#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 14:45 GMT TreeBASE (cc) 1994-2008 Study reference: Tanaka E., Shimizu K., Imanishi Y., Yasuda F., & Tanaka C. 2008. Isolation of basidiomycetous anamorphic yeast-like fungus Meira argovae found on Japanese bamboo. Mycoscience, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S2083] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=12; TAXLABELS Dicellomyces_gloeosporus Dicellomyces_scirpi Exobasidium_japonicum Exobasidium_oxycocci Graphiola_cylindrica Graphiola_sp Kordyana_celebensis Kordyana_tradescantiae Meira_argovae Meira_argovae_OM1 Meira_geulakinigii Meira_nashicola ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3256] TITLE Meira_D1_D2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=655; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Dicellomyces_gloeosporus TAACGAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCTCAAATTTGAAAGCTTGTCCTTTTTTCGGGGGCACGCATTGTAATCTCGAGATGTGTTTTCCGTGTTGGCTTACGGACAATGTCCTTGGAATAGGAAATCATAGAGGGTGACAACCCCGTCTTTGCCGTAAACATCCAATGCTTTGTGATACACAATCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGAGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTCACGTAATAAGTATTTTTATG-GAGCATTATGGCGGTGTATTCTTCGGAATGCTAAGTAAGAGTTTCTCTCCTGCCGCTCCTATTTTACTGGTCATTGTCGATTCTGTTGCCGACGGATAAGGGTACGAGAAAGGTAGCATTATGTTCGCATAATGTGTTTATAGACTTGTACTGGATACGTTGGTCGGGATCGAGGATAACGCAGGGAACCCTTCG---GGGCTGGCTTTCGAGCACATTT-TCCCTAAGGACAACGACTTCAATTGCGTGAAGCGACCCGTCTTGA Dicellomyces_scirpi --------------CTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCC-TTT-------GGTCCGCATTGTAATCTCGAGATGTGTTTTCCGTGCTAGACCGTGGACAAGTTCCTTGGAATTGGATGTCATAGAGGGTGAGAACCCCGTACATGCCGCGGATGCCTAGTGCTTTGTGATACACGTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTCAAGT--TAGATGTGT-------------GTAGTGGTGC-----TCAGCCG-C-AAGGC---GTTTTCAT--TGC------TAC---ACAGGCCAACATCGGTTGTA--GGGGGTGGAGAATAGGCGGAGGAATGTGGCACC---TCCGGG---TGCGTT-ATAGCCTCTGCCCGGATACATCCCCCACGACCGAGGTCAGCA-----------------------GCGTTCG----CGCTT-------AGGATGCTG---------GCGT-AA------TGGCTTGA Exobasidium_japonicum TAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCAGT-------AATGTCCGCATTGTAATCTCGAGAGATGTTTTCCGCGTTGGACCACGTACAAGTTCCTTGGAATAGGATGTCATAGAGGGTGAAAATCCCGTACTTGATGTGGACGCCCAGTGCTTTGTGATACGTCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCATTTGAAGTCAGACGTG-TATTT---CAGTATT----CAGCCTTGCTTTT-----GCTTGGT----GTATTTGCTGT----------CGT-ACAGGCCAACATCAGTTTTG--AGTGACGGATAAGGGTAGAGAGAATGTGGCACC---TTCGGG---TGTGTT-ATAGCTCTTTACTGGATACGTCGTTTGGGACTGAGGAA--CGCAGCGCGCC-GTAA----GGCAGACCCTCGGGTACTTTC-GCGCTTAGGATGTTGGCGTTAATGGCTTTAAGTGACCCGTCTTGA Exobasidium_oxycocci TAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCAGT-------AATGTCCGCGTTGTAATCTCGAGAGTTGTTTTCCGCGCTGGACCACGTACAAGTTCCTTGGAATAGGATGTCATAGAGGGTGAAAATCCCGTACTTGATGTGGACGCCCAGTGCTTTGTGATACATCATCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCATTTGAAGTCAGACGTG-TATTT---CAGTATT----CAGCCTTGCTTTTT---TGCTTGGT----GTATTTGCTGT----------TTTTACAGGCCAACATCAGTTTTG--AGTGACGGATAAGGGTAGAAAGAATGTAGCACC---TTTGGG---TGTGTT-ATAGCTTTTTACTGGATACGTCGTTTGGGACTGAGGAA--CGCAGCGCGCC-GTAA----GGCAGACCTTCGGGTACTTTC-GCGCTTAGGATGTGGGCGT-AATGGCTTTAAGTGACCCGTCTTGA Graphiola_cylindrica TAACAAGGATTCCCTTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCCGC-------AAGGTCCGCATTGTAATCTCGAGAAGTGTTTTCCGCGCTGGACCATGGACAAGTTCCCTGGAATGGGATGTCATAGAGGGTGATAACCCCGTACTTGCTGTGGACGCCCAGTGCTTTGTGATACACTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAAGTCAGACGTG-CATG----CAGTATT----CAGCCTGGCTTCG-----GCTTGGT----GTATTTATTGT----------TTT-GCAGGCCAACATCGATTTTC--GGCAACGGATAAGGGTATAGGGAATGTGGCCTC---TCCGGA---GGTGTT-ATAGCCCTGTACTGGATACGTTGCTGGGGATCGAGGAT--CGCAGCGCCCCCGCAA---GGGCAGGCCTTCGGGCACTTTG-GCGCTTAGGATGTTGGCGT-AATGGCTTTCAGTGACCCGTCTTGA Graphiola_sp TAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCAGC-------AATGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGCTGGACCGTGGACAAGTTTCCTGGAATGGAATGTCATAGAGGGTGAAAACCCCGTACTTGCCGCGGACGCCCAGTGCTTTGTGATGCGCGTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCATTGGAAGTCAGACGTG-CATG----CAGTACT----CAGCCTGGCTTTG-----GCTTGGT----GTATTTGCTGT----------TTT-GCAGGCCAACATCGATTTTT--GGCAACGGATAAGGGTAGAGAGAATGTGGCCTC---CCCGGA---GGTGTT-ATAGCTCTCTACTGGATACGTTGCCGGGGATCGAGGAA--CGCAGCGTCCCCGCAA---GGGCAGGTCTTCGGACACTTTG-ACGCTTAGGATGTTGGCGT-AATGGCTTTCAATGACCCGTCTTGA Kordyana_celebensis CTACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAAGCTTACAGT-------AATGTACGCGTTGTAATCTCGAGAAATGTTTTCCGTGCTGGACCATGGACAAGTTCCTTGGAATAGGATGTCATAGAGGGTGAGAACCCCGTCTTTGCCATGGACGCCCAGCGCTTTGCGATACATTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTCAAGTCAGACGTGTAGCG----CGGTACT----CAGCCT-------------TATGGT----GTTTTTACCGC----------ATT-ACTGGCCAGCATCGATTTTG--AGCGACGGAGAAGGGTGTGAGGAACGTGGCACC---TCCGGG---TGTGTT-ATAGCCTTACACTGGATACGTCGCTTGGGATCGAGGAA--CGCAGCGCACCCGCAA---GGGCAGGTCTTCGGACACTTTT-GCGCTTAGGATGCTGGCGT-A------------------------ Kordyana_tradescantiae -------GATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTTGCAGC-------AATGCACGCGTTGTAATCTCGAGAAATGTTTTCCGTGCTGG{AT}CCATGGACAAGTTCCTTGGAATAGGATGTCATAGAGGGTGAGAACCCCGTCTTTGCCATGGACGCCCAGTGCTTTGTGATACATTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTCAAGTCAGACGTGTAGTG----CGGTACT----CAGCCT-------------TACGGC----GTTTTTACCGT----------TTT-ACTAGCCAGCATCGATTTTG--AGCAACGGATAAGGGTGTGGGGAACGTGGCACC---TC-GGG---TGTGTT-ATAG{AC}CTTACACTGGATACGTCGCTTGGGATCGAGGAA--CGCAGTGCACCCGCAA---GGGCAGGTCTTCGGACACTCT----------------------------------------------- Meira_argovae TAACAAGGATTCCCTTAGTAACGGCGAGTGAAGCGGGAATAGCTCAAATTTGAAAGCTGGCAGC-------AATGTCCGCGTTGTAATCTCGAGAAGTGTTTTCCGTGCTGGACCATAGATATGTTCCTTGGAATAGGATGTCAAAGAGGGTGAGAATCCCGTACATGCTATGGACGCCCAGTGCTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTCAAGTCAGATATGGCTTT----GAATGTT----CAGCCT-------------TTAGGT----GTATTCATTTT----------TTG-TCAGGCCAGCATCGATTTTG--AACGTCGGATAAGGGTAGAAGGAATGTAGCAT-ACTTTCGGGTA-TGTGTT-ATAGCCTTTTACTGGATACGACGATCGGGATCGAGGTT--CGCAGCACACCCTTTTTT-GGGCAGGTCTTCGGACACTTTT-GTGCTTAGGATGCTGGCGT-AATGGCTTGAAGCGACCCGTCTTGA Meira_argovae_OM1 TAACAAGGATTCCCTTAGTAACGGCGAGTGAAGCGGGAATAGCTCAAATTTGAAAGCTGGCAGC-------AATGTCCGCGTTGTAATCTCGAGAAGTGTTTTCCGTGCTGGACCATAGATATGTTCCTTGGAATAGGATGTCAAAGAGGGTGAGAATCCCGTACATGCTATGGACGCCCAGTGCTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTCAAGTCAGATATGGCTTT----AAATGTT----CAGCCT-------------TTCGGT----GTATTCATTTT----------TTG-TCAGGCCAGCATCGATTTTG--AACGTCGGATAAGGGTAGAAGGAATGTAGCAT-ACTTTCGGGTA-TGTGTT-ATAGCCTTTTACTGGATACGACGATCGGGATCGAGGTT--CGCAGCACACCCTTTTT--GGGCAGGTCTTCGGACACTTTT-GTGCTTAGGATGCTGGCGT-AATGGCTTGAAGCGACCCGTCTTGA Meira_geulakinigii TAACAAGGATTCCCTTAGTAACGGCGAGTGAAGCGGGAATAGCTCAAATTTGAAAGCTGGCAGC-------AATGTCCGCGTTGTAATCTCGAGAAGTGTTTTCCGTGCTGGACCATAGATATGTTCCTTGGAATAGGATGTCATAGAGGGTGAGAACCCCGTACATGCTATGGACGCCCAGTGCTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTCAAGTCAGATATGGCTTT----GAATGTT----CAGCCT-------------TTAGGT----GTATTCATTTT----------TTG-TCAGGCCAGCATCGATTTTG--GACGTCGGATAAGGGTAGAAGGAACGTGGCAT-ACTTTCGGGTA-TGTGTT-ATAGCCTTTTACTGGATACGACGATCGGGATCGAGGTT--CGCAGCACACCCTTTTT--GGGCAGGTCTTCGGACACTTTT-GTGCTTAGGATGCTGGCGT-AATGGCTTGAAGCGACCCGTCTTGA Meira_nashicola TAACAAGGATTCCCTTAGTAACGGCGAGTGAAGCGGGAATAGCTCAAATTTGAAAGCTGGCAGC-------AATGTCCGCGTTGTAATCTAGAGAAGTGTTTTCCGTGCTGGACCATAGATATGTTCCTTGGAATAGGATGTCATAGAGGGTGAGAACCCCGTACATGCTATGGACGCCCAGTGCTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTCAAGTCAGATATGGCTTT----GAATGTT----CAGCCT-------------TTAGGT----GTATTCATTTT----------TTG-TCAGGCCAGCATCGATTTTG--AACGTCGGATAAGGGTAGAAAGAACGTAGCAT-ACTCTCGGGTA-TGTGTT-ATAGCTTTTTACTGGATACGACGATCGGGATCGAGGTT--CGCAGCACACCCTTTTTT-GGGCAGGTCTTCGGACACTTTTTGTGCTTAGGATGCTGGCGT-AATGGCTTGAAGCCAC--------- ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Meira_D1_D2) = N: 1-655; CODONPOSSET CodonPositions (CHARACTERS = Meira_D1_D2) = N: 1-655; END; BEGIN TREES; TITLE Tb9104; LINK TAXA = Taxa1; TRANSLATE 1 Exobasidium_japonicum, 2 Exobasidium_oxycocci, 3 Graphiola_cylindrica, 4 Graphiola_sp, 5 Meira_argovae_OM1, 6 Meira_argovae, 7 Meira_geulakinigii, 8 Meira_nashicola, 9 Kordyana_celebensis, 10 Kordyana_tradescantiae, 11 Dicellomyces_gloeosporus, 12 Dicellomyces_scirpi; TREE Fig._2 = [&R] ((((((1,2),(3,4)),(9,10)),(((5,6),8),7)),12),11); END;