#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 11:46 GMT TreeBASE (cc) 1994-2008 Study reference: Accioly T., Cruz R.H., Mendonca N.A., Ishikawa N.K., Hosaka K., Martin M., & Baseia I.G. 2017. Amazonian bird's nest fungi (Basidiomycota): current knowledge and novelties on Cyathus species. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S20804] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=18; TAXLABELS 'Crucibulum laeve SWFC21261_DQ463357' 'Cyathus africanus SWFC20782_DQ463340' 'Cyathus africanus var latisporus SWFC21187_DQ463342' Cyathus_albinus Cyathus_amazonicus_AB7806 'Cyathus annulatus DAOM200366_DQ463351' 'Cyathus gansuensis SWFC20880_DQ463348' 'Cyathus jiayuguanensis SWFC20846_DQ463341' Cyathus_limbatus_AmBR 'Cyathus olla BPI727227_DQ463345' 'Cyathus pallidus SWFC21160_DQ463356' 'Cyathus renweii SWFC201406_DQ463352' 'Cyathus setosus DAOM200815_DQ463349' 'Cyathus sp Cabo_Verde_MPM3246Inf' 'Cyathus stercoreus Brazil_UFRN1200' 'Cyathus stercoreus SWFC21386_DQ463354' 'Cyathus subiglobisporus EF613554_THAI' 'Nidula niveotomentosa SWFC3000_DQ463358' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=38; TAXLABELS 'Crucibulum laeve SWFC21261_DQ463357' 'Cyathus africanus DAOM200370_DQ463347' 'Cyathus africanus L38_JX103204' 'Cyathus africanus SWFC20782_DQ463340' 'Cyathus africanus var latisporus SWFC21187_DQ463342' Cyathus_albinus Cyathus_amazonicus Cyathus_amazonicus_AB7806 'Cyathus annulatus DAOM200366_DQ463351' 'Cyathus berkeleyanus SWFC20789_DQ463355' 'Cyathus colensoi DAOM200423_DQ463344' 'Cyathus crassimurus DAOM200372_DQ463350' 'Cyathus gansuensis SWFC20880_DQ463348' 'Cyathus hookeri L63_KC005989' 'Cyathus hookeri SWFC20799_DQ463346' 'Cyathus jiayuguanensis SWFC20846_DQ463341' Cyathus_limbatus_AMBr 'Cyathus olla 136_KC989088' 'Cyathus olla BPI727227_DQ463345' 'Cyathus olla f brodiensis SWFC21137_DQ463343' 'Cyathus pallidus SWFC21160_DQ463356' 'Cyathus renweii SWFC201406_DQ463352' 'Cyathus setosus DAOM200815_DQ463349' Cyathus_sp._BBH18348_EF613553 Cyathus_sp._BRFM934_JX082337 'Cyathus sp. Cabo_Verde_MPM3239' 'Cyathus sp. Cabo_Verde_MPM3246Inf' 'Cyathus stercoreus Brazil_UFRN1200' 'Cyathus stercoreus RBG_Kew_K_M_44345_EU784192' 'Cyathus stercoreus RBG_Kew_K_M_48966_EU784193' 'Cyathus stercoreus SWFC21386_DQ463354' 'Cyathus stercoreus Xsd08083_FJ478125' 'Cyathus striatus DSH96_028_DQ486697' 'Cyathus striatus RBG_Kew_K_M_122876_EU784194' 'Cyathus striatus RBG_Kew_K_M_126658_EU784195' Cyathus_subglobisporus_EF613553 'Cyathus triplex SWFC21077_DQ463353' 'Nidula niveotomentosa SWFC3000_DQ463358' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M42629] TITLE Cyathus_ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=791; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Crucibulum laeve SWFC21261_DQ463357' NNTTAAT-GAA----T-AAA-----CC-TGGTTT-----GCTGTTGCTGGCTCTTC-G--------GAGTAAT----GTGCA---------------------CGCTT----ATCATCTTTATATTTCCACCTGTGCACCTTTTGTAGACTTGGGA---TTATCTCTCGAG-------------GTAA-----CTCGGATGTG---GGTTT-GCAG------TT-GTGAAAACTCTGCTCTCCTTGT--ATTAT-CCA--GTCTATGTTAATTATATACACCAT-T-A-GTAT--GTTTAT-AGAATGTCGTTATTAGGATTTCAAAT-CCTTTTAATCAA--ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACC-ACTTCTACT--TTTATT--AGTT-GA-AG-CTGGCTTGGATGTGGGGGTT---GCCGGCTTTTCTAATATAAAA-GGTCGGCTCTCCTTAAATGCATTAGCA-GAACCTTATGTGAATCAG----CTATTGGTGT-GATAATTATCTACGCC---A-------------------------TTGG-TTGTGAAGCAGCTATATAC-GGGGTTCAGCTTCTAACCGTC-TGAAA---GGACAATT-A-TA--TGACAATTTGACCTCAAATCAGGT 'Cyathus africanus DAOM200370_DQ463347' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGA-TCGCTTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTG--GAGTTT-GCGGGCGTCATTAAGTTGATGTCGGCTTTCTCTGTTGGTCTT-CA-C-GTCTATTTT-ACAT-ATAC-TC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTTA-TGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTT---GCGGGCTTTCATTTAGTTGAA--GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GCGCGAA-AGCA------CTTGGGTT----CAATTTC-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGT 'Cyathus africanus L38_JX103204' NNNNNNNNNNNNNNNNNNAAGTGGGCTTTCTTTTAGTTGGCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGA-TCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTG--GAGTTT-GCGGGCGTCATTAAGTTGATGTCGGCTTTCTCTGTTGGTCTT-CA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTTA-TGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTT--GCGGGCTTTTATTCAGTTGAAA-GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GCGCGAA-AGCA------CTTGGGTT----CAATTTC-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGT 'Cyathus africanus SWFC20782_DQ463340' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGA-TCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTG--GAGTTT-GCGGGCGTCATTAAGTTGATGTCGGCTTTCTCTGTTGGTCTT-CA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTTA-TGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTT--GCGGGCTTTTATTCAGTTGAAA-GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GCGCGAA-AGCA------CTTGGGTT----CAATTTC-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGT 'Cyathus africanus var latisporus SWFC21187_DQ463342' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGA-TCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTG--GAGTTT-GCGGGCGTCATTAAGTTGATGTCGGCTTTCTCTGTTGGTCTT-CA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTTA-TGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTT--GCGGGCTTTTATTCAGTTGAAA-GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GCGCGAA-AGCA------CTTGGGTT----CAATTTC-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGT Cyathus_albinus NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA-----CATAT----GTGCTCGCC---------------TCCATTTTT{AG}TATTCACCTT-----TCCACCTGTGAACC-ATTGTAGATGTTGAAGG-TCAATTCTCAAGCTT----CA-TT----------GCTTGGTTTG--GCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTGTCGAACTT-CAAT-GTCTATTT--ACAT-ATAC-CC-T-TGATAAAA--GTTAAT--GAAGGTCTTGATT-GGGCTTC-AC-GCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTACATTT-GTTTAT-CAAGT--GA-AGTGCGCGTTGGATGTGGGGGTT---GCGGGCTT-CATTTAGTTGAG--GTCGGCTCCTCTGAAATGCATTAGCGGGAATCTTTGTTGTGCC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GT--GGCTGACACTAGGGCTTGG-T-----CAAA--C-AAGCC-GGGGTTCTGCTTCTAATGGTCCATTCACTTGGACAAT--ACT--TTGACA-TTTGACCTCAAATCAGGT Cyathus_amazonicus NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGCTGATG-----GTCAAA-----CATAT----GTGCTCGCC---------------TCCATTTTTATATTCACCTT-----TCCACCTGTGAACC-ATTGTAGATGTTGAAGG-TCATTTCTCAAGCTT----CA-TT----------GCTTGGTTTG--GCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTGTCGAACTT-CAAT-GTCTATTT--ACAT-ATAC-CC-T-TGATAAAA--GTTAAT--GAAGGTCTTGATT-GGGCTTC-AC-GCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTACATTT-GTTTAT-CAAGT--GA-AGTGCGCGTTGGATGTGGGGGTT---GCGGGCTT-CATTTAGTTGAG--GTCGGCTCCTCTGAAATGCATTAGCGGGAATCTTTGTTGTGCC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GT--GGCTGACACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Cyathus_amazonicus_AB7806 NNNNNNNNNNNNNNNNNAGAGT-------------GGAGGTTGATGCTGATG-----GTCAAA-----CATAT----GTGCTCGCC---------------TCCATTTTTATATTCACCTT-----TCCACCTGTGAACC-ATTGTAGATGTTGAAGG-TCATTTCTCAAGCTT----CA-TT----------GCTTGGTTTG--GCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTGTCGAACTT-CAAT-GTCTATTT--ACAT-ATAC-CC-T-TGATAAAA--GTTAAT--GAAGGTCTTGATT-GGGCTTC-AC-GCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTCCATTT-GTTTAT-CAAGT--GA-AGTGCGCGTTGGACGTGGGGGTT---GCGGGCTT-CATTTAGTTGAGAGGTCGGCTCCTCTGAAATGCATTAGCGGGAATCTTTGTTGTGCC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GT--GGCTGACACTAGGGCTTGG-T-----CAAA--C-AAGCC-GGGGTTCTGCTTCTAATGGTCCATTCACTTGGACAAT--ACT--TTGACA-TNNNNNNNNNNNNNNNNN 'Cyathus annulatus DAOM200366_DQ463351' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGACGCTGATG-----GTCAAA-----CATAT----GTGCTCGCC--GCCATGA-GAGG-TTCATTTTT-TATTAACCCT---TTTCCACCTGTGAACT-ATTGTAGATGTTGGAGA-TCATTCCTCAGGC----AGCAAT-----------GCTTGGTTTG--GAGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTTTCTCTG-CGATCGA-CAAT-GTCTATTT--ACAT-ATAC-CC-T-TGATTAAA--GTT-A-AAGAAGGACTTGATT-GGGCTTTCA-TGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTATCTTT-ATTGAT-----------AGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCTCTGAAATGCATTAGCGGGAATCTTTGTTGAACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GTA-GTTCGGCA------CTTGGGTTTGG-CAA---C-AAGCC-GGGATTCTGCTTCTAATCGTCCATTCACTTGGACAAT--ACT--TTGACA-TTTGACCTCAAATCAGGT 'Cyathus berkeleyanus SWFC20789_DQ463355' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATGCTGGTGTTTCTCTTAACGGAGAGACAT-ATTGTGCTCATC-AACTG-AAGGGGGGTTCATTTTT-TATTATATTT-----TCCACCTGTGAACT-ATTGTAGATGTTGGAGA-TCACCTCTCAA-------GCAA------GTAATTGCTTGGTCTGGAGAGTTT-GCGGGCTTCATTAAGTTGAAGTCGGCTCTCTCTGTCGATCTT-CAAT-GTCTATTTT-ACAT-ATAC-TCA---AATAAAA--GTT-AT-AGAAGGAATTGATT-GGGCTTT-AATGCCTATAAATCAAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCATTTCATTT-GTTAATTCAAGT--GA-GATGCATGTTGGATGTGGGGGTT---GCGGGCATTCATTAAGTTGAA--GTCGGCTCTCCTGAAATATATTAGCTGGGACCTTTGTTGGACT-GCTTTCCATA--GTGTGATAATTATCTACGCTT--AGGAG--GCTTTGAAGACA-TA----TTGGTTTTT---AATTA---AACCAGAGGTTCTGCTTCTAATAGTCCATTGACTTGGACAATT-ATTA--TGACA-TTTGACCTCAAATCACGT 'Cyathus colensoi DAOM200423_DQ463344' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGA-TCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTG--GAGTTT-GCGGGCGTCATTAAGTTGATGTCGGCTTTCTCTGTTGGTCTT-CA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTTA-TGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTT--GCGGGCTTTCATTCAGTTGAAA-GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GCGCGAA-AGCA------CTTGGGTT----CAATTTC-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TT-GACCTCAAATCAGGT 'Cyathus crassimurus DAOM200372_DQ463350' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGACGCTGATG-----GTAAAA-----CATAT----GTGCTCGCC--GCCATGA-GGGGGTTCATTTTT-TATTAACCTT-CTTTTCCACCTGTGCACTC-TTGTAGATATTGAAGGGTCATCTCTCAGGC----AGCAAT-----------GCTTGGTTTG--GAGTTT-GCGGGCTTCATTTATTTGAAATCGGCTTTCTCTGTCGACCTTTCAGT-ATCTATTTT-ACAT-ATAC-CC-T-TGAAATAA--GTT-AT-AGAAGGACTTGATT-GGGCTCT-AATGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTACATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTTT-GCGGGCTT-CATTCAGTTGAA--GTCGGCTCTCCTGAAATGCATTAGCGTGAATCTTTGTTGAACCCGCTT-CTATTAGGTGTGATAATTATCTACGCCTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 'Cyathus gansuensis SWFC20880_DQ463348' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATGCTGGTGTTTCTCT-AACCGGGAGACAT-ATTGTGCTCGCCT-GCT--GATGGGGGTTCATTTTT-TGTTAA-CTT-CTTTTCCACCTGTGCACT-ATTGTAGTTGTTGTTGA-TCGTCTCTCAAGC-----GCAA------------GCTTGGTCTG--GAGTTTTGCGGGTTTCATTAAGTTGAAGTCGGCTTTCTCTGTTGATCTT-CAGC-ATCTATTT--ACAT-ATAC-TC----GATATAA--GTT--T-AGAAGGTCTTGAT-AGGGCTTT-A-TGCCTATAAATCAATTATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCATTTCATTT-GTTTAT-CAAGT--GA-AATGCATGTTGGATGTGGGGGTT---GCGGGCTTTCATTCAATTGAA--GTCGGCTCTCCTGAAATGCATTAGCTGGAACCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GTGAAAAAGACA-------TTTCATA----CACTTGT-GTAT--GGGGTTCTGCTCCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGT 'Cyathus hookeri L63_KC005989' NNNNNNNNNNNNNNNNNAAAGTGGGCTTTCTTTTAGTTGGCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGA-TCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTG--GAGTTT-GCGGGCGTCATTAAGTTGATGTCGGCTTTCTCTGTTGGTCTT-CA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTTA-TGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTT--GCGGGCTTTTATTCAGTTGAAA-GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GCGCGAA-AGCA------CTTGGGTT----CAATTTC-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGT 'Cyathus hookeri SWFC20799_DQ463346' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGA-TCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTG--GAGTTT-GCGGGCGTCATTAAGTTGATGTC{AC}GCTTTCTCTGTTGGTCTT-CA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTTA-TGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTT---GCGGGCTTTCATTCAGTTGAA--GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GCGCGAA-AGCA------CTTGGGTT----CAATTTT-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGT 'Cyathus jiayuguanensis SWFC20846_DQ463341' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGA-TCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTG--GAGTTT-GCGGGCGTCATTAAGTTGATGTCGGCTTTCTCTGTTGGTCTT-CA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTTA-TGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTT--GCGGGCTTTTATTCAGTTGAAA-GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GCGCGAA-AGCA------CTTGGGTT----CAATTTC-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGT Cyathus_limbatus_AMBr NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATG-----GTAAAA-----CATAT----GTGCTCGCC--GCCATGA-GGGG-TTCATTTTT-TATTATTCTT-CTTTTCCACCTGTGCACTC-TTGTAGATATTGGAGG-TCATCTCTCAGGC----AGCAAT-----------GCTTGGTGTC--GAGTTT-GCTGGCTTCATTTATTTGAAGTCGGCTTTCTCTGTCGACCTT-CAGT-ATCTATTTT-ACAT-ATAC-CC-T-TGAAATAA--GTT-AT-AGAAGGACTTGATT-GGGCTCT-AATGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTACATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTTTTGCGGGCTTTCATTCAGTTGAA--GTCGGCTCTCCTGAAATGCATTAGCGTGAATCTTTGTTGAATC-GCTT-CTATTAGGTGTGATAATTATCTACGCCTTTGAAAA--GGG-GTTCAGCA------CTTGGGTTTGG-CAA---C-AAACCAAAGGTTCTGCTTCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 'Cyathus olla 136_KC989088' CATTA-TTGAATTAATAAAAGTGGGCTTTCTTTTAGTTGGCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGA-TCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTG--GAGTTT-GCGGGCGTCATTAAGTTGATGTCAGCTTTCTCTGTTGGTCTT-CA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTTA-TGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGTGTGTTGGATGTGGGGGTT---GCGGGCTTTCATTCAGTTGAA--GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GCGCGAA-AGCA------CTTGGGTT----CAATTTT-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGT 'Cyathus olla BPI727227_DQ463345' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGA-TCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTG--GAGTTT-GCGGGCGTCATTAAGTTGATGTCAGCTTTCTCTGTTGGTCTT-CA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTTA-TGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGTGTGTTGGATGTGGGGGTT---GCGGGCTTTCATTCAGTTGAA--GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GCGCGAA-AGCA------CTTGGGTT----CAATTTT-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGT 'Cyathus olla f brodiensis SWFC21137_DQ463343' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGA-TCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTG--GAGTTT-GCGGGCGTCATTAAGTTGATGTCAGCTTTCTCTGTTGGTCTT-CA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTTA-TGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTT--GCGGGCTTTCATTCAGTTGAAA-GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GCGCGAA-AGCA------CTTGGGTT----CAATTTC-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TT-GACCTCAAATCAGGT 'Cyathus pallidus SWFC21160_DQ463356' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATGCTGGTGTTTCTACTC-----GAGACAC-A-TGTGCTCGCC-AGCTG--ATGGGGGTTCATTTTT-TATTA-CTTT---TTTCCACCTGTGCACT-ATTGTAGATGTTGGAGA-TCGTATCTCAA-------GC--------GTAA--GCTTGGTCTG--GAGTTT-GCGGGCTTCATTAAGTTGAAGTCGGCATTCTCTGTTGATCTT-CA-C-GTCTATTTTTACAT-ATAC-TC-T-TAATAA----GTT--T-AGAAGGACTTGATT-GGGCTTTTAATGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCATTTCATTT-GTTTAT-CAAGT--GA-AATGCATGTTGGATGTGGGGGTTT--GCGGGCATTCATTAAGTTGAA--GTCGGCTCTCCTGAAATACATTAGCGGGAACTTATGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GTGTGA--GACAGTAA--CATACTTTA------TTGT-GTAT---GGGTTCTGCTTCTAATCGTCCATTCACTTGGACAATT-ACT-CTTGACA-TTTGACCTCAAATCAGGT 'Cyathus renweii SWFC201406_DQ463352' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGACGCTGATG-----GTCAAA-----CATAT----GTGCTCGCC--GCCATGA-GGGG-TTCATTTTT-TATTAACCTT----TTCCACCTGTGAACT-ATTGTAGATGTTGGAGA-TCATTCCTCAA-------GCAAT-----------GCTTGGTTTG--GAGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTTTCTCTG-CGATCGA-CAAT-ATCTATTT--ACATTATAC-CC-T-TGATTAAA--GT--A-AAGAAGGACTTGATT-GGGCTTTTAATGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTATCTTT-ATTGAT-----------AGTGCGCGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCTCTGAAATACATTAGCGGGAATCTTTGTTGAACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GTA-GCTCAGCA------CTTGGGTTTGG-CAA---C-AAACC-GGGATTCTGCTTCTAATCGTCCCTT-----GGACAATT-ACT--TTGACA-TT-GACCTCAAATCAGGT 'Cyathus setosus DAOM200815_DQ463349' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATG-----GTAAAA-----CATAT----GTGCTCGCC--GCCATGA-GGGG-TTCATTTTT-TATTATTCTT-CTTTTCCACCTGTGCACTC-TTGTAGATATTGGAGG-TCATCTCTCAGGC----AGCAAT-----------GCTTGGTGTC--GAGTTT-GCTGGCTTCATTTATTTGAAGTCGGCTTTCTCTGTCGACCTT-CAGT-ATCTATTTT-ACAT-ATAC-CC-T-TGAAATAA--GTT-AT-AGAAGGACTTGATT-GGGCTCT-AATGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTACATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTTTTGCGGGCTTTCATTCAGTTGAA--GTCGGCTCTCCTGAAATGCATTAGCGTGAATCTTTGTTGAATC-GCTT-CTATTAGGTGTGATAATTATCTACGCCTTTGAAAA--GGG-GTTCAGCA------CTTGGGTTTGG-CAA---C-AAACCAAAGGTTCTGCTTCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Cyathus_sp._BBH18348_EF613553 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATGCTGATG-----GTAAAA-----CATAT----GTGCTCGCC--GCCATGA-GGGG-TTCATTTTT-TATTAACCTT-C-TTTCCACCTGTGCACT-TTTGTAGATGTTGAAGA-TGATCTCTCAAGC----AGCAAT-----------GCTTGGTTTG--GAGTTT-GCGGGCTTCATTAAATTGAAGTCGGCCTTCTCTGTTGATCTT-CAATTGTCTATTTT-ACAT-ATAC-CC-T-TGAATGAA--GTT-AT-AGAAGGTGTTGATTCGGGCTTT-AATGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTTATTT-GTTTAT-CAAGT---AGAGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCTCTGAAAAGCATTAGCGGGAATCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GTA-GTTCAGCA------CTTGGGTTTGG-CAA---C-AAACC-GGGGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Cyathus_sp._BRFM934_JX082337 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCTGATG-----GTCAAA-----CATAT----GTGCTCGCC---------------TCCATTTTTATATTCACCTT-----TCCACCTGTGAACC-ATTGTAGATGTTGAAGG-TCAATTCTCAA-------GC--TTC------ATTGCTTGGTTTG--GCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTGTCGAACTT-CAAT-GTCTATTT--ACAT-ATAC-CC-T-TGATAAAA--GTTAAT--GAAGGTCTTGATT-GGGCTTC-AC-GCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTACATTT-GTTTAT-CAAGT--GA-AGTGCGCGTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 'Cyathus sp. Cabo_Verde_MPM3239' CATTA-TTGAATT---AATAGTTGG----------TAGTGCTGATGCTGGTG-----GTCAAA-----CACAT----GTGCTCGCTCTGC-------------CACT----TATTATTACC---TTTCCACCTGTGAACT-ATTGTAGATGTTGAAGG-TCACCTCTCAAGCTT----CA-T----------TGCTTGGTTTG--GCGTTT-GCGGGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 'Cyathus sp. Cabo_Verde_MPM3246Inf' CATTA-TTGAATT---AATAGTTGG----------TAGTGCTGATGCTGGTG-----GTCAAA-----CACAT----GTGCTCGCTCTGC-------------CACT----TATTATTACC---TTTCCACCTGTGAACT-ATTGTAGATGTTGAAGG-TCACCTCTCAAGCTT----CA-T----------TGCTTGGTCTG--GCGTTT-GCCGGCTTCCTTCAGTTGAAGTCCGCTCTCCCTG-CCAACTT-CAAT-GGCTATCTCTACCT-ATAC-CCAT-T-AAAA----GT-ATC-AGAAGGACTTGATT-GGGCTTC-ATTGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCCCATCCATGAAGAACGCAGCGAATTGCCATAAGTAATGTGAATTGCAGAATTCAATGAATCATCCAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCCAAGAGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 'Cyathus stercoreus Brazil_UFRN1200' CATTA-TTGAATT---AATAGTGG-----------TAGTGCTGATGCTGGTG-----GTCAAA-----CACAT----GTGCTCGCTCTGC-------------CACT----TATTAACATT-----TCCACCTGTGAACT-ATTGTAGATGTTGAAGG-TCACCTCTCAAGCTTTCAGCAAT-----G-ATATGCTTGGTCTG--GCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTG-CGAACTT-CAAC-ATCTATCCTTACAT-ATAC-CCAT-TAACAAAAA-GT-AACAAGAAGGACTTGATT-GGGCTTC-ATTGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTCATTTTGTTTATTCAAGT--GA-AGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCCCTGAAATGCATTAGCAGGAATCTTTGTTGTGCT-GCTT-CTATTGGGTGTGATAATTATCTACGCTT--AGGAA--GT--GGCTGACACTAGGACTTGG-T-----CAAA--C-AAGTC-GGGGTTCCGCTTCTAATAGTCCATTCACTTGGACAAT--ACTACTTGACA-TTTGACCTCAAATCANNN 'Cyathus stercoreus RBG_Kew_K_M_44345_EU784192' CATTA-TTGAATT---AATAGTGG-----------TAGTGCTGATGCTGGTG-----GTCAAA-----CACAT----GTGCTCGCTCTGC-------------CACT----CATTAACATT-----TCCACCTGTGAACT-ATTGTAGATGTTGAAGG-TCACCTCTCAAGCTTTCAGCAAT-----G-ATATGCTTGGTCTG--GCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTG-CGAACTT-CAAC-ATCTATCCTTACAT-ATAC-CCAT-TAACAAAAAAGT-AACAAGAAGGACTTGATT-GGGCTTC-ATTGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTCATTTTGTTTATTCAAGT--GA-AGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCCCTGAAATGCATTAGCAGGAATCTTTGTTGTGCT-GCTT-CTATTGGGTGTGATAATTATCTACGCTT--AGGAA--GT--GGCTGACACTAGGACTTGG-T-----CAAA--C-AAGTC-GGGGTTCCGCTTCTAATAGTCCATTCACTTGGACAAT--ACTACTTGACA-TTTGACCCCAAATCAGGT 'Cyathus stercoreus RBG_Kew_K_M_48966_EU784193' CATTA-TTGAATT---AATAGTGG-----------TAGTGCTGATGCTGGTG-----GTCAAA-----CACAT----GTGCTCGCTCTGC-------------CACT----TATTAACATT-----TCCACCTGTGAACT-ATTGTAGATGTTGAAGG-TCACCTCTCAAGCTTTCAGCAAT-----G-ATATGCTTGGTCTG--GCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTG-CGAACTT-CAAC-ATCTATCCTTACAT-ATAC-CCAT-TAACAAAAA-GT-AACAAGAAGGACTTGATT-GGGCTTC-ATTGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTCATTTTGTTTATTCAAGT--GA-AGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCCCTGAAATGCATTAGCAGGAATCTTTGTTGTGCT-GCTT-CTATTGGGTGTGATAATTATCTACGCTT--AGGAA--GT--GGCTGACACTAGGACTTGG-T-----CAAA--C-AAGTC-GGGGTTCCGCTTCTAATAGTCCATTCACTTGGACAAT--ACTACTTGACA-TTTGACCTCAAATCAGGT 'Cyathus stercoreus SWFC21386_DQ463354' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGGTG-----GTCAAA-----CACAT----GTGCTCGCTCTGC-------------CACT----{CT}ATTAACATT-----TCCACCTGTGAACT-ATTGTAGATGTTGAAGG-TCACCTCTCAAGCTTTCAGCAAT-----G-ATATGCTTGGTCTG--GCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTG-CGAACTT-CAAC-ATCTATCCTTACAT-ATAC-CCAT-TAACAAAAA-GT-AACAAGAAGGACTTGATT-GGGCTTC-ATTGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTCATTTTGTTTATTCAAGT--GA-AGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCCCTGAAATGCATTAGCAGGAATCTTTGTTGTGCT-GCTT-CTATTGGGTGTGATAATTATCTACGCTT--AGGAA--GT--GGCTGACACTAGGACTTGG-T-----CAAA--C-AAGTC-GGGGTTCCGCTTCTAATAGTCCATTCACTTGGACAAT--ACTACTTGACA-TTTGACCTCAAATCAGGT 'Cyathus stercoreus Xsd08083_FJ478125' CATTA-TTGAATT--TAATAGTGG-----------TAGTGCTGATGCTGGTG-----GTCAAA-----CACAT----GTGCTCGCTCTGC-------------CACT----TATTAACATT-----TCCACCTGTGAACT-ATTGTAGATGTTGAAGG-TCACCTCTCAAGCTTTCAGCAAT-----G-ATATGCTTGGTCTG--GCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTG-CGAACTT-CAAC-ATCTATCCTTACAT-ATAC-CCAT-TAACAAAAA-GT-AACAAGAAGGACTTGATT-GGGCTTC-ATTGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTCATTTTGTTTATTCAAGT--GA-AGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCCCTGAAATGCATTAGCAGGAATCTTTGTTGTGCT-GCTT-CTATTGGGTGTGATAATTATCTACGCTT--AGGAA--GT--GGCTGACACTAGGACTTGG-T-----CAAA--C-AAGTC-GGGGTTCCGCTTCTAATAGTCCATTCACTTGGACAAT--ACTACTTGACA-TTTGACCTCAAATCAGGT 'Cyathus striatus DSH96_028_DQ486697' NNNNNNTTGAATTAATAAAAGTGGGCTTTGAATT-GGAGGCTGATGCTGATG-----GTCAAA-----CATAT----GTGCTCGCC--GCCATGA-AGAG-TTCGCTTTT-TATTAACCTT-----TCCACCTGTGCACT-T{CT}TGTAGATGTTGGAGG-TCATCCTTCAAGC----AGCAAT-----------GCTTGGTTTG--GAGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCTCTGTCGATCTT-CAAT-GTCTATTTT-ACAT-ATAC-CC-T-TGATAAAA--GTT-A-AAGAAGGACATGATT-GGGCTTT-A-TGCCTATAAATCTATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTCATTT-GTTTAT-CAAGT---AAAGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCTCTGAAATGCATTAGCGGGAATCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GTA-GTTCAGCA------CTTGGGTTTGG-CAA---C-AAACC-GGGGTTCTGCTTCTAATGGTCCATTTACTTGGACAAT--ACTCTTTGACA-TNNNNNNNNNNNNNNNNN 'Cyathus striatus RBG_Kew_K_M_122876_EU784194' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGTCGGCTCTCTCTGTCGATCTT-CAAT-GTCTATTTT-ACAT-ATAC-CC-T-TGATAAAA--GTT-A-AAGAAGGACATGATT-GGGCTTT-A-TGCCTATAAATCTATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTCATTT-GTTTAT-CAAGT---AAAGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCTCTGAAATGCATTAGCGGGAATCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GTA-GTTCAGCA------CTTGGGTTTGG-CAA---C-AAACC-GGGGTTCTGCTTCTAATGGTCCATTTACTTGGACAAT--ACTC-TTGACA-TT-GACCTCAA-TCNNNN 'Cyathus striatus RBG_Kew_K_M_126658_EU784195' CATTAATTGAATTAATAAAAGTGGGCTTTGAATT-GGAGGCTGATGCTGATG-----GTCAAA-----CATAT----GTGCTCGCC--GTCATGA-AGAG-TTCGCTTTT-TATTAACCTT-----TCCACCTGTGCACT-TTTGTAGATGTTGAAGG-TCATCCTTCAAGC----AGCAAT-----------GCTTGGTTTG--GAGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCTCTGTCGATCTT-CAAT-GTCTATTTT-ACAT-ATAC-CC-T-TGATAAAA--GTT-A-AAGAAGGACATGATT-GGGCTTT-A-TGCCTATAAATCTATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTCATTT-GTTTAT-CAAGT---AAAGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCTCTGAAATGCATTAGCGGGAATCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GTA-GTTCAGCA------CTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Cyathus_subglobisporus_EF613553 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATGCTGATG-----GTAAAA-----CATAT----GTGCTCGCC--GCCATGA-GGGG-TTCATTTTT-TATTAACCTT-C-TTTCCACCTGTGCACT--TTGTAGATGTTGAAGA-TGATCTCTCAAGC----AGCAAT-----------GCTTGGTTTG--GAGTTT-GCGGGCTTCATTAAATTGAAGTCGGCCTTCTCTGTTGATCTT-CAATTGTCTATTTT-ACAT-ATAC-CC-T-TGAATGAA--GTT-AT-AGAAGGTGTTGATTCGGGCTTT-AATGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTTATTT-GTTTAT-CAAGT---AGAGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCTCTGAAAAGCATTAGCGGGAATCTTTGTTGGACC-GCTT-CTATTGGGTGTGATAATTATCTACGCCT--AGGAA--GTA-GTTCAGCA------CTTGGGTTTGG-CAA---C-AAACC-GGGGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 'Cyathus triplex SWFC21077_DQ463353' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTACATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTTT-GCGGGCTT-CATTCAGTTGAA--GTCGGCTCTCCTGAAATGCATTAGCGTGAATCTTTGTTGAACCCGCTT-CTATTAGGTGTGATAATTATCTACGCCTTTGAAAAAAGGGGGTTCAGCA------CTTGAGTTTGG-CAA---C-AAACTGAAGGTTCTGCTTCTAATGGTCCATTCATTTGGACAAT--ACT--TTGACA-TTTGNNNNNNNNNNNNNN 'Nidula niveotomentosa SWFC3000_DQ463358' NNNNNNNNNNNNNNNNNNNNGCGATGATCATATGATGACTGTCGCGCTGATG---CTGCTC---TCGGCAT------GTGCTCGTG-----------------CAC------ATCATGATC--TCTCACA-TTGTGCAC--ATTGTAGACT--GGATA--CATC----GAGCC-GAGCCAAATCTCGGTTTGGCCTCGGTTTG-AGGATT--GCTG------T---GTTAACGCCAGTCTTTCCT-TACATT-T-CCAA-GTCTATGTTTACAT---AC-CCATATAATGAAAAACC---T-AGAATGTCTA-TGT-GGGCCTTT-GTGCCTATAAA-GAAAAATACAACT-CCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTATCAACCT-CAAAAGCT--TTCATTA--GCTCGAGAG----GCTTGGATGTGGGGGTT---GCAGGCCTTTT----GTTA---GGTCTGCTCCTCTTAAATGCATTAGCGTGAACCTTTGTGGAACA-G----CTATTGG-TGTGATAATTATCTACGCCT----------------------------TTGGTTTGTGAAGCAGT----------GTTCGAGCTTCTAACGGTCCTTAAGCT-GGACAATTTA-----TGACAATT-GACCTCAAATCAGGT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M42630] TITLE Cyathus_albinus_ITS_LSU; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1582; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Crucibulum laeve SWFC21261_DQ463357' NNTTAAT-GAA----T-AAACCTGG--T--T-TGCTGTTGCTGGCTCTTC-G--------------GAGTAAT----GTGCA---------------------CGCTT----ATCATCTTTATATTTCCACCTGTGCACCTTTTGTAGACTTGGGA--TTATCTCTCGAG-------------GTAA-----CTCGGATGTG-GGTTT-GCAG------TT-GTGAAAACTCTGCTCTCCTTGT--ATTATCCA--GTCTATGTTAATTATATACACCAT-T-A-GTAT--GTTTAT-AGAATGTCGTTATTAGGATTTCAAATCCTTTTAA-TCA--AATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACC-ACTTCTACT--TTTATT--AGTT-GA-AG-CTGGCTTGGATGTGGGGGTT---GCCGGCTTTTCTAATATAAAA-GGTCGGCTCTCCTTAAATGCATTAGCA-GAACCTTATGTGAATCAG---CTATTGG-TGTGATAATTATCTACGCC---A-----------------------TTGG-TTGTGAAGCAGCTATATAC-GGGGTTCAGCTTCTAACCGTC-TGAAA---GGACAATT-A-TA--TGACAATTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TAGTCT-TATGGCTGCCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAAAGGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCA-GGGCTTTGTGGTACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTTAGTCGCGTTGGCTGGAAATCAACC-----CTTT-G---GGTGTACTTTCT-AGTTGACGGGTCAGCATCAATTTTGATTGTTGGATAAAGGC-TTAGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTAGGTTGCATACAACAGTTGGGATTGAGGAACTCAGCACGCCGAAAGGCCGGGTATTTT-ACCACGATTCGTGCTTAGGATGCTGGCATAATAGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACCCGGATGCGTAATGAAAGTGAAAGTTGAGAACCCTGTCGTGGGGTGCATCGACGCCCGGACTTGATGTTTACTGACGGTTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus africanus SWFC20782_DQ463340' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGATCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTGGAGTTT-GCGGGCGTCATTAAGTTGATGTCGGCTTTCTCTGTTGGTCTTCA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTT-ATGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTT--GCGGGCTTTTATTCAGTTGAAA-GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTTCTATTGGGTGTGATAATTATCTACGCCT--AGGAAGCGCGAA-AGCA------CTTGGGTT----CAATTTC-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTACTCTTTTGTAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGATTGCTGGAGAAAGGC-TTAGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTAGGTTGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGTAAGGTTGGGTCTTCGGACTACACT-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus africanus var latisporus SWFC21187_DQ463342' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGATCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTGGAGTTT-GCGGGCGTCATTAAGTTGATGTCGGCTTTCTCTGTTGGTCTTCA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTT-ATGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTT--GCGGGCTTTTATTCAGTTGAAA-GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTTCTATTGGGTGTGATAATTATCTACGCCT--AGGAAGCGCGAA-AGCA------CTTGGGTT----CAATTTC-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTACTCTTTTGTAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGATTGCTGGAAAAAGGC-TTAGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTAGGTTGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGAAAGGTTGGGTCTTTTGACCACACT-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cyathus_albinus NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA-----CATAT----GTGCTCGCC---------------TCCATTTTT{AG}TATTCACCTT-----TCCACCTGTGAACC-ATTGTAGATGTTGAAGGTCAATTCTCAAGCTT----CA-TT----------GCTTGGTTTGGCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTGTCGAACTTCAAT-GTCTATTT--ACAT-ATAC-CC-T-TGATAAAA--GTTAAT--GAAGGTCTTGATT-GGGCTTC--ACGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTACATTT-GTTTAT-CAAGT--GA-AGTGCGCGTTGGATGTGGGGGTT---GCGGGCTT-CATTTAGTTGAG--GTCGGCTCCTCTGAAATGCATTAGCGGGAATCTTTGTTGTGCC-GCTTCTATTGGGTGTGATAATTATCTACGCCT--AGGAAGTGGCTG-A-CACTAGGGCTTGG-T-----CAAA--C-AAGCC-GGGGTTCTGCTTCTAATGGTCCATTCACTTGGACAAT--ACT--TTGACA-TTTGACCTCAAATCAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTGCA-TTTTGCAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGATTGCTGGAAAAAGGCCT-AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCTGGGTTGTATACAGTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Cyathus_amazonicus_AB7806 NNNNNNNNNNNNNNNNNAGAGT-GG------------AGGTTGATGCTGATG-----GTCAAA-----CATAT----GTGCTCGCC---------------TCCATTTTTATATTCACCTT-----TCCACCTGTGAACC-ATTGTAGATGTTGAAGGTCATTTCTCAAGCTT----CA-TT----------GCTTGGTTTGGCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTGTCGAACTTCAAT-GTCTATTT--ACAT-ATAC-CC-T-TGATAAAA--GTTAAT--GAAGGTCTTGATT-GGGCTTC--ACGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTCCATTT-GTTTAT-CAAGT--GA-AGTGCGCGTTGGACGTGGGGGTT---GCGGGCTT-CATTTAGTTGAGAGGTCGGCTCCTCTGAAATGCATTAGCGGGAATCTTTGTTGTGCC-GCTTCTATTGGGTGTGATAATTATCTACGCCT--AGGAAGTGGCTG-A-CACTAGGGCTTGG-T-----CAAA--C-AAGCC-GGGGTTCTGCTTCTAATGGTCCATTCACTTGGACAAT--ACT--TTGACA-TNNNNNNNNNNNNNNNNNCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTC--TTTGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTGCT-TTTTGCAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGATTGCTGGAAAAAGGCCT-AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCTGGGTTGTATACAGTGATTGGGATTGAGGAACGCAGCACGCCGCAAGGTTGGGT-TTC-GACCACACT-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus annulatus DAOM200366_DQ463351' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGACGCTGATG-----GTCAAA-----CATAT----GTGCTCGCC--GCCATGA-GAGG-TTCATTTTT-TATTAACCCT---TTTCCACCTGTGAACT-ATTGTAGATGTTGGAGATCATTCCTCAGGC----AGCAAT-----------GCTTGGTTTGGAGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTTTCTCTG-CGATCGACAAT-GTCTATTT--ACAT-ATAC-CC-T-TGATTAAA--GTT-A-AAGAAGGACTTGATT-GGGCTTTC-ATGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTATCTTT-ATTGAT-----------AGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCTCTGAAATGCATTAGCGGGAATCTTTGTTGAACC-GCTTCTATTGGGTGTGATAATTATCTACGCCT--AGGAAGTA-GTTCGGCA------CTTGGGTTTGG-CAA---C-AAGCC-GGGATTCTGCTTCTAATCGTCCATTCACTTGGACAAT--ACT--TTGACA-TTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-N-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTACTCTTTTGTAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGATTGCTGGAGAAAGGC-TTAGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCTAGGTTGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGTAAGGTTGGGTCT-CTGACCACACT-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGTAAACTCGAGCGCACAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus gansuensis SWFC20880_DQ463348' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATGCTGGTGTTTCTCT-AACCGGGAGACAT-ATTGTGCTCGCCT-GCT--GATGGGGGTTCATTTTT-TGTTAA-CTT-CTTTTCCACCTGTGCACT-ATTGTAGTTGTTGTTGATCGTCTCTCAAGC-----GCAA------------GCTTGGTCTGGAGTTTTGCGGGTTTCATTAAGTTGAAGTCGGCTTTCTCTGTTGATCTTCAGC-ATCTATTT--ACAT-ATAC-TC----GATATAA--GTT--T-AGAAGGTCTTGAT-AGGGCTTT--ATGCCTATAAATCAATTATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCATTTCATTT-GTTTAT-CAAGT--GA-AATGCATGTTGGATGTGGGGGTT---GCGGGCTTTCATTCAATTGAA--GTCGGCTCTCCTGAAATGCATTAGCTGGAACCTTTGTTGGACC-GCTTCTATTGGGTGTGATAATTATCTACGCCT--AGGAAGTGAAAAAGACA-------TTTCATA----CACTTGT-GTAT--GGGGTTCTGCTCCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTGGGAATCAACCTTACTCTTTTGTAGGGCTTATTTTCT-AGTTGACGGGCCAACATCAATTTTGATTGCTGGAAAAGGGCCT-AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCTTGGGTCGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGTAAGGTTGGGT-TTC-GACCACACT-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGTAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCAGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus jiayuguanensis SWFC20846_DQ463341' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGATCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTGGAGTTT-GCGGGCGTCATTAAGTTGATGTCGGCTTTCTCTGTTGGTCTTCA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTT-ATGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTT--GCGGGCTTTTATTCAGTTGAAA-GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTTCTATTGGGTGTGATAATTATCTACGCCT--AGGAAGCGCGAA-AGCA------CTTGGGTT----CAATTTC-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTACTCTTTTGTAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGATTGCTGGAAAAAGGC-TTAGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTAGGTTGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGAAAGGTTGGGTCTTTTGACCACACT-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC Cyathus_limbatus_AmBR NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATG-----GTAAAA-----CATAT----GTGCTCGCC--GCCATGA-GGGG-TTCATTTTT-TATTATTCTT-CTTTTCCACCTGTGCACTC-TTGTAGATATTGGAGGTCATCTCTCAGGC----AGCAAT-----------GCTTGGTGTCGAGTTT-GCTGGCTTCATTTATTTGAAGTCGGCTTTCTCTGTCGACCTTCAGT-ATCTATTTT-ACAT-ATAC-CC-T-TGAAATAA--GTT-AT-AGAAGGACTTGATT-GGGCTCT-AATGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTACATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTTTTGCGGGCTTTCATTCAGTTGAA--GTCGGCTCTCCTGAAATGCATTAGCGTGAATCTTTGTTGAATC-GCTTCTATTAGGTGTGATAATTATCTACGCCTTTGAAAAGGG-GTTCAGCA------CTTGGGTTTGG-CAA---C-AAACCAAAGGTTCTGCTTCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGATGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTG{CT}T-TTTTGCAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGATTGCTGGAAAAAGGCCT-AGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCTGGGTTGTATACAGTGATTGGGATTGAGGAACGCAGCACGCCGCAAGGTTGGGT-TTC-GACCACACT-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus olla BPI727227_DQ463345' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATGCTGATGTTTCCGTCAAACGAAACATATCTTTGTGCTCGCC--GACG-GA-GGGG-TTCATTTTT-TATTA-CCTT-CTTTTCCACCTGTGAACT-TTTGTAGATGTTGAAGATCGCCTCTCAA-------GCAATTCGTAAGAATTGATTGGTTTGGAGTTT-GCGGGCGTCATTAAGTTGATGTCAGCTTTCTCTGTTGGTCTTCA-C-GTCTATTTT-ACAT-ATAC-CC-T-T-ATTTCA--GTT--T-AGAAGGACATGATT-GGGCTTTT-ATGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCATTTCATTT-GTTTAT-CAAGT--GA-AGTGTGTGTTGGATGTGGGGGTT---GCGGGCTTTCATTCAGTTGAA--GTCGGCTCTCCTGAAATGCATTAGCGGAAACCTTTGTTGGACC-GCTTCTATTGGGTGTGATAATTATCTACGCCT--AGGAAGCGCGAA-AGCA------CTTGGGTT----CAATTTT-GAACC-GGGGTTTTGCTTCTAATCGTCCATTCACTTGGACAATTTACT--TTGACA-TTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTACTCTTTTGTAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGATTGCTGGAAAAAGGC-TTAGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTAGGTTGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGAAAGGTTGGGTCTTTTGACCACACT-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCGTAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus pallidus SWFC21160_DQ463356' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATGCTGGTGTTTCTACTC-----GAGACAC-A-TGTGCTCGCC-AGCTG--ATGGGGGTTCATTTTT-TATTA-CTTT---TTTCCACCTGTGCACT-ATTGTAGATGTTGGAGATCGTATCTCAA-------GC--------GTAA--GCTTGGTCTGGAGTTT-GCGGGCTTCATTAAGTTGAAGTCGGCATTCTCTGTTGATCTTCA-C-GTCTATTTTTACAT-ATAC-TC-T-TAATAA----GTT--T-AGAAGGACTTGATT-GGGCTTTTAATGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCATTTCATTT-GTTTAT-CAAGT--GA-AATGCATGTTGGATGTGGGGGTTT--GCGGGCATTCATTAAGTTGAA--GTCGGCTCTCCTGAAATACATTAGCGGGAACTTATGTTGGACC-GCTTCTATTGGGTGTGATAATTATCTACGCCT--AGGAAGTGTGA--GACAGTAA--CATACTTTA------TTGT-GTAT---GGGTTCTGCTTCTAATCGTCCATTCACTTGGACAATT-ACT-CTTGACA-TTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTACTCTTTTGTAGGGCTTACTTTCT-AGTTGACGGGCCAACATCAATTTTGATTGCTGGAAAAGGGCCT-AGGGAATGTGGCACCTTCGGGTGTGTTATAGCCTTGGGTCGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGAAAGGTTGGGTCTTT-GACCACACT-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus renweii SWFC201406_DQ463352' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGACGCTGATG-----GTCAAA-----CATAT----GTGCTCGCC--GCCATGA-GGGG-TTCATTTTT-TATTAACCTT----TTCCACCTGTGAACT-ATTGTAGATGTTGGAGATCATTCCTCAA-------GCAAT-----------GCTTGGTTTGGAGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTTTCTCTG-CGATCGACAAT-ATCTATTT--ACATTATAC-CC-T-TGATTAAA--GT--A-AAGAAGGACTTGATT-GGGCTTTTAATGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTATCTTT-ATTGAT-----------AGTGCGCGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCTCTGAAATACATTAGCGGGAATCTTTGTTGAACC-GCTTCTATTGGGTGTGATAATTATCTACGCCT--AGGAAGTA-GCTCAGCA------CTTGGGTTTGG-CAA---C-AAACC-GGGATTCTGCTTCTAATCGTCCCTT-----GGACAATT-ACT--TTGACA-TT-GACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-N-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTACTCTTTTGTAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGATTGCTGGAGAAAGGC-TTAGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCTAGGTTGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGTAAGGTTGGGTCT-CTGACCACACT-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGTAAACTCGAGCGCACAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus setosus DAOM200815_DQ463349' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGATG-----GTAAAA-----CATAT----GTGCTCGCC--GCCATGA-GGGG-TTCATTTTT-TATTATTCTT-CTTTTCCACCTGTGCACTC-TTGTAGATATTGGAGGTCATCTCTCAGGC----AGCAAT-----------GCTTGGTGTCGAGTTT-GCTGGCTTCATTTATTTGAAGTCGGCTTTCTCTGTCGACCTTCAGT-ATCTATTTT-ACAT-ATAC-CC-T-TGAAATAA--GTT-AT-AGAAGGACTTGATT-GGGCTCT-AATGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTACATTT-GTTTAT-CAAGT--GA-AGTGCGTGTTGGATGTGGGGGTTTTTGCGGGCTTTCATTCAGTTGAA--GTCGGCTCTCCTGAAATGCATTAGCGTGAATCTTTGTTGAATC-GCTTCTATTAGGTGTGATAATTATCTACGCCTTTGAAAAGGG-GTTCAGCA------CTTGGGTTTGG-CAA---C-AAACCAAAGGTTCTGCTTCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGGTCT-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTATGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTACTCTTTTGTAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGATTGCTGGAAAAAGGC-TTAGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTAGGTCGTATACAGTGATTGGGATTGAGGAACGCAGCACGCCGAAAGGTTGGGT-TTC-GACCACACT-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCATAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus sp Cabo_Verde_MPM3246Inf' CATTA-TTGAATT---AATAGTTGG----------TAGTGCTGATGCTGGTG-----GTCAAA-----CACAT----GTGCTCGCTCTGC-------------CACT----TATTATTACC---TTTCCACCTGTGAACT-ATTGTAGATGTTGAAGGTCACCTCTCAAGCTT----CA-T----------TGCTTGGTCTGGCGTTT-GCCGGCTTCCTTCAGTTGAAGTCCGCTCTCCCTG-CCAACTTCAAT-GGCTATCTCTACCT-ATAC-CCAT-T-AAAA----GT-ATC-AGAAGGACTTGATT-GGGCTTC-ATTGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCCCATCCATGAAGAACGCAGCGAATTGCCATAAGTAATGTGAATTGCAGAATTCAATGAATCATCCAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCCAAGAGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGG-TGGTCC-T-TGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTGCTCTTTTGCAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGACCATTGGAGAAAGGC-TCAGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCTGGGTTGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGCAAGGTTGGGT-TTC-GACCACACC-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus stercoreus Brazil_UFRN1200' CATTA-TTGAATT---AATAGT-GG----------TAGTGCTGATGCTGGTG-----GTCAAA-----CACAT----GTGCTCGCTCTGC-------------CACT----TATTAACATT-----TCCACCTGTGAACT-ATTGTAGATGTTGAAGGTCACCTCTCAAGCTTTCAGCAAT-----G-ATATGCTTGGTCTGGCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTG-CGAACTTCAAC-ATCTATCCTTACAT-ATAC-CCAT-TAACAAAAA-GT-AACAAGAAGGACTTGATT-GGGCTTC-ATTGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTCATTTTGTTTATTCAAGT--GA-AGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCCCTGAAATGCATTAGCAGGAATCTTTGTTGTGCT-GCTTCTATTGGGTGTGATAATTATCTACGCTT--AGGAAGTGGCTG-A-CACTAGGACTTGG-T-----CAAA--C-AAGTC-GGGGTTCCGCTTCTAATAGTCCATTCACTTGGACAAT--ACTACTTGACA-TTTGACCTCAAATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTGCTCTTTTGCAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGACCATTGGAGAAAGGC-TTGGGGAATGTGGCACCTTCGGGTGTGTTATAGACCCAGGTTGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGCAAGGTAGGGT-TTC-GACCACACC-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus stercoreus SWFC21386_DQ463354' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCTGGTG-----GTCAAA-----CACAT----GTGCTCGCTCTGC-------------CACT----{CT}ATTAACATT-----TCCACCTGTGAACT-ATTGTAGATGTTGAAGGTCACCTCTCAAGCTTTCAGCAAT-----G-ATATGCTTGGTCTGGCGTTT-GCGGGCTTCATTCAGTTGAAGTCGGCTCTCGCTG-CGAACTTCAAC-ATCTATCCTTACAT-ATAC-CCAT-TAACAAAAA-GT-AACAAGAAGGACTTGATT-GGGCTTC-ATTGCCTATAAATCAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTCATTTTGTTTATTCAAGT--GA-AGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCCCTGAAATGCATTAGCAGGAATCTTTGTTGTGCT-GCTTCTATTGGGTGTGATAATTATCTACGCTT--AGGAAGTGGCTG-A-CACTAGGACTTGG-T-----CAAA--C-AAGTC-GGGGTTCCGCTTCTAATAGTCCATTCACTTGGACAAT--ACTACTTGACA-TTTGACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGG-TGG-CC-TTCAGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTGCTCTTTTGCAGGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGACCATTGGAGAAAGGC-TTGGGGAATGTGGCACCTTCGGGTGTGTTATAGACCCAGGTTGTATACAGTGGTTGGGATTGAGGAACGCAGCACGCCGCAAGGTAGGGT-TTC-GACCACACC-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCACAATGAAAGTAAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTATACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Cyathus subiglobisporus EF613554_THAI' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATGCTGATG-----GTAAAA-----CATAT----GTGCTCGCC--GCCATGA-GGGG-TTCATTTTT-TATTAACCTT-C-TTTCCACCTGTGCACT-TTTGTAGATGTTGAAGATGATCTCTCAAGC----AGCAAT-----------GCTTGGTTTGGAGTTT-GCGGGCTTCATTAAATTGAAGTCGGCCTTCTCTGTTGATCTTCAATTGTCTATTTT-ACAT-ATAC-CC-T-TGAATGAA--GTT-AT-AGAAGGTGTTGATTCGGGCTTT-AATGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTTTATTT-GTTTAT-CAAGT---AGAGTGCGTGTTGGATGTGGGGGTT---GCGGGCTT-CATTCAGTTGAA--GTCGGCTCCTCTGAAAAGCATTAGCGGGAATCTTTGTTGGACC-GCTTCTATTGGGTGTGATAATTATCTACGCCT--AGGAAGTA-GTTCAGCA------CTTGGGTTTGG-CAA---C-AAACC-GGGGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGG-CTTTGTGGTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTGGAAGTCAGTCGCGTTGGCTAGGAATCAACCTTACTCTTTTGTAAGGCTTACTT-CTTAGTTGACGGGCCAACATCAATTTTGATTGCTGGAAAAAGGC-TTAGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTGGGTCGTATACAGTGATTGGGATTGAGGAACGCAGCACGCCGTAAGGTTGGGT-TTC-GACCACACT-CGTGCTTCGGATGTTGGCATAATGGCTTTCATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGAGTGGAAAACTCGAGCGCATAATGAAAGTAATAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGATGTTTACTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC 'Nidula niveotomentosa SWFC3000_DQ463358' NNNNNNNNNNNNNNNNNNNNGCGATGATCATATGATGACTGTCGCGCTGATG-----CTGCTC---TCGGCAT----GTGCTCGTG-----------------CAC------ATCATGATC---TCTCACATTGTGCAC--ATTGTAGACT--GGATA-CA----TCGAGCC-GAGCCAAATCTCGGTTTGGCCTCGGTTTGAGGATT-GCTG------T---GTTAACGCCAGTCTTTCCT-TACATT-TCCAA-GTCTATGTTTACAT---AC-CCATATAATGAAAAACC---T-AGAATGTCTA-TGT-GGGCCTTT-GTGCCTATAAA-GAAAAATACAACT-CCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTATCAACCT-CAAAAGCT--TTCATT--AGCTCGAGAG----GCTTGGATGTGGGGGTT---GCAGGCCTTTT----GTTA---GGTCTGCTCCTCTTAAATGCATTAGCGTGAACCTTTGTGGAACA-G---CTATTGG-TGTGATAATTATCTACGCCT--------------------------TTGGTTTGTGAAGCAGT----------GTTCGAGCTTCTAACGGTCCTTAAGCT-GGACAATTTA-----TGACAATT-GACCTCAAATCAGGTCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCT-GTCTATATGGCAGTCCGAGTTGTAATCTAGAGAAGTGCTACCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCA-GGGCTTTGTGGTGCGCTCTCAACGAGTCNAGTTGTTNGGGAATGNAGCTCAAAATGGGTGGTAAATTCCNTCTAAAGCTAANTATAGGCNANAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGANAGTTAAACAGTACNTGAAATTGCAGAAAGGGAAACGCTTGAAGTCAGTCGCGCTGGCCAGGGATCCACCTCGCTCTTTTGTGAGGCGCACTTTCT-GGTCGGTGGGTCAGCATCAGTTTTGGTTGCTGGATAAAGGCCTT-GGGAATGTGGCATCTTCGGATGTGTTATAGCCCTTGGTTGGATACAGTGGCTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGG-CTTTTAGCCACG-TACGTGCTTGGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACCCGAGTGCGCAATGAAAGTGAAAGTTGAGATCCCTGTCGTGGGGAGCATCGACGCCCGGACCTGAGGCTTGCTGACGGTTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTC ; END; BEGIN TREES; TITLE Cyathus_albinus_ITS_LSU_180117_StrictData_Hsearch_5thgap_10kbs_majrul_parsimony; LINK TAXA = Taxa1; TRANSLATE 1 'Crucibulum laeve SWFC21261_DQ463357', 2 'Nidula niveotomentosa SWFC3000_DQ463358', 3 Cyathus_amazonicus_AB7806, 4 'Cyathus sp Cabo_Verde_MPM3246Inf', 5 'Cyathus stercoreus SWFC21386_DQ463354', 6 Cyathus_albinus, 7 'Cyathus stercoreus Brazil_UFRN1200', 8 'Cyathus africanus SWFC20782_DQ463340', 9 'Cyathus africanus var latisporus SWFC21187_DQ463342', 10 'Cyathus gansuensis SWFC20880_DQ463348', 11 'Cyathus jiayuguanensis SWFC20846_DQ463341', 12 'Cyathus olla BPI727227_DQ463345', 13 'Cyathus pallidus SWFC21160_DQ463356', 14 'Cyathus annulatus DAOM200366_DQ463351', 15 'Cyathus renweii SWFC201406_DQ463352', 16 'Cyathus setosus DAOM200815_DQ463349', 17 'Cyathus subiglobisporus EF613554_THAI', 18 Cyathus_limbatus_AmBR; TREE 'PAUP_1' = [&R] ((1:100.0,2:100.0):50.0,(((3:100.0,6:100.0):100.0,(4:100.0,(5:100.0,7:100.0):100.0):99.955):96.985,(((16:100.0,18:100.0):100.0,(17:100.0,(14:100.0,15:100.0):100.0):55.6):60.7,((10:100.0,13:100.0):98.168,(12:100.0,(8:100.0,9:100.0,11:100.0):80.762):100.0):82.626):73.228):50.0); END; BEGIN TREES; TITLE Cyathus_ITS; LINK TAXA = Taxa2; TRANSLATE 1 'Crucibulum laeve SWFC21261_DQ463357', 2 'Cyathus africanus DAOM200370_DQ463347', 3 'Cyathus africanus L38_JX103204', 4 'Cyathus africanus SWFC20782_DQ463340', 5 'Cyathus africanus var latisporus SWFC21187_DQ463342', 6 Cyathus_albinus, 7 Cyathus_amazonicus, 8 Cyathus_amazonicus_AB7806, 9 'Cyathus annulatus DAOM200366_DQ463351', 10 'Cyathus berkeleyanus SWFC20789_DQ463355', 11 'Cyathus colensoi DAOM200423_DQ463344', 12 'Cyathus crassimurus DAOM200372_DQ463350', 13 'Cyathus gansuensis SWFC20880_DQ463348', 14 'Cyathus hookeri L63_KC005989', 15 'Cyathus hookeri SWFC20799_DQ463346', 16 'Cyathus jiayuguanensis SWFC20846_DQ463341', 17 Cyathus_limbatus_AMBr, 18 'Cyathus olla 136_KC989088', 19 'Cyathus olla BPI727227_DQ463345', 20 'Cyathus olla f brodiensis SWFC21137_DQ463343', 21 'Cyathus pallidus SWFC21160_DQ463356', 22 'Cyathus renweii SWFC201406_DQ463352', 23 'Cyathus setosus DAOM200815_DQ463349', 24 Cyathus_sp._BBH18348_EF613553, 25 Cyathus_sp._BRFM934_JX082337, 26 'Cyathus sp. Cabo_Verde_MPM3239', 27 'Cyathus sp. Cabo_Verde_MPM3246Inf', 28 'Cyathus stercoreus Xsd08083_FJ478125', 29 'Cyathus stercoreus Brazil_UFRN1200', 30 'Cyathus stercoreus RBG_Kew_K_M_44345_EU784192', 31 'Cyathus stercoreus RBG_Kew_K_M_48966_EU784193', 32 'Cyathus stercoreus SWFC21386_DQ463354', 33 'Cyathus striatus DSH96_028_DQ486697', 34 'Cyathus striatus RBG_Kew_K_M_122876_EU784194', 35 'Cyathus striatus RBG_Kew_K_M_126658_EU784195', 36 Cyathus_subglobisporus_EF613553, 37 'Cyathus triplex SWFC21077_DQ463353', 38 'Nidula niveotomentosa SWFC3000_DQ463358'; TREE con_50_majrule = [&R] ((38:0.2562812,1:0.224008):0.10794025,((22:0.0111889,9:0.01273436):0.02977481,(35:0.003282664,34:0.001896652,33:0.002335331):0.02207439,(37:0.01112102,12:0.004456341,(23:0.001332179,17:0.00133399):0.01407993):0.05119021,((7:0.001581193,8:0.005158733,(25:0.002095171,6:0.001404867):0.003201027):0.01994233,((26:0.008068165,27:0.01946623):0.06387509,(32:0.001270421,28:0.001198995,31:0.001213034,29:0.001206842,30:0.004459181):0.007517495):0.06025722):0.03510404,((24:0.001411791,36:0.001388742):0.02809251,((13:0.04400408,(21:0.02765063,10:0.08390914):0.01336277):0.05473932,(2:0.006534101,11:0.001252991,(20:0.001298037,(15:0.001282432,(19:0.001259065,18:0.001187481):0.002772376):0.002795335):0.002721763,(5:0.001215266,16:0.001251907,4:0.001227417,14:0.001128008,3:0.001170043):0.002764775):0.03837217):0.03087319):0.007217997):0.10794025); END; BEGIN TREES; TITLE Cyathus_albinus_ITS_LSU_180117_StrictData; LINK TAXA = Taxa1; TRANSLATE 1 'Crucibulum laeve SWFC21261_DQ463357', 2 'Nidula niveotomentosa SWFC3000_DQ463358', 3 Cyathus_amazonicus_AB7806, 4 'Cyathus sp Cabo_Verde_MPM3246Inf', 5 'Cyathus stercoreus SWFC21386_DQ463354', 6 Cyathus_albinus, 7 'Cyathus stercoreus Brazil_UFRN1200', 8 'Cyathus africanus SWFC20782_DQ463340', 9 'Cyathus africanus var latisporus SWFC21187_DQ463342', 10 'Cyathus gansuensis SWFC20880_DQ463348', 11 'Cyathus jiayuguanensis SWFC20846_DQ463341', 12 'Cyathus olla BPI727227_DQ463345', 13 'Cyathus pallidus SWFC21160_DQ463356', 14 'Cyathus annulatus DAOM200366_DQ463351', 15 'Cyathus renweii SWFC201406_DQ463352', 16 'Cyathus setosus DAOM200815_DQ463349', 17 'Cyathus subiglobisporus EF613554_THAI', 18 Cyathus_limbatus_AmBR; TREE con_50_majrule = [&R] ((1:0.114499,2:0.1409948):0.07716565,((16:0.007046667,18:0.005686404):0.02474226,((14:0.005301854,15:0.004679658):0.01384764,((3:0.002295197,6:0.002892586):0.01016599,(4:0.02633345,(5:5.831963E-4,7:5.275772E-4):0.01300598):0.02524959):0.01626885):0.006126164,(17:0.01507588,((10:0.02420852,13:0.01712125):0.02757807,(8:0.003587279,(9:5.345122E-4,11:5.291689E-4,12:0.003310384):0.001838404):0.01939666):0.01379956):0.006158025):0.07716565); END; BEGIN TREES; TITLE Cyathus_albinus_ITS_LSU_StrictData_Hsearch_5thgap_10kbs_majrul_parsimony; LINK TAXA = Taxa1; TRANSLATE 1 'Crucibulum laeve SWFC21261_DQ463357', 2 'Nidula niveotomentosa SWFC3000_DQ463358', 3 Cyathus_amazonicus_AB7806, 4 'Cyathus sp Cabo_Verde_MPM3246Inf', 5 'Cyathus stercoreus SWFC21386_DQ463354', 6 Cyathus_albinus, 7 'Cyathus stercoreus Brazil_UFRN1200', 8 'Cyathus africanus SWFC20782_DQ463340', 9 'Cyathus africanus var latisporus SWFC21187_DQ463342', 10 'Cyathus gansuensis SWFC20880_DQ463348', 11 'Cyathus jiayuguanensis SWFC20846_DQ463341', 12 'Cyathus olla BPI727227_DQ463345', 13 'Cyathus pallidus SWFC21160_DQ463356', 14 'Cyathus annulatus DAOM200366_DQ463351', 15 'Cyathus renweii SWFC201406_DQ463352', 16 'Cyathus setosus DAOM200815_DQ463349', 17 'Cyathus subiglobisporus EF613554_THAI', 18 Cyathus_limbatus_AmBR; TREE 'PAUP_1' = [&R] ((1:100.0,2:100.0):50.0,(((3:100.0,6:100.0):100.0,(4:100.0,(5:100.0,7:100.0):100.0):99.955):96.985,(((16:100.0,18:100.0):100.0,(17:100.0,(14:100.0,15:100.0):100.0):55.6):60.7,((10:100.0,13:100.0):98.168,(12:100.0,(8:100.0,9:100.0,11:100.0):80.762):100.0):82.626):73.228):50.0); END;