGACCACGT-----------AAATG-AAATAGAATAGAGA------------CAAAAATTA?CAAG---AGAGAAAAAAAAA-------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGAATCTAATCAATGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTTGCTTT-CTAT----------CTAATTTACA----------------GAAAGGATA-----ATCCT-----------ATATAC-----CTAATA-------------------CACACGTATATATA---------------------------------CTGACATATCAAA----------------TGATTAATCAC--GA------CCCGAATCCATAATATAATATTTATTTATTTATTTATCTAATATAAATAAATAGTTTTATTATATTATATATTATATATATATATAATATTATATATAATATAAATAATATAAATAAATATATAAATAAATATATATAATA-------------------------------------------------------------------------------------------------------TAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTTATC-----TTTTGAAAAAAAAAAAAA------------------------------------------------------TGATAAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCATTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TATTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGATAGATATATG----------TATGTAC------AAAGACTCTCAACTATTGAAT-----TATTCACTATTCGCAATCTACATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTT--------------AAGACCCAA-AAATTCCCAGGG-----------TAAGGT--------------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------TATGGACATAAACACAAGC---CCTCTAATCT--AATAAGATAA---------AGTGATG-CATGGAAAACGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?01100101011001100??1000010???0??001001?101?001???001?01?0101?010000010001?10?11?00010100100 Homalomena_magna_AM905774 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTAAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCAAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGCTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCATGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGTTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTTCTCATGATCAT------GGTTTAAATGTA---AATGAATCCC------ATTTTTATGAACCCGCGGAAATTTCAGGTTATAACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAAAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGGCATTGTGGAAATGCCTTTCTCGCTGCGGTTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAAATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTTCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAATTCCTATGTAGTTGAATGCGAATCCATATTCCGTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTATAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATATTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAAT------CCTTTAGCGGTAAAGAGTCAAATGCTAGAGGATTCCTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCGTTGTCAAAAGCTAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTATCAGATTCTGACATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTATAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAAAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTTGGTGAATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTCTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATCCCTAGGGAAAGTCGTGTGCATTGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ATCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATT---ATTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTTATATAATAAATAA-TTTTATGAAAAATTT-AAGAG-----GTGAATCC-----ATTAC---------AA-ATT------GAAG-----------TAAGAGTCAAATATTCATTGATCAAATCATTCACTC-----CAGAGTTTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATGGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAC---------CCCATTTTACTTCCT------AAGTATTTTTCCTCT------TTTC-GTTGG----TGGCTCA-----AAA-TTCACTATGTTT-CCATTTACTC----TATTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----TGTTTAGCCCAAGTTTTT------GTGCAATACATGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTAGAGTATTGAAT-----TATTTACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAG-----TAATATCAAA----------------------AAGTCTTCTTTTTTATTT------------AAGACCAAA-TAATTTCCAGGG-----------TAAGGGTTTT----------------AAAAC----TTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111000101011001100101000010???0??011001?101?001???001?11?010000101??010001?10?10?001?1?001?0 Jasarum_steyermarkii_AM905792 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTATTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCACTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCGTTTATGCGTTGGAGAGACCGTTTCGTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCATAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACAAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTTTGCCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGTACTTGCTCATGATCGT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTGCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TTAGATATACTAATACCCTATTCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCGTGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTAACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGCATTTTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTTTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCACTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CAAAAACTCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATG-------------------CGCACGTCTATATA---------------------------------CTGACATATCAAA----------------TGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATAATTTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTAAATATAATAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGCGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTTACCTCTT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----TTGTTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGCACAA-------------GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTTTT------------AAGACAAAA--AAAGTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC--TTTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAGCACAAGC----CCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001100101000010???0??001001?101?001???001?01?010000111??010001??1100?001?1?001?0 Lagenandra_ovata_AM905780 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGGCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGTTGCTACCACATCGAACCTGTTCCTGGCGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTCGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCCATTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATTAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGGAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTTAGAAGCGTGTGTACAAGCGCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCTTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAACAGATTAAATTTGAATTCGAACCAGTGGATAAGCTAGATATGGAAGAATTAAAAGGATATTTC------GAAAAAACTAGATCGAAACAACAACACTTTCTATACCCGCTTCTCTTTCAAGAGTCTATTTATTCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------ATTTTGATGAATCTGCGGAAATTTCAGATTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCCA------ATGATATCAGAGGGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAATACCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATTATATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAATTTTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTATTTTTTCACGAATATCATAATTGGAAAAATCTCATTACTCTC---------AAAAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGAATATATATATTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGCAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTTTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCTTGTAGGATCCACATAAACCAATTCCCAAAATTTTCTTTCTATTTTCTGGGTTATCTTTTAAGTGTATCAATAAAT------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATGGATACTGTT------ACTAAAAAATGGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCGGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGATCTTCAAAAAAACAGAATTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAAAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTA----AATCATTT-----------ATGATT----CATTGGTCATGAGACCGTGT-----------AAATG-AAATAGAATAGAAA------------CAAAAA-TTTCGAG---AGAGATAAAA----------------TGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAAT-----------CTGAATA----GTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCT-----AAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAATTGCAAGCACGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGTTCAAGTCCCTCTATCCCCAATAACGA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCTTTTTT---------------AAGACCCC------TTACGGGG-----ATTAGGTAAGGGTTTT----------------CAAAC-----TTTTTGTCCTGTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111100101101011110????????????????????????????1???01?????????????????????????100?001?1?0???? Landoltia_punctata_AY034223 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGACAAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCTGCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACCGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCCGTTGCTGGAGAAGAAAATCAATATATTGCTTATGTAGCGTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCTAGGCCCACCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACCATCAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCTGAAGCAATTTATAAAGCACAAGCTGAAACAGGTGAAATTAAAGGGCATTACCTAAATGCTACTGCAGGTAATTGTGAAGACATGATGAAAAGGGCTGTGTTTGCTAGAGAATTGGCAGTACCTATTGTAATGCATGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTAGCAGATTATTGCCGAGACAACGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTCATTGAAAAAGACAGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGCGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGTGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGACCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAATTAGCCGCTGCT??????????????????????????????????????????????????????ATGGAAGAATTAAAAGGATATTTA------CAAAAAGGTGGATTTAAACAACAACACTTACTATATCCACTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCAG------GGTTTAAATGTG---AATGCATCAA------CTTTTAATGAACCCGCTGAAATTTCCGGTTATGACAATAAATATAGCTCATTACTTGTGAAACGGTTAATTACTCGAATATACCAACAGAATAGTTTGATCCATTCTGTTAAT------GATTCTAAGCAAAATAGATTCATTGGACACAAC------AAGAATTTTTATTATCAA------ATGATATCCGAGGGTTTTGCTATCGTAGTAGAAATTCCGTTTTCAATGCGATTAGTATCTTCTCTC---AAAAAAAAAGAA---ATACCGAAATATCAGAATTTACGATCTATTCATTCAATATTCCCATTTTTAGAGGATAAATTTGCACATTTAAATTATGTA------TCAGATATACTGATACCTTATCCGGTTCATCTAGAAATATTGGTTCAAATTCTACAATGCTGGGTACAGGATGTTCCCGCTTTACATTTATTACGATTGCTTTTTCATGACTATCATAATGGGAGTAATTGCATTACTCCA---------AAAAAA------TCTAGTTAT---GGTTTTTCAAAAGATAATCCAAGACTCTATAGGTTCCT------ATATAATTCTTATGTAGTCGAATGCGAATCCATATTTGTTTTTCTTCGTAAATCATCC---TCTTATTTACGATCAACATCTTTTGGATCCCTTCTTGAGCGAACACACTTCTATGGAAAAATGAAA------CATATTGGAGTAACTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATCCATTATGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTGAATTTATGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATACACATAAACCAATTCCCCCATTTTTCTTTCTATTTTTTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCATCCGTGAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACCGTT------ACTCCAAAATTTGAAACGATGATATCAATTATTCCTATGATTGGGTCATTGGCAAAAGCTAAATTTTGTAATCTATCGGGGAATCCTATTAGCAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTAGAATATGTAGAAACCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTATATCGAATAAAGTATATACTTAGACTTTCATGTGCTCGAACTTTGGCGCGTAAACATAAAAGTACAGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAGTTTTTCGAAGAATTCTTTATGGAAGAAGAAAAAGTTCTTTCTTTAATTTTA---CCAAGAACT------------------TCTTATCCTTTACAT------CAGTTATAT------------------------AGAGAA---CCTATTTGGTATTTGGATATTGGTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATAAATGATAAAACCGTGTAGTTGT-----AAATCAATATAGAATAGAAA------------ACAAAATTATCAAG--------TAAAAAAACA------TGTTATGTTAGTC-----ATCT---TTATTATGAAATGCTCATACAGTAGTGGTTGAATCAACTGAGTA----GTCAGATTTCTTACA----CTTTCTTTTC------GGGATCTAATCTAAATTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGATAGGTGCAGAGACTCAATGGAAGATGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCGTTG-----GTATCCGGAATTATGCTTT-CTCT----------CTAA----------------------GAAAGAGTA-----ACCCT-----------CTATAC-----CTAACA-------------------CACACGTATATATA---------------------------------CCAACATTTCAAC----------------TGATTAATCAG--GA------CCCGAATCCATAATTTTTATTTTTATATTATATTTATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAAACTATATTAAATATATA---TCTA------ATTT-AAGAGTTATTCTGAATTC-----ATTAC---------AA-ATT------CAAG-----------TAACAGTGGAATGTTAAGTTATCAAATCATTCACTC-----CAAAGTCTGATTATTT---TATTTTTTCACAAAA-------------------------------------------TAATAATAAAATAAAATAATAAATTGGACAAGAATAAAGAGAGATTCCCATTGGACAAGAATAAAGAGAGATTCCCATTCTACATGTC-------ACTACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CGATTTGACTTCCT------AAGTCTTTTTCCTCT------TTTCCATTGGTTGGTGACTCA-----AAA-TTAACTCTATTTTAGAGTTATTC----TACTCCTTCACTAA------AAGATCCGAGCAT----------TTT------------------------CCAAGTTTTT------GTGTAATACACGTCCAAA-----------TGAAGAT------------------ATATGGAC------AAAGA--------TAGTGAATGGAATTATTCACTATTAACAATCTCTATTCTT------AGGTTAGGTTATCTTTACACT-AT------AATATAAATGTT--------------------CAAATTCCTTTTT----------------AAGACCAAAAAAA----GAAAA--------AGGTAAGGGTTTC------------AAATAAAAC---TTTTTTTGTCCTTTTGTT------------------------------------------------------------------AATGGACAAAAACAGAAGC---CCTGG-------AGTAAGATAA---------GGTGATG-CATGTAAAACAGTCGGG------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?11100101011001100??1010011???0??00?1?1?101?001???001?01?010??0101??00000??00?00000011?00101 Lasia_spinosa_AM905749 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGCGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCGGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATTCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCTGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGGAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCCAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCCTTTTCGCTTCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATGTA------TCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCT------ATATAATTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGTATAAGTACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCCCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTTAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGGATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------GGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGTTCATGAGACCATGT-----------AAATG-ATATAGAACAGAAA------------CCCACACTTTCAAG---AGAGAAAAAAAAAAA-----------TGTCAGTC-----GTTC---TTATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-----CGCATCGCATATATCGCATATATATATATATA-----------------------------CTGATATATCAAA----------------CGATTAATTAC--GA------CCCGAATCCATAATTTTAATTTATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATTATAATAAATTAAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGT?????TCCCTCTATCCCCAATAAAAA---------CCCATTCGACTTCCT------AAGTATTTTTCCTCT------TTTCTGTTGG----TGGCTCA-----AAA-TTAACTATGTTTTCCATTTACTC----TACTCTTTCACA--CACAAAAAGATCCGAGCAT----------TTTATGTTATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAA--------------------------TCTTCCCTT--------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC----TTTTTTGTCCCTTTAATGGACA-------------------------------------------------------------TATGGACATAAACACAAGC---CCCCT-------AGTAAGATAG---------GGTAATG-CATGGGAAATTG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?11100101011001100101000010???00?001001?101?001???001?0000101?010001010001?10100?00011?001?0 Lasimorpha_senegalensis_AM905755 TCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCTAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCACTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGCGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACACACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTGATGATCCTGCGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCCAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTTCATTTTTGGAGGACAAATTATCACACATAAATTATATA------TCAGATATATTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACGAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCT------ATATAATTCTTATGTAATTGAATGCGAATCCGCATTAGTTTTTCTCCGTAAACAATCCCTTATTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATTTTCTGATGAAGAAATGGAAATACTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCTTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGT------ACTTCAGCGGTAAAGAGTCAAATGCTAGAGGATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCCCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGCCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGGATT------------------TATTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGTATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGTTCATGAGACCATGT-----------AAATG-ACATAGAATAGAAA------------CCCACACTTTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----GTTC---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCATTTCTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCATATATATATA---------------------------------CTGATATATCAAA----------------CGATTAATTAC--GA------CCCGAATCCATAATTTTAAATTATTAATATAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTTATAATTATATAAATTCAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAACTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAA------------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTCGACTTCCT------AAGTATTTT-CCTCT------TTTCTGTTGG----TAGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAACACAAAAAGATCCGAGCAT----------TTT-----ATGTTT----------AGTCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAA--------------------------TCTTTCTTT--------------------GACCCCT-AAATTTCTAGGG-----ATTAGGTAAGGGTTTG----------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC---CCCCT-------AGTAAGATAG---------GGTAATG-CATGGGAAATTG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?11100101011001100101000000???0??001001?101?001???001?0000101?010001010001?10100?00011?001?0 Lemna_minor_AM905730 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGACAAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCCGTTGCTGGAGAAGAAAATCAATTTATTGCTTATATAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACCTCCATTGTAGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTTTGGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCACCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACCATCAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAAGCCGAAACAGGTGAAATTAAAGGGCATTACTTAAATGCTACTGCAGGTACTTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCTAGAGAATTGGGAGTCCCTATTGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTTCTTTAGCATATTATTGCCGAGACAACGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGGGGGGATCACGTTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACAGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGTGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGCGGAACTTTAGGACACCCTTGGGGAAATGCACCAGGTGCTGTAGCTAGCCGTGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGACCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAACTGGAGTCCTGAATTAGCGGCTGCTTGTGAAGTTTGGAAA???????????????????????????????????????ATGGAAGAATTCAAAGGATATTTA------CAAAAAGGTGGATTTAAACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTATGCACTTGCTCACGATCAT------GGTTTAAATGTA---AATGCATCAA------CTTTTAACGAACCCCCTGAAATTTCAGGTTATGGCAATAAATATAGCTCATTACTTGTGAAACGGTTAATTACTCGAATATACCAACAGAATAGTTTTATCTATTCTGTCAAT------AATTCTAAGCAAAATAGATTCGTTGGACACAAT------AAGAATTTTTATTATAAA------ATGATATCAGAGGGTTTTGCTATTGTTGTAGAAATTCCGTTTTCACTGCGATTAGTATCTTCTCTCAAAGAAAAAAAAGAA---ATAACGAAATCTCAGAATTTACGATCTATTCATTCACTATTTCCATTTTTAGAGGATAAATTTTCACATTTAAATTATGTA------TCAGATATACTAATACCTTATCCGGTCCATCTAGAAATATTGGTTCAAATTCTACAATGCTGGATACAAGATCTTCCCACTTTACATTTATTACGATTGATTTTTCACGACTATCACAATGGGAGTAATAGCATTCCTCCA---------AATAAA------TCTAGTTTT---GGTTTTTCAAAAGATAATCCAAGACTCTATAGGTTCCT------ATATAATTCTTATGTAGTCGAATGCCAATCCATATTTGATTTTCTTCGTAAATCATCC---TCTTATTTACGATCAACATCTTTTGGACCCCTTCTTGAGCGAACACACTTCTATGGAAAAATGAAA------CATATTGGAGTAACTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATGCATTATGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTGAATTTATGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATACACATAAACCAATTCCCCCATTTTTCTTTCTATTTATTGGGTTATCTTTCAAGTGTGCCAATAAAT------CCTTCATCCGCGAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATAGCTTT------ACTCCAAAATTTGAAACAATGATATCAATTATTCCTATGATTGGGTCATTGGGCAAAGCTAAATTTTGTAATCTATCAGGGAATCCTATTAGCAAGCCAGCTTGGGCAGATTTGTCAGATTCTGATATTATTGATCGATTTGGTAGAATATATAGAAACCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAATATATACTTAGACTTTCCTGTGCTCGAACTTTGGCTCGTAAACATAAAAGTACAGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAGTTTTTCGAAGAATTCTTTATGGAACAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAACT------------------TCTTATCCTTTACAT------CAGTTATCT------------------------AGAGAA---CCCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTA----AATCATTTCGATTT-----ATGATT----CATTGGTGATAAAACAGTAT-----------AAATC-AAATAGAAAAAAAC------------------TTATCAAG--------TAAAAAA--------------TCTTAGTC-----ATCT---TTATTCTGAAATGCTCATACAGTAGTGGTTGAATCAACTGAGTA----GTCAGTTTTCTTACA--------CTTTTC------GGGATCTAATCTAAATTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCGCGG????????????????TATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATG---AAAAAGGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGATGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGGTGGTATCTGGAATTATTCTTT-CTCT----------CTAA----------------------GAAAGGGTA-----ACCCT----------------C-----TTAACA-------------------CGCACATATATA-----------------------------------CTGCAAC----------------------TGATTAATCAG--GA------CCCGAATCCATAATTTTTATTTCTATATTTATTATTTCTCTAATTTATATATATAAATATAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAAAATCAATAA-TTTTCT---AAATT--AAGAGTTATTCTGAATTC-----ATTCC---------AA-ATT------CAAG-----------TAATAGTGGAATATTCAGTGATCAAATCATTCACTC-----CAAAGTGTTATTTTTT-----TTTTCAAAAAAAAAGAATAA----------------------------------------------------TAATAAATTGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------ACTACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CGATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCT----------------------A-TTGACTAT--------TTC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTTT-----------AAG--------------------------------------------------------------------------------------ACAAAAA------------------------AAG------------------AAAAAAAA----------------------------------------------------------------------------------------AATGGACAAAAACAGAAAC---CCTGG-------AGTAATATAA---------GGTGACGACATGTCAAATAG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?1110010?011001100??1000011???1??00100??101?001???001??????????????????0???00??0000011?00??? Lysichiton_americanus_AM905728 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTGCTCAACCCGGAGTTCCACCTGAAGAAGCAGGTGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGGCCATTGTTGGAGAGGAAAATCAATTTTTTGCTTATGTAGCGTACCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCTTTACGAGCTCTACGTCTGGAGGATCTTCGAATTCCTCCGGCTTATTCCAAAACTTTCCAAGGCCCACCCCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTATTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTTCCCATCGTAATGCATGACTACTTGACAGGGGGATTCACTGCAAATACTAGTTTGTCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTAGAAGGTGAACGTGGGATGACTTTGGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTGTTGAAGGTAATCAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTATGGAAGGAGATCAAATTTGATTTCGCTCCAGTAGATCCGGATCCGATGGAAGAGTTAAAAGGATATTTA------GAAAAAGATAGATCTCGGCAACAACACTTCCTATATCCGCTTATCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAA---TA---AAGGGATCAA------TTTTTTACGAATCCACGGAAATTTTAGGTTATGACAATAAATCCAGCTCATTACTTGTTAAACGTTTAATTACTCGAATGTATCAACAGAATTATTTGATTAATTCGGTTAAG------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTTTTCTCAA------ATGCTATCAGAGGGTTTTGCAGTCATTGTGGAAATTCCCTTCTCGCTACGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAGATCTCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAGGACAAATTCTCACATTTAAATTATGTG------TCAGATATATTAATACCCTACCCCATTCATCTTGAAATCTTGGTTCAAATTCTACAATGCAGTATACAAGATCTTCCCTCTTTGCATTTATTGCGATTCTTTCTTCACGAATATCATAATTGGAATAGTCTCATTACTCCA---------AATAAA------TCTAGTTAC---ATTTTTTCAAAAGAAAATAAAAGACTATTTCGGTTCCT------ATATAGTTCTTATGTATTTGAATGGGAATCTATATTAGTTTTTCTACGTAAGCAATCC---TCTTATTTACGATTAACATCTTACGGATCTTTTATTGAGCGAACACTTTTCTATGGAAAAGTGGAA------CATCTTTTAGTAGTTTGTCGTAATGATTTTCAGAAGACCCTATGGTTATTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGAACTCATCTTATGATGAAGAAATGGAAATGTCACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCGTACAGAATCCATATAAAGCAATTCTCAACTTATTCCTTCTATTTTCTGGGCTATCTTTCAAGTGTGCTAAAAAGT------CCTTCCGCGGTTAGGAGTCAAATGTTAGAGAATTTTTTTTTAATAGATACTGTT------ACTAATAAATTCGATATTATAGTCCCAATTATTTCTATGATTGGATCATTGTCTAAAGCTAAATTTTGTAATGTATCAGGGCATCCTATTAGTAAGCCGGTTTGGGCCGATTTGCCGGATTCTGATATTATTGATCGATTTGGTAGGATATGTAGAAATCTTTCTCATTATCACAGTGGATCCTCAAAAAAACAGAGTTTGTATGGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTCGGCTCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTGGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTTTTTTTT---CCAAGAACC------------------TCTTTTCCTTTACAT------AGGTCATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATCAATGACTTGGTG----AATCATTT-----------ATGATT--------GGTTATGAGACTCTGT-----------AAAAA-AAATGGAATAGAAATGATCTA---TCTATAAATGATCAAG---AGATAAAAAAAA---------------TTCATTC-----ATTTTTTGAATTCTGAAATGCTCATA-----GTGGTTGAATCAATTACGTA----GTCAAGTTTATTAGA----CTTTCTTTTC------GGGATCT-----AGGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAAATGCAAGCACGGTGGAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATT---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GTGAAAAAGGAGGTTTTTATATAT-----ATAAAATATAAAAACTAGAA---------------------------------------------------------------------------------------TAAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA-----ATGAATGGAGTTG--------------------ACTGCGTTGCGTTGGTAACTGGAATTCTTCCTT-ATAT----------CGAAATTACA----------------GAAAGGATG-----ACTCT-----------ACATAC-----CTAATA-------------------CGTACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATTAC--GA------CCTGAATCCATAATTTATATTTATTTGTAAATTATAAATTATATATATTATTTATTTTATATATAATTTATATATAAATTATAAATATAAATTATATAAATAAAAATAATAATATATTTATAAA------------------------------------------------------------------------------------------------------------TATATAAATTTATAAATAATTAA-ATTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCCAATCC----AA-ATT------AAAG-----------GAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CGAAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTTGAAATCGTGGGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CAATTTGACTTCCTAAGTATAAGTATTTTTCCTCTT-----TTTTCGTCGG----TGGTTCA-----AAA-TTCACTATGTTTTCCATTCACTC----TACTATTTCACAAA------CGGATCCGCGCAG----------TTT-----GTGTCT---------TATCCCAAGTTTTT------GTACGATACACGTACAAA-----------TAAACAT------------------ATATGGGC------AAGGAATCTCCATTATTGAAT------------TATTCACAGTCCATATTTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGG-CATAAACATAAGT---CCTCT-------AGTAGGATAA--------------CG-CATGGGGAATGG-----------------CCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGAC-GA???????????????1011111?11101?00010101110100000010???0??0010010101?000000000101?010010101??1?0??????????10011?101?? Magnolia_umbrella_AF206791 TCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAGGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCTGGGGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTCTGGAGGATCTGCGAATTCCTACTGCTTATGTCAAAACTTTCCAAGGCCCGCCCCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCACTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCCAAGAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGGGCCATATTTGCCAGGGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACGGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATACACTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACCGTAGTAGGTAAACTGGAAGGGGAACGGGACATCACTTTGGGTTTTGTTGATTTACTACGCGATGATTTTATTGAAAAAGACCGAAGCCGCGGTATTTATTTCACTCAAGATTGGGTCTCTTTGCCAGGTGTTCTGCCCGTGGCTTCAGGCGGTATTCACGTTTGGCATATGCCTGCCCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTGGCGTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTCAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGCCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATTCGAATTCAAAGCAGTGGATACCTTGTAAATGGAGGAATTACAAGGATATTTA------GAAATAGATAGATCTAGGCAACAACACTTCCTATATCCG{CT}TTCTATTTCAGGAGTATATCTACGCACTTGCTCATGATCAT------GGTTTA---------AATGGATCGA------TTTTTTACGAACCTATGGAAAATTTCGGTTATGACAATAAATCCAGTTCACTAATTGTGAAACGTTTAATTACTCGAATGCATCAACAGAATCATTTGATTCTTTCGGTTAAT------GATTCCAACGAATCTATTTTCGTTGGGCACAAC------AAGAATTTTTATTTTCAA------ATGGTATCAGAGGGTTTTGCAGTCATTATGGAAATTCCATTCTCGCTGCGATTAGTATCTTCCCTAGAAGAAAAA---GAA---ATAGCAAAATCTCA??ATTTACGATCTATTCATTCAATATTTCCCTTTTTCGAGGACAAATTATCACATTTAAATCATGTG------TCAGATATACTAATACCTCATCCCATCCATCTGGAAATCTTGGTTCAAACCCTTCACTGCTGGATACAAGATGCCCCCTCTTTGCATTTATTGCGATTCTTTCTCCACGAGTATCGTAATTCGAATAGTCTCATTACTCCA---------AAGAAA------TCCATTTCT---CTTTTTTCAAAAGAGAATCAAAGATTCTTCTTGTTACT------ATATAATTCTCATGTATATGAATGTGAATCCGTATTAGTGTTTCTCCGTAAACAATCT---TCTCATTTACGATCAACATCCTCTGGAACTTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAA------CATCTTGTAGTAGTGC?TCGTAATGATTTTCAGAAGACCCTATGGTTGTTCAAGGACCCTTTCATGCATTATGTCAGATATCAAGGAAAATCCATTCTGGCTTCAAAGGGGACTCATCTTCTGATGAAGAAATGGAAATCTCACCTTGTCTATTTTTGGCAATGTCATTTTTACTTGTGGTCTCTACCGGACAGGATCCATATAAACCAATTATACAATCAATCCTT??ATTTTCTGGGCTATCTTTCAAGTGTACGACTAAAC------ACTTCGGTGGTAAGGATTCAAATGCTAGAGAATTCATTTCTAATGGATACTTCT------ATTAATAAATTCGAGACCCTAGTCCCAATTATTCCTCTGATTGGATCAGTGGCTAAAGCAAAATTTTGTAACGTATCAGGGCATCCCATTAGTAAGTCGGTCCGGGCCGATTCGTCAGATTCTGATATTATCAATCGATTTGGGCGGATATACAGAAATCTTTCTCATTATCACAGTGGATCCTCAAAAAAACAGACTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGAAAAGATTAGGTTCGGAATTCTTGGAGGAATTCCTTACAGAGGAAGAACAAGTTCTTTCTTTGATCTTC---CAAAGAACC------------------TCTTCTCCTTCTTAT------AGGTCACAT------------------------AGAGAA---CGGATTTGGTATTTGGATATTATCCGTATCAATGACCTGGCC----AATCATTC-----------ATGATT--------GGTCATGGGA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CCCCCT------AACCATTTATCCTCTT-----TTTTTGTCAG----TGGTTCA-----AAA-TTAGCTATGTTTCTCATTCACTC----TACTCTTTCACAAA------TGGGTCCGACCAG-----AAATGTTT-----CTCTCT---------TATCACAAGTCTTGTGATAGATATGATATACGTACAAA-----------TGCCCAT------------------ATATGGGC------AAGGAA--------------------------------------CATATCATT----------------ACTCTTACACTTACA------------------------------------AAGTCTTCTTTTT----------------GAAGATCCAA-GAAATTCCAGGA-----CCTAGGTAAGATTTTGG---------------AATGC---TTTTTGAGTCCCTTT---------------------------------------------------------------------AATTGACATAGACCCAAGC---CCTCT-------AGTAGGATGA--------------CG-CATCGGGAATGG-----------------TCGGG-----------------------------------ATAGCTCAGCTGGTAGAGCAGAGGAC??????????????????1111111?11101????????????????????????????????????????1???000101?000010001?????1???10100100011?1?1?0 Mangonia_tweedieana_AM905766 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAACCGTTGTTGGGGAGGAAAATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCCATTTTTAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAACCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGTAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGGATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAGTTTTTATTCTCAA------ATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTCGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCCTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAAAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCAAAGACTATTTTGGTTCCT------ATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGACCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACGAATTCTCCAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAG------TCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATGACTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATTGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTAGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTCCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CAACAATTCTCAAG---AGAGAAAAAAAAA-------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTCGAATCAGCTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGGGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTATTTTATTTATATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATAAATTCAAAA-TATTATGAAATATTT-AAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAGTCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATAAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCATTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGGTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTAACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATCAAAA------------------AAAAAGTCTTCCTTTTTATTTAAATTT------AAGACCCCC-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATCAAAC---TTTTTCTGTCCTTTT---------------------------------------------------------------------AATAGACATAAAAACAAGC----CCCT-------AGTAAGATAA---------GGCGATA-GATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111110001011001100101000010???0??001001?101?001???001?01?010000101??0100001101000001?1?001?0 Monstera_adansonii_AM905743 TCAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTATTGGGGAGGAAGATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTATAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCTGTACTACAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGTAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAGTTCAAACCAGTAGATACGATAGATATGGAAGAATTCAAAGGATATTTAGAAATAGAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCAT------GGTTTAAATGTA---AATGGATCAATATCCATTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCACAAC------CAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCATTACTCCA---------AGGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTTCT------ATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATTTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTATTAATAAAT------CCTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTTATAGATACTGTT------GCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTATTTCTTTAATCTTA---CCAAGAATT------------------TCTTATTCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATAA-----------ATGATTGATTCATTGGTCATCAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CCCAAATTAACAAG---AGAGGAAAAAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTTAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTCCTTTTCGGAATGTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGGAAACTGCA????????GCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAAA-----------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTAT----------CTAATTTACT-----------TTACAGAAAGGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATTAAA----------------CGATTAATCAC--GA------CCCGAATCCATAATATTTATTTATATAAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATCAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGA?????????????????????C-ATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTTT------TTTCCATTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TATT-----ACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCAC-----GCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA----------------------AAGTCTTCCTTTTTTT--------------AAGACCCAA-AAATTTCCAGGG-----------TAAGGT--------------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------TATGGACATAAACACAAGC---CCTCTAATCT--AATAAGATAA---------AGTGATG-CATGGAAAACGG-----------------TCGGG-----------------------------------ATAGCTCAG???????????????????????????????????0001111?011000010110010001010000100000??001001?101?001???001?01?0101?010001011000010?11?00010100100 Montrichardia_arborescens_AM905818 TCAAAGCTGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGACTATGAGACAAAAGATACCGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACGACTGTGTGGACTGATGGACTTACCAGCCTTGACCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCCAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCCGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAATCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCGAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCAAACCAGTAGATACGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAATAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACAGAAATTTCAGGTTATGACAATAAATTTAACTCATTACTTGTGAAACGTTTAATTACTCGAATATACCAACAGAATTATTTGACCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAATCTCAAATAATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCCGATATATTAATACCCTATCCCGTTCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGGGAATCCAAGACTATTTCGGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTAATAAAGAAATGGAAATCTTATTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTTTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGTGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGACATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGCGACCATGT-----------AAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGTACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTT----GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCT-----AATGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTTATATAATAAATAAACAAATAA-TTTTATGAAAAATTT-AAAATTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTAATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCAGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTTACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAACCCAGGGTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------GGGGTATCCTTACACTTAT-----AAATATAAAA----------------------AAGTCTTCTTTTTTATTT------------AAGACCCAA-TAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GACGATG-CATAGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111100101011001100101000010???0??001001?101?001???001?01?010000101??010001?00100?001?1?001?0 Nephthytis_afzelii_AM905759 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACTACATCGAACCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTAAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTGTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGTTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCAGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTAATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGTCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGCCATTGTGGAAATTCCTTTCTTGCTGCGATTAGCATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCAA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCT------ATATAATTCTTATGTAGTTGAATGTGAATCTATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGACCCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGGACAA---CATCTTATAGTACTTTGTTGTAATGATTTTCAGAAAACTCTATGGTTGTTCAAGGACCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAAT------CTTTCAGCAGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTCCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATAACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCGCGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTT----GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTATTTATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGAATTCAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTGG-----TCATTGATCAAATCATTAACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTTTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATGTGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTGAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTATTT------------AAGACCCAA-AAAATTCCAAGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTATGTCCTGTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------AGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACT?????????????????1011110111100101011001100101000010???0??001001?101?001???001?01?010000101??010001?10100?001?1?001?0 Orontium_aquaticum_AM905729 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGTGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGACCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCGTACCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCTTTACGAGCTCTACGTCTGGAGGATCTTCGAATTCCTACGGCTTATACAAAAACTTTCCAAGGCCCACCCCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGAACAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTCCCCATCATAATGCATGACTACTTGACAGGTGGATTCACTGCGAATACTAGTTTGTCTCATTATTGTCGAGACAATGGCCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATACATTTCCGTGTACTAGCTAAAGCATTACGTATGTCCGGTGGAGATCATATTCACGCCGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTGGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGACGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCACTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTGTTGAAGGTACTCAAATTATCCGTGACGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTATGGAAGGAGATCAAATTCATATTCCCTGCAGTAGATCCGGACG??ATGGAAGAGTTAAAAGGGTATTTA------GAAAAAGATAGATCTCGGCAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTA---------AACGGATCAA------TTTTTTACGAATCCATGGAAATTTTAGGTTATGACAATAAATTCAGCTCATTACTTGTTAAACGTTTAATTACTCGAATATATCAACAGAATTATTTGATTAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTTTTCTCAA------ATGCTATCGGAGGGTTTTGCAGTCATTGTGGAAATTCCCTTCTCGCTACGATTAGTATCTTCCTTCGAAGAAAAAAAGGAA---ATACCAAAATCTCAAAGTTTACGATCTATTCATTCAATATTTCCTTTTTTAGAGGACAAATTATCACATTTAAATTATGTG------TCAGATATATTAATACCCTATCCCATTCATCTTGAAATCTTGGTTCAAATTCTACAATGCTGTATACAAGATCTTCCCTCTTTGCATTTATTGCGATTCTTTCTTCACGAATATCATAATTGGAATAGTCTCATTACTCCA---------AAGAAA------TCTAGTTAC---ATTTTTTCAAAAGAAAATCAAAGACTATTTCGGTTCCT------ATATAATTCTTATGTATTTGAATCGGAATCTATATTCGTTTTTATCTGTAAGCAGTCC---TCTTATTTACGATCAACATCTTACGGATCTTTTATTGAGCGAACACATTTCCATGGAAAAGTAGAA------CAGCTTATAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGAACTCATCTTCTGATGAAGAAATGGAAATATCACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCGCACAGAATCCATATAAACCAATTCTCAACTTATTCCTTCTATTTTCTAGGCTATCTTTCAAGTGTACTAAAAAAT------CCTTACCCGGTTAGGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAGAAATTCGATACTCTAGTCCCAATTATTCCTATGATTGGATCATTATCTAAAGCTAAATTTTGTAATGTATCAGGACATCCTATTAGTAAGCCGGTTTGGGACGATTTGCCGGATTCTGATATTCTTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATCACAGTGGATCCTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTCGGCTCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAGAGATTGGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAATTCTTTCTTTGATTTTA---CCAAGAACT------------------TCTTTTCCTTTACAT------AGGTCATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATCAATGACTTGGTA----AATCATTT-----------ATGATT--------GGTCATGAGACCCTGT-----------AAATA-AAATGGAATAGAAACGGTCTATAGTCTATAAATGATCAAG---AGAGAAAAAAAAA--------------TGCATTC-----ATTT---GAATTCTGAAATGCTCATA-----GTGGTTGAATCAATTGCGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCT-----AGGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAAATGCAAGCACGGTGAAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATT---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------ACGAAAAAGGGGGTTTTACTATAT-----ATAAAATATAAAAACTAGAA---------------------------------------------------------------------------------------TCAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ACTGCGTTGCGTTGGTAGCTGGAATTCTTCCTT-CTAT----------CGAAATTACA------------TACAGAAAGGATG-----ACCCT-----------ATATAC-----CTAATA-------------------CGTACGTATATATA---------------------------------CTGACATATCAAA----------------TGATTAATCAC--GA------CCTGAATCCATAATTTCTATTTTTTTGTAAATTCTATTTCTATATTTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATAAAATAGAAATAATCCA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCTAATCC----AA-GTT------GAAG-----------GAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CGGAGTCTGATTTATC-----TTTTGAAAAAAAAAATGATA----------------------------------------------------TGATTAATCGTACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAA-----------CCATTTTGACTTCCTAAGTATAAGTATTTTTCCTCTT-----TTTTCGTCGG----TGGTTCA-----AAA-TTCGCTATGTTTTCCATTCACTC----TACTATTTCACAAA------CGGATCCGCGCAG----------TTT-----GTGTCT---------TATCCCAAGTTTTT------GTACGATACACGTACAAA-----------TAAACAT------------------ATATGGGC------AAGGAATCTCCATTATTGAAT------------TATTCACAGTCCATATTTT-------------------------AC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GG-CATAAACATAAGT---CCTCT-------AGTAGGATAA--------------CG-CATGGGGAATGG-----------------CCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1111111?11101?000111011101010000100100??0010010101?000000000101?010010101??1?0??????????10011?101?? Pedicellarum_paiei_AM905733 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGCGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACCGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGATTACTTAACAGGAGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGGGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGGCAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCGAACCAGTAGATAAGCTAGATATGGAAGAATTCAAAGAATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTATTCATGATCGT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACGGAAATTTCCAGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTCGGGCACAAC------CAAAATTATTATTCTCAA------ATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCGTTCTCGCTGCGATTAGTACCCTCCCTCGAAGAAAAAAAAAAAGAAATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTCGAAATTCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTATATTTATTACGATTCTTTTTTCACGAATATCATAATTGGGATAATCTTGTTACTCCA---------AAGAAA------TCTAGTTAT---GATTTTTCAAAAGAGAATCCAAGACTATTTAGGTTCTT------ATATAATTCTTATGTAGTTGAGTGCGAATCTATATTAGTTTTTTTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTATTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAATTCTATGGTTATTCAAAGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGACTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTGAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCCCCAGTTTTTCTTTCTATTTTATGGGTTATCTTTTAAGTGTACAAATAAAT------CTTTCAGCGGTAAACAGTCAAATGCTAGCGAATTCTTTTTTAATAGATACTATT------GCTAAAAAATGGGAAACTATACTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAATTTTGTAACGTATCAGGGAATCCTATTAGTAAGCCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAAAGTTTG??????????????????????GACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TATTATCCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATAACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAATTGAAA------------TCAAAATTACCAAG---AGAGAAAAAAAAAA------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAATAATAGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGAATCTAATCTCAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAATTGCAAGCCCGATGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AATGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAATTTACA----------------GAAAGGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTAACATATCAAA----------------CGATTAATCAC--GA------CCCGAATCCATAATTTTTATTTATA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATAAAAAA-TATCATGAAAAATTTTAAGAATTATTGTGAATCC-----ATTCCAACC-----AA-ATT------GAAA-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAGAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTTCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCAT----------TCT-----TTGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTTATTATTTGCA---------------------------------------------------ATCA------------------------AAGTCTTCCTTTTT----------------AAGACCCCA-AAAATTCCAAGG-----------TAAGGGTTTT----------------AAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC---CCTCTAATCT--AATAAGATAA---------GGTGATG-CACGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1010111?01100101011001100101000010???0??0010001101?001???001?01?0101?0101??010????10?10?0001010010? Peltandra_virginica_AM905815 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCCGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATACGAACCAGTGGATAAGCTAGAT?TGGAAGAATTAAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTAAAACGTTTAATTACTCGAATGTACCAACAGAATTTTTTGATCAATTCTGTTAAT------GATTCTAAACAAAATAGATTCGTTGGGCATAAC------AAGAATTTGGATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCTTCCCTCGAAGCAAAAAAAGAA---ATACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTCTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATTTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCACCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGCTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTAAAATGCTAGAGAATTCTTTTTTAATAGATACTGTG------ATTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATATTTCGACTTTCCTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TATTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTAGTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG?GC-T-TGAGC-TTAGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTGTTTTTTTTT--GAGAAAAAG------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAAACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CAATTAATCAC--GA------CCCAAATCCATAATTATTATTTATAATTTATAAATATAAAAATATAATAATATAATAAATATATATATAATATATAATAAATTAATATAATATATAAATTAATATAA-TAT--------------------------------------------------------------------------------------------------------------------ATAATAATAATATATAATAAATTCAATA-TTTTATGAAAAAATA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCAGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAA-----------CCCATTTTACCTCCTAAGTT-AAGTATTTTTCCTCT------TTTCCGTCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAACACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTAACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTTTTCCTTTTTTTTT------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC-----CTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGCCCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAAAGG-----------------TCGGG-----------------------------------ATAGCTCAGTTG-TAGAGCAG-GGACTGAAT?????????????1011010111100101011001100111000010???0??001001?101?000001001?01?010000111??010001?00100?00001?001?0 Philodendron_deltoideum_AM905775 TCAAAGCTGGTGTTAAAGATTACAAATTGAATTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTAAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCAAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCGGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGCTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTATCTTTAGAAGCATGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATTTTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTTCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------ATTTTTATGAACCCGCGGAAATTTCAGGTTATAACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAAAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATGCCTTTCTCGCTGCGGTTAGTATCCTCTCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCCAATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTTCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATTTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAATTCCTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCCTCCTCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTATAGTATTTTGTTGTAATGATTTTCAGAAAACCCTAGGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATATTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCGCATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAAT------CCTTTAGCGGTAAAGAGTCAAATGCTAGAGGATTCCTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCGTTGTCAAAAGCTAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTATCAGATTCTGACATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTATAGCGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCTTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAAAATT------------------TCTTATCCTTTAGAT------AAGTTATAT------------------------AGAGAA---CGAATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTTGGTGAATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCGTGCAGTAATGGTTGAATCAACTGAGTA----TTCAAATTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATT---ATTTTTATTTATAATAATTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTTATTTATATAATAAATAAAAAA-TTCTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCAAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAC---------CCCATTTGACTTCCT------AAGTCTTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTT-CCATTTACTC----TATTCTTTC-----------AAGATCCGAGCGT----------TTT-----ATGTTT-----TGTTTAGCCCAAGTTTTT------GTGCAATACATGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTAGAGTATTGAAT-----TATTTACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAG-----GAATATCAAA----------------------AAGTCTTCTTTTTTATTT------------AAGACCAAA-AAATTTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC----TTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGGTGGTAGAGAGGAGGA???????????????????1011100111000101011001100101000010???0??011001?101?001???001?1??010000101??010001?10100?001?1?001?0 Phymatarum_borneense_AM905783 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCACTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAACTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------ATTTTGATGAACCTGCGGAAATTTCAGATTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCCA------ATGATATCAGAGAGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACAATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCTA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTTATTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATTTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCAAAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAAT------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTAAAAATTTGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCAGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAAT------------------------AAAA-TCTCAAG---AGAGATAAAA----------------TGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAATA----GTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTGCA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATATTTATATAATATAATAATAATAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAATCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTTATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAGA---------CCCATTTTACTTCCT------AAGTATTTTTCCTCT------TTTCCGCTAG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATATACGTACAAA-----------TGAAGAT----------------ATATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTTT-------------AAGACCCCC-CAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTGTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC101111011110011?101001100??1000010???0??001001?101?001???001?01?0100001001?010001?10100?001?1?001?0 Pinellia_pedatisecta_AM905807 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGAGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTATTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGAAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTGCAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTTAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCTGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTTGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACTAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCCTTTCTCACGAATATTATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTCTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTTTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTTTAGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTACTTCGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTTATACATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAAATTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCCATTTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTCCCAATAAAT------CCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCCAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCGGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCACTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCGTTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-----------------TGTTAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACCGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTT-----GAGAAAAAAA-----------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCCAATCCATAATTTTTATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATAAGAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATTGAAATTGAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGGGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTGACCTCCT------AAGTATTTTTCCTCC------TTTCCGCCGT----TGAAAAA-----AAA-TTCACTATGTTTTCCATTTACTC----TATTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGGCTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCTTTTTTTTT-------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATAGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC10110101111001010110011011010?0010???0??001001?1000001???001?01?010000111??010001?10100?00001?001?0 Piper_betle_L12660 TCAAGGCTGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGAGTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCGCAACCCGGAGTTCCACCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCCTCTACTGGTACATGGACAACTGTATGGACCGACGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGGGAGGAAAATCAATATATTTGCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGCTTCAAAGCCCTACGAGCCCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCCCATGGAATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAGTTGGGGTTATCGGCTAAGAACTACGGTAGGGCAGTTTATGAATGTCTCCGCGGTGGCCTTGATTTCACCAAGGATGATGAAAATGTGAACTCCCAACCATTTATGCGCTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCTCTTTATAAAGCGCAGGCCGAAACGGGTGAAATTAAAGGACATTACTTAAATGCTACGGCAGGTACATGCGAAGAAATGATAAAAAGGGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACGGGGGGGTTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGACAACGGCCTACTACTTCATATCCACCGTGCAATGCACGCAGTTATTGATAGACAGAAGAATCATGGTATGCACTTCCGTGTACTAGCAAAAGCATTACGTATGTCTGGTGGAGACCATGTTCACTCAGGTACGGTAGTAGGTAAACTAGAAGGGGAGCGGGAAATTACTCTGGGTTTTGTTGATTTGCTACGTGATGATTTTGTTGAAAAAGATCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGCGTTTTGCCAGTAGCTTCAGGGGGGATTCACGTTTGGCATATGCCTGCCCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCCGGCGCAGTAGCGAATCGTGTGTCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAGGGTAATGAAATTATTCGTGAAGCTGCTAAATGGAGCCCCGAACTGGCGGCTGCTTGTGAAGTATGGAAAGAAATCAAATTCGAATTCGAAGCAATGGATACCTTGTGAATGGAA-AATT-AAAGGATATTTA------GAAACATTTAGATCTGAGCAAAAGCACTTCCTGTATCCACTTCTTTTTCAGGAATATATCTACGCACTCGGCCATGATCAT------GGTTTA---------AATAGACCGA------TTCCTTACGAATCCATAGAAAATTTAGGTTATGGCGATAAATCTAGTTCACTAATTGTGAAACGTTTAATTATTCGAATGCATAAACAGAATCATTTTCTTATTTCTTGTAATGAAAATGATTTTCAACAAAATCAATTGTTGGGGCGAAAA------AACAATTTGCATTCGAAA------ATGATATCGGAGGCTTTTTCAATTATTGTGGAAATTCCATTCTCCTTCCAATTAGTGTCTTGCCTAGAAAAAAAAAGAGAA---ATAGCAAAATCTCATAATTTACGATCTATCCACTCAATATTTTCCTTTTTTGAGGACAATATATTCTATTTATATCATATA------TCGGATGTATTAATACCCTACCCTATCCATCCAGAAATTTTAGTTCAAACCCTTCGTTACTGGATACAAGACGTCCCCTCTTTGCATTTATTGCGAATCTTTTTATACGAGTATTGTCATTCGGGCAGTCTCATTAGCAAA---------AAAAAA------AAATTTTCT---TTTTCAT?AAAAGAAAATGAAAGATTATCCTTATTCAT------ATATAATTCTCATGTATATGAATGGGAATCCGTATTCCTTTTTATCCGTAAACAATCT---TCTCATTTACTATCAATATCCTGGGAAGCCCTTCTTGAACGAGTCCATTTCTATGGGAAAATAGAA------CATCT-GTAGTAGTGCTTTGTAATGATTTTCAGAAGGCTTTGCGGTTGTTCAAAGATTCTTTCATGCATTATGTTAGATATCGGGGAAAATCCCTTTTGATTTCAAAGGGAACTGATCTTTTGATGAAAAAATGGAAATATCACTTTATCTATTTATGGCAATGTAATTTTCACTTGTGGTCTCAACTGCACAGGATCCATATAAACCAATTAGATAATCGTTCCTTCCATTTTTTGGGCTATGTTTCAAGTGTACGAAGAAAT------CTTTCGGTGGTAAAAAGTCAAATGCTAGAGAATTCATTTCTAATGGAGACTTCC------GTTAAGAAGTTCGAAACCATAGTCCCAATTATTTCTCTCATTGATTCATTGTCAAAAGAAAAATTTTGTAATCTATCGGGGCATCCCACTAGTAAGGCGATTTGGGCGGATTTGTCAGATTCTGATATTATGGAACGATTTGGGCGCGTATGCAGAAATCTTTCTCATTAT??????????????????????????????????????????????????????????????????????????????????????????????????????????TTTCAGAAAAATTAGGTTCGGGATTTTTGAAGGAATTCCTTGCCGAAGAGGAACAAGTTCTTTCATATTTCTTC---CCAAGATCC------------------TACCCCACTTCGTAT------AGGTCAAAT------------------AAAGATAAAGAA---CGGATTTGGTATTTGGATATTACCCATACAAATGACTTGACC----AATCATGA-----------ATGATT--------GATCATAAGAC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TAGAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATA---AAAAGTGGGCAATCCTGAGCCAAATCCTATTTTT---------CGGAAAACACGAGTTCA-----------------------------GAA-------------------------------------------------------------------------------------AGCGAAAAAG---GGATAGGTGCAGAGACTCAATGGAAGTTGTTCT-----AACGAATCAA----ATGGGGTTGCCTTTACCTTTATTA-----ATTGCA-----TTGGTA-TAGGAATCCTTCTA--CTCC----------ATAAAATAAG---------------AGAAAGAATT-----ACCCT-----------GGATGC-----GTA---------------------------------------------------------------------CTGAAATAGCAAA-----------------GATTCATCAC--GA------CCTGAATTC-TTTTTT-TTTTCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAAATTC-TGAAATTGTTCTGAATTG-----ATTCCA--------------------GAGG-----------GAAGAATCAAATATTCAGTGATCAAATCGTTTACTC-----CGGAGTATGATGGATC-----TTTTGAAGAAC-------------------------------------------------------------TGATTAATCGGACGAGAATAAAGATAGAGTCCC---------------------------ATTCTACATGTC-------GATACTGACAACAATGAAATTTATGGTAAGAGGAAAATCCGTCGACTTGAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAATAATAA----TCCCTATTTGACTCCCT------AACCATTTATCCTCTTTCTTTTCTTAGCCAG----CGATTCC-----AAG-TTTTCTATGTTTATTACTTATTC----TACTCTTTCACAAA------TGGATCGG-TCAG-----AAATCTTT-----ATCTAT---------TCTCAAAAATCTTGTAATAGATATTATCTACGTTAAAA-----------------T------------------ATACGGTAAAACCCATACTATGCTATGGT---------------AAAAATTTCCA-TCCAT-TTATT----------------ATGGACTCACTTACAG--TCCATATCA---------------------TTACTCCTACATTTA-----------------CAAGGTCTTCTTTTTTCTGAAAA-----TCCAAGCAAGAAATTCC---------------AGTGC----TTTTGAATTTCTTT---------------------------------------------------------------------AATTGACATAGACC-AAGT---CCTTT-------AGTAGGATAGTAATAATAA-----TG-TGTCGGAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGCTGGTAGAGCAGAGGGCTGAAATACA?????????1111111?11101????????????1011001?01?????10?001??0??001???000001?000010001??0?0100000100101011?100?0 Piptospatha_ridleyi_AM905781 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAACTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------ATTTTGATGAACCTGCGGAAATTTCAGATTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCCA------ATGATATCAGAGAGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACAATCCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCTA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTTATTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCCAAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATGGATACTGTT------ACTAAAAATTTGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT------AAATGAAATGTAAATGAAATAGAAA------------CAAAAA-TCTCAAG---AGAGATAAAA----------------TCTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAATA----GTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAGAACTGCAAGCACGG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTGCA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATATTTATATAAATTTATATATTTATATAATATAATAATAAATTTATATAATATAATAATAATAAATTAATAATAATAAA------------------------------------------------------------------------------------------------------------------------------------------------TTTGAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAATCGAATATTCAG--------------ACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAGA---------CCCATTTTACTTCCT------AAGTATTTTTCCTCT------TTTCCGCTAG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATCTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATATACGTACAAA-----------TGAAGAT----------------ATATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTTT-------------TAGACCCCC-AAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTGTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTC???????1011110111100101101001100??1000010???0??001001?101?001???001?01?0100001001?010001?10100?001?1?001?0 Pistia_stratiotes_AM905799 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGACAAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCAGGGGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCTGTTCCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCCGTTACCAACATGTTTACTTCCATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTGCGTCTAGAGGATTTGCGAATTCCTCCCGCGTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCAGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTTTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCGGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAGTTAGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGCGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATAACTTTAGGTTTTGTTGACTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATCCCTGTCGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGAGACGATTCCGTCTTGCAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATAGGGTAGCTTTGGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGCAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGAAATCAAATTCGAATACCAACCAGTTGATACGATTT??ATGGAAGAATTCAAAGGATATTTC------GAAAAGAGTGGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCCA------TTTTTTATGAACTCCCGGAAATTTCCGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAGTATACCAACAGAATTATTTGATCAATTCTGTTAAT------CATTCTAACCCCAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTAGAAATTCCTTTCTCATTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAATTTCTCACATTTAAATTGGATA------TCAGATATACTAATTCCTTATCCCGTACACTTAGAAATGTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGGGTAATCCCATTACTCCA---------AGGAAA------TCCAACTATTATGGTCTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAATTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATTTTATGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCTTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCGCTTTTGGTCTCAACCTGGTAGGATCCACATAAGCCAATTCTCAAAATTTTCGTTCTATTTTCTAGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATATTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATAATTGGATCATTGTCAAAAGCGAAATTTTGTAACGTATCGGGGAATCCCATTAGTAAGCCAGTTTGGGCGGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGAAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCGGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATAACTTAGCG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATCT-----------AAATG-AAATCAAATAGAAA------------CTCACATTCTAAAG---AGAGAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATATATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGC?????????????????????ATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTTT--AAGAAACAAA-----------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACATATATATA---------------------------------CTGGCATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATATTATATATTCTTAATTTATATATTCTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTTATATGTTATATAATAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAAGCC-----ATTCT---------AA-ACT------TAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAA???????????????????????????CAAAAA------------TCCATTTTACCTCCTAAGCT-AAGTATTTTTCCTCC------TTTCTGCCGG----AAACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCAAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACATACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTCTTGAAT-----TTTTTACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTATTT------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAACTTTTTTTTTGGTCCTGTT---------------------------------------------------------------------TATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAA-TCCTCGTGTCA?1011010111100101011001100??1000010???0??001001?101?000001001?01?010000111??010001?10100?00001?001?0 Podolasia_stipitata_AM905752 TCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACTTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTGAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCACGGGAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCCAACCAAAATAGATTCGTTGGGCACAAC------AAGAGTTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATGTA------TCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCT------ATATAATTCTTATGTAATTGAATGCGAATTCGTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTAACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAGT------ACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATATTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCCCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGGATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGTTCATGAGACCATGT-----------AAATG-ACATAGAATAGAAA------------CCCACACTTTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----GTTC---TCATTCTGAAATGCTCATGCAGTAATCGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGAGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCATATATATATATA-------------------------------CTGATATATCAAA----------------CGATTAATTAC--GA------CCCGAATCCATAATTTGAATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTATAATTATATAAATTCAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATTTTCAGTGATCAAATCATTCACTC-----CAGAG------TGATC-----TTTTGAAAAAAAAA----------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTCGACTTCCT------AAGTATTTTTCCTCT------TTTCTGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAA--------------------------TCTTCCTTT--------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC---CCCCT-------AGTAAGATAG---------GGTAATG-CATAGGAAATTG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?11100101011001100101000010???01?001001?101?001???001?01?0101?010001010001?10100?00011?001?0 Pothoidium_lobbianum_AM905734 TCAAAGCTGGTGTTAAAGATTACAAATTGAATTATTATACTCCTGATTATGCGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACCGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTACTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGATTACTTAACAGGAGGATTCACTGCAAATACTAGTTTAGCTTATTATTGCCGGGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCGAACCAGTAGATAAGCTAGATATGGAAGAATTCAAAGAATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTATTCATGATCGT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACGGAAATTTCCAGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCACAAC------CAGAATTTGTATTCTCAA------ATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCGTTCTCGCTACGATTAGTACACTCCCTCGAAGAAAAAAAAAAAGAAATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTCGAAATTCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGGATAATCTAGTTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCTT------ATATAATTCTTATGTAGTTGAATACGAATCTATATTAGTTTTTTTCCGTAAACAATTC---TCTTATTTACGATCAACATCTTCTGGAACCTTTATTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAATTCTATGGTTATTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGACTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTGAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCCCCAGTTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACAAATAAAT------CTTTCAGCGGTAAACAGTCAAATGCTAGCGAATTTTTTTTTAATAGATACTATT------GCTAAAAAATGGGAAACTATACTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGTCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAACAGTTTGATCGAATAAAATAT???????GACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATAACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAATTGAAA------------TCAAAATTACCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAATAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAATTGCAAGCACGATGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGAAATTCTTCTTT-CTAT----------CTAATTTACA----------------GAAAGGATA-----ACCCT-----------ATATAC-----CTAATG-------------------CGCACGTATATATA---------------------------------CTAACATATCAAA----------------CGATTAATCAC--GA------CCCGAATCCATAATTTTTATTTATA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATAAAAAA-TTTCATGAAAAATTTTAAGAATTATTGTGAATCC-----ATTCCAACC-----AA-ATT------GAAA-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAGAAAAAA----------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTTCT------AAGTATTTTTCCTCT------TTTTCGTTGG----TGGCTCA-----AAA-TTCACTACGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----TTGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCATTATTTGCAATCTACGTCGTT-----------AGGTTATCCTTACACTTA----------ATCAAA----------------------AAATCTTCCTTTTT----------------AAGACCCCC-AAAATTCCAAGG-----------TAAGGGTTTT----------------AAAAC----TTTTTTGTCCTTTTCTTTT----------------------------------------------------------------AATGGACATAAGCACAAGC---CCTCTAATCT--AATAATCTAA-TCTAATAAGGTGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1010111?01100101011001100101000010???0??0010001101?001???001?01?0101?0101??01001??10?10?0001010010? Pothos_scandens_AM905732 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGCGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACCGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGATTACTTAACAGGAGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGGGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGCAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCGAACCAGTAGATAAGCTAGATATGGAAGAATTCAAAGAATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATACCCGCTTCTCTTTCAAGAGTATATTTATGCATTTATTCATGATTGT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACAGAAATTTCCAGTTATGACAATAAATCTAGCTCATTACTTGCGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCACAAC------CAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCGTTCTCGCTGCGATTAGTACCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTCGAAATTCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGGATAATCTCGTTACTCCA---------AAGAAA------TCTAGTTAT---GATTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCTT------ATATAATTCTTATGTAGTTGAATACGAATCTATATTAGTTTTTTTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTATTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAATTATATGGTTATTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGACTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTGAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCCCCAGTTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACAAATAAAT------CTTTCAGCGGTAAACAGTCAAATGCTAGCGAATTTTTTTTTAATAGATACTATTGCTAATGCTAAAAAATTTGAAACTATACTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAATTTTGTAACGTATCAGGGAATCCTATTAGTAAGTCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAACAAAACAAAGTTTGTATCGAATAAAATATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGGATT------------------TCTTATCCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGGCCATGT-----------AAATG-AAATAGAATTGAAA------------TCTAAATTACCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAATAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGGAA-TTGCAAGC????TGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAATTTACA----------------GAAAGGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTAACATATCAAA----------------CGATTAATCAC--GA------CCCGAATCCATAATTTTTATTTATA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATAAAAAA-TTTCATGAAAAATTTTAAGAATTATTGTGAATCC-----ATTCCAACC-----AA-ATT------GAAA-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTTTGATTGATC-----TTTTGAAGAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAA????????????????????????????CATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTTCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTGACAAA------AAGATCCGAGCAT----------TTT-----TTGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCATTATTTGCAATCTACGTTGTT-----------AGGTTATCCTTACACTTA----------ATCAAA----------------------AAATCTTCCTTTTT----------------AAGACCCCA-AAAATTCCAAGG-----------TAAGGGTTTT----------------AAAAC----TTTTATGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC---CCTCTAATCT--AATAA--------------GGTGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?01100101011001100101000010???0??0010001101?001???001?01?0101?0101??01001??10?1000001010010? Protarum_sechellarum_AM905805 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCAGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCCAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCGGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATGGATTCGTTGGACATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCGCTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG??????????CCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTT---GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATAATAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGAATTTATATAATAAATTCCAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGCCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTTACCTCCT------AAGTATTTTTCCTCC------TTTCCGCCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGGAC------AAGGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTTTTT------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------CAAAC-----TTTTTGTCCTTTGA---------------------------------------------------------------CTTTTAATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001100?01000010???0??001001?101?001???001?01?010000111??010001?10100?00001?001?0 Pseudodracontium_lacourii_AM905786 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCGAAGGCCCACCTCACGGTATCCAAAGCGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGTGTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACCTAACAGGGGGATTCACCGCAAATACGAGTTTGTCTCATTATTGCCGAGACAATGGTCTATTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGTATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCCGGTGGGGACCATATTCACGCCGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCGAAACAACAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCCA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGCGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTTCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTGCGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTACCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAAGAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTCTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAACGAGCACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCACTTTTTGGCAATGTCATTTTCACTTTTGGTCTAAACCCTGTAGGATTCACATAAACCAATTCTCAAATTTTTTTTTCTATTTTCTGGGTTATCTTTCAAGTGTATCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAGTGGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGAGCATTGTCAAAAGCGAAATTTTGTAACGTATCAGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCCGATTCTGATATTATTGATCGATTTGGTCGGACATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACAGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGCTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAG---CGCGTTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGATCATGA-----------AAATG-AAATAGAATAGAAA------------CACAAATTCTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGACCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGGTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAGGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATAATTCATAATAATTATTTATATAATAATTATTTATATATTATATTATTTATATATTATATATATATAATTAT-----------------------------------------------------------------------------------------------------------------------------------------------AAATTATAATAATAATAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATT----------------------------------TGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAA------------CCATTTTACCTCTT------AAGTATTTTTCCTCT------TTTCTGTCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTTAAT-----TTTTCACTATTCACAATCTATATCGTT-----------AGGTTATCCTTACACTTAT-----AAGTATCAAA----------------------AGGTCCTCCTTTTTATTT------------AAGACCAAA-AAATTTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC----ATTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001100??1000010???0??001001?101?1?1???001?01?010000111??010001?10100?001?1?001?0 Pseudohydrosme_gabunensis_AM905760 ???????????GTTAAAGATTACAAATTGACTTATTATACTCCCGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGCAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCTGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTGTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGCGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTGCAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGCAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGTTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCCA------TTTTTTATGAACCCGCAGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTAATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGCCATTGTGGAAATTCCTTTCTCGCTGCGATTAGCATCCTCCCTCGAAGAAAAAAAAGAA---ATACCCAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCAA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTGGGTTCCT------ATATAATTCTTATGTAGTTGAATGTGAATCTATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGACCCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGGACAA---CATCTTATAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGACCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTTTGGCTTCAAAAAGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAAT------CCTTCAGCAGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTCCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CCCAAATTATCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTT----GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTATTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATAATGAATTCCAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTGGAATATTCATTGATCAAATCATTAACTC-----CAGAGTCTGATTAATC-----TTTTGAAAAATGAAAAAAAAA---------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATGTGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCGCAATCTATATTGTT-----------AGGTTATCCTTACACTGAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTATTT------------AAGACCCCA-AAAATTCCAAGG-----ATTAGGTAAGGGTTTT----------------CAAAC---TTTTTTTGTCCTGTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------AGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111100101011001100101000010???0??001001?101?001???001?01?010000101??010001?10100?001?1?001?0 Pycnospatha_arietina_AM905751 TCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAGCCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTTTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGATCCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCCAATCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTGGAGGACAAATTATCACACATAAATTATGTA------TCAGATATACTAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTCGGTTCCT------ATATAATTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCCATAAGT------ACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCCCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATAGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGGATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGTTCATGAGACCATGT-----------AAATG-ACATAGAATAGAAA------------CCCACACTTTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----GTTC---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCATATATATATATATATATAA------------------------CTGATATATCAAAATACTGATATATCAAACGATTAATTAC--GA------CCCGAATCCATAATTTGAATTTATTATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATATAAATTCAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAA------------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTCGACTTCCT------AAGTATTTTTCCTCT------TTTCTGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGTCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATGTATGAAGATATATATAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAA--------------------------TCTTCCTTT--------------------GACCCCT-AAAATTCTAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGC---CCCCT-------AGTAAGATAG---------GGTAATG-CATGGGAAATTG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?11100101011001100101000010???000001001?101?001???001?01?0101?010001010001?10100?00011?001?0 Remusatia_vivipara_AM905803 TCAAAGCTGGTGTTAGAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTATCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCACTTTTTAAAGCACAGTCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAACCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAGGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTGTGAACCCCCTGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATTAGAGGGTTTTGCTGTCATTGTGGAAATTCCTCTCTCATTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGGTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCC---TCTTATTTACAATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTGCAGAAAACCCTATGGGTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAGCCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAACCAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTGCGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGATTTGGTG----AACCATTT-----------ATGATT----CATTAGTCATAAGACCCTGT-----------AAATG-AAATTGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTT------GGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTT---GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CAAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCCAATCCATAATGATTATTTATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATTTAAATTGAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTTTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTTACCTCCT------AAGTATTTTTCCTCC------TTTCCGCCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAAATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTT---------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------CAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001101101000010???0??001001?1000001???001?01?010000111??010001?10100?00001?001?0 Rhaphidophora_crassifolia_AM905741 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACTACATCGAACCCGTTCCTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTTTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGCGATCTTGCTAGTGAAGGTAATGCAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAATTTGGAAAGAGATCAAATTCGAGTTCCAACCAGTAGATACGCTAGATATGGAAGAATTCAAAGGATATTTAGAAATAGAAAAAAGTAGATCTAAACAACAACACTTCCTATACCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCAT------GGTTTAAATGTA---AATGGATCAATATCCATTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCACAAC------CAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCA---------AGGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTTCT------ATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGCTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATTTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCAGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAAT------CCTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTTATAGATACTGTT------GCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATTCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATGA-----------ATGATTGATTCATTGGTCATCAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CCAAAATTAACAAG---AGAGGAAAAAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTCCTTTTCGGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCGATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTAT----------CTAATTTACA----------------GAAAAGATA-----ACCCG-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CACGAATCCATAATATTTATTTATAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATCAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCATTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TATTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCAC-----GCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA----------------------AAGTCTTCCTTTTTTTT-------------AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------TATGGACATAAGCACAAGC---CCTCTAATCT--AATAAGATAA---------AGTGATG-CATGGAAAACGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGGGTCAC0001111?01100001011001000101000010???0??001001?101?001???001?01?0101?010001011000010?11?00010100100 Rhodospatha_oblongata_AM905739 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGACAGTCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTACTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACGGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCCAAGCAGTAGATACTCTAGATATGGAAGAATTTAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCGCTTGTTCATGGTCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCATAAC------CAGAAATTTTATTATCAA------ATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCA---------AGGAAATGGAAATCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTATTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAAT------CTTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------GCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGTTTTTTTAGAAGAATTTTTTACGGAAAAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TATTATTCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTC-----------ATGATT----CGTTGGTCATCAGCCCCCGT-----------AAATG-GAATAGAATAGGAA------------CCCCAATTTCCCAG---AGAGAAAAAAAAAAA-----------TGTCAGTC-----ATTT---TAATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG????????????????TATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTTTCTTT-CTAT----------CTAATTTACA----------------GAAAGGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CAATTAATCAC--GA------CCCGAATCCATAATATTTATTTATATAATATAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAAA------------------------------------------------------TGATCAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATC??????????AAGTCCCTCTATCCCCAAAAAAAAAA--------CCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCATTGG----TGGCTCA-----AAA-ATCACTACGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCGCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA----------------------AAGTCTTCCTTTTTTTTT------------AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------AAAAC---TTTTTTTGTCCTTTT----------------------------------------------------------------------ATGGACATAAACACAAGC---CTTCTAATCT--AATAAGATAA---------AGTGATG-CATGGAAAACGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?01100101011001100??1000010???0??001001?101?001???001?01?0101?010001010000010?11?00010100100 Scaphispatha_gracilis_AM905793 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGCGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATATGGAAGAATTCAAAGGATATTTA------GAAAAAAATAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGTACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCGGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGGTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTATGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAA---CATTTCGTAGTACTTTGTTGTAATGATTTTAAGAAAACCCTATGGTTGGTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAAATTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGATTGAATCATTGTCAAAAGCTAAATTTTGTAACGTATCAGGGAATCCCATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTCGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTACTTAGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AAAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAATTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGCGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGGGTTG--------------------ATTGCATTGCGTTGGTAACTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATAATTTATA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAAATATAATAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAAA-TCTGATTGATC-----TTTTGAAAAAAAAA----------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTTACCTCTTAA-TT-AAGTATTTTTCCTCT------TTTCCATTGG----TGACTCA-----AAA-TTCACT-----TTCTATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCTT-----------------------------AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----GTTTCACTATTCACAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAATCCTTACACTTATAAATATCAAAAAGGCTTCCTTTTTATTT------------AAGACAAAA--AAATTTCATGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAGCACAAGC----CCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCCG1011010111100101011001100101000010???0??001001?101?000011001?01?0?1000111??010001??1100?001?1?001?0 Schismatoglottis_trifasciata_AM905782 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCACTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGACAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATAGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGAT?????????????????????????????????????????????????????????TTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------ATTTTGATGAACCTGCGGAAATTTCAGATTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCCA------ATGATATCAGAGAGTCTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACAATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCTA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTTATTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCAAAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAAT------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTAAAAATTTGGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGAAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTTGGATATGTAGAAATCTTTTTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATGAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAAT-----AGAAA------------CAAAAA-TCTCAAG---AGAGATAAAA----------------TGTCAGTCCAGTCATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAATA----GTCAAGTTTTTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG??????????CCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAAGAAA--------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTGCA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATATTTATATAATATAATAATAATAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAATCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTTATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGAC???????????????GGTTCAAGTCCCTCTATCCCCAATAAAGA---------CCCATTTTACTTCCT------AAGTATTTTTCCTCT------TTTCCGCTAG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATATACGTACAAA-----------TGAAGAT----------------ATATATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTATT-----------AGGTTATCCTTATGCTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTTT-------------AAGACCCCC-AAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCTGTT---------------------------------------------------------------------AATGGACATAAACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAG?????????????????????????????????????????011110111100111101001100?01000010???0??001001?101?001???001?01?0100001001?010001?10100?001?1?001?0 Scindapsus_hederaceus_AM905742 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACTACATCGAACCCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTGTTATACCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGACTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGGGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCAAACCAGTAGATACGATAGATATGGAAGAATTAAAAGGATATTTAGAAATAGAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCAT------GGTTTAAATGTA---AATGGATCAATATCCATTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGACACAAC------CAGAATTTTGATTCTCAA------ATGATATCAGAGGGTTTTGCTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCCATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCA---------AGGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTTCT------ATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATTTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTAGTAATAAAT------CCTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTTATAGATACTGTT------GCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATTCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATGA-----------ATGATTGATTCATTGGTCATCAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CCAAAATTAACAAG---AGAGAAAAAAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTCCTTTTCGGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTTGCATTGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTAT----------CTAATTTACA----------------GAAAGGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCATGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCGAACCCATAATATTTATTTATTTATTTATATAAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAAAAAAAAAA-----------------------------------------------TGATCAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGG????????CCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCATTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TATTCTTTCACAAA------AAGATCCGAGCAT--------------------TTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATG----------TATGTAC------AAAGACTCTCGAGTATTGAAT-----TATTCAC-----GCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATCAAA----------------------AAGTCTTCCTTTTTTT--------------AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------CAAAC---TTTTTTTGTTCTTTT---------------------------------------------------------------------TATGGACATAAACACAAGC---CCTCTAATCT--AATAAGATAA---------AGTGATG-CATGGAAAACGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC0001111?01100001011001000001000010???0??001001?101?001???001?01?0?01?010001011000010?11?00010100100 Spathantheum_intermedium_AM905769 TCAAAGCTGGTGCTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCAATTTATAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTACGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAGTTTTTATTCTCAA------ATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAACTTTCAGAATTTACGATCTATTCATTCAATATTTTCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTACA---------AAAAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTAGGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATTTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTTTTCTTTCTACTTTCTGGGTTATCTTTCCAATGTACCAATAAAG------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTACTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAGTGCCTTGGTG----GATCA------------------------CATTGGTCATGAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CAACAATTCTCAAA---AGAGAAAAAAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAGCTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTACATTGCGTTGGTAGCTGAAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGAGA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATGTCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTATTGAATTTATAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATAAATTCAAAA-TATTATGAAATATTT-AAGAGTTATTCTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTTACTTCCT------AAGTATTTTTCC--------------GTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAAATGCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATCAAAT------------------AAAAAGTCTTCCTTTTTATTTCAATTT------AAGACCCCA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------AAAATCAAAC---TTTTTCTGTCCTTTT---------------------------------------------------------------------AATAGACATAAAAA-AAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111110001011001100101000010???0??001001?101?001???10??01?010000101??0100001101000011?1?001?0 Spathicarpa_hastifolia_AM905772 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCCCTTTTTAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCTTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCGGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCCGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATACGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGCGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAGTTTTTATTCTCAA------ATGATATCAGAGGTTTTTGCTGTCATTGTAGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACATGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAAAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCTAAGACTATTTCGGTTCCT------ATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGGAATGATTTTCAGAAAACCTTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTTACTTTTGGTCTCAACCCTGTAGAATCCACATAAACCAATTCTCGAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAG------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATGACTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGGTTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTCTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTCCTTTAATCTTA---CCAAGAATT------------------TCTTATACTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CAACAATTCTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAAAGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAATTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTATTTAATTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATTTATAAATTCAAAA-TATTATGAAAAATTT-TAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAAT-TGAAAT------------------AAAAAGTCTTCCTTTTTATTTCAATTTAAATTGAAGACCCCA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------CAAATCAAAC----TTTTCTGTCTTTTT---------------------------------------------------------------------AATAGACATAAAAACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111110001011001100101000010???0??001001?101?001???001?01?010000101??0100001101000001?1?001?0 Spathiphyllum_wallisii_AJ235807 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGCCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGTCCCTATCGTAATGCATGACTATTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCGGGTACAGTAGTAGGTAAACTGGAAGGTGAACGAGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTTTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGCGAGGTTTGGAAAGAGATCAAATTTGAGTACAAACCAGTAGATACGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGTTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCACGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCACAAC------CAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGTTTTCATTGTGGAAATTCCTTTCTCACTGCGATTACTATCCTCCCTCGAAGAAAAAAAAAAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTAGAGGATAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCTGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGTTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCA---------AGGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCCTATTTGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACCCATTTCTATGGAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATTGTTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCTTGTAGGATCCACATAAACCAATTCTCCCATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAAT------CCTTCAGTAATAAAGAGTCAATTGCTAGAGCATTCTTTTTTAATAGATACTGTT------GCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTTGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGATTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATATTA---CCAAAAATT------------------TCTTATTCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTAGTCGTATAAATGACTTGGCG----AATCATAA-----------ATGATT----CATTGGTCATCAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CCCAAATTAACCAG---AGAGAAAAAAAAAA------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGAATCTAATCAATGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG???????GAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTTGCTTT-CTAT----------CTAATTTACAGAAAATCTAATTTACAGAAAGGATA-----ATCCT------ATATTATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCGAATCCATAATATTTATTTATCTAATAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGAGAAATCGGACGAGAATAAAGAGAGAGTCCC-------------------------------------------------------------------------------------------------------------------------TATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCATTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TATTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GGGCAATACACGTACAAA-----------TGAAGATAGATATATG----------TATGTAC------AAAGACTCTCAACTATTGAAT-----TATTCACTATTCGCAATCTACATTGTT-----------AAGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTACTTTTTTT--------------AAGACCCCA-AAATTCCCAGG------------TAAGGT--------------------AAAAC---TTTTTTTGTCCTTTT---------------------------------------------------------------------TATGGACATAAACACAAGC---CCTCTAATCT--AATAAGATAA---------AGTGATG-CATGGAAAACGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?01100101011001100?010000100000??001001?101?001???001?01?0101?010000010001?10??1?00010100100 Spirodela_polyrrhiza_AM905731 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGACAAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCCGTTGTTGGAGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCACCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACCATCAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCTGAAGCAATTTATAAAGCACAAGCTGAAACAGGTGAAATTAAAGGGCATTACTTAAATGCTACTGCAGGTACTTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATTGTAATGCATGACTACTTGACAGGGGGATTCACTGCAAATACTAGTTTAGCACATTATTGCCGAGACAACGGCCTACTTATTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGCGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGTGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTTTGGAAAGCGATCAAATTTGAGTTCGAACCAGTAGATAAGCTAGATATGGAAGAATTCAAAGGATATTTA------CAAAAAGGTGGATTTAAACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTACGTACTTGCTCATGATCAT------GGTTTAAATGTA---AATGCATCAA------CTTTTAATGAACCCTCGGAAATTTCAGGTTATGACAATAAATCTAGCTTATTACTTGTGAAACGTTTAATAACTCGAATATACCAACAGAATAGTTTGATCCATTCTGTTAAT------GATTCTAACCAAAATATATTCGTTGGACACAAC------AAGAATTTTTATTATCAA------ATGATATCAGAGGGTTTTGCTATCGTTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCTTCTTTCAAAGAAAAAAAAGAA---ATACCGAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTAGAGGATAAATTTGCACATTTAAATTATGTA------TCAGATATACTAATACCTTATCCCGTCCATCTAGAAATATTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCCTTTTTCACCAATATCACAATGGGAATAATTGCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGATAATCCAAGACTATATAGGTTCCT------ATATAATTCTTATGTAGTAGAATACGAATCCATATTTGTTTTTCTCCGTAAATCATCC---TCTTATTTACGATCAACATCTTTTGGAACCCTTCTTGAGCGAACATACTTCTATGGAAAAATGAAA------AATATTGGAGTAACTCATTCTAATAATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTTATGCATTATGTTAGGTATCAAGGAAAATCAATTATGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTGAATTTATGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAATCAATTCTCCCATTTTTCTTTCTATTTTTTGGGTTATCTTTCAAGTGTCCTAGAAAAT------CGATCATCGGTAACGACTCAAATGCTAGAGAATTCCTTTTTAATAGAGACCGTT------ACTAAAAAATTTGAAACGATGGTATCCATTATTCCTATGATTGGTTCATTGTCAAAAGCTAAATTTTGTAACCTATCGGGGAATCCGATTAGCAAGCCTGTTTGGGCCGATTTATCAGATTCTGATATTATTGATCGATTTGGTCGAATATGTAGAAACCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTCGAACTTTGGCGCGTAAGCATAAAAGTACTGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAGTTTTTAGAAGAATTCTTTATGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAACT------------------TCTTATCCTTTACAC------AAGTTATAT------------------------AGAGCA---CCCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATAATTT-----------ATGATT----CATTGGTGATAAAACCATGT-----------AAATC-AAATAGAATAGAAA------------AAAAAATTCTCAAGTTAAGAGATAAAAAA--------------TGTTAGTC-----ATCT---TTATTCTGAAATGCTCATACAGTTGTGGTTGAATCAACTGAGTA----GTCAAGTTTCTTACA----CTTTCTTTTC------GGGATCTAATCTAAATTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATT---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGATGTTCT-----AACGA---------ATGGAGTTA--------------------ATTGTATTGCGTTGGTAGCTGGAATTATTCTTT-CTCT----------CTAAATTACA----------------GAAAGGATA-----ACCCT-----------CTATAC-----CTAACA-------------------CGCACGTATATATA---------------------------------CTGACATTTCAAA----------------TGATTAATCAG--GA------CCCGAATCCATAATTTTTATTTCTATATTTC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTATATAAAAAAAATAGAAATTCAAATAAATAA-TTTTA------ATTT-AAGAGTTATTCTGAATCT-----ATTCC---------AA-ATT------CAAG-----------TAAGAGTGGAATATTCAGTGATCCAATCATTCACTC-----CAGAGTCTGATTGATT-----TTTTGGAAAAAAAAA---------------------------------------------------------TAATTAATTGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAAAA---------CGATTTGACTTCCT------AAGTATTTTTCCTCTTTTCT-TTTCCATCGG----TGACTCA-----AAA-TTCACTATATTTTCCATTTACTC----TACTCCTTCACTAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTGT------GTGTAATATACGTACAAA-----------TGAAGAT------------------ATATGGAC------AAAGATTCTCCTGTATTGAAT-----TATTCAGTATTAACAATCTATATTGTT-----------AGGTTATCCTTACACATTTAA-TATAATATAAATGTT--------------------AAAATTCCTTTTTGACT------------AAGACAAAAAA-----------------------AAGGGTTT-----------------AAAAC---TTTTTTTGTCCTGTT---------------------------------------------------------------------AATGGACAAAAACGGAAGC---TCTGG-------AGTAAGATAA---------GGTAATG-CATGGAAAATAG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?11100101011001100101000010???0??0011?1?101?001???000001?0101?0101??010000000??0?00011?001?0 Stenospermation_ulei_AM905738 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACTTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTTGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTAGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTACTTTAGCTCATTATTGTCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACGGTAGTAGGTAAACTGGAAGGCGAACGTGAGATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCTGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTAGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAGTTCAAACCAGTAGATACACTAGATATGGAAGAATATAAAGGATATTTA------GAAAAAAGTAGATCTA?ACAACAACACTCACTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGTTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------GGTTTTATGAACCCACGAAAATTTCAGGCTATGACAATAAATCTAGCTCATTACTTGAGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCATAAC------CAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTCTCATTGTGGAAATTCCTTTCTCACTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAT---GTACCAT??TCTCACAATTTACGATCTATTCATTCAATATTTCCATTCTTAGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCATGAATATCATAATTGGAATAATCTCGTTACTCCA---------AGGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTTGGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCTTTATTAGTTTTTCTCCGTAAAGAATCC---TCTTATTTACGATCAACATCTTCTGGAACTTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAA------CATCTTGTAGTAGTTTGTTGTAATGATTTTCAGAAAACCCTGTGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAAGGGCCTCATCTTTTGATGAATAAATGGAAATCTTACTTTGTCCATTTTTGGCAATGTCATTTTCACTTTTGGTTTCAACCCTGTAGGATCCACATAAACCAATTCTCCAATTATTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACTAATAAAT------CTTTCAGTAGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACCGTT------GCTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCGAAAGCTAAGTTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAACAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCCGTTTTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATTCTTTACATTTACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTTGTATAAATGACTTGGTG----AATCATGA-----------ATGATT----CATTGGTCATCAGACCAAGT-----------AAATT-AAATAGAATAGAAA------------CCCAAATTAACAAG---AGAGAAAAAAAA--------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTCTTTTC------GGAATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG????????AGCCTTGGTATGGAAACCTACTAAGTGCTAGCTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTTGTCTTT-CTAT----------CTAATTTACA----------------GAAAGGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCGAATCCATAATATTTATTTATATA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATAAATAAATAG-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTTGAATATTCAGTGATCAAATCATTCACTCCAGACCAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATCAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAG-CCCTCTATCCCCAATAAAAA----------CCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCATTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTCACTC----TACTCTTTCACAAA--CAAAAAGATCCGAGCAT----------TT----------------------------------------------------------------------------------------------------------------GACTCTCGAGTATTGAAT-----TATTCACTATTCGCAATCTACATTGTT-----------AGGTTATCCTTACACTTATAAAATAAATATAAAA----------------------AAGTCTTCCTTTTTTT--------------AAGACCCCA-AAATTTCCAGGG-----------TAAGGT--------------------AAAACC--TTTTTTTGTCCTTTT---------------------------------------------------------------------TATGGACATAAACACAAGC---CTTCTAATCT--AATAAGATAA---------AGTGATG-CATGGAAAACGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?01100101011001100?01000010???0??001001?101?001???001?001010????????010000010?11?00010100?00 Steudnera_colocasiifolia_AM905801 TCAAAGCTGGTGTTAGAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTTTGTGCCGAAGCACTTTATAAAGCACAGTCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAACCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATGGAAGAATTAAAGGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTGTGAACCCCCTGAAATTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATTAGAGGGTTTTGCTGTCATTGTGGAAATTCCTCTCTCATTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATTATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGGTTTTCGAAAGAGAATCCAAGACTTTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTCGTTTTTCTCCGTAAACAATCC---TCTTATTTACAATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTGCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCTACATAAGCCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGACCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGATTTGGTG----AGCCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACGGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTTTTTT-GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCCAATCCATAATTATTATTTATATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATTGAAATTGAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTTTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTTACCTCCT------AAGTATTTTTCCTCC------TTTCCGCCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAAATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTTTT-------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001101101000010???0??001001?1000001???001?01?010000111??010001?10100?00001?001?0 Stylochaeton_bogneri_AM905776 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTACAAAGCACAGCCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATTAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGGTTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGTAATGCGCCTGGTGCAGTAGCTAATAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTACTGAACTAGCTGCTGCCTGTGAGATTTGGAAAGCGATCAAATTTGAGTTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAGGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTTTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAAATTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTATTAAT------GATTCTAACCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCTTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCTATTTTTGGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGCTCATCTAGAAATCCTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCCTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTCTCAAAAGAGAATCCAAGACTCTTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCCTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTATTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTAGTTTGTTGTAATGATTTTTATAAAACCCCATGGTTGTTCAAGGATCCTTTCATGCATTATATTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTTATCTTCTTATGAAGAAATGGAAATCCTACTTTGTCAATTTTTGGCAATGTCATTTTCGCTTTTGGTCTCAACCCTGTAGGATCTACATAAACCAATTCTCCAATTTTTCTTTCTATTTTTGGGGTTATCTTTCAAGTGTACCAAAAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTG---CCAAGAATT------------------TCTTATCCTTTGCAT------AAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTTGTCATGAGACTATGT-----------AAATG-AAATAGAATATAAA------------CCCCAATTCTCAAG---AGAGAAAAAAGAAAA-----------TGTCAGTC--------------ATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----GTCAAGTTTCTTAGA----CTTTCGTTTT------GGGATCT-----AAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAAAAGCAAG?????TGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATAGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCGAATCCATAAGTTTTATTTATTTTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTATATAAATAAATAA-TTTTATGAAAAACTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ACT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAAAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTATACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAA----------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTTCGCTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATCTACTCGACTCACTCTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTT------GTGCAATACACATACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTTACAATCTATATTGTA-----------AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTATTT------------AAGACCCCC-AAAATTCCAGGG-----ATTGGGTAAGGGTTTT----------------AAAAC----TTTTTTGTCCTGTT---------------------------------------------------------------------AATGGACATAAACACAAGC---CCCCT-------AGTAAGAAAA---------GATGATG-CATGGAAACTGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC10111101111001010??001110101000010???0??001001?101?001???001?01?0101?0101??010001?10100?00011?001?0 Symplocarpus_foetidus_L10247 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTGCTCAACCCGGAGTTCCACCTGAAGAAGCAGGTGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGGCCATTGTTGGAGAGGAAAATCAATTTATTGCTTATGTAGCGTACCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCTTTACGAGCTCTACGTCTGGAGGATCTTCGAATTCCTCCGGCTTATTCAAAAACTTTCCAAGGCCCACCCCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTATTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAACTCCCATCGTAATGCATGACTACTTGACAGGGGGATTCACTGCAAATACTAGTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGGGATGACTTTGGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTGGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTGTTGAAGGTAATCAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTATGGAAGGAGATCAAATTTGATTTCGCTCCAGTAGATCCGGACCCAATGGAAGAGTTAAAAGGATATTTA------GAAAAAGAGAGATCTCGGCAACAACACTTCCTATATCCGCTTATCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTA---------AAGGGATCAA------TTTTTTACGAATCCACGGAAATTTTAGGTTATGACAATAAATCCAGCTCATTACTTGTTAAACGTTTAATTACTCGAATGTATCAACAGAATTATTTGATTAATTCCGTTAAT------GATTCTAACCAAAATGGATTCGTTGGGCATAAC------AAGAATTTTTTTTCTCAA------ACGCTATCAGAGGGTTTTGCAGTCATTGTGGAAATTCCCTTCTCGCTACGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAGGACAAATTCTCACATTTAAATTATGTG------TCAGATATATTAATACCCTACCCCATTCATCTTGAAATCTTGGTTCAAATTCTACAATGCTGTATACAAGATCTTCCCTCTTTGCATTTATTGCGATTCTTTCTTCACGAATATCATAATTGGAATAGTCTCATTACTCCA---------AATAAA------TCTAGTTAC---ATTTTTTCAAAAGAAAATCAAAGACTATTTCGGTTCCT------ATATAATTCTTATGTATTTGAATGGGAATCTATATTAGTTTTTCTACGTAAGCAATCC---TCTTATTTACGATCAACATCTTACGGATCTTTTATTGAGCGAACACTTTTCTATGGAAAAGTGGAA------CATCTTTTAGTAGTTTGTCGTAATGATTTTCAGAAGACCCTATGGTTATTCAAGGATCCTTTTATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGAACTCATCTTATGATGAAGAAATGGAAATGTCACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCGTACAGAATCCATATAAAGCAATTCTCAACTTATTCCTTCTATTTTCTGGGCTATCTTTCAAGTGTGCTAAAAAAT------CCTTCCGCGGTTAGGAGTCAAATGTTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGATATTATAGTCCCAATTATTCCTATGATTGGATCATTGTCTAAAGCTAAATTTTGTAATGTATCAGGGCATCCTATTAGTAAGCCGGTTTGGGCCGATTTGCCAGATTCTGATATTATTGATCGATTTGGTAGGATATGTAGAAATCTTTCTCATTATCACAGTGGATCCTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTCGGCTCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTGGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTGATTTTA---CCAAGAACC------------------TTTTTTCCTTTACAT------AGGTCATAT------------------------AGAGAA---CGTATTTGGTATTTTGATATTATTCGTATCAATGACTTGGTG----AATCATTT-----------ATGATT--------GGTTATGAAACTCTGT-----------AAAAA-AAATGGAATATAAATGATCTA---TCTATAAATGATCAAG---AGATAAAAAAAAAA-------------TTCATTC-----ATTTTTTTAATTCTGAAATGCTCATA-----GTGGTTGAATCAATTACGTA----GTCAAGTTTATTAGA----CTTTCTTTTC------GGGATCT-----AGGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAAATGCAAGCACGGTGGAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATT---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GCAAAAAAGGAGGTTTATATATATAATATAAAAAATATAAAAACTAGA----------------------------------------------------------------------------------------CTAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA-----ATGAATGGAGTTG--------------------ACTGCGTTGCGTTGGTAACTGGAATTATTCCTT-ATAT----------CAAAATTACA----------------GAAAGGGTG-----ACCCT-----------ACATAC-----CTAATA-------------------CGTACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATTAC--GA------CCTGAATCCATAATTTATATTTATTTGTAAATTATA--TTATATAAATATTAAATAATAATAATAAATAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATATATTTATAAATATATAA-ATTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCCAATCC----AA-ATT------AAAG-----------GAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CGAAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTTGAAATCGTGGGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTTACTTCCTAAGTATAAGTATTTTTCCTCTT-----TTTGCGTCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTCACTC----TACTATTTCACAAA------CGGATCCGCGCAG----------TTT-----GTGTCT---------TATCCCAAGTTTTT------GTACGATACACGTACAAA-----------TAAACAT------------------ATATGGGC------AAGGAATCCCCATTATTGAAT-----TATTCACAG--CACAGTCCATATTTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGG-CATAAACATAAGT---CCTCT-------AGTAGGATAA--------------CA-CATGGGGAATGG-----------------CCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1111111?11101?00010101110100000010???0??0010010101?000000000101?010010101??010??????????10011?101?? Synandrospadix_vermitoxicus_AM905771 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCAATTTTTAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTACCAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATACGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAGC------AAGAGTTTTTATTCTCAA------ATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCTCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACATGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAAAAT------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAACTCTTATGTAATTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAGATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCGATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGAATCCACATAAACCAATTCTCGAATTTTTCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAG------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATTACTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCACGT-----------AAATA-AAATAGAATAGAAA------------CAACAATTCTCAAG---AGAGAAAAAAAAA-------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATC-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTATTTAATTTATATTTATAAATTAAAAATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAAA-TATTATGCAAAATTT-AAGAGTTATTGTGAATTC-----ATTCC------------------------------------AAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTTACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GGGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATAAAAA------------------AAAAAGTCTTCCTTTTTATTTAAATTT------AAGACCCCA-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------CAAATCAAAC---TTTTTCTGTCCTTTTAATAGAACTTTTTCTGTCCTTTTAATAGAACTTTTTCTGTCCTTTTAATAGAACTTTTTCTGTCTTTTTAATAGACATAAAAACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111110001011001100101000010???0??001001?????001???001?01?010000101??0100001101000001?1?001?0 Syngonium_auritum_AM905789 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGTTGGGGAGGACAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTACTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATGTTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAATCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATCAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGAGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGTACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGGACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAGGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTCTCACATTTAAATTGTGTA------TTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAACGAACACATTTCCATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCACATTTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTTTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTAGAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAGCAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTA----AATCATTT-----------ATGATT----CATTAGTCATAAGACCGTGT-----------AAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGA------------------CCCCAATCCATAATTATTATTTATATAATTTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTAAATAAAATATAATAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTTACCTCTTA-----AGGTATTTTTCCTCT------TTTCCGTTGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAAA---------------TATCAAAAAGTCTTCCTTTTTATTT------------AAGACAAAA--AAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC--TTTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAGCACAAGC----CCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001100101000010???0??001001?101?0001??001?01?010000111??010001??1100?001?1?011?0 Taccarum_weddellianum_AM905770 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCCCTTTTTAAAGCACAAGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGGTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCAATATTGCCGAGACAACGGTTTACTCCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAAATAACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTAGATACGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTCGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCGCGGAATTTTCAGGTTATGACAATAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACAAAAATAGATTCGTTGGGCACAAC------AAGAGTTTTTATTCTCAA------ATGATATCAGAGGTTTTTGCTGTCATTGTGGAAATTCCTTTTTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACATGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAAAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAACTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGAATCCACATAAACCAATTCTCGAATTTTGCTTTCTACTTTCTGGGTTATCTTTCAAATGTACCAATAAAG------CCTTCGGCGGTAAAGAGTCAAATGCTAGAGAATGACTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATCGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTATAGTGGGTCCTCAAAAAAGCAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGCAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTCCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCA------------------------CATTGGTCATGAGACCACGT-----------AAATG-AAATAGAATAGAAA------------CAACAATTTTCAAG----GAGAAAAAAAAA-------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTACATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCGCGTATATATA---------------------------------CTAACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTTTTATTTAATTTATATTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAAATTCAAAA-TATTATGAAAAATTT-AAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAA----------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------TCCATTTGACTTCCT------AAGTATTTTTTCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTACATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACGCTTAT---ATAAATATAAA--------------------AAAAAGTCTTCCTTTTTATTTAAATTT------AAGACCCCC-AAAATTCCAGGA-----ATTAGGTAAGGGTTTT-----------CAAATCAAAC---TTTTTCTGTCTTTTT----------------------------------------------------------------TTTTTAATAGACATAAAAACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011110111110001011001100101000010???0??001001?101?001???001?01?010000101??0100001101000001?1?001?0 Tofieldia_pusilla_AJ286562 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAGGGACGATGCTACCACATCGAGACTGTTGTTGGGGAGGAAAATCAGTATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTTTTTGGGTTCAAAGCTCTACGAGCTCTACGTTTGGAGGATCTGCGAATTCCTCCTTCTTATTCCAAAACTTTCCAAGGCCCGCCCCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAATATGGCCGTCCCCTATTGGGATGTACTATTAAACCAAAATTAGGATTATCCGCAAAAAACTACGGTAGGGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCGCAGGCCGAAACAGGTGAAATCAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGCTAAAAAGGGCCATATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGTCTCATTATTGCCGAGACAACGGCCTTCTTCTGCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCAAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCCGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACCTTGGGTTTTGTTGATTTACTACGTGATGATTTGATTGAAAAAGACCGAAGTCGAGGTATTTTTTTCACTCAAGATTGGGTTTCTATGCCGGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCACATGCCTGCCCTAACTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGCCCCGAACTGGCGGCTGCTTGTGAGGTATGGAAGGAAATCAAATTCGAGTTCGAACCAGTGGATAAGATAGATATGGAAGAATTAAAAGGATATTTA------GAAAAATATAGATCTCGGCAACAACGCTTCTTATATCCGTTACTCTTTCAGGAGTATATTTATACACTTGCTCATGATCAT------GGTTTA---------AATGAATCGG------TTTTTCACGAACCCATGGAAATTTTAGGTTATGACAATAAATTCAGTTCAGTACTTGTGAAACGTTTAATTAATCGAATGTCTCAACAGAATTATTTGATTCATTCGGTTAAT------TATTTTAACCAAAATCGATTTGTTGTGCTCAACATCAACAAGAATTTGTATTCTCAA------ATAATATCAGAGGTTTTTGCAGTCGTTTTGGAAATTCCTTTCTCATCGCGATTGGTGTCTTTCCTTGAAGAAAAAAAAGAA---ATACCAAAATCAAAGAATTTACGATCCATTCATTCAATATTTTCTTTTTTAGAGGACAAATTATTACATTTAAATTATGTG------TCAGATATATTAATACCCCATCCCATCCATCTTGAAATATTGGTTCAAATTCTACAATGTCGGATACAAGATGTTCCCTCTTTACATTTATTGCGATTTTTTCTCCACGAATATCATAATTGGAATAGTCTAATTACTCCA---------AAGAAA------TCTATTTCT---CCTTTTTTAAAAGAGAATCAAAGACTCTTTCGGTTCCT------ATATAATTCTTATGTATCTGAATATGAATCCGTATTCGTTTTTTTTCGTAAACAATCC---TCTTATTTACGAGCAACATCTTCTGGAGCCTTTCTTGAGCGAACACATTTCTATGGAAAGATAGAG------CATCTTATAGTAGTTTGTCGTAATGGTTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCGAGGAAAATCAATTCTAGCTTCAAAGGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACCTTGTCAATTTTTGGCAATGTAATTTTTACTTTTGGTCTCAACCATATAGGATCCATATAAAGCAATTCTCGAATTATTCCTTCTATTTTCTGGGCTATATTTCTAGTATACTAATAAAG------CCTTCAGCTGTAAGGAGTCAAATGCTAGATAATTCATTTCTAATGGATACTGTT------ACTAAAAAATTCGATACTATAGTCCCAATTTTTCCTCTGATTGGAGCATTGTGCAAAGCGAAATTTTGTAACGTATCAGGGCATCCCATTAGTAAGCCGATCTGGGCAGATTTGTCAGATTCTGATATTATTGATCGATTTAGTCGAATATGTAAAAATCTTTCTCATTATCACAGCGGATCCTCAAAAAAACAGAGTTTATATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAATACAGTACGTGCTTTTTTTAAAAAATTAGGTTCTGGGTTTTTAGAAGAATTCTTTACGGAAGAAAAAAAAGTGCTTTCTTTGATCTTA---CCAAGAATT------------------TCTTTTTCTTCACAT------AGGTTAGAT------------------------AGAGAA---CGTATTTGGTATTTGGATATTATTCGTATCAATGACTTGGTG----AATCATTC-----------ATGATT--------GGTTATGAGACCATGG---------------------AAAGCGGAAATGGTC-------------TGATCAAT---AGAGAAAAAATAAA------------TTGCATTT-----ATTT---GCATTTTGAAATGC{GT}GATGCAGTAGTGATTGAATCAATTGAGTA----TTTAA-TTTCTTAAA----CTTTCTT????????????????????????????????????????????????????????????????????????????TGGCT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATT---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------TATAAAAC-----CTTGTTTTAT----------------AAAACTAGAA---------------------------------------------------------------------------------------TAAAAAAG---GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ACTGCGTTGCATTGGTAGTCGGAATCCTCCTAT-------------------ATTATG----------------GAAAGGATA--------GG-----------ATA-GC-----CTTATA-------------------TAT--GTATACATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCGAATCCATAATTTAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAAATTCTA---GGAAATGCAAAATTT-CAGAGTTATTTGGAATCC-----ATTCTAATCC----AA-GTTGA--TTGAAG-----------GAAGAATCGAATATTCAGTGATAAAACCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAA-------------------------------------------------------------TGATGAATCGGACAAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAG----------TCCATTTTACTTGCT------AAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT-AACAA-------------------------------------TTATGGGC------AAGGAATCTCCGTTATTGAAT------------CATTCACAGTCCATATCATT----------------ACCCTTCCATTTACAA--ACATTTACAAACATTTCGAAATACAAG----GAAAGTCTTCTTTTT----------------AAAGATCCAA-GAAATTCCATAAACTAAGTTAGGTAAGATTTTTG---------------ACTAC---TTTTTTAGTCCTTTG---------------------------------------------------------------------AATTGACATAAACACAAGT---CCTCC-------AGTAGTATAA--------------TA-CGTGGAGAATAG-----------------TCGGG-----------------------------------ATAGCTCATTTGGTAGAGCAGAGGACTGAAAATCCTC???????1111111?11101?00011001???1010000?0???0??00?00101000001????0?????????????1??1?0100010000100011?10100 Triglochin_maritimum_U80714 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCGGAAGAAGCAGGGGCTGCAGTGGCTGCCGAATCTTCTACTGGTACATGGACAACCGTGTGGACTGATGGACTTACTAGCTTGGATCGTTACAAAGGACGATGCTATCACATCGAGCCCGTTGTTGGGGAGGAAGATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCTCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATATCAAAACTTTCCAAGGTCCACCCCATGGAATCCAGGTTGAGAGAGATAAATTAAACAAATATGGTCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCACAACCATTTATGCGCTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCTCTTTATAAAGCGCAAACCGAAACAGGTGAAATTAAAGGACATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGCTAAAAAGAGCTCAATTTGCCAGGGAATTGGGAGTTCCTATCGTAATGCATGACTACCTAACGGGTGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGCCGAGACAATGGCTTACTTCTTCACATTCACCGCGCAATGCATGCGGTTATTGATAGACAGAAGAATCATGGGATGCATTTTCGTGTACTAGCTAAAGCATTACGCATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTAGAAGGTGAGCGTGAGATTACTTTGGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGCCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTCTGCCTGTGGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACTGAGATTTTTGGGGATGATTCCGTACTACAGTTTGGC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AACTCTGCG------TCGGAGATACTAATACCCTATCCCATTCATCTCGAAATATTGGTTCAAATTTTACAATCTTGGATACAAGATGTTTCTCTTTTGCATTTATTGCGACTTTTTTTCTACGAATATCATAATTGGAATAGTCCTATTATTTTA---------AGAAAA------TCCATTTAT---ATCTTTTC?AAAGAGAATCAAAGATTATTCCAGTTACT------ATATAATTCTTATGTATCTGAATATGAATCAGTATTTTGTTTTCTCCGTAAACAGTCT---TCTTATTTACTACCAACATCTTTTGGAGACTTTATGGAGCGAACATCCTTCTATGGAAAAATGGGA------CATCTTGCAGTAGTTTTTCGTAATGATTTTCAGAAAACCTTACGATTACTCAATGATTCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGAACTCATTTTCTTATGAAGAAATGGCAATATTACCTTGTTAATTTTTGGCAATGGAATTTTTCTTTTTGGTCTCAACCATCAAGAATTTATACAAACCAATTGTCAAATAACTCCTTCTATTTTATGGGTTATCTTTTAAGCGTATTAAGGAAT------CCTTTGACAGTAAGGAGTCAAATGCTCGAGGATTCTTTTTTAATAGACATTATT------AGTAAAAAATTCGACACTATAGTTCCAATTATGCCTCTCATTGGATCATTATCTAAAGCGAAATTTTGTAATGTGTACGGGCGTCCCATTAGTAAGCCTATTTGGGCCGATTTATCGGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATCACAGTGGATCCTCAAAAAAACAGAGTTTGTATCGAAT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGGAT-TGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAATAAAAATGGGCAATCCTGAGCCAAAT-CTTGTTTT---------CTCAAAACAAA----------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ACTGCG-----CCGGTAGA-GGAATCTTTCCGT---------------GGAAACTTTA----------------GAAAGGATA-----AACGC-----------ATCTAT-----TGAATA-------------------C--------------------------------------------------TATATCAAA----------------TGATTAATGTT--GG------CCCGAATCCGTTTTTTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATATGAAAATGAA-AAAATGGAAAAATC---------GGTGTGAATTT-----ATTTC---------AC-GTT------GAGG-----------AAAAAATCGAATATTC----ATCAACTCATTCACTC-----CATAGTCCGATAGATC-----TTTTAAATAAC-------------------------------------------------------------TGATTAATCCGACGAGAATAAAGATAGAGTCCC---------------------------ATTCTACATGCTACATGTCAATACCGGCAACAATGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGAAAA---------CCTATTCGACTTCCT------AAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATTTTTTTT--------------------------------ATTCCAGGGG---GACTGGGTAAGATTTTC------------------ATC---TTTTTTAGTCCCTTT---------------------------------------------------------------------AATTGACATAAACATGGGT---CCTATACTAT--AGTAGAATTA--------------TG-TGCAAAAAGTAG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC????111??????????????????1011010?0??????00100??101?001????0?????????????????????????000?00010110?0? Typhonium_blumei_AM905808 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTCCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTACGTCTAGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTGTTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTATAGGACACCCTTGGGGAAATGCACCAGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAGAGTAGATCTATACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGCACTTGCTCATAATCAT------GGTTTAAATGTA---AATGGGTCAA------TTTTTTATGAACCCCCTGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGCGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ACGATATCAGAGGGTTTTGCTGTCATTATGGAAATTCCTTTCTCATTGCGACTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTATGTGTATCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCTTCTTTACATTTATTACGATTCTTTTTTCAGGAATATTATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCGAAAGATAATCCAAGACTTTTTTTTTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTACGGAATCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACAACATCTCGTAGTGCTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACGTAAGCCAATTCTCAAAATTTTCTTTCCACTTTCTGGGTTATCTTTCAAGTGTCCCCAAAAAT------CCTTTAGCGGTAAAGAGTCAAATGCTAGAGAGTTCTTTTTTTATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCGAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCGGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGTATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGCGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTGCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAATTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGATCATGT-----------AAATG-AAATCGAATAGAAA------------CTCAAATTCTAAAG---AGAGAAAAA-----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGATTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAA-----GTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG???????GAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTTTTT-----GAGAAAAAAA-----------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATA------------------TCATAATTATTATTTATAATTTATATTATTTATATATTTATATTTATATTATTTTTTATATTATTTATATAAAATATAAATAAAAA------------------------------------------------------------------------------------------------------------TAAATAATAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AACATTGAAATTGAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAG???????ATCCCCAAAAAAA-----------CCATTTGACCTCCT------AAGTATTTTTTCTCC------TTTCCGCCGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-TTGTT-----AGGTTATACTTACACTTAT-----AAATATCAAA----------------------AAATCTTCCTTTTTTTTTT-----------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTA----------------AAAAC-----TTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGTCCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010011100101011001101?01000010???0??001001?0000001???001?01?010000111??010001?10100?00001?001?0 Typhonodorum_lindleyanum_AM905814 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGCCGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGAGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAACCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATACGAACCAGTAGATAAGCTAGATATGGAAGAATTAAAGGGATATTTA------GAAAAAAGTAGATCTAAACAACAAAACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------ATTTTTATGAACCCGCAGAAATTTCAGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTTTTTGATCAATTCTGTTAAT------GATTCTAAACAAAATGGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ACGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCATTGCGATTAGTATCTTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TCAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCTAAGACTATTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAA---CATTTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CTCAAATTCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATAATATAATTATAATATAAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATTAATAATTTAAAAATTTTATGAAAAAATA-AAGAGTTATTGCGAATCC-----ATTCT------------------------------------AAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAA----------------------------------------------------------TGATTAATCAGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAA-----------TCCATTTTATCTCCTAAGTT-AAGTATTTTTCCTCT------TTTCCGTCGA----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGCTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAAAT------------------ATATGTAC------AAAGACTCTCAAGTATTGAAT-----TTTTCAATATTCACAATCTATATTGTA-TTGTT-----AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTTT-------------AAGACCAAA-AAAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------TAAAC-----CCTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAACACAAGCAAGCCCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011010111100101011001100??1000010???0??000001?????000001001?01?010000111??010001?00100?00001?001?0 Ulearum_sagittatum_AM905794 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGGACTGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAA{CG}CCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTATGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCATTTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAACGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACAGCAAATACTAGTTTAGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATCGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGAGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAATACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTATGTACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCGGGTTATGACAAAAAATTTAGCTCATTACCTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATGGATTCGTTGGGCATAAC------AAGAATTTTGATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAATTTGTGTA------TTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTTTGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAGTCC---TCTTATTTACGATCAACATCCTCTGGAACCCTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTTTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTTATTTTCACTTTTGGTCTCAACCCTGTAGGATCTACATAAACCAATTCTCCAATTTTTCTTTACATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCCGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTCTAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCCGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCCTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----TATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATA----------------CAAAAAATCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATTAGAGTTTTAGATGTATACATAGGGAAAGTCGTGTGAAATGAAAGCTGCAAGCTCGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAACTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGATTAATCAC--GA------CCCAAATCCATAATTATTTTATTATATTATTTAAATTATTTAATTATTTTAATTTATTTTATTATTTATAATTTTATTATTTATATATTTTTATTATTTATAATTATTTATATATTTATAATTATTTATATATAATTATATAATTTATAATTTTATAAATATAATTTATAATTTTATTATTTATAATATTTATTATTTATATTTATATAATATTATTTATATAAATAATATATATTAAATATAATAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAAAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CCATTTTACCTCTTAA-TT-AAGTATTTTTTCTCT------TTTCCGTTGG----TGACTCA-----AAA-TTCACTATGTTTTCCACTTACTC----TACTCTTTCACAAA------AAGATCCGAGCTT-----------------------------AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCCCAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTGTTCCTTTTTATTT------------AAGACAAAA--AAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC-TTTTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAGCACAAGT----CCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAG????????????????????????????????????????101101011110010?011001100??1000010???0??001001?101?000011001?01?0?1000111??010001??1100?001?1?001?0 Urospatha_sagittifolia_AM905748 TCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACCCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCTGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCATATCGAAGCTGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTACCGAAGCCCTTTTTAAAGCACAGGCCGAAACTGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCGGGTACGTGTGAAGAAATGATTAAAAGGGCTGTGTGTGCCAGAGAATTAGGAGTCCCTATCGTAATGCACGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAACTGGAGTCCTGAACTAGCCGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAACCAGTGGATAAGCTAGATATGGAAGAATTCAAAGGATATTTA------GAAAAAAGTAGATCTAAACAGCAACATTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTACGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGACCGA------TTTTTTATGATCCCACGGAAATTTCAGGTTATGACAATAAATCTAGTTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGAGAAGTTCTGTTAAT------GATTCCAACCAAAATGGATTCGTTGGACACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTATCGCTGCGATTAGGATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATTTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTAGAGGACAAATTATCACACATAAATTATATA------TCAGATATACCAATACCCTATCCCATCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCTCTCTTTACATTTATTACAATTCTTTTTTCATGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTTTTTTGGTTCCT------ATATAATTCTTATGTAATTGAATGCGAATCCGTATTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTTTGGAACTTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAA------CATCTTGTATTAGTTTGTTGTAATGATTTTAATAAAACCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCCTACCTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTCTAGGATCCGCATAAACCAATTCTCCAATTTTTCTTTCTATTTTCTGGGTTATCTTTCAAGTATACCAATAAGT------ACTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTCCTATGATTGGATCATTGTCAAAAGCTCAATTTTGTAACGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCAATTTGTCAGATTCTGATATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAGAGTTTGTATGGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAGTTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGGATT------------------TCTTATCCTTTACAT------AAGTTATAT------------------------AGAGAAGAACGTATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGTTCATAAGACCGTGT-----------AAATG-ACATAGAATAGAAA------------CCCACATTTTCAAG---AGAGAAAAAAA---------------TGTCAGTC-----GTTC---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGA----CTTTTTTTTC------GGGATTTAATTTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCGT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAACTGGCATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCATATATATATATATATATATATACTGATACTGATATATCAATA-CTGATATATCAAA---CTGATATATCAAACGATTAATTTC--GA------CCCGAATCCATAATTTGAATTTATTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATAAATTCAAAT-TTTTATGAAAAATTT-AAGAGTTATTGTGAATTC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAA---------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATATCGACAACAATGAAATTTATAGTAAGAGGAAAA?????????????????????????????????CCCTCTATCCCCAATAAAAA---------CCCATTCGACTTCCT------AAGTATTTTTCCTCT------TTTCTGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCA-----------TTT-----TTGTTT----------AGCCCAAGTTTTT------GTGCAATACACGTACAAA-----------TGAAGAT----ATATGTATGAAGATATATGTAC------AAAAACTCTCGAATATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCTTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTT--------------------GACCCCT-AAAATTATAGGG-----ATTGGGTAAGGGTTTT----------------CAAAC---TTTGTTTGTCCTTTT---------------------------------------------------------------------AATAGACATAAACACAAGC---CCCCT-------AGTAAGATAG---------GGTAATG-TATGGGAAATTG-----------------TCGGG-----------------------------------GTAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTC???????1011111?11100101011001100101000010???000001001?101?001???001?01?0?01?010001010001?10100?00011?001?0 Wolffia_columbiana_AY034255 TCAAAGCTGGGGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGTCTTACCAGTCTTGATCGTTACAAAGGACGCTGCTACCATATCGAACCTGTTGCTGGAGAGGAAAATCAATATATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAAGATTTGAGAATTCCTCCTGCTTATTCCAAAAGTTTCCAAGGACCACCTCACGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTACTAGGATGTACCATCAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCTGAAGCAATTTATAAAGCACAAGCTGAAACAGGTGAAATTAAAGGGCATTACCTAAATGCTACCGCAGGTACTTGTGAAGAAATGATCAAAAGAGCTGTGTTTGCTAGAGAATTGGGAGTCCCTATTGTTATGCATGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTAGCACATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGGATGTCTGGTGGGGACCATATTCACGCTGGTACCGTAGTAGGTAAGCTGGAAGGTGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACAGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTATCTATGCCTGGTGTTATCCCTGTAGCTTCAGGTGGTATTCATGTTTGGCATATGCCTGCACTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGCGGAACTTTAGGACACCCTTGGGGT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATGGAAGAATTCAAAGGATATTTA------CGAAAAGGTGGATTGAAACAACAACACTTCCTATATCCCCTTCTCTTCAAAGAGTATATTTATGCACTTGCGCATGATCAG------GGTTTAAAT---------GCATCAA------CTTTTAATGAACCCGCTGATATTTCAGGTTATGACAAAAAATATAGCTCATTACTTGTCAAACGGTTAATTAAGAGACTATATCAACAGAATAGCTTGATACGTTCTGTTAAT------AAAGCTAAGCAAACTAGATTCGTCGGACACAAC------AAGAATTTTTATTATCAA------ATGGTATCAGAGGGTTTTGCTATCGTTTTAGAAATTCCCTTGTCCCTACGATTAGTATCTTCGCTCAAAGAAAAAAAAGAA---ATACCGAAATATCAGAATTTACGATCTATTCATTCAATATTTTCTTTTTTAGAGGACAAATTTCCACATTTACATTATGTA------TCAGATATACTGATACCTTATCCGG?CCATCTAGAAAAATTGATTCCAATTTTACAATGCTGGATACATGATGTTCCCACTTTACATTTATTACGATTGTTTTTTCATGACTATCACAATTGGAGTAATTGCATTACTACA---------AATAAA------TCTAGTTAT---GGTTTTTCAAAAGAAAATCCAAGATTATATAGGTTTCT------ATATAATTCTTATGTAGTTGAAGCCGAATCCATATTTGTTTTTCTTCGTAAATTTTCA---TCCTATTTACGATCAACATCTTTTGGACCTCTTCTTGAGCGAACACACTTCTATGGAAAAATGAAA------CATATTGGCGTAACTCGTTGTAATTATTTTCAGAAACCCCTAGGGCTCTTCAAGGATCCTATGATGCATTATGTTAGGTATCAATCAAAAGTTCTTATCGCTTCAAGGGGGACTCATCTTCTTTTGAAGAAATGGAAATCTTACTTTATGAATTTATGGCAATGTCATTTTGACTTTTGGTCTGAACCCAGTAGGATACACATAAACCAATTTCCAAAATTTTCTTTCTATTTTTTGGGTTATCTTTCAAGTATAGAAATGACT------CCTTCATCCATAAAAAGTCAAATGCTCGAGAATGCTTTTTTAATAGATACTGTT------ACTCCCAAATTTCAAACTATCATAGCCATTATTCCGATCATTGAGTCATTGGCCAGAGCTAGATTTTGTAATCTATCGGGGAATCCTATTAGCAAGCCAGTTTGGACCGATTTGTCAGATTCTGAGATTATTGATCGATTTGGTAGACTATGTCGAAATCTTTCACATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTAGACTTTCATGTGCTCGAACTTTGGCGCGGAAACACAAAACGACAGTGCGCACTTTTTTGCAAAGATTAGGTTCAGAGTTTTTTGAAGAATTCTTTATGGAAGAAGAAAAAGTTCTTTCTTTAATGTTA---TCAAGAACT------------------TCTTATCCTTTACAT------CAGTTATAT------------------------AGAGAA---CCTATTTGGTTTTTGGATATTATTCGTCTAAATGACTTGGTG----AATCATTT-----------ATGATT----AAGTTGTGATAA----GTGT-----------AAATC-AAATAGAACCCAAAAG----------TCT---TCCATACA------C-----------------------GTTA-TC-----ACCT---TTATACTGAAATGCTCATATAGTAGTGGTTGAATCAACTGAGTT----GTCAGGTTTCTTACA----CTTTCTTTTC------GGGATCTAATCTAAATTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATT---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGATGTTCT-----AACGA---------ATGGAGTTG---------------AGTGTATTGCGTTGGGTTGGTATG-----TTATTTTGA-CTAT----------CTAA----------------------GAAAGAGT------AACCC----------TCTCTAC-----TAAATA-------------------CACACGTATATATATA-------------------------------CTGACATTTCAAC----------------TAAGTAATCAG--GA------CCCGAATCCAGAATATTCATTTATATATTTATATAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAATGACAAATTTTCTAA-TTTCAG-----ATTT-AAGAGTTATTCTGAATTC-----ATTCC---------AA-ATT------CAAC----ATTCAACTAATAGTTGAATATTCAGTAATCAAATCATTCACTC-----CACAGTCTGATTTATTGGTTTTTTTGAAAAAAAAA---------------------------------------------------------------AATTGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATGCTGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGGAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CGATTTGACTTCCT------TAGTATTTTTCCTCT------TTTTGATCGG----TGACCCA-----AAA-TTCACTCTCTTTTACACATTGAC--TCTACTGCTTCACTAA------AAGATCCGAGCAT----------TTT-----TTGTTT----------AGCCCAAGTTTTT------GTGTA---TACGTACAAA-----------TGAATAT------------------ATATGGAC------AACGA-----GACTATTGAAGTGACTTATTTACTATTCAAAATATCT-----------------AGGCTATTCTTCCACTTAT------ACTATCAACCTT--------------------GAAATTCCTGTTTAAGTT-----------AAGACCAAAA--------------------AAGTCA------------------AAAAAAAAAC-GTTTTAACCGCCTATTCTTTTTTTTCTTGTTATTGT--------------------------------------------------AATGAACACAAACAGAAGT---ACTGGA---TGGAGTAAGATAA---------GGTAATG-CATGTCAAATAG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC1011111?1110010001100110010100?011???01?001011?101?001???001?01?0101?0101??00000??00?00?00010000101 Wolffiella_oblonga_AY034242 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATGAGACAAAAGATACGGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCGGAATCTTCTACGGGTACATGGACAACTGTGTGGACTGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAGGAAAATCAATTTATTGCTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCACCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTAGGATGTACCATCAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCTGAAGCAATTTATAAATCACAAGCTGAAACTGGTGAAATTAAAGGGCATTACCTAAATGCTACCGCAGCTACTTGTGAAGAAATGATCAAAAGAGCTGTGTTTGCTAGAGAATTGGGAGTCCCTATTGTTATGCATGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTAGCCTTTTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAGAAAAACCATGGTATCCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGACCATATTCACTCTGGTACCGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACAGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCAGGTGGTATTCATGTTTGGCATATGCCTGCACTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGCGGAACTTTAGGACACCCTTGGGGTAATGCACCTGGTGCAGTAGCTAACCGTGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTTGCAAATGGAGTCCTGAATTAGCTGCTGCT??????????????????????????????????????????????????????ATGGAAGAATTCAAAGGATATTTA------GAAAAGGGTGGATTTAAACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTATGCACTTGCTTATGATCAG------GGTTTAAATGTA---AATGCATCAA------CTTTTAATGAACCCGTTGAAATTTCAGGTTATGACAAAAAATATAGCTCATTACTTGTCAAAAGGTTAATTAAGAGACTATACCAACAGAATAGCTTGATACATTCTGTTAAT------AATGCTAAACAAAATAGATTTGTCGGACACAAC------AAGAACTTTTATTATCAA------ATGATATCAGAGGGTTTTTCTATCGTTGTAGAAATTCCCTTTTCACTTCGATTAATATCTTCACTAAAAGAAAAAAAAGAA---ATACCGAAATATCAGAATTTACGATCTATTCATTCAATATTTTCATTTTTAGAGGATAAATTTGCACATTTAAATTATATA------TCAGATATACTGATACCTTATCCAGTCCATCTAGAAAAATTGATTCAAATTCTACAATGCTGGATACAGGATGTTCCCACCTTACATTTATTACGATTGTTTTTTCATGACTATCACAATTGGAGTAATGACATTACTACA---------AATAAA------TCGACTTAT---GGTTTTTCAAAAGATAATGCAAGACTCTATAGGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTTCGCAAATCATCA---TCCTATTTACAATCAACATCTTTTGGACCCCTTCTTGAGCGAACACACTTCTATGGAAAAATGAAA------GATATTGGAATAATTTCTTGTAATGATTTTCAGAAACCCCTAGGGTTATTCAAGGATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATCTATTATCGCTTCAAGAGGGACTGATCTTCTTTTGAAGAAATGGAAATCTTACTTTCTAAATTTATGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATACACATAAACGAATTTGCACATTTTTCTTTCTATTTTTTGGGTTATCTTTCAAGTGTACAAATGAAT------CCTTCTTCCATGAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTCCAAAATTTCAAACTCTGATAGCAATTATTCCGATGATTGGGTCATTGGCCAGAGCTAAATTTTGTAATCTATCGGGTAATCCTATTAGCAAGCCAGTTTGGACCGATTTGTCAGATTCTGAGATTATTGATCGATTTGGTAGACTATGTCGAAACATTTCACATTATTACAGTGGGTCTTCAAAAAAACAGAGTTTGTACCGAATAAAGTATATACTTAGACTTTCATGTGCTCGAACTTTGGCGCGGAAACATAAAACGACAGTACGCACTTTTTTGCAAAGATTAGGGTCAGAGTTTTTCGAAGAATTCTTTATGGAAGAGGAAAAAGTTCTTTCTTTAATGTTA---GCAAGAACT------------------TCTTATCCTTTACAT------CAGTTATAT------------------------AGAGAA---CCCATTTGGTATTTGGATATTATTCGCATCAATGACTTGGTG----AATCATTT-----------ATGATT----CAGTTGTGATAAACCTGTGT-----------AAATC-AACTAGAATAAAAA-------------AAAAATTCTCACAT--AAACATAAAAAAAAAA----------GGGTAATC-----ACCT---TTATACTGAAATGCTCATACAGGAGTGGTTGAATCAACTGAGTC----GTCAGGTTTCTTACA----CTTTCTTTTC------GGGATCTAATCTAAATTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGATAGGTGCAGAGACTCAATGGAAGATATTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTATCTGGAATTATTCTTT-CTAT----------CTAA----------------------GAAAGGGTA-----ACCCT-----------CTAGAC-----CAAACA-------------------CACACATATATATA---------------------------------CTGACATTTGAAC----------------TGATGAATCAA--GATCAGGACCCGAATCCAGAATATTAATTCCTATATTTAATATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTATTCTATTAATATAGAAATTAAACTCAAAAATTTTCTAA-TTTCAG-----ATTT-CAGAATTATTCTGAATTC-----ATTCC---------AA-ATT------CAAG-----------TAATAGTGGAATATTCTGTAATCAAATCATTCACTC-----CAGAGTCTGATTTCTT------------------------------GTTATTATTAACTTTTCTTGTTATTATTAAC----------------TAATAAATTGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------ACTACTGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAAA-----------CGATTTGAATTCCT------AAGTATTTTTCCGCT------TTTTCATCGG----TGACTCA-----AAA-TTCACGATATTTTACATTTACTC----TACTCCTTCACTAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTTTTT----GTCTAATATACGTACAAA-----------T-------------------------------C------TTATATTCTCGAATAGTGAAATAACCTATTCACTATTAACAATCTCTAATGTT-----------AGGTTATCTTTCCAATTAT------AATATAAATCTT--------------------GAAATTCCTGGT----------------AACGC----------------------------GTA-----TTC------------------------TTTTTTTGTCCTGTTATTTT----------------------------------------------------------------AATGAACACAAACAGAAGT---ACTGGA-----GAGTAAGATAA---------GGTGATG-CATGTCAAATAG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTC??1011111?1110010?011001100??1000011???0??001011?101?0?1???001?01?0101?000???00000?????00?00010000101 Xanthosoma_helleborifolium_AM905790 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAACTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTGCTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATTTGGAAAGCGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGATATGGAAGAATTAAAAGGATTTTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGTACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTTGGGTTATGACAAAAATTTGAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATAGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCATCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TTAGATATACTAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATTTGATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTCTTTTTGTTCCT------ATATAATTCTTATGTGGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCCTTCTTGAGCGAACACATTTCCATGAAAAAATAGAACAA---CATCTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGCTTAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAATTTTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTCGAGAATTCTTTTTTAACAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGGTTGGATCATTGTCAAAAGCGAAATTTTGTAACGTATCGGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTTTGGTCGGATATGTAGAAATCTTTCTCATTATTATAGCGGGTCTTCAAAAAAACAAAGTTTGTATCGAATAAAGTATATACTTCGACTTTCGTGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTCTTATCCTTTCATAAGGTTATAT------AGAGAG---CGCATTTGGTATTTGGATATTATTGGTATAAATGACTTGGTG----GCTCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGGATAGAAA------------CAAAAATTCTCAAG---AGAGAGAAGAA---------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGATAGTCGTGTGCAATGGGGACTTTTCAAAGGG?GCATCTGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA----------------CGA------------------CCCCAATCCATAATTATTATTTATATTATTTATAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATAAAATATAATAAATTCAAAA-TTTTATGAAAAATTA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAA--------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAA------------CTATTTTACCTCTTA-----AGGTATTTTTCCTCT------TTTCCGTTGG----TGACTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------TTT-----ATGTTT-----AGTTTAGCACAAGTTTTT------GTGCAATACACGTACAA-------------GAAGAT------------------ATATGTAC------AAAGACTCTCGAGTATTGAAT-----TTTTCACTATTCACAATCTATATTGTT-----------AGTTTATCCTTACACTTAT-----AAATATCAAA---------------TATCAAAAAGTCTTCCTTTTTATTT------------AAGACAAAA--AAATTTCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC--TTTTTTTTGTCCTTTT---------------------------------------------------------------------AATGGACATAAGCACAAGC----CCCT-------AGTAAGATAA---------GGCAATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAAAA????????????1011010110100101011001100001000010???0??001001?101?0001??001?01?010000111??010001??1100?001?1?011?0 Zamioculcas_zamiifolia_AM905778 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGATAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTGACTTCTATTGTGGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTTTACTTCTTCACATCCATCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGCATGTCTGGTGGGGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGGGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCGGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAGTTCGAACCAGTAGATACGCTAGATATGGAAGAATTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCACTTCTCTTTCAAGAGTATATTTACACACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGACCCA------TTTTTTATGAACCCACGGAATTTTCAGGTTATGACAATAAATCTAGCTCATTACTTGTGAAACGTTTAATTATTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTATGTA------TCAGATATACTAATCCCCTATCCCGTCCATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAGAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAGTCCATATTAGTGTTTCTCCGTAAACAATCC---TCTTATTTACGATTAACATCTTCTGGAACCTTTATTGAGCGAACACTTTTCTATGAAAAAATAGAACAA---CATCTTGTAGTCGTTTGTTGTAATGATTTTCGGAAAACCCTATGGTTGCTTAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTAATTTTCGCTTTTGGTCTCAACCCTGTAGGATCCGCATAAACCAATTCTCAAAAATTTCTTTCTATATTTTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAACGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTGGAAACTCTAGTTCCAATTATTCCAATGATTGGATCATTGTCAAAAGCTAAATTTTGTAATGTATCGGGGAATCCTATTAGTAAGCCAGTTTGGGCCGATTTGTCAGATTCTGGTATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCACAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGGTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TATTATCCTTTACATATACATAAGTTATAT------------------------AGAGAA---CGTATTTGGTATTTTGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CATTGGTCATGAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CCAAAATTTTCAAG---AGAGAAAAAAAAAA------------TGTCAGTC-----ATTT---TCATTCTGAAATGCTCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTTTTAGACA--CTTTCTTTTT------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGG?GCAT-TGAGCCTTGGTATGGAAACCCACCAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAA-------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTATTT-CTAT----------ATAAATTACA------------TACAGAAAAGATA-----ATCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA-----------TCAAACGATTAATCAC--GA------CCCGAATCCATAATTTTTATTTCTATAATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATAAATAAAAAAGACATATTTTATATAAAAA-TTTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATTGA----GAAG-----------TAAGAATCGAATATTCAGTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAA-------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTTTTTCACAAA------AAGATCCGAGCAT----------TTT-----ATGTTT----------AGCCCAAGTTTT-------GTGCAATACACGGACAAA-----------TGAAGAT------------------ATATGTAC------AAAGACTTTCGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGTTATCCTTACACTTAT-----AAATATCAAA----------------------AAGTCTTCCTTTTTTTTTTTTATTT-----AAGACCCCCTAAAATTCCAGGG-----ATTAGGTAAGGGTTTT----------------AAAAC---TTTTTTTGTCCCTTT---------------------------------------------------------------------AATGGACATAAACACAAGC---CCCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGAGGACTGAA??????????????10111101011001010110001001010000100100?1001001?1001001???001?01?0101?1?01??010001?00100?00011?001?0 Zantedeschia_albomaculata_AM905762 TCAAGGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACGGATGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAAGAAAATCAATATATTGCTTATGTAGCCTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATCGTGGGTAATGTCTTTGGGTTTAAAGCTTTACGAGCTCTACGTTTGGAGGATTTGCGAATTCCTCCCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTGGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATAAAAGGACATTACTTGAATGCTACTGCAGGTACGTGCGAAGAAATGATAAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACGGGGGGATTCACGGCAAATACTAGTTTAGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTTCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGCGATGATTATATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTCTCCATGCCAGGTGTTCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACTGAGATCTTTGGGGATGATTCTGTACTACAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTAGCTTTAGAAGCGTGTGTAAAGGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAAGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTACTGAACTAGCAGCTGCTTGTGAGGTTTGGAAAGAGATAAAATTCGAATTCGAACCAGTAGATAAGATAGATATCGAAGAATTAAAAGGATATTTA------GAAAAAAGTCAATCTAAACAACAACACTTCCTATATCCGCTACTCTTTCAAGAGTATATTTATGCACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGG---------GTTATGGCAATAAATTTAGCTTATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTTTTTGATAAATTCTGTTAAT------GATTCTAATCAAAATAGATTCGTTGGGCACAAC------AAGAATTTTGATTCTCAA------ATGATATCAGAGGGTTTTGCTGTCATTGTGGAAATTCCTTTCTCGCTGCGATTAGTATCCTCCCTCGAGGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTCTCACATTTAAATTATGTA------TCAGATATACTAATACCCTATCCTGTCCATCTAAAAATCTTGGTTCAAATTTTACAATGCTGGATACAAGACATTCCTTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTCATTACTCCA---------AAAAAA------TCTAGTTAT---GGTTTTTCAAAAGAGAATCCAAGACTATTTCGGTTTCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATACTAGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCCGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACAACATCTTGTAGTACTTTGTTGTAATGATTTTCAGAAAATCCTATGGTTGTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCCGTAGGATCCACATAAACCAATTCTCAAAATTTTCTTTCTATTTTCTGGGTTATCTTTCAAATGTACCAATAAAC------CCTTCAGCAGTAAAGAGTCAAATGCTAGAGAATTCCTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTGTTCCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAATGTATTAGGGAATCCTATTAGTAAGCCAATTTGGGCTGATTTGTTAGATTCTGACATTATTGATCGATTTGGTCGGATATGTAGAAATCTTTCTCATTATTACAGCGGGTCTTCAAAAAAACAGAGTTTGTATCGAATAAAGTATATACTTCGACTTTCATGTGCTAGAACTTTGGCCCGTAAACATAAAAGTACGGTACGCACTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTCTTTACGGAAGAAGAAAAAGTTATTTCTTTAGCTTTA---CCAAGAATT------------------TCTTATCCCTTACAT------AAGTTATAT------------------------AGAGAA---CGCATTTGGTATTTGGATATTATTCGTATAAATGACTTGGTG----AATCATTT-----------ATGATT----CGTTGGTCATGATACTATGT-----------AAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAA----------------TTTCAGTC-----ATTT---TCATTCTGAAATGCTCATGTAGTAATGGTTGAATCAACTAAATA----CTCAAGTTTCTTAGA----CTTTCTTTTG------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAG?????TGCAT-TGAGCCTTGGTATGGAAACCTATTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTTGTTTT----GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCT-----AACGA---------ATGGAGTTG--------------------ATTGCATTGCGTTGGTAGCTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAGGATA-------------------------AC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGACATATCAAA------------CAA-CGATTAATCACACGA------CCCAAATCCT-----TTTATTTATATAATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAAATTCAAAA-ATTTATGAAAAATTT-AAGAGTTATTGTGAATCC-----ATTCC---------AA-ATT------GAAG-----------TAAGAGTCGAATACTCATTGATCAAATCATTCACTC-----CAGAGTCTGATTGATC-----TTTTGAAAAAAAAAAAAAA-----------------------------------------------------TAATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATGTC-------AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAA---------CCCATTTGACTTCCT------AAGTATTTTTCCTCT------TTTCCGTTGG----TGGCTCA-----AAA-TTCACTATGTTTTCCATTTACTC----TACTCTTTCACAAA------AAGATCCGAGCGT----------CTT-----ATGTTT-----AGTTTAGCCCAAGTTTTT------GGGCAATACACGTACAAA-----------TGAAGAT------------------ATGTGTA------------CTCTAGAGTATTGAAT-----TATTCACTATTCACAATCTATATTGTT-----------AGGCAATCCTAACACTTAT-----AAATATCAAA-----------------------AGTCTTCCTTTTTATTTTA-TTT------TAGACTCCC-AAAATTCCAAGG-----ATTTG-TAAAGGTTTT----------------CAAAC---TTTTTTTGTCC----------------------------------------------------------------------------GGACATAGACACAAGC----CCCT-------AGTAAGATAA---------GGCGATG-CATGGAAAATGG-----------------TCGGG-----------------------------------ATAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCTCGTGTCAC1011110011100101011001100101000010???0??001001?101?001???001?01?010000101??010001?10100?001?1?00??0 Zomicarpella_amazonica_AM905796 TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGCGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGTTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACGAGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTACGGTCGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATCAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGTGAACGTGATATTACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCCCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGCGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCAAATCGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTTTGGAAAGCGATCAAATTCGAATTCGAAGCAGTAGATAAGCTAGAT?????????TTAAAAGGATATTTA------GAAAAAAGTAGATCTAAACAACAACACTTCCTATATCCGCTTCTCTTTCAAGAGTATATTTATGTACTTGCTCATGATCAT------GGTTTAAATGTA---AATGGATCAA------TTTTTTATGAACCCGCGGAAATTTCGGGTTATGACAAAAAATTTAGCTCATTACTTGTGAAACGTTTAATTACTCGAATGTACCAACAGAATTATTTGATCAATTCTGTTAAT------GATTCTAACCAAAATGGATTCGTTGGGCATAAC------AAGAATTTTTATTCTCAA------ATGATATCAGAGGGGTTTGCTGTCATTGTGGAAATTCCTTTCTCGTTGCGATTAGTATCCTCCCTCGAAGAAAAAAAAGAA---ATACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCATTTTTTGAGGACAAATTATCACATTTAAATTGTGTA------TTAGATATACAAATACCCTATCCCGTACATCTAGAAATCTTGGTTCAAATTCTACAATGCTGGATACAAGATGTTCCCTCTTTACATTTATTACGATTCTTTTTTCACGAATATCATAATTGGAATAATCTTATTACTCCA---------AAGAAA------TCTAACTATTATGGTTTTTCAAAAGAGAATCCAAGACTATTTATGTTCCT------ATATAATTCTTATGTAGTTGAATGCGAATCCATATTTGTTTTTCTCCGTAAACAATCC---TCTTATTTACGATCAACATCTTCTGGAACCTTTCTTGAGCGAACACATTTACATGAAAAAATAGAACAA---CATTTCGTAGTACTTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGGTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAAGGGACTCGTCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCACTTTTGGTCTCAACCCTGTAGGATCCACATAAACCAATTCTCAAAAATTTCTTTCCATTTTCTGGGTTATCTTTCAAGTGTACCAATAAAT------CCTTCAGCGGTAAAGAGTCAAATGCTAGAGAATTCTTTTTTAATAGATACTGTT------ACTAAAAAATTCGAAACTATAGTTCCAATTATTTCTATGATTGGATCATTGTCAAAAGCTAAATTTTGTAACGTATCAGGGAATCCTATTAGTAAACCAGTTTGGGCCGATTTGTCAGATTCTGATATTATTGATCGGTT???????????????????????????????????????????????????????????????????????????????????GACTTTCGTGTGCTAGAACTTTAGCCCGTAAACATAAAAGTACGGTACGTGCTTTTTTGCAAAGATTAGGTTCAGAATTTTTAGAAGAATTTTTTACGGAAGAAGAAAAAGTTCTTTCTTTAATCTTA---CCAAGAATT------------------TCTTATCCTTTACAT------AAGTTATATAGAGTACATAAGTTATAT------AGAGAA---CGCATTTGGTACTTAGAAATTATTCGTATAAATGACTTGGTA----AATCATTT-----------ATGATT----CATTAGTCATAAGACCATGT-----------AAATG-AAATAGAATAGAAA------------CAAAAATTCTCAAG---AGAGAAAAAA----------------TGTCAGTC-----ATTT---TCATTCTGAAATGCCCATGCAGTAATGGTTGAATCAACTGAGTA----TTCAAGTTTCTTAGA----CTTTCTTTTC------GGGATCTAATCTAAGTTTTAGATGTATACATAGGGAAAGTCGTGTGCAATGAAAACTGCAAGCACGGTGCAT-TGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTCCAAACTCAGAGAAACCCTGGAATA---AAAAATGGGCAATCCTGAGCCAAATCCTTGTTTT---------GAGAAAAAA------------------------------------------------------------------------------------------------------------------------------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCT-----AACAA---------ATGAGGTTG--------------------ATTGCATTGCGTTGGTAACTGGAATTCTTCTTT-CTAT----------CTAAATTACA----------------GAAAAGATA-----ACCCT-----------ATATAC-----CTAATA-------------------CGCACGTATATATA---------------------------------CTGAATACTGACA---------TATCAAACGATTAATCAC--GA------CCCAAATCCATAATTATTATTTATATAATTTATATTAATTTAATTTATATTATTATTTATATAATTTATATATAATTTATATTAATTTATATTTATATAATTTATATAATATTTATATAATTTATATTAAATATAATAATAATATAA-------------------------------------------------------------------------------------------TAATAATAAATTCAAAA-TTTTATGAAAAATGA-AAGAGTTATTGCGAATCC-----ATTCT---------AA-ATT------GAAG-----------TAAGAGTCGA-----CAGTGATCAAATCATTCACTC-----CAAA-TCTGATTGATC-----TTTTGAAAAAAAAAAAAA------------------------------------------------------TGATTAATCGGACGAGAATAAAGAGAGAGTCCC---------------------------ATTCTACATG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????1011010110100101011001100101000010???0?0001001?101?00??????????????0???????????????????????????0??? ; END; BEGIN SETS; CHARSET IndelMatk (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 5323-5333; CHARSET IndelIntron1 (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 5348-5364 5418; CHARSET matK (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 1392-3086; CHARSET Intron1.2 (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 4196-4528; CHARSET Exon3 (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 4529-4578; CHARSET Partexcint (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 3963-4195; CHARSET IndelIntron1.2 (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 5365-5375; CHARSET Intron1.1 (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 3369-3962; CHARSET introntrnK (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 3087-3368; CHARSET Espaciador (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 4579-5278; CHARSET TrnF (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 5279-5322; CHARSET IndelEspaciador (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 5376-5417 5419-5421; CHARSET IndelTrnK (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 5334-5347; CHARSET rbcL (CHARACTERS = 'rbcL, matK-trnK, trnL-trnF and indels') = 1-1391; END; BEGIN TREES; TITLE Tb9095; LINK TAXA = Taxa1; TRANSLATE 1 Magnolia_umbrella_AF206791, 2 Piper_betle_L12660, 3 Hedyosmum_mexicanum_AM905824, 4 Acorus_calamus_M91625, 5 Alisma_plantago_aquatica_L08759, 6 Triglochin_maritimum_U80714, 7 Tofieldia_pusilla_AJ286562, 8 Gymnostachys_anceps_AM905727, 9 Lysichiton_americanus_AM905728, 10 Orontium_aquaticum_AM905729, 11 Symplocarpus_foetidus_L10247, 12 Lemna_minor_AM905730, 13 Spirodela_polyrrhiza_AM905731, 14 Landoltia_punctata_AY034223, 15 Wolffiella_oblonga_AY034242, 16 Wolffia_columbiana_AY034255, 17 Pothos_scandens_AM905732, 18 Pedicellarum_paiei_AM905733, 19 Pothoidium_lobbianum_AM905734, 20 Anthurium_acaule_AM905735, 21 Holochlamys_beccarii_AM905736, 22 Spathiphyllum_wallisii_AJ235807, 23 Heteropsis_oblongifolia_AM905737, 24 Stenospermation_ulei_AM905738, 25 Rhodospatha_oblongata_AM905739, 26 Anadendrum_sp._AM905740, 27 Rhaphidophora_crassifolia_AM905741, 28 Scindapsus_hederaceus_AM905742, 29 Monstera_adansonii_AM905743, 30 Alloschemone_occidentalis_AM905744, 31 Amydrium_humile_AM905745, 32 Epipremnum_pinnatum_AM905746, 33 Dracontium_polyphyllum_AM905747, 34 Urospatha_sagittifolia_AM905748, 35 Lasia_spinosa_AM905749, 36 Cyrtosperma_macrotum_AM905750, 37 Pycnospatha_arietina_AM905751, 38 Podolasia_stipitata_AM905752, 39 Anaphyllopsis_americana_AM905753, 40 Dracontioides_desciscens_AM905754, 41 Lasimorpha_senegalensis_AM905755, 42 Anubias_barteri_AM905756, 43 Aglaonema_modestum_AM905757, 44 Aglaodorum_griffithii_AM905758, 45 Nephthytis_afzelii_AM905759, 46 Pseudohydrosme_gabunensis_AM905760, 47 Anchomanes_difformis_AM905761, 48 Zantedeschia_albomaculata_AM905762, 49 Gearum_brasiliense_AM905763, 50 Dieffenbachia_aglaonematifolia_AM905764, 51 Bognera_recondita_AM905765, 52 Mangonia_tweedieana_AM905766, 53 Gorgonidium_sp._AM905767, 54 Asterostigma_pavonii_AM905768, 55 Spathantheum_intermedium_AM905769, 56 Taccarum_weddellianum_AM905770, 57 Synandrospadix_vermitoxicus_AM905771, 58 Spathicarpa_hastifolia_AM905772, 59 Callopsis_volkensii_AM905773, 60 Homalomena_magna_AM905774, 61 Philodendron_deltoideum_AM905775, 62 Stylochaeton_bogneri_AM905776, 63 Gonatopus_angustus_AM905777, 64 Zamioculcas_zamiifolia_AM905778, 65 Cryptocoryne_lingua_AM905779, 66 Lagenandra_ovata_AM905780, 67 Piptospatha_ridleyi_AM905781, 68 Schismatoglottis_trifasciata_AM905782, 69 Phymatarum_borneense_AM905783, 70 Aridarum_nicolsonii_AM905784, 71 Amorphophallus_hottae_AM905785, 72 Pseudodracontium_lacourii_AM905786, 73 Hapaline_benthamiana_AM905787, 74 Caladium_lindenii_AM905788, 75 Syngonium_auritum_AM905789, 76 Xanthosoma_helleborifolium_AM905790, 77 Chlorospatha_sp._AM905791, 78 Jasarum_steyermarkii_AM905792, 79 Scaphispatha_gracilis_AM905793, 80 Ulearum_sagittatum_AM905794, 81 Filarum_manserichense_AM905795, 82 Zomicarpella_amazonica_AM905796, 83 Arisarum_vulgare_AM905797, 84 Ambrosina_bassii_AM905798, 85 Pistia_stratiotes_AM905799, 86 Colocasia_esculenta_AM905800, 87 Steudnera_colocasiifolia_AM905801, 88 Alocasia_odora_AM905802, 89 Remusatia_vivipara_AM905803, 90 Ariopsis_peltata_AM905804, 91 Protarum_sechellarum_AM905805, 92 Arisaema_franchetianum_AM905806, 93 Pinellia_pedatisecta_AM905807, 94 Typhonium_blumei_AM905808, 95 Arum_hygrophilum_AM905809, 96 Biarum_tenuifolium_AM905810, 97 Helicodiceros_muscivorus_AM905811, 98 Dracunculus_vulgaris_AM905812, 99 Eminium_spiculatum_AM905813, 100 Typhonodorum_lindleyanum_AM905814, 101 Peltandra_virginica_AM905815, 102 Culcasia_liberica_AM905816, 103 Cercestis_mirabilis_AM905817, 104 Montrichardia_arborescens_AM905818, 105 Calla_palustris_AM905819, 106 Arophyton_buchetii_AM905820, 107 Carlephyton_glaucophyllum_AM905821, 108 Bucephalandra_motleyana_AM905822, 109 Colletogyne_perrieri_AM905823; TREE Fig._1 = [&R] (1,(2,3),(4,(((5,6),7),((8,((9,11),10)),(((12,(14,(15,16))),13),((((17,(18,19)),20),((21,22),(26,27,(28,(29,(31,32)))),((23,(25,30)),24))),((((33,40,39),(35,36,38,41,37)),34),(((42,((((((43,44),(45,(46,47))),(48,(49,((56,58),57),(52,((53,55),54)),50,51))),((60,61),(102,103))),((((71,72),((73,78),((74,75),(((76,77),(79,82)),(80,81))))),(((83,84),((100,(106,(107,109))),101)),((85,91),(((86,89,87),90),(88,((92,93),(94,((((95,98),96),97),99)))))))),104)),59)),(((65,66),((67,((68,69),70)),108)),105)),(62,(63,64)))))))))); END;